>Feature sequence01 362 69 gene locus_tag LOCUS_00010 362 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 799 2550 gene locus_tag LOCUS_00020 799 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 4433 2769 gene locus_tag LOCUS_00030 4433 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4897 4430 gene locus_tag LOCUS_00040 gene rimI 4897 4430 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938967.1 protein_id gnl|my_center|LOCUS_00040 5569 4901 gene locus_tag LOCUS_00050 gene yihA 5569 4901 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709878.1 protein_id gnl|my_center|LOCUS_00050 16711 5573 gene locus_tag LOCUS_00060 16711 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 17382 16894 gene locus_tag LOCUS_00070 17382 16894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 18275 17379 gene locus_tag LOCUS_00080 gene prmA 18275 17379 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392110.1 protein_id gnl|my_center|LOCUS_00080 19464 18265 gene locus_tag LOCUS_00090 gene ygeW 19464 18265 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859787.1 protein_id gnl|my_center|LOCUS_00090 21013 19556 gene locus_tag LOCUS_00100 gene hutI 21013 19556 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070505.1 protein_id gnl|my_center|LOCUS_00100 21330 21046 gene locus_tag LOCUS_00110 21330 21046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 21533 21327 gene locus_tag LOCUS_00120 21533 21327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 21423 21656 gene locus_tag LOCUS_00130 21423 21656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 21743 22540 gene locus_tag LOCUS_00140 21743 22540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 22568 22939 gene locus_tag LOCUS_00150 22568 22939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 22962 23999 gene locus_tag LOCUS_00160 22962 23999 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112017.1 protein_id gnl|my_center|LOCUS_00160 24045 25127 gene locus_tag LOCUS_00170 24045 25127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 25112 25789 gene locus_tag LOCUS_00180 gene lipB 25112 25789 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174104.1 protein_id gnl|my_center|LOCUS_00180 25786 28227 gene locus_tag LOCUS_00190 25786 28227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 28316 29932 gene locus_tag LOCUS_00200 28316 29932 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 protein_id gnl|my_center|LOCUS_00200 29929 32679 gene locus_tag LOCUS_00210 29929 32679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 32682 34301 gene locus_tag LOCUS_00220 32682 34301 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_00220 34298 35914 gene locus_tag LOCUS_00230 34298 35914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 35898 36650 gene locus_tag LOCUS_00240 gene dapB 35898 36650 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532457.1 protein_id gnl|my_center|LOCUS_00240 36682 38310 gene locus_tag LOCUS_00250 36682 38310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 38685 38979 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggcgacggcatccccgact 41675 40980 gene locus_tag LOCUS_00260 41675 40980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 42644 41703 gene locus_tag LOCUS_00270 42644 41703 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723154.1 protein_id gnl|my_center|LOCUS_00270 42843 43991 gene locus_tag LOCUS_00280 42843 43991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 44023 44538 gene locus_tag LOCUS_00290 44023 44538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 44528 45475 gene locus_tag LOCUS_00300 44528 45475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 46309 45647 gene locus_tag LOCUS_00310 46309 45647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 47612 46293 gene locus_tag LOCUS_00320 47612 46293 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_00320 49363 47609 gene locus_tag LOCUS_00330 49363 47609 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879268.1 protein_id gnl|my_center|LOCUS_00330 49844 49380 gene locus_tag LOCUS_00340 49844 49380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 50411 49848 gene locus_tag LOCUS_00350 50411 49848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 51636 50524 gene locus_tag LOCUS_00360 51636 50524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 52507 51617 gene locus_tag LOCUS_00370 52507 51617 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211372.1 protein_id gnl|my_center|LOCUS_00370 52588 53562 gene locus_tag LOCUS_00380 52588 53562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 53559 54236 gene locus_tag LOCUS_00390 53559 54236 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166475.1 protein_id gnl|my_center|LOCUS_00390 54249 55124 gene locus_tag LOCUS_00400 54249 55124 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583758.1 protein_id gnl|my_center|LOCUS_00400 55141 55626 gene locus_tag LOCUS_00410 55141 55626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 56775 55636 gene locus_tag LOCUS_00420 56775 55636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 57448 56798 gene locus_tag LOCUS_00430 57448 56798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 59212 57467 gene locus_tag LOCUS_00440 59212 57467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 60465 59221 gene locus_tag LOCUS_00450 60465 59221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 61289 60465 gene locus_tag LOCUS_00460 61289 60465 CDS product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940991.1 protein_id gnl|my_center|LOCUS_00460 62053 61286 gene locus_tag LOCUS_00470 62053 61286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 62760 62050 gene locus_tag LOCUS_00480 62760 62050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 63205 62768 gene locus_tag LOCUS_00490 63205 62768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 64450 63218 gene locus_tag LOCUS_00500 gene xcpS 64450 63218 CDS product GspF family T2SS innner membrane protein variant XcpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091376.1 protein_id gnl|my_center|LOCUS_00500 66212 64464 gene locus_tag LOCUS_00510 gene gspE 66212 64464 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041913993.1 protein_id gnl|my_center|LOCUS_00510 68870 66219 gene locus_tag LOCUS_00520 gene gspD 68870 66219 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940997.1 protein_id gnl|my_center|LOCUS_00520 69794 68886 gene locus_tag LOCUS_00530 69794 68886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 70822 69980 gene locus_tag LOCUS_00540 gene rsmA 70822 69980 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269133.1 protein_id gnl|my_center|LOCUS_00540 73079 70827 gene locus_tag LOCUS_00550 73079 70827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 72973 73401 gene locus_tag LOCUS_00560 72973 73401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 74737 75849 gene locus_tag LOCUS_00570 gene dnaN 74737 75849 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_00570 76562 76873 gene locus_tag LOCUS_00580 76562 76873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 77040 77243 gene locus_tag LOCUS_00590 77040 77243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 78420 78653 gene locus_tag LOCUS_00600 78420 78653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 81025 79208 gene locus_tag LOCUS_00610 gene glmS 81025 79208 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_00610 81899 81102 gene locus_tag LOCUS_00620 81899 81102 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056890.1 protein_id gnl|my_center|LOCUS_00620 83209 81917 gene locus_tag LOCUS_00630 gene serS 83209 81917 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458807.1 protein_id gnl|my_center|LOCUS_00630 83356 84405 gene locus_tag LOCUS_00640 83356 84405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 87266 84402 gene locus_tag LOCUS_00650 87266 84402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 87909 87397 gene locus_tag LOCUS_00660 87909 87397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 88140 89522 gene locus_tag LOCUS_00670 gene mgtE 88140 89522 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232543.1 protein_id gnl|my_center|LOCUS_00670 89530 90255 gene locus_tag LOCUS_00680 89530 90255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 91477 90242 gene locus_tag LOCUS_00690 91477 90242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 91618 93789 gene locus_tag LOCUS_00700 gene glgX 91618 93789 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122228.1 protein_id gnl|my_center|LOCUS_00700 96244 93746 gene locus_tag LOCUS_00710 96244 93746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 96440 97153 gene locus_tag LOCUS_00720 96440 97153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 97164 99023 gene locus_tag LOCUS_00730 97164 99023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 99066 100223 gene locus_tag LOCUS_00740 gene yqhD 99066 100223 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098716.1 protein_id gnl|my_center|LOCUS_00740 101709 100237 gene locus_tag LOCUS_00750 101709 100237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 103301 101712 gene locus_tag LOCUS_00760 103301 101712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 104092 103298 gene locus_tag LOCUS_00770 104092 103298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 105161 104097 gene locus_tag LOCUS_00780 105161 104097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 105375 105857 gene locus_tag LOCUS_00790 gene nuoE 105375 105857 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_00790 105899 107662 gene locus_tag LOCUS_00800 gene nuoF 105899 107662 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_00800 107698 109791 gene locus_tag LOCUS_00810 107698 109791 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931974.1 protein_id gnl|my_center|LOCUS_00810 111228 109801 gene locus_tag LOCUS_00820 111228 109801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 111852 111241 gene locus_tag LOCUS_00830 111852 111241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 112978 111869 gene locus_tag LOCUS_00840 112978 111869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 114517 112988 gene locus_tag LOCUS_00850 114517 112988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 114823 115893 gene locus_tag LOCUS_00860 gene asnA 114823 115893 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_00860 115966 116502 gene locus_tag LOCUS_00870 115966 116502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 116566 116772 gene locus_tag LOCUS_00880 gene rpmF 116566 116772 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638547.1 protein_id gnl|my_center|LOCUS_00880 116777 117235 gene locus_tag LOCUS_00890 gene rpiB 116777 117235 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_00890 117270 118379 gene locus_tag LOCUS_00900 gene ribD 117270 118379 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_00900 118416 119018 gene locus_tag LOCUS_00910 118416 119018 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881107.1 protein_id gnl|my_center|LOCUS_00910 119015 120139 gene locus_tag LOCUS_00920 119015 120139 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_00920 120136 121977 gene locus_tag LOCUS_00930 120136 121977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 122097 122948 gene locus_tag LOCUS_00940 122097 122948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 123989 122958 gene locus_tag LOCUS_00950 123989 122958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 125717 124044 gene locus_tag LOCUS_00960 125717 124044 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_00960 126763 125744 gene locus_tag LOCUS_00970 126763 125744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 128792 126747 gene locus_tag LOCUS_00980 128792 126747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 130139 128979 gene locus_tag LOCUS_00990 130139 128979 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584144.1 protein_id gnl|my_center|LOCUS_00990 130385 131047 gene locus_tag LOCUS_01000 130385 131047 CDS product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929263.1 protein_id gnl|my_center|LOCUS_01000 131044 131538 gene locus_tag LOCUS_01010 131044 131538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 131690 132223 gene locus_tag LOCUS_01020 131690 132223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 132240 133436 gene locus_tag LOCUS_01030 132240 133436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 133588 134151 gene locus_tag LOCUS_01040 133588 134151 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119124.1 protein_id gnl|my_center|LOCUS_01040 137092 134132 gene locus_tag LOCUS_01050 137092 134132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 138335 137094 gene locus_tag LOCUS_01060 138335 137094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 140719 138419 gene locus_tag LOCUS_01070 140719 138419 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897245.1 protein_id gnl|my_center|LOCUS_01070 141188 140712 gene locus_tag LOCUS_01080 141188 140712 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_01080 142046 141216 gene locus_tag LOCUS_01090 142046 141216 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530648.1 protein_id gnl|my_center|LOCUS_01090 142243 144597 gene locus_tag LOCUS_01100 142243 144597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 144691 145308 gene locus_tag LOCUS_01110 144691 145308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 148899 145354 gene locus_tag LOCUS_01120 148899 145354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 149018 153205 gene locus_tag LOCUS_01130 149018 153205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 153270 153845 gene locus_tag LOCUS_01140 153270 153845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 155066 154197 gene locus_tag LOCUS_01150 155066 154197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 155277 155074 gene locus_tag LOCUS_01160 155277 155074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 155713 155258 gene locus_tag LOCUS_01170 155713 155258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 157144 155720 gene locus_tag LOCUS_01180 gene atpD 157144 155720 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_01180 157986 157141 gene locus_tag LOCUS_01190 gene atpG 157986 157141 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940788.1 protein_id gnl|my_center|LOCUS_01190 159511 157994 gene locus_tag LOCUS_01200 gene atpA 159511 157994 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_01200 160072 159530 gene locus_tag LOCUS_01210 160072 159530 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425856.1 protein_id gnl|my_center|LOCUS_01210 160643 160062 gene locus_tag LOCUS_01220 160643 160062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 161065 160640 gene locus_tag LOCUS_01230 161065 160640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 161557 161805 gene locus_tag LOCUS_01240 161557 161805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 161890 162639 gene locus_tag LOCUS_01250 161890 162639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 163345 163773 gene locus_tag LOCUS_01260 163345 163773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 164401 165369 gene locus_tag LOCUS_01270 164401 165369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 165366 168761 gene locus_tag LOCUS_01280 165366 168761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727531.1 protein_id gnl|my_center|LOCUS_01280 168761 169594 gene locus_tag LOCUS_01290 168761 169594 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727532.1 protein_id gnl|my_center|LOCUS_01290 171892 169595 gene locus_tag LOCUS_01300 171892 169595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 172205 172468 gene locus_tag LOCUS_01310 172205 172468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 173222 172662 gene locus_tag LOCUS_01320 173222 172662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 174553 173357 gene locus_tag LOCUS_01330 174553 173357 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462194.1 protein_id gnl|my_center|LOCUS_01330 176072 174636 gene locus_tag LOCUS_01340 176072 174636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 176266 176616 gene locus_tag LOCUS_01350 176266 176616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 176630 177892 gene locus_tag LOCUS_01360 176630 177892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 177981 178178 gene locus_tag LOCUS_01370 177981 178178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 180096 178270 gene locus_tag LOCUS_01380 180096 178270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 181544 180267 gene locus_tag LOCUS_01390 gene clpX 181544 180267 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229613.1 protein_id gnl|my_center|LOCUS_01390 182158 181544 gene locus_tag LOCUS_01400 gene clpP 182158 181544 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545892.1 protein_id gnl|my_center|LOCUS_01400 183577 182180 gene locus_tag LOCUS_01410 gene tig 183577 182180 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460612.1 protein_id gnl|my_center|LOCUS_01410 183950 185269 gene locus_tag LOCUS_01420 183950 185269 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_01420 185283 186752 gene locus_tag LOCUS_01430 gene gltX 185283 186752 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104596.1 protein_id gnl|my_center|LOCUS_01430 186950 188614 gene locus_tag LOCUS_01440 186950 188614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 189405 188611 gene locus_tag LOCUS_01450 189405 188611 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407737.1 protein_id gnl|my_center|LOCUS_01450 189770 189402 gene locus_tag LOCUS_01460 189770 189402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 190734 189775 gene locus_tag LOCUS_01470 190734 189775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 191431 190778 gene locus_tag LOCUS_01480 gene nth 191431 190778 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_01480 191757 191440 gene locus_tag LOCUS_01490 gene trxA 191757 191440 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125291.1 protein_id gnl|my_center|LOCUS_01490 191881 192186 gene locus_tag LOCUS_01500 191881 192186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 192634 192197 gene locus_tag LOCUS_01510 192634 192197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 192758 195898 gene locus_tag LOCUS_01520 192758 195898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 196008 196643 gene locus_tag LOCUS_01530 196008 196643 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809919.1 protein_id gnl|my_center|LOCUS_01530 196582 200397 gene locus_tag LOCUS_01540 196582 200397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 201299 200436 gene locus_tag LOCUS_01550 201299 200436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 202577 201474 gene locus_tag LOCUS_01560 202577 201474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 203643 202579 gene locus_tag LOCUS_01570 203643 202579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 203818 204336 gene locus_tag LOCUS_01580 203818 204336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 206759 204825 gene locus_tag LOCUS_01590 gene speA 206759 204825 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144058.1 protein_id gnl|my_center|LOCUS_01590 206934 208838 gene locus_tag LOCUS_01600 206934 208838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 208947 210125 gene locus_tag LOCUS_01610 208947 210125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 210148 211923 gene locus_tag LOCUS_01620 210148 211923 CDS product SpoIVB peptidase S55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_01620 211923 214025 gene locus_tag LOCUS_01630 211923 214025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 214032 215885 gene locus_tag LOCUS_01640 gene uvrC 214032 215885 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943890.1 protein_id gnl|my_center|LOCUS_01640 215968 215885 gene locus_tag LOCUS_t00010 215968 215885 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 216108 216431 gene locus_tag LOCUS_01650 216108 216431 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_01650 216451 217878 gene locus_tag LOCUS_01660 216451 217878 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690317.1 protein_id gnl|my_center|LOCUS_01660 217900 219840 gene locus_tag LOCUS_01670 gene tkt 217900 219840 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301211.1 protein_id gnl|my_center|LOCUS_01670 219865 220341 gene locus_tag LOCUS_01680 219865 220341 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048399.1 protein_id gnl|my_center|LOCUS_01680 220432 220875 gene locus_tag LOCUS_01690 gene rnhA 220432 220875 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003511799.1 protein_id gnl|my_center|LOCUS_01690 221189 222427 gene locus_tag LOCUS_01700 221189 222427 CDS product 2-aminoethylphosphonate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525538.1 protein_id gnl|my_center|LOCUS_01700 222476 222949 gene locus_tag LOCUS_01710 222476 222949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 222961 224082 gene locus_tag LOCUS_01720 222961 224082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 224314 225444 gene locus_tag LOCUS_01730 224314 225444 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_01730 226991 225954 gene locus_tag LOCUS_01740 226991 225954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 228154 226988 gene locus_tag LOCUS_01750 228154 226988 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240521.1 protein_id gnl|my_center|LOCUS_01750 228876 228154 gene locus_tag LOCUS_01760 228876 228154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 229410 228898 gene locus_tag LOCUS_01770 229410 228898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 229975 229412 gene locus_tag LOCUS_01780 229975 229412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 230308 229979 gene locus_tag LOCUS_01790 230308 229979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 231502 230738 gene locus_tag LOCUS_01800 231502 230738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 231820 232485 gene locus_tag LOCUS_01810 231820 232485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 232609 232971 gene locus_tag LOCUS_01820 232609 232971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 232976 233233 gene locus_tag LOCUS_01830 232976 233233 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582458.1 protein_id gnl|my_center|LOCUS_01830 233257 233604 gene locus_tag LOCUS_01840 233257 233604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 233697 234638 gene locus_tag LOCUS_01850 233697 234638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 235370 234642 gene locus_tag LOCUS_01860 235370 234642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940945.1 protein_id gnl|my_center|LOCUS_01860 236216 235374 gene locus_tag LOCUS_01870 236216 235374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 237397 236213 gene locus_tag LOCUS_01880 237397 236213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 237498 237878 gene locus_tag LOCUS_01890 237498 237878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 238322 237888 gene locus_tag LOCUS_01900 238322 237888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 239107 238319 gene locus_tag LOCUS_01910 239107 238319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 240626 239187 gene locus_tag LOCUS_01920 240626 239187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 240841 241617 gene locus_tag LOCUS_01930 240841 241617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 243417 241675 gene locus_tag LOCUS_01940 243417 241675 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388445.1 protein_id gnl|my_center|LOCUS_01940 243548 244615 gene locus_tag LOCUS_01950 243548 244615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 245401 244622 gene locus_tag LOCUS_01960 245401 244622 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690200.1 protein_id gnl|my_center|LOCUS_01960 245683 246495 gene locus_tag LOCUS_01970 245683 246495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 248061 246688 gene locus_tag LOCUS_01980 248061 246688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 248173 248496 gene locus_tag LOCUS_01990 248173 248496 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876989.1 protein_id gnl|my_center|LOCUS_01990 249591 248509 gene locus_tag LOCUS_02000 249591 248509 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246499.1 protein_id gnl|my_center|LOCUS_02000 249766 251496 gene locus_tag LOCUS_02010 249766 251496 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392558.1 protein_id gnl|my_center|LOCUS_02010 251471 252157 gene locus_tag LOCUS_02020 251471 252157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 252181 253287 gene locus_tag LOCUS_02030 252181 253287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 253284 255542 gene locus_tag LOCUS_02040 253284 255542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 255557 257539 gene locus_tag LOCUS_02050 255557 257539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 257536 259536 gene locus_tag LOCUS_02060 257536 259536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 259554 260591 gene locus_tag LOCUS_02070 259554 260591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 261759 260581 gene locus_tag LOCUS_02080 261759 260581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 263483 261756 gene locus_tag LOCUS_02090 263483 261756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 264400 263495 gene locus_tag LOCUS_02100 264400 263495 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262600.1 protein_id gnl|my_center|LOCUS_02100 264752 264825 gene locus_tag LOCUS_t00020 264752 264825 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 264903 264986 gene locus_tag LOCUS_t00030 264903 264986 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 265027 265101 gene locus_tag LOCUS_t00040 265027 265101 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 265118 265191 gene locus_tag LOCUS_t00050 265118 265191 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 265245 266441 gene locus_tag LOCUS_02110 gene tuf 265245 266441 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_02110 266453 266608 gene locus_tag LOCUS_02120 gene rpmG 266453 266608 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943500.1 protein_id gnl|my_center|LOCUS_02120 266696 266769 gene locus_tag LOCUS_t00060 266696 266769 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 266802 267161 gene locus_tag LOCUS_02130 266802 267161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 267176 267703 gene locus_tag LOCUS_02140 gene nusG 267176 267703 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_02140 267921 268343 gene locus_tag LOCUS_02150 gene rplK 267921 268343 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081512.1 protein_id gnl|my_center|LOCUS_02150 268427 269134 gene locus_tag LOCUS_02160 gene rplA 268427 269134 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_02160 269149 269685 gene locus_tag LOCUS_02170 gene rplJ 269149 269685 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943495.1 protein_id gnl|my_center|LOCUS_02170 269748 270134 gene locus_tag LOCUS_02180 gene rplL 269748 270134 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870240.1 protein_id gnl|my_center|LOCUS_02180 270255 274457 gene locus_tag LOCUS_02190 gene rpoB 270255 274457 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943493.1 protein_id gnl|my_center|LOCUS_02190 274533 278735 gene locus_tag LOCUS_02200 gene rpoC 274533 278735 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_02200 278933 279307 gene locus_tag LOCUS_02210 gene rpsL 278933 279307 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_02210 279320 279808 gene locus_tag LOCUS_02220 gene rpsG 279320 279808 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417210.1 protein_id gnl|my_center|LOCUS_02220 279945 282065 gene locus_tag LOCUS_02230 gene fusA 279945 282065 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_02230 282126 282434 gene locus_tag LOCUS_02240 gene rpsJ 282126 282434 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_02240 282464 283096 gene locus_tag LOCUS_02250 gene rplD 282464 283096 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357518.1 protein_id gnl|my_center|LOCUS_02250 283101 283406 gene locus_tag LOCUS_02260 283101 283406 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_02260 283419 284255 gene locus_tag LOCUS_02270 gene rplB 283419 284255 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_02270 284273 284551 gene locus_tag LOCUS_02280 gene rpsS 284273 284551 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943482.1 protein_id gnl|my_center|LOCUS_02280 284563 284958 gene locus_tag LOCUS_02290 gene rplV 284563 284958 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148024.1 protein_id gnl|my_center|LOCUS_02290 284969 285625 gene locus_tag LOCUS_02300 gene rpsC 284969 285625 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393931.1 protein_id gnl|my_center|LOCUS_02300 285629 286045 gene locus_tag LOCUS_02310 gene rplP 285629 286045 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943479.1 protein_id gnl|my_center|LOCUS_02310 286042 286269 gene locus_tag LOCUS_02320 286042 286269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 286262 286531 gene locus_tag LOCUS_02330 gene rpsQ 286262 286531 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943477.1 protein_id gnl|my_center|LOCUS_02330 286548 286916 gene locus_tag LOCUS_02340 gene rplN 286548 286916 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943476.1 protein_id gnl|my_center|LOCUS_02340 286916 287287 gene locus_tag LOCUS_02350 gene rplX 286916 287287 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156486.1 protein_id gnl|my_center|LOCUS_02350 287300 287929 gene locus_tag LOCUS_02360 gene rplE 287300 287929 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_02360 287941 288120 gene locus_tag LOCUS_02370 287941 288120 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002153498.1 protein_id gnl|my_center|LOCUS_02370 288133 288531 gene locus_tag LOCUS_02380 gene rpsH 288133 288531 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892856.1 protein_id gnl|my_center|LOCUS_02380 288548 289087 gene locus_tag LOCUS_02390 gene rplF 288548 289087 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_02390 289100 289465 gene locus_tag LOCUS_02400 gene rplR 289100 289465 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_02400 289507 289998 gene locus_tag LOCUS_02410 gene rpsE 289507 289998 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938615.1 protein_id gnl|my_center|LOCUS_02410 290033 290230 gene locus_tag LOCUS_02420 gene rpmD 290033 290230 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776359.1 protein_id gnl|my_center|LOCUS_02420 290234 291172 gene locus_tag LOCUS_02430 290234 291172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 291229 292542 gene locus_tag LOCUS_02440 gene secY 291229 292542 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_02440 292567 293208 gene locus_tag LOCUS_02450 292567 293208 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_02450 293233 294003 gene locus_tag LOCUS_02460 gene map 293233 294003 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_02460 294161 294541 gene locus_tag LOCUS_02470 gene rpsM 294161 294541 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938621.1 protein_id gnl|my_center|LOCUS_02470 294541 294930 gene locus_tag LOCUS_02480 gene rpsK 294541 294930 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_02480 295121 296167 gene locus_tag LOCUS_02490 295121 296167 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_02490 296253 296654 gene locus_tag LOCUS_02500 296253 296654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 296752 298284 gene locus_tag LOCUS_02510 296752 298284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 298400 300973 gene locus_tag LOCUS_02520 298400 300973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 301071 302777 gene locus_tag LOCUS_02530 301071 302777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 302797 305244 gene locus_tag LOCUS_02540 302797 305244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 305261 306130 gene locus_tag LOCUS_02550 305261 306130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 306202 307494 gene locus_tag LOCUS_02560 gene thiC 306202 307494 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392914.1 protein_id gnl|my_center|LOCUS_02560 307491 308294 gene locus_tag LOCUS_02570 307491 308294 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190175.1 protein_id gnl|my_center|LOCUS_02570 308304 308789 gene locus_tag LOCUS_02580 308304 308789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 310176 308917 gene locus_tag LOCUS_02590 gene rpsA 310176 308917 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941857.1 protein_id gnl|my_center|LOCUS_02590 310335 311441 gene locus_tag LOCUS_02600 310335 311441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 311502 313322 gene locus_tag LOCUS_02610 311502 313322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 313322 314182 gene locus_tag LOCUS_02620 313322 314182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 314764 314192 gene locus_tag LOCUS_02630 314764 314192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 315852 314761 gene locus_tag LOCUS_02640 315852 314761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 317213 315846 gene locus_tag LOCUS_02650 317213 315846 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_02650 318724 317345 gene locus_tag LOCUS_02660 gene murD 318724 317345 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_02660 319167 318781 gene locus_tag LOCUS_02670 gene trxA 319167 318781 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784741.1 protein_id gnl|my_center|LOCUS_02670 319463 321037 gene locus_tag LOCUS_02680 319463 321037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 322015 321038 gene locus_tag LOCUS_02690 gene trxB 322015 321038 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900782.1 protein_id gnl|my_center|LOCUS_02690 323134 322343 gene locus_tag LOCUS_02700 323134 322343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 324378 323134 gene locus_tag LOCUS_02710 324378 323134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 325888 324479 gene locus_tag LOCUS_02720 325888 324479 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804150.1 protein_id gnl|my_center|LOCUS_02720 327395 325902 gene locus_tag LOCUS_02730 327395 325902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 327785 329032 gene locus_tag LOCUS_02740 327785 329032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 329058 333422 gene locus_tag LOCUS_02750 329058 333422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 333581 334777 gene locus_tag LOCUS_02760 333581 334777 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107117.1 protein_id gnl|my_center|LOCUS_02760 334793 335218 gene locus_tag LOCUS_02770 gene ndk 334793 335218 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883257.1 protein_id gnl|my_center|LOCUS_02770 335205 336314 gene locus_tag LOCUS_02780 335205 336314 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073191.1 protein_id gnl|my_center|LOCUS_02780 336346 339156 gene locus_tag LOCUS_02790 336346 339156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 339303 339602 gene locus_tag LOCUS_02800 339303 339602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 340031 339615 gene locus_tag LOCUS_02810 340031 339615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 341146 340028 gene locus_tag LOCUS_02820 341146 340028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 341642 341154 gene locus_tag LOCUS_02830 341642 341154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 342653 341655 gene locus_tag LOCUS_02840 342653 341655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 344578 342713 gene locus_tag LOCUS_02850 344578 342713 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932766.1 protein_id gnl|my_center|LOCUS_02850 345890 344601 gene locus_tag LOCUS_02860 345890 344601 CDS product ATP citrate lyase citrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932767.1 protein_id gnl|my_center|LOCUS_02860 347838 345922 gene locus_tag LOCUS_02870 347838 345922 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_02870 348848 348045 gene locus_tag LOCUS_02880 348848 348045 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406424.1 protein_id gnl|my_center|LOCUS_02880 349474 348845 gene locus_tag LOCUS_02890 349474 348845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 351170 349488 gene locus_tag LOCUS_02900 351170 349488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 351464 351213 gene locus_tag LOCUS_02910 351464 351213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 351589 353451 gene locus_tag LOCUS_02920 351589 353451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 355376 353505 gene locus_tag LOCUS_02930 355376 353505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 356561 355488 gene locus_tag LOCUS_02940 356561 355488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 356715 357650 gene locus_tag LOCUS_02950 356715 357650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 357695 359884 gene locus_tag LOCUS_02960 357695 359884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 359925 361316 gene locus_tag LOCUS_02970 gene murC 359925 361316 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_02970 361313 362413 gene locus_tag LOCUS_02980 361313 362413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 362673 364631 gene locus_tag LOCUS_02990 362673 364631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 >Feature sequence02 81 584 gene locus_tag LOCUS_03000 81 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 616 1008 gene locus_tag LOCUS_03010 616 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 2238 1240 gene locus_tag LOCUS_03020 2238 1240 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 protein_id gnl|my_center|LOCUS_03020 2519 2887 gene locus_tag LOCUS_03030 2519 2887 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256185.1 protein_id gnl|my_center|LOCUS_03030 2884 3642 gene locus_tag LOCUS_03040 2884 3642 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880615.1 protein_id gnl|my_center|LOCUS_03040 3639 6449 gene locus_tag LOCUS_03050 3639 6449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 6446 7429 gene locus_tag LOCUS_03060 6446 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 7426 8136 gene locus_tag LOCUS_03070 7426 8136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 8159 8608 gene locus_tag LOCUS_03080 8159 8608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 8605 9741 gene locus_tag LOCUS_03090 8605 9741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 9777 10175 gene locus_tag LOCUS_03100 9777 10175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 10183 10806 gene locus_tag LOCUS_03110 10183 10806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 10885 11691 gene locus_tag LOCUS_03120 10885 11691 CDS product TIGR04255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098801.1 protein_id gnl|my_center|LOCUS_03120 11694 12359 gene locus_tag LOCUS_03130 11694 12359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 12361 13218 gene locus_tag LOCUS_03140 12361 13218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 13261 16395 gene locus_tag LOCUS_03150 13261 16395 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942010.1 protein_id gnl|my_center|LOCUS_03150 16746 16510 gene locus_tag LOCUS_03160 16746 16510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 16688 17278 gene locus_tag LOCUS_03170 16688 17278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 18683 17298 gene locus_tag LOCUS_03180 18683 17298 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887812.1 protein_id gnl|my_center|LOCUS_03180 19768 18680 gene locus_tag LOCUS_03190 19768 18680 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887814.1 protein_id gnl|my_center|LOCUS_03190 20127 19786 gene locus_tag LOCUS_03200 20127 19786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 20937 20131 gene locus_tag LOCUS_03210 20937 20131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 22118 21000 gene locus_tag LOCUS_03220 22118 21000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 23214 22111 gene locus_tag LOCUS_03230 23214 22111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 25370 23328 gene locus_tag LOCUS_03240 25370 23328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 26665 25370 gene locus_tag LOCUS_03250 26665 25370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 28036 26951 gene locus_tag LOCUS_03260 28036 26951 CDS product PP2C family serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173287.1 protein_id gnl|my_center|LOCUS_03260 28776 28060 gene locus_tag LOCUS_03270 28776 28060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 30220 28799 gene locus_tag LOCUS_03280 30220 28799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 31759 30269 gene locus_tag LOCUS_03290 31759 30269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 31961 32644 gene locus_tag LOCUS_03300 31961 32644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 32736 33380 gene locus_tag LOCUS_03310 32736 33380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 33395 34582 gene locus_tag LOCUS_03320 33395 34582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 34579 36369 gene locus_tag LOCUS_03330 34579 36369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 36416 37048 gene locus_tag LOCUS_03340 36416 37048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 37951 37196 gene locus_tag LOCUS_03350 37951 37196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 39969 37948 gene locus_tag LOCUS_03360 gene pglZ 39969 37948 CDS product BREX-3 system phosphatase PglZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870227.1 protein_id gnl|my_center|LOCUS_03360 42797 39966 gene locus_tag LOCUS_03370 42797 39966 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870228.1 protein_id gnl|my_center|LOCUS_03370 43918 42869 gene locus_tag LOCUS_03380 43918 42869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 45833 43911 gene locus_tag LOCUS_03390 45833 43911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 48668 45837 gene locus_tag LOCUS_03400 48668 45837 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280509.1 protein_id gnl|my_center|LOCUS_03400 52491 48760 gene locus_tag LOCUS_03410 52491 48760 CDS product DUF6079 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870232.1 protein_id gnl|my_center|LOCUS_03410 53003 52488 gene locus_tag LOCUS_03420 gene brxF 53003 52488 CDS product BREX-3 system P-loop-containing protein BrxF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870233.1 protein_id gnl|my_center|LOCUS_03420 53294 53067 gene locus_tag LOCUS_03430 53294 53067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 53819 53445 gene locus_tag LOCUS_03440 53819 53445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 54522 53839 gene locus_tag LOCUS_03450 54522 53839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 55743 56513 gene locus_tag LOCUS_03460 55743 56513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 56998 57384 gene locus_tag LOCUS_03470 56998 57384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 57385 57840 gene locus_tag LOCUS_03480 57385 57840 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035740.1 protein_id gnl|my_center|LOCUS_03480 57864 58292 gene locus_tag LOCUS_03490 57864 58292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 58297 58629 gene locus_tag LOCUS_03500 58297 58629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 60065 58914 gene locus_tag LOCUS_03510 60065 58914 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140271.1 protein_id gnl|my_center|LOCUS_03510 61212 60586 gene locus_tag LOCUS_03520 61212 60586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 61593 62105 gene locus_tag LOCUS_03530 61593 62105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 62443 62667 gene locus_tag LOCUS_03540 62443 62667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 62737 64191 gene locus_tag LOCUS_03550 62737 64191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 64188 65867 gene locus_tag LOCUS_03560 64188 65867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 65982 67610 gene locus_tag LOCUS_03570 65982 67610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258135.1 protein_id gnl|my_center|LOCUS_03570 67600 69627 gene locus_tag LOCUS_03580 67600 69627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 69627 70964 gene locus_tag LOCUS_03590 69627 70964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 70961 71494 gene locus_tag LOCUS_03600 70961 71494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 71494 73953 gene locus_tag LOCUS_03610 71494 73953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 74007 75464 gene locus_tag LOCUS_03620 74007 75464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 76260 75487 gene locus_tag LOCUS_03630 76260 75487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 77462 76257 gene locus_tag LOCUS_03640 77462 76257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 77461 79572 gene locus_tag LOCUS_03650 77461 79572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 79577 79879 gene locus_tag LOCUS_03660 79577 79879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 80258 82115 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttttaccgctattgctgttgaagcaattgaaac 82169 82528 gene locus_tag LOCUS_03670 82169 82528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 82644 82865 gene locus_tag LOCUS_03680 82644 82865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 82895 84364 gene locus_tag LOCUS_03690 82895 84364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 86485 84380 gene locus_tag LOCUS_03700 86485 84380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 87072 86482 gene locus_tag LOCUS_03710 87072 86482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 89023 87065 gene locus_tag LOCUS_03720 89023 87065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 91259 89382 gene locus_tag LOCUS_03730 91259 89382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 92652 91480 gene locus_tag LOCUS_03740 92652 91480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 98036 92664 gene locus_tag LOCUS_03750 98036 92664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 98194 99921 gene locus_tag LOCUS_03760 98194 99921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 100110 99943 gene locus_tag LOCUS_03770 100110 99943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 100302 102248 gene locus_tag LOCUS_03780 100302 102248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 103323 102454 gene locus_tag LOCUS_03790 103323 102454 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980286.1 protein_id gnl|my_center|LOCUS_03790 103472 103975 gene locus_tag LOCUS_03800 103472 103975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 104210 104587 gene locus_tag LOCUS_03810 104210 104587 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194678.1 protein_id gnl|my_center|LOCUS_03810 104746 105264 gene locus_tag LOCUS_03820 104746 105264 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_03820 105261 106190 gene locus_tag LOCUS_03830 105261 106190 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647871.1 protein_id gnl|my_center|LOCUS_03830 106136 106375 gene locus_tag LOCUS_03840 106136 106375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 108139 106577 gene locus_tag LOCUS_03850 108139 106577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 108214 108636 gene locus_tag LOCUS_03860 108214 108636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 108958 109932 gene locus_tag LOCUS_03870 108958 109932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 109922 110767 gene locus_tag LOCUS_03880 109922 110767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 110996 111373 gene locus_tag LOCUS_03890 110996 111373 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194678.1 protein_id gnl|my_center|LOCUS_03890 112137 111532 gene locus_tag LOCUS_03900 112137 111532 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195801.1 protein_id gnl|my_center|LOCUS_03900 114218 112167 gene locus_tag LOCUS_03910 114218 112167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 115499 114309 gene locus_tag LOCUS_03920 115499 114309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 116847 115723 gene locus_tag LOCUS_03930 116847 115723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 117524 116844 gene locus_tag LOCUS_03940 117524 116844 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085667.1 protein_id gnl|my_center|LOCUS_03940 119536 117614 gene locus_tag LOCUS_03950 119536 117614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 119781 121256 gene locus_tag LOCUS_03960 119781 121256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 121385 122638 gene locus_tag LOCUS_03970 121385 122638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 122648 124150 gene locus_tag LOCUS_03980 122648 124150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 124147 126006 gene locus_tag LOCUS_03990 gene mnmG 124147 126006 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499797.1 protein_id gnl|my_center|LOCUS_03990 127242 126088 gene locus_tag LOCUS_04000 127242 126088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 127790 127239 gene locus_tag LOCUS_04010 127790 127239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 128540 127797 gene locus_tag LOCUS_04020 128540 127797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 130271 128628 gene locus_tag LOCUS_04030 130271 128628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 131062 130463 gene locus_tag LOCUS_04040 gene raiA 131062 130463 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_04040 132776 131139 gene locus_tag LOCUS_04050 gene rpoN 132776 131139 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_04050 132893 133729 gene locus_tag LOCUS_04060 132893 133729 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943921.1 protein_id gnl|my_center|LOCUS_04060 133737 136040 gene locus_tag LOCUS_04070 133737 136040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 136192 136404 gene locus_tag LOCUS_04080 136192 136404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 139566 136465 gene locus_tag LOCUS_04090 139566 136465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 139985 139725 gene locus_tag LOCUS_04100 139985 139725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 141322 139982 gene locus_tag LOCUS_04110 141322 139982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 141725 141333 gene locus_tag LOCUS_04120 141725 141333 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112869.1 protein_id gnl|my_center|LOCUS_04120 143055 141715 gene locus_tag LOCUS_04130 143055 141715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 143692 143048 gene locus_tag LOCUS_04140 143692 143048 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902736.1 protein_id gnl|my_center|LOCUS_04140 143972 143703 gene locus_tag LOCUS_04150 143972 143703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 144507 143965 gene locus_tag LOCUS_04160 144507 143965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 145271 144504 gene locus_tag LOCUS_04170 145271 144504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 146448 145276 gene locus_tag LOCUS_04180 gene epmA 146448 145276 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388833.1 protein_id gnl|my_center|LOCUS_04180 147025 146462 gene locus_tag LOCUS_04190 gene efp 147025 146462 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810907.1 protein_id gnl|my_center|LOCUS_04190 147930 147136 gene locus_tag LOCUS_04200 147930 147136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 148559 147927 gene locus_tag LOCUS_04210 148559 147927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 149285 148662 gene locus_tag LOCUS_04220 149285 148662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 150641 149292 gene locus_tag LOCUS_04230 150641 149292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 150772 151395 gene locus_tag LOCUS_04240 150772 151395 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483174.1 protein_id gnl|my_center|LOCUS_04240 152436 151396 gene locus_tag LOCUS_04250 152436 151396 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393847.1 protein_id gnl|my_center|LOCUS_04250 153134 152433 gene locus_tag LOCUS_04260 153134 152433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 153317 154651 gene locus_tag LOCUS_04270 153317 154651 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116269310.1 protein_id gnl|my_center|LOCUS_04270 154661 154954 gene locus_tag LOCUS_04280 154661 154954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 157467 155146 gene locus_tag LOCUS_04290 157467 155146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 158586 157495 gene locus_tag LOCUS_04300 158586 157495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 159493 158591 gene locus_tag LOCUS_04310 159493 158591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 160163 159453 gene locus_tag LOCUS_04320 gene ftsE 160163 159453 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617723.1 protein_id gnl|my_center|LOCUS_04320 161762 160212 gene locus_tag LOCUS_04330 161762 160212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 164899 161759 gene locus_tag LOCUS_04340 164899 161759 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_04340 166245 164896 gene locus_tag LOCUS_04350 166245 164896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 166757 166242 gene locus_tag LOCUS_04360 166757 166242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 167973 166960 gene locus_tag LOCUS_04370 167973 166960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 170106 168163 gene locus_tag LOCUS_04380 170106 168163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 170932 170150 gene locus_tag LOCUS_04390 170932 170150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 171950 171147 gene locus_tag LOCUS_04400 171950 171147 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880179.1 protein_id gnl|my_center|LOCUS_04400 172578 171955 gene locus_tag LOCUS_04410 gene tmk 172578 171955 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173647.1 protein_id gnl|my_center|LOCUS_04410 173440 172583 gene locus_tag LOCUS_04420 173440 172583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 174109 173573 gene locus_tag LOCUS_04430 174109 173573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 175848 174151 gene locus_tag LOCUS_04440 175848 174151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 176095 177087 gene locus_tag LOCUS_04450 176095 177087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 177084 177938 gene locus_tag LOCUS_04460 gene prmC 177084 177938 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_04460 178029 179228 gene locus_tag LOCUS_04470 178029 179228 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772253.1 protein_id gnl|my_center|LOCUS_04470 179336 180307 gene locus_tag LOCUS_04480 179336 180307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 180311 181582 gene locus_tag LOCUS_04490 180311 181582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 181772 182572 gene locus_tag LOCUS_04500 181772 182572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 183413 182829 gene locus_tag LOCUS_04510 183413 182829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 183346 184275 gene locus_tag LOCUS_04520 183346 184275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 184290 184877 gene locus_tag LOCUS_04530 184290 184877 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930580.1 protein_id gnl|my_center|LOCUS_04530 184890 185939 gene locus_tag LOCUS_04540 184890 185939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 185969 186322 gene locus_tag LOCUS_04550 185969 186322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 186326 187444 gene locus_tag LOCUS_04560 186326 187444 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 protein_id gnl|my_center|LOCUS_04560 187496 189571 gene locus_tag LOCUS_04570 187496 189571 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 protein_id gnl|my_center|LOCUS_04570 189608 190717 gene locus_tag LOCUS_04580 189608 190717 CDS product DUF444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233828.1 protein_id gnl|my_center|LOCUS_04580 190722 192257 gene locus_tag LOCUS_04590 190722 192257 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228236.1 protein_id gnl|my_center|LOCUS_04590 192260 193573 gene locus_tag LOCUS_04600 gene rlmD 192260 193573 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105059.1 protein_id gnl|my_center|LOCUS_04600 193581 196412 gene locus_tag LOCUS_04610 193581 196412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 197076 196432 gene locus_tag LOCUS_04620 gene rpe 197076 196432 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232058.1 protein_id gnl|my_center|LOCUS_04620 198430 197081 gene locus_tag LOCUS_04630 gene rsmB 198430 197081 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_04630 199362 198427 gene locus_tag LOCUS_04640 gene fmt 199362 198427 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338559.1 protein_id gnl|my_center|LOCUS_04640 201026 199410 gene locus_tag LOCUS_04650 201026 199410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 >Feature sequence03 1920 130 gene locus_tag LOCUS_04660 1920 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 2585 4375 gene locus_tag LOCUS_04670 2585 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 4489 6255 gene locus_tag LOCUS_04680 4489 6255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 6353 7906 gene locus_tag LOCUS_04690 6353 7906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 8521 7964 gene locus_tag LOCUS_04700 8521 7964 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127205.1 protein_id gnl|my_center|LOCUS_04700 8919 8557 gene locus_tag LOCUS_04710 8919 8557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 10619 8916 gene locus_tag LOCUS_04720 10619 8916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 11893 10616 gene locus_tag LOCUS_04730 11893 10616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 12190 13356 gene locus_tag LOCUS_04740 gene metK 12190 13356 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_04740 13364 13897 gene locus_tag LOCUS_04750 13364 13897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 13950 14153 gene locus_tag LOCUS_04760 13950 14153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 15257 14166 gene locus_tag LOCUS_04770 15257 14166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796266.1 protein_id gnl|my_center|LOCUS_04770 15327 15426 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16040 15582 gene locus_tag LOCUS_04780 16040 15582 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143392.1 protein_id gnl|my_center|LOCUS_04780 16359 16811 gene locus_tag LOCUS_04790 16359 16811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 19425 16795 gene locus_tag LOCUS_04800 19425 16795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 19592 22894 gene locus_tag LOCUS_04810 19592 22894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 23021 25273 gene locus_tag LOCUS_04820 23021 25273 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072577.1 protein_id gnl|my_center|LOCUS_04820 25340 26980 gene locus_tag LOCUS_04830 25340 26980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 28178 27015 gene locus_tag LOCUS_04840 28178 27015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 29346 28207 gene locus_tag LOCUS_04850 29346 28207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 30374 29343 gene locus_tag LOCUS_04860 30374 29343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 31820 30414 gene locus_tag LOCUS_04870 31820 30414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 33335 31869 gene locus_tag LOCUS_04880 33335 31869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 33334 34614 gene locus_tag LOCUS_04890 33334 34614 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791443.1 protein_id gnl|my_center|LOCUS_04890 34611 35060 gene locus_tag LOCUS_04900 34611 35060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 35080 36192 gene locus_tag LOCUS_04910 35080 36192 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938875.1 protein_id gnl|my_center|LOCUS_04910 36189 37058 gene locus_tag LOCUS_04920 gene rsmI 36189 37058 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_04920 37369 38298 gene locus_tag LOCUS_04930 37369 38298 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575124.1 protein_id gnl|my_center|LOCUS_04930 38352 38930 gene locus_tag LOCUS_04940 38352 38930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 39028 42699 gene locus_tag LOCUS_04950 39028 42699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 43527 42652 gene locus_tag LOCUS_04960 43527 42652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 43717 45177 gene locus_tag LOCUS_04970 43717 45177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 45244 45612 gene locus_tag LOCUS_04980 45244 45612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 45633 46367 gene locus_tag LOCUS_04990 45633 46367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 47186 46377 gene locus_tag LOCUS_05000 47186 46377 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815385.1 protein_id gnl|my_center|LOCUS_05000 47290 47454 gene locus_tag LOCUS_05010 47290 47454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 47459 48085 gene locus_tag LOCUS_05020 gene trmB 47459 48085 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057818.1 protein_id gnl|my_center|LOCUS_05020 48055 49470 gene locus_tag LOCUS_05030 48055 49470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 50161 49511 gene locus_tag LOCUS_05040 gene thiE 50161 49511 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941250.1 protein_id gnl|my_center|LOCUS_05040 51237 50158 gene locus_tag LOCUS_05050 gene thiH 51237 50158 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962602.1 protein_id gnl|my_center|LOCUS_05050 51866 51234 gene locus_tag LOCUS_05060 51866 51234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946301.1 protein_id gnl|my_center|LOCUS_05060 52216 51872 gene locus_tag LOCUS_05070 52216 51872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 52167 53099 gene locus_tag LOCUS_05080 52167 53099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 53146 53811 gene locus_tag LOCUS_05090 53146 53811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 54649 53837 gene locus_tag LOCUS_05100 54649 53837 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257316.1 protein_id gnl|my_center|LOCUS_05100 55890 54646 gene locus_tag LOCUS_05110 55890 54646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 58286 55887 gene locus_tag LOCUS_05120 gene lon 58286 55887 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942434.1 protein_id gnl|my_center|LOCUS_05120 61227 58408 gene locus_tag LOCUS_05130 61227 58408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 63137 61335 gene locus_tag LOCUS_05140 63137 61335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 63806 63234 gene locus_tag LOCUS_05150 63806 63234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 64637 63903 gene locus_tag LOCUS_05160 64637 63903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 64940 66553 gene locus_tag LOCUS_05170 64940 66553 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942540.1 protein_id gnl|my_center|LOCUS_05170 68083 66566 gene locus_tag LOCUS_05180 68083 66566 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357216.1 protein_id gnl|my_center|LOCUS_05180 68245 70053 gene locus_tag LOCUS_05190 68245 70053 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_05190 72262 70070 gene locus_tag LOCUS_05200 72262 70070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 76041 72472 gene locus_tag LOCUS_05210 76041 72472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 77752 76103 gene locus_tag LOCUS_05220 77752 76103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 77844 78824 gene locus_tag LOCUS_05230 77844 78824 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360255.1 protein_id gnl|my_center|LOCUS_05230 78821 79543 gene locus_tag LOCUS_05240 78821 79543 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_05240 80504 79587 gene locus_tag LOCUS_05250 80504 79587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 80807 80520 gene locus_tag LOCUS_05260 80807 80520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 80867 81064 gene locus_tag LOCUS_05270 80867 81064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 82048 81197 gene locus_tag LOCUS_05280 82048 81197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 83379 82063 gene locus_tag LOCUS_05290 83379 82063 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448293.1 protein_id gnl|my_center|LOCUS_05290 83515 85839 gene locus_tag LOCUS_05300 83515 85839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 85924 87417 gene locus_tag LOCUS_05310 85924 87417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 87544 90651 gene locus_tag LOCUS_05320 87544 90651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 91238 91561 gene locus_tag LOCUS_05330 91238 91561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 92407 91661 gene locus_tag LOCUS_05340 92407 91661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 94263 92506 gene locus_tag LOCUS_05350 94263 92506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 94889 94335 gene locus_tag LOCUS_05360 94889 94335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 96531 94894 gene locus_tag LOCUS_05370 gene cysS 96531 94894 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_05370 98811 96538 gene locus_tag LOCUS_05380 98811 96538 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546134.1 protein_id gnl|my_center|LOCUS_05380 99364 98825 gene locus_tag LOCUS_05390 99364 98825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 100242 99367 gene locus_tag LOCUS_05400 100242 99367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 100366 100441 gene locus_tag LOCUS_t00070 100366 100441 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 100590 104069 gene locus_tag LOCUS_05410 100590 104069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 104988 104086 gene locus_tag LOCUS_05420 104988 104086 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_05420 106989 105001 gene locus_tag LOCUS_05430 106989 105001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 107201 108520 gene locus_tag LOCUS_05440 107201 108520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 108522 109157 gene locus_tag LOCUS_05450 108522 109157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 109190 110689 gene locus_tag LOCUS_05460 109190 110689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 112132 110705 gene locus_tag LOCUS_05470 112132 110705 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_05470 113118 112129 gene locus_tag LOCUS_05480 113118 112129 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762399.1 protein_id gnl|my_center|LOCUS_05480 113927 113115 gene locus_tag LOCUS_05490 113927 113115 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_05490 115452 113935 gene locus_tag LOCUS_05500 115452 113935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 116085 115462 gene locus_tag LOCUS_05510 116085 115462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 117630 116095 gene locus_tag LOCUS_05520 117630 116095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 117829 119238 gene locus_tag LOCUS_05530 gene glnA 117829 119238 CDS product glutamine synthetase GlnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880012.1 protein_id gnl|my_center|LOCUS_05530 119242 122067 gene locus_tag LOCUS_05540 119242 122067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 122072 123364 gene locus_tag LOCUS_05550 122072 123364 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940462.1 protein_id gnl|my_center|LOCUS_05550 123361 124263 gene locus_tag LOCUS_05560 gene lgt 123361 124263 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403744.1 protein_id gnl|my_center|LOCUS_05560 124260 125297 gene locus_tag LOCUS_05570 124260 125297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 125308 126021 gene locus_tag LOCUS_05580 125308 126021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 126165 127352 gene locus_tag LOCUS_05590 126165 127352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 127462 129501 gene locus_tag LOCUS_05600 127462 129501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 129498 130427 gene locus_tag LOCUS_05610 129498 130427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 131135 130368 gene locus_tag LOCUS_05620 131135 130368 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274356.1 protein_id gnl|my_center|LOCUS_05620 133039 131129 gene locus_tag LOCUS_05630 gene feoB 133039 131129 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541602.1 protein_id gnl|my_center|LOCUS_05630 133586 133191 gene locus_tag LOCUS_05640 gene rpsI 133586 133191 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829824.1 protein_id gnl|my_center|LOCUS_05640 134032 133589 gene locus_tag LOCUS_05650 gene rplM 134032 133589 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081738.1 protein_id gnl|my_center|LOCUS_05650 134529 134729 gene locus_tag LOCUS_05660 134529 134729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 134746 135702 gene locus_tag LOCUS_05670 134746 135702 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805026.1 protein_id gnl|my_center|LOCUS_05670 135699 136757 gene locus_tag LOCUS_05680 135699 136757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 136762 138156 gene locus_tag LOCUS_05690 136762 138156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 139056 138160 gene locus_tag LOCUS_05700 139056 138160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 139515 139066 gene locus_tag LOCUS_05710 139515 139066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 140337 139519 gene locus_tag LOCUS_05720 140337 139519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 140518 142134 gene locus_tag LOCUS_05730 gene rng 140518 142134 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_05730 142165 143289 gene locus_tag LOCUS_05740 142165 143289 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256249.1 protein_id gnl|my_center|LOCUS_05740 143378 143304 gene locus_tag LOCUS_t00080 143378 143304 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 143645 143385 gene locus_tag LOCUS_05750 gene rpsT 143645 143385 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942846.1 protein_id gnl|my_center|LOCUS_05750 143928 145271 gene locus_tag LOCUS_05760 143928 145271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 145313 145474 gene locus_tag LOCUS_05770 145313 145474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 145838 147403 gene locus_tag LOCUS_05780 145838 147403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 147411 148247 gene locus_tag LOCUS_05790 147411 148247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 150990 148261 gene locus_tag LOCUS_05800 150990 148261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 151188 153833 gene locus_tag LOCUS_05810 151188 153833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 154074 153892 gene locus_tag LOCUS_05820 154074 153892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 153998 155584 gene locus_tag LOCUS_05830 153998 155584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 154229 154132 gene locus_tag LOCUS_t00090 154229 154132 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 156989 155709 gene locus_tag LOCUS_05840 156989 155709 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942174.1 protein_id gnl|my_center|LOCUS_05840 158109 157093 gene locus_tag LOCUS_05850 158109 157093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 158292 159341 gene locus_tag LOCUS_05860 gene murG 158292 159341 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_05860 160466 159747 gene locus_tag LOCUS_05870 gene rph 160466 159747 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247089.1 protein_id gnl|my_center|LOCUS_05870 161373 160483 gene locus_tag LOCUS_05880 161373 160483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 162011 161370 gene locus_tag LOCUS_05890 162011 161370 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226658.1 protein_id gnl|my_center|LOCUS_05890 163626 162016 gene locus_tag LOCUS_05900 163626 162016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 165477 163681 gene locus_tag LOCUS_05910 165477 163681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 165593 166468 gene locus_tag LOCUS_05920 165593 166468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 166465 167094 gene locus_tag LOCUS_05930 gene queE 166465 167094 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947757.1 protein_id gnl|my_center|LOCUS_05930 168061 167126 gene locus_tag LOCUS_05940 168061 167126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 168269 169672 gene locus_tag LOCUS_05950 168269 169672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 169685 170857 gene locus_tag LOCUS_05960 169685 170857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 171724 171020 gene locus_tag LOCUS_05970 171724 171020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 172662 171751 gene locus_tag LOCUS_05980 172662 171751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 172797 173237 gene locus_tag LOCUS_05990 172797 173237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 175619 173280 gene locus_tag LOCUS_06000 gene recG 175619 173280 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_06000 175785 176693 gene locus_tag LOCUS_06010 175785 176693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 176856 178061 gene locus_tag LOCUS_06020 176856 178061 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020871.1 protein_id gnl|my_center|LOCUS_06020 178084 178659 gene locus_tag LOCUS_06030 gene pyrE 178084 178659 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942282.1 protein_id gnl|my_center|LOCUS_06030 178746 179336 gene locus_tag LOCUS_06040 178746 179336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 179349 180167 gene locus_tag LOCUS_06050 179349 180167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 180177 181049 gene locus_tag LOCUS_06060 180177 181049 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142331.1 protein_id gnl|my_center|LOCUS_06060 182201 181158 gene locus_tag LOCUS_06070 182201 181158 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943100.1 protein_id gnl|my_center|LOCUS_06070 183198 182185 gene locus_tag LOCUS_06080 183198 182185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 183510 184376 gene locus_tag LOCUS_06090 183510 184376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 >Feature sequence04 221 1636 gene locus_tag LOCUS_06100 221 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 1708 2217 gene locus_tag LOCUS_06110 1708 2217 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071839.1 protein_id gnl|my_center|LOCUS_06110 3151 2225 gene locus_tag LOCUS_06120 3151 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 3914 4273 gene locus_tag LOCUS_06130 3914 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 4309 6126 gene locus_tag LOCUS_06140 4309 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 7903 6146 gene locus_tag LOCUS_06150 7903 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 8168 9199 gene locus_tag LOCUS_06160 8168 9199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 9215 10738 gene locus_tag LOCUS_06170 9215 10738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 10942 11850 gene locus_tag LOCUS_06180 10942 11850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 13612 12140 gene locus_tag LOCUS_06190 13612 12140 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 protein_id gnl|my_center|LOCUS_06190 13518 13808 gene locus_tag LOCUS_06200 13518 13808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 14021 15991 gene locus_tag LOCUS_06210 14021 15991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 16878 16006 gene locus_tag LOCUS_06220 16878 16006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 17068 17685 gene locus_tag LOCUS_06230 17068 17685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 17741 18673 gene locus_tag LOCUS_06240 17741 18673 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407374.1 protein_id gnl|my_center|LOCUS_06240 18854 19582 gene locus_tag LOCUS_06250 gene fabG 18854 19582 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036220.1 protein_id gnl|my_center|LOCUS_06250 21762 19600 gene locus_tag LOCUS_06260 21762 19600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 24009 21838 gene locus_tag LOCUS_06270 24009 21838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 24200 25309 gene locus_tag LOCUS_06280 24200 25309 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259287.1 protein_id gnl|my_center|LOCUS_06280 25306 26649 gene locus_tag LOCUS_06290 25306 26649 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804843.1 protein_id gnl|my_center|LOCUS_06290 26646 28316 gene locus_tag LOCUS_06300 26646 28316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 28313 29161 gene locus_tag LOCUS_06310 28313 29161 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976585.1 protein_id gnl|my_center|LOCUS_06310 29835 29934 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30049 30987 gene locus_tag LOCUS_06320 30049 30987 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940332.1 protein_id gnl|my_center|LOCUS_06320 32403 30991 gene locus_tag LOCUS_06330 32403 30991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 35509 32417 gene locus_tag LOCUS_06340 35509 32417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 35712 35975 gene locus_tag LOCUS_06350 35712 35975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 39705 36178 gene locus_tag LOCUS_06360 gene smc 39705 36178 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918261.1 protein_id gnl|my_center|LOCUS_06360 40088 40471 gene locus_tag LOCUS_06370 40088 40471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 40575 41756 gene locus_tag LOCUS_06380 40575 41756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 41774 41995 gene locus_tag LOCUS_06390 41774 41995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 44281 42143 gene locus_tag LOCUS_06400 44281 42143 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680717.1 protein_id gnl|my_center|LOCUS_06400 44479 47445 gene locus_tag LOCUS_06410 44479 47445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 47470 48264 gene locus_tag LOCUS_06420 47470 48264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 48623 49288 gene locus_tag LOCUS_06430 48623 49288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 49281 50738 gene locus_tag LOCUS_06440 49281 50738 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403192.1 protein_id gnl|my_center|LOCUS_06440 50858 51775 gene locus_tag LOCUS_06450 50858 51775 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026644807.1 protein_id gnl|my_center|LOCUS_06450 52921 51803 gene locus_tag LOCUS_06460 52921 51803 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_06460 54111 53170 gene locus_tag LOCUS_06470 gene dmeF 54111 53170 CDS product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704592.1 protein_id gnl|my_center|LOCUS_06470 54230 56359 gene locus_tag LOCUS_06480 54230 56359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 56466 57251 gene locus_tag LOCUS_06490 56466 57251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 57254 57727 gene locus_tag LOCUS_06500 gene greA 57254 57727 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920688.1 protein_id gnl|my_center|LOCUS_06500 57727 57912 gene locus_tag LOCUS_06510 57727 57912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 57887 58138 gene locus_tag LOCUS_06520 57887 58138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 58238 58501 gene locus_tag LOCUS_06530 58238 58501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 58538 61015 gene locus_tag LOCUS_06540 58538 61015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 61145 64324 gene locus_tag LOCUS_06550 61145 64324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 64410 65747 gene locus_tag LOCUS_06560 64410 65747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 65858 66226 gene locus_tag LOCUS_06570 gene queD 65858 66226 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391049.1 protein_id gnl|my_center|LOCUS_06570 66234 67034 gene locus_tag LOCUS_06580 gene folE2 66234 67034 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_06580 67085 67738 gene locus_tag LOCUS_06590 67085 67738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 67735 68940 gene locus_tag LOCUS_06600 67735 68940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 69935 68994 gene locus_tag LOCUS_06610 69935 68994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 70749 69955 gene locus_tag LOCUS_06620 70749 69955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 71919 70930 gene locus_tag LOCUS_06630 71919 70930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 72158 85669 gene locus_tag LOCUS_06640 72158 85669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 82793 82892 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 86976 85723 gene locus_tag LOCUS_06650 86976 85723 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807926.1 protein_id gnl|my_center|LOCUS_06650 88110 87019 gene locus_tag LOCUS_06660 88110 87019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 88911 88237 gene locus_tag LOCUS_06670 88911 88237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 89380 88964 gene locus_tag LOCUS_06680 gene cdd 89380 88964 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888808.1 protein_id gnl|my_center|LOCUS_06680 90573 89401 gene locus_tag LOCUS_06690 90573 89401 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626572.1 protein_id gnl|my_center|LOCUS_06690 91135 90581 gene locus_tag LOCUS_06700 91135 90581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 91232 91157 gene locus_tag LOCUS_t00100 91232 91157 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 91443 91952 gene locus_tag LOCUS_06710 91443 91952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 91958 92197 gene locus_tag LOCUS_06720 91958 92197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 92214 92666 gene locus_tag LOCUS_06730 gene rplI 92214 92666 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_06730 92690 94120 gene locus_tag LOCUS_06740 gene dnaB 92690 94120 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_06740 94148 95266 gene locus_tag LOCUS_06750 94148 95266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 95523 95945 gene locus_tag LOCUS_06760 95523 95945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 95961 96356 gene locus_tag LOCUS_06770 95961 96356 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922983.1 protein_id gnl|my_center|LOCUS_06770 96695 98128 gene locus_tag LOCUS_06780 gene ahcY 96695 98128 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937910.1 protein_id gnl|my_center|LOCUS_06780 98723 99436 gene locus_tag LOCUS_06790 98723 99436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 99491 101443 gene locus_tag LOCUS_06800 99491 101443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 101440 101835 gene locus_tag LOCUS_06810 101440 101835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 101901 102518 gene locus_tag LOCUS_06820 101901 102518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 102723 103043 gene locus_tag LOCUS_06830 102723 103043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 103980 103240 gene locus_tag LOCUS_06840 103980 103240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 104419 104733 gene locus_tag LOCUS_06850 104419 104733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 104730 104954 gene locus_tag LOCUS_06860 104730 104954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 104951 105514 gene locus_tag LOCUS_06870 104951 105514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 105484 105648 gene locus_tag LOCUS_06880 105484 105648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 106355 105804 gene locus_tag LOCUS_06890 106355 105804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 106498 108915 gene locus_tag LOCUS_06900 106498 108915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 108918 109364 gene locus_tag LOCUS_06910 108918 109364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 109354 109668 gene locus_tag LOCUS_06920 109354 109668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 109661 109873 gene locus_tag LOCUS_06930 109661 109873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 109866 110234 gene locus_tag LOCUS_06940 109866 110234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 110399 111460 gene locus_tag LOCUS_06950 110399 111460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 111569 111739 gene locus_tag LOCUS_06960 111569 111739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 111741 111929 gene locus_tag LOCUS_06970 111741 111929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 112008 113129 gene locus_tag LOCUS_06980 112008 113129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 113401 113219 gene locus_tag LOCUS_06990 113401 113219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 114040 114264 gene locus_tag LOCUS_07000 114040 114264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 114537 115478 gene locus_tag LOCUS_07010 114537 115478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 117229 116081 gene locus_tag LOCUS_07020 117229 116081 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106059.1 protein_id gnl|my_center|LOCUS_07020 118258 117233 gene locus_tag LOCUS_07030 gene mutY 118258 117233 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171406.1 protein_id gnl|my_center|LOCUS_07030 120050 118263 gene locus_tag LOCUS_07040 120050 118263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 121358 120057 gene locus_tag LOCUS_07050 121358 120057 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_07050 122129 121479 gene locus_tag LOCUS_07060 122129 121479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 122248 123015 gene locus_tag LOCUS_07070 122248 123015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 124397 123174 gene locus_tag LOCUS_07080 124397 123174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 125595 124423 gene locus_tag LOCUS_07090 125595 124423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 126343 125747 gene locus_tag LOCUS_07100 126343 125747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 127367 126489 gene locus_tag LOCUS_07110 127367 126489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 127683 130433 gene locus_tag LOCUS_07120 127683 130433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 132019 130748 gene locus_tag LOCUS_07130 132019 130748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 132610 132113 gene locus_tag LOCUS_07140 gene tpx 132610 132113 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538561.1 protein_id gnl|my_center|LOCUS_07140 132795 135143 gene locus_tag LOCUS_07150 132795 135143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 135248 136114 gene locus_tag LOCUS_07160 135248 136114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 136232 138235 gene locus_tag LOCUS_07170 136232 138235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 138825 138244 gene locus_tag LOCUS_07180 138825 138244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 138953 142039 gene locus_tag LOCUS_07190 138953 142039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 142325 142648 gene locus_tag LOCUS_07200 142325 142648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 143144 142734 gene locus_tag LOCUS_07210 143144 142734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 143844 144200 gene locus_tag LOCUS_07220 143844 144200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 144197 144556 gene locus_tag LOCUS_07230 gene tnpB 144197 144556 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624622.1 protein_id gnl|my_center|LOCUS_07230 144621 146138 gene locus_tag LOCUS_07240 144621 146138 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971015.1 protein_id gnl|my_center|LOCUS_07240 146974 146228 gene locus_tag LOCUS_07250 146974 146228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 147649 147077 gene locus_tag LOCUS_07260 147649 147077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 148460 147792 gene locus_tag LOCUS_07270 148460 147792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 148743 150227 gene locus_tag LOCUS_07280 148743 150227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 150535 150972 gene locus_tag LOCUS_07290 150535 150972 CDS product HI0074 family nucleotidyltransferase substrate-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258928.1 protein_id gnl|my_center|LOCUS_07290 150969 151268 gene locus_tag LOCUS_07300 150969 151268 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258929.1 protein_id gnl|my_center|LOCUS_07300 151406 151334 gene locus_tag LOCUS_t00110 151406 151334 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 151490 151414 gene locus_tag LOCUS_t00120 151490 151414 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 153066 151636 gene locus_tag LOCUS_07310 153066 151636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 154537 153194 gene locus_tag LOCUS_07320 gene murD 154537 153194 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_07320 156502 154619 gene locus_tag LOCUS_07330 156502 154619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 >Feature sequence05 156 860 gene locus_tag LOCUS_07340 156 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 3013 875 gene locus_tag LOCUS_07350 3013 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 3997 3071 gene locus_tag LOCUS_07360 gene miaA 3997 3071 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_07360 4134 4221 gene locus_tag LOCUS_t00130 4134 4221 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4271 4358 gene locus_tag LOCUS_t00140 4271 4358 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4485 6317 gene locus_tag LOCUS_07370 4485 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 6342 6671 gene locus_tag LOCUS_07380 6342 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 6682 7293 gene locus_tag LOCUS_07390 gene recR 6682 7293 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_07390 7994 7440 gene locus_tag LOCUS_07400 7994 7440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 8664 8011 gene locus_tag LOCUS_07410 8664 8011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 9410 8775 gene locus_tag LOCUS_07420 9410 8775 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894436.1 protein_id gnl|my_center|LOCUS_07420 9838 9590 gene locus_tag LOCUS_07430 9838 9590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 11001 9838 gene locus_tag LOCUS_07440 11001 9838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 16052 11019 gene locus_tag LOCUS_07450 16052 11019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 18700 16049 gene locus_tag LOCUS_07460 18700 16049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 19527 18748 gene locus_tag LOCUS_07470 19527 18748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 19703 21010 gene locus_tag LOCUS_07480 19703 21010 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674820.1 protein_id gnl|my_center|LOCUS_07480 21024 21803 gene locus_tag LOCUS_07490 21024 21803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 21923 23200 gene locus_tag LOCUS_07500 gene ftsA 21923 23200 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_07500 23310 24563 gene locus_tag LOCUS_07510 gene ftsZ 23310 24563 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939769.1 protein_id gnl|my_center|LOCUS_07510 24669 24962 gene locus_tag LOCUS_07520 24669 24962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 24988 26073 gene locus_tag LOCUS_07530 24988 26073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 26097 26837 gene locus_tag LOCUS_07540 26097 26837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 26839 27519 gene locus_tag LOCUS_07550 26839 27519 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870048.1 protein_id gnl|my_center|LOCUS_07550 27516 28160 gene locus_tag LOCUS_07560 27516 28160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 28245 28610 gene locus_tag LOCUS_07570 28245 28610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 30149 28665 gene locus_tag LOCUS_07580 30149 28665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 30315 30653 gene locus_tag LOCUS_07590 30315 30653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 30650 31075 gene locus_tag LOCUS_07600 gene rlmH 30650 31075 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531239.1 protein_id gnl|my_center|LOCUS_07600 32867 31119 gene locus_tag LOCUS_07610 32867 31119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 34322 32901 gene locus_tag LOCUS_07620 34322 32901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 36768 34330 gene locus_tag LOCUS_07630 36768 34330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 36918 38282 gene locus_tag LOCUS_07640 36918 38282 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838467.1 protein_id gnl|my_center|LOCUS_07640 38302 40752 gene locus_tag LOCUS_07650 38302 40752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 40797 42125 gene locus_tag LOCUS_07660 40797 42125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 42137 42997 gene locus_tag LOCUS_07670 42137 42997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 43015 43986 gene locus_tag LOCUS_07680 43015 43986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 44008 46371 gene locus_tag LOCUS_07690 44008 46371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 46900 46529 gene locus_tag LOCUS_07700 46900 46529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 49054 46919 gene locus_tag LOCUS_07710 49054 46919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 51123 49540 gene locus_tag LOCUS_07720 gene murJ 51123 49540 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_07720 51174 51407 gene locus_tag LOCUS_07730 51174 51407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 51412 51879 gene locus_tag LOCUS_07740 51412 51879 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263491.1 protein_id gnl|my_center|LOCUS_07740 51879 52040 gene locus_tag LOCUS_07750 51879 52040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 52047 52793 gene locus_tag LOCUS_07760 52047 52793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 52861 53010 gene locus_tag LOCUS_07770 52861 53010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 53139 53654 gene locus_tag LOCUS_07780 53139 53654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 53651 54142 gene locus_tag LOCUS_07790 53651 54142 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263491.1 protein_id gnl|my_center|LOCUS_07790 54139 54537 gene locus_tag LOCUS_07800 54139 54537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 54556 54738 gene locus_tag LOCUS_07810 54556 54738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 54822 55676 gene locus_tag LOCUS_07820 54822 55676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 55772 57274 gene locus_tag LOCUS_07830 55772 57274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 57406 59238 gene locus_tag LOCUS_07840 57406 59238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 59231 59665 gene locus_tag LOCUS_07850 59231 59665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 59744 60136 gene locus_tag LOCUS_07860 59744 60136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 60713 60165 gene locus_tag LOCUS_07870 60713 60165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 61054 61623 gene locus_tag LOCUS_07880 61054 61623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 61704 62996 gene locus_tag LOCUS_07890 61704 62996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 63008 65341 gene locus_tag LOCUS_07900 gene rnr 63008 65341 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942131.1 protein_id gnl|my_center|LOCUS_07900 65346 66371 gene locus_tag LOCUS_07910 65346 66371 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_07910 66454 67839 gene locus_tag LOCUS_07920 66454 67839 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107821.1 protein_id gnl|my_center|LOCUS_07920 68818 67814 gene locus_tag LOCUS_07930 68818 67814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 70033 68909 gene locus_tag LOCUS_07940 70033 68909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 70980 70204 gene locus_tag LOCUS_07950 70980 70204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 71336 71947 gene locus_tag LOCUS_07960 71336 71947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 71944 72987 gene locus_tag LOCUS_07970 71944 72987 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111129.1 protein_id gnl|my_center|LOCUS_07970 76305 72997 gene locus_tag LOCUS_07980 gene ygfK 76305 72997 CDS product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869176.1 protein_id gnl|my_center|LOCUS_07980 76277 76588 gene locus_tag LOCUS_07990 76277 76588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 76936 76640 gene locus_tag LOCUS_08000 76936 76640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 77625 76951 gene locus_tag LOCUS_08010 77625 76951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 80061 77674 gene locus_tag LOCUS_08020 80061 77674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 80113 80667 gene locus_tag LOCUS_08030 80113 80667 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_08030 80753 82714 gene locus_tag LOCUS_08040 80753 82714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 82730 83461 gene locus_tag LOCUS_08050 82730 83461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679004.1 protein_id gnl|my_center|LOCUS_08050 83570 84634 gene locus_tag LOCUS_08060 83570 84634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_08060 85902 85069 gene locus_tag LOCUS_08070 85902 85069 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257277.1 protein_id gnl|my_center|LOCUS_08070 86851 85937 gene locus_tag LOCUS_08080 86851 85937 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257278.1 protein_id gnl|my_center|LOCUS_08080 88935 87010 gene locus_tag LOCUS_08090 88935 87010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 90960 88942 gene locus_tag LOCUS_08100 90960 88942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 93408 91027 gene locus_tag LOCUS_08110 93408 91027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 93851 93447 gene locus_tag LOCUS_08120 93851 93447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 94033 95748 gene locus_tag LOCUS_08130 94033 95748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 95741 97618 gene locus_tag LOCUS_08140 95741 97618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 98335 97880 gene locus_tag LOCUS_08150 98335 97880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 98487 99713 gene locus_tag LOCUS_08160 98487 99713 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_08160 99710 101359 gene locus_tag LOCUS_08170 99710 101359 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_08170 101430 102206 gene locus_tag LOCUS_08180 101430 102206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 102345 102665 gene locus_tag LOCUS_08190 102345 102665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 102897 102625 gene locus_tag LOCUS_08200 102897 102625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 103332 104306 gene locus_tag LOCUS_08210 103332 104306 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 protein_id gnl|my_center|LOCUS_08210 104446 104832 gene locus_tag LOCUS_08220 104446 104832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 104801 105637 gene locus_tag LOCUS_08230 104801 105637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 106526 105834 gene locus_tag LOCUS_08240 106526 105834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 107393 106611 gene locus_tag LOCUS_08250 107393 106611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 107704 107988 gene locus_tag LOCUS_08260 107704 107988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 109745 107985 gene locus_tag LOCUS_08270 109745 107985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 113182 109757 gene locus_tag LOCUS_08280 113182 109757 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 protein_id gnl|my_center|LOCUS_08280 114968 113322 gene locus_tag LOCUS_08290 114968 113322 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227677.1 protein_id gnl|my_center|LOCUS_08290 114931 115137 gene locus_tag LOCUS_08300 114931 115137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 117671 116127 gene locus_tag LOCUS_08310 117671 116127 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778938.1 protein_id gnl|my_center|LOCUS_08310 118656 121727 gene locus_tag LOCUS_08320 118656 121727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 121846 122088 gene locus_tag LOCUS_08330 121846 122088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 122275 123501 gene locus_tag LOCUS_08340 122275 123501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 122343 122436 gene locus_tag LOCUS_t00150 122343 122436 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 124923 123628 gene locus_tag LOCUS_08350 124923 123628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 125103 126614 gene locus_tag LOCUS_08360 125103 126614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 126733 127092 gene locus_tag LOCUS_08370 126733 127092 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583889.1 protein_id gnl|my_center|LOCUS_08370 127210 127572 gene locus_tag LOCUS_08380 127210 127572 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583889.1 protein_id gnl|my_center|LOCUS_08380 127621 128103 gene locus_tag LOCUS_08390 127621 128103 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867824.1 protein_id gnl|my_center|LOCUS_08390 128100 128354 gene locus_tag LOCUS_08400 128100 128354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 128354 128629 gene locus_tag LOCUS_08410 gene mnhG 128354 128629 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080104.1 protein_id gnl|my_center|LOCUS_08410 128626 128880 gene locus_tag LOCUS_08420 128626 128880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 128873 129631 gene locus_tag LOCUS_08430 128873 129631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 129628 129996 gene locus_tag LOCUS_08440 129628 129996 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250172.1 protein_id gnl|my_center|LOCUS_08440 129993 131540 gene locus_tag LOCUS_08450 129993 131540 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250171.1 protein_id gnl|my_center|LOCUS_08450 131545 133428 gene locus_tag LOCUS_08460 131545 133428 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080094.1 protein_id gnl|my_center|LOCUS_08460 133440 134321 gene locus_tag LOCUS_08470 133440 134321 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080087.1 protein_id gnl|my_center|LOCUS_08470 134323 134979 gene locus_tag LOCUS_08480 134323 134979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 134969 135487 gene locus_tag LOCUS_08490 134969 135487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 135474 136625 gene locus_tag LOCUS_08500 135474 136625 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080082.1 protein_id gnl|my_center|LOCUS_08500 136635 138470 gene locus_tag LOCUS_08510 136635 138470 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080080.1 protein_id gnl|my_center|LOCUS_08510 138481 138954 gene locus_tag LOCUS_08520 138481 138954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 138958 140049 gene locus_tag LOCUS_08530 138958 140049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 140330 141451 gene locus_tag LOCUS_08540 140330 141451 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993997.1 protein_id gnl|my_center|LOCUS_08540 141474 142823 gene locus_tag LOCUS_08550 gene glmM 141474 142823 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_08550 142872 143606 gene locus_tag LOCUS_08560 142872 143606 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942449.1 protein_id gnl|my_center|LOCUS_08560 143644 145188 gene locus_tag LOCUS_08570 143644 145188 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_08570 146480 145773 gene locus_tag LOCUS_08580 146480 145773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 151353 150784 gene locus_tag LOCUS_08590 151353 150784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 152031 151771 gene locus_tag LOCUS_08600 152031 151771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 >Feature sequence06 1578 268 gene locus_tag LOCUS_08610 1578 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 1716 3617 gene locus_tag LOCUS_08620 1716 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 3807 5879 gene locus_tag LOCUS_08630 3807 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 5904 7607 gene locus_tag LOCUS_08640 5904 7607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 9487 7625 gene locus_tag LOCUS_08650 9487 7625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 10241 9528 gene locus_tag LOCUS_08660 10241 9528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 10943 10353 gene locus_tag LOCUS_08670 10943 10353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 12538 10946 gene locus_tag LOCUS_08680 12538 10946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 12764 13681 gene locus_tag LOCUS_08690 12764 13681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 13763 14602 gene locus_tag LOCUS_08700 13763 14602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 14599 15456 gene locus_tag LOCUS_08710 14599 15456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 16407 15502 gene locus_tag LOCUS_08720 16407 15502 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940333.1 protein_id gnl|my_center|LOCUS_08720 18242 16404 gene locus_tag LOCUS_08730 gene htpG 18242 16404 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141812.1 protein_id gnl|my_center|LOCUS_08730 18400 19680 gene locus_tag LOCUS_08740 18400 19680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 19824 21167 gene locus_tag LOCUS_08750 gene trkA 19824 21167 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021494.1 protein_id gnl|my_center|LOCUS_08750 21177 22631 gene locus_tag LOCUS_08760 21177 22631 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_08760 24153 22906 gene locus_tag LOCUS_08770 24153 22906 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 protein_id gnl|my_center|LOCUS_08770 25604 24384 gene locus_tag LOCUS_08780 25604 24384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 28252 25736 gene locus_tag LOCUS_08790 28252 25736 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136932681.1 protein_id gnl|my_center|LOCUS_08790 28415 30670 gene locus_tag LOCUS_08800 28415 30670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 30786 32075 gene locus_tag LOCUS_08810 30786 32075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 32068 33951 gene locus_tag LOCUS_08820 gene nuoF 32068 33951 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_08820 33951 35939 gene locus_tag LOCUS_08830 33951 35939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 36045 36245 gene locus_tag LOCUS_08840 gene thiS 36045 36245 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869550.1 protein_id gnl|my_center|LOCUS_08840 36358 37443 gene locus_tag LOCUS_08850 36358 37443 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_08850 38901 37819 gene locus_tag LOCUS_08860 38901 37819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 38816 39157 gene locus_tag LOCUS_08870 38816 39157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 39511 40200 gene locus_tag LOCUS_08880 39511 40200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 40322 41389 gene locus_tag LOCUS_08890 gene rffG 40322 41389 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226604.1 protein_id gnl|my_center|LOCUS_08890 41386 42258 gene locus_tag LOCUS_08900 gene rfbA 41386 42258 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815331.1 protein_id gnl|my_center|LOCUS_08900 43134 42283 gene locus_tag LOCUS_08910 gene rfbD 43134 42283 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786018.1 protein_id gnl|my_center|LOCUS_08910 43703 43131 gene locus_tag LOCUS_08920 gene rfbC 43703 43131 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877392.1 protein_id gnl|my_center|LOCUS_08920 44287 43763 gene locus_tag LOCUS_08930 44287 43763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 45525 44284 gene locus_tag LOCUS_08940 45525 44284 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193386705.1 protein_id gnl|my_center|LOCUS_08940 45696 46622 gene locus_tag LOCUS_08950 45696 46622 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812720.1 protein_id gnl|my_center|LOCUS_08950 46619 47485 gene locus_tag LOCUS_08960 46619 47485 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812722.1 protein_id gnl|my_center|LOCUS_08960 47608 48297 gene locus_tag LOCUS_08970 47608 48297 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_08970 48308 49306 gene locus_tag LOCUS_08980 48308 49306 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_08980 51526 49313 gene locus_tag LOCUS_08990 51526 49313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 51740 54052 gene locus_tag LOCUS_09000 51740 54052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 54136 55740 gene locus_tag LOCUS_09010 54136 55740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 55822 57891 gene locus_tag LOCUS_09020 55822 57891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 57953 59170 gene locus_tag LOCUS_09030 57953 59170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 60844 59183 gene locus_tag LOCUS_09040 60844 59183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 60952 61752 gene locus_tag LOCUS_09050 60952 61752 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_09050 61821 62261 gene locus_tag LOCUS_09060 61821 62261 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460328.1 protein_id gnl|my_center|LOCUS_09060 62307 63272 gene locus_tag LOCUS_09070 gene cysK 62307 63272 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267110.1 protein_id gnl|my_center|LOCUS_09070 63290 63637 gene locus_tag LOCUS_09080 63290 63637 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135500.1 protein_id gnl|my_center|LOCUS_09080 64180 63650 gene locus_tag LOCUS_09090 64180 63650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 65110 64196 gene locus_tag LOCUS_09100 65110 64196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 65371 66345 gene locus_tag LOCUS_09110 65371 66345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 66433 70008 gene locus_tag LOCUS_09120 66433 70008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 70309 70019 gene locus_tag LOCUS_09130 70309 70019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 71073 70315 gene locus_tag LOCUS_09140 71073 70315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 71172 73208 gene locus_tag LOCUS_09150 71172 73208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 73281 73976 gene locus_tag LOCUS_09160 73281 73976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 74298 73954 gene locus_tag LOCUS_09170 74298 73954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 74319 75821 gene locus_tag LOCUS_09180 74319 75821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 78823 76025 gene locus_tag LOCUS_09190 78823 76025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 80239 78896 gene locus_tag LOCUS_09200 80239 78896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 82164 80287 gene locus_tag LOCUS_09210 82164 80287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 82226 83227 gene locus_tag LOCUS_09220 82226 83227 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038051.1 protein_id gnl|my_center|LOCUS_09220 83561 83265 gene locus_tag LOCUS_09230 83561 83265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 87739 83930 gene locus_tag LOCUS_09240 87739 83930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 88355 89050 gene locus_tag LOCUS_09250 88355 89050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 90324 89062 gene locus_tag LOCUS_09260 90324 89062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 92582 90333 gene locus_tag LOCUS_09270 92582 90333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 94786 92702 gene locus_tag LOCUS_09280 94786 92702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 95350 94868 gene locus_tag LOCUS_09290 95350 94868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 95486 96916 gene locus_tag LOCUS_09300 95486 96916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 97363 96929 gene locus_tag LOCUS_09310 97363 96929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 97707 97360 gene locus_tag LOCUS_09320 97707 97360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 97598 98467 gene locus_tag LOCUS_09330 97598 98467 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929974.1 protein_id gnl|my_center|LOCUS_09330 98518 99795 gene locus_tag LOCUS_09340 gene eno 98518 99795 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869074.1 protein_id gnl|my_center|LOCUS_09340 99817 100206 gene locus_tag LOCUS_09350 gene crcB 99817 100206 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969203.1 protein_id gnl|my_center|LOCUS_09350 100494 100243 gene locus_tag LOCUS_09360 100494 100243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 100418 100981 gene locus_tag LOCUS_09370 100418 100981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 100991 101527 gene locus_tag LOCUS_09380 100991 101527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 101532 105446 gene locus_tag LOCUS_09390 101532 105446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 105451 105918 gene locus_tag LOCUS_09400 105451 105918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 105915 106973 gene locus_tag LOCUS_09410 105915 106973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 106973 107515 gene locus_tag LOCUS_09420 106973 107515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 107597 108274 gene locus_tag LOCUS_09430 107597 108274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 108279 109358 gene locus_tag LOCUS_09440 108279 109358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 111300 109591 gene locus_tag LOCUS_09450 111300 109591 CDS product glycoside hydrolase family 44 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964233.1 protein_id gnl|my_center|LOCUS_09450 111677 111329 gene locus_tag LOCUS_tm00010 111677 111329 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 111822 111747 gene locus_tag LOCUS_t00160 111822 111747 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 112181 111846 gene locus_tag LOCUS_09460 112181 111846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 112500 112195 gene locus_tag LOCUS_09470 112500 112195 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_09470 112912 112568 gene locus_tag LOCUS_09480 gene rplT 112912 112568 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138360.1 protein_id gnl|my_center|LOCUS_09480 113127 112930 gene locus_tag LOCUS_09490 gene rpmI 113127 112930 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297539.1 protein_id gnl|my_center|LOCUS_09490 113319 113161 gene locus_tag LOCUS_09500 113319 113161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 113635 113721 gene locus_tag LOCUS_t00170 113635 113721 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 113778 115403 gene locus_tag LOCUS_09510 113778 115403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 115400 115981 gene locus_tag LOCUS_09520 115400 115981 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404252.1 protein_id gnl|my_center|LOCUS_09520 115978 119571 gene locus_tag LOCUS_09530 115978 119571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 119568 120623 gene locus_tag LOCUS_09540 119568 120623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 121184 120636 gene locus_tag LOCUS_09550 121184 120636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 122183 121224 gene locus_tag LOCUS_09560 122183 121224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 122805 122188 gene locus_tag LOCUS_09570 122805 122188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 125951 122823 gene locus_tag LOCUS_09580 gene ileS 125951 122823 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882759.1 protein_id gnl|my_center|LOCUS_09580 126198 126010 gene locus_tag LOCUS_09590 126198 126010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 126391 128442 gene locus_tag LOCUS_09600 126391 128442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 128570 129580 gene locus_tag LOCUS_09610 128570 129580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 129577 131877 gene locus_tag LOCUS_09620 129577 131877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 131885 132598 gene locus_tag LOCUS_09630 131885 132598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 132612 133457 gene locus_tag LOCUS_09640 gene nadC 132612 133457 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067615902.1 protein_id gnl|my_center|LOCUS_09640 133454 135169 gene locus_tag LOCUS_09650 133454 135169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 135401 136213 gene locus_tag LOCUS_09660 135401 136213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 139936 136241 gene locus_tag LOCUS_09670 139936 136241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 >Feature sequence07 675 1556 gene locus_tag LOCUS_09680 675 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1570 3474 gene locus_tag LOCUS_09690 1570 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 3480 4295 gene locus_tag LOCUS_09700 3480 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 5409 4300 gene locus_tag LOCUS_09710 5409 4300 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969607.1 protein_id gnl|my_center|LOCUS_09710 6708 5458 gene locus_tag LOCUS_09720 6708 5458 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_09720 7579 6794 gene locus_tag LOCUS_09730 7579 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 8373 7726 gene locus_tag LOCUS_09740 8373 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 9614 8418 gene locus_tag LOCUS_09750 9614 8418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 10225 9596 gene locus_tag LOCUS_09760 10225 9596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245105.1 protein_id gnl|my_center|LOCUS_09760 11033 10245 gene locus_tag LOCUS_09770 11033 10245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 12779 11133 gene locus_tag LOCUS_09780 12779 11133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 12970 15543 gene locus_tag LOCUS_09790 12970 15543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 18064 15776 gene locus_tag LOCUS_09800 18064 15776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 19136 18087 gene locus_tag LOCUS_09810 19136 18087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 20102 19212 gene locus_tag LOCUS_09820 20102 19212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 20951 20124 gene locus_tag LOCUS_09830 20951 20124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 22844 21228 gene locus_tag LOCUS_09840 22844 21228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 23103 23813 gene locus_tag LOCUS_09850 23103 23813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 23816 24406 gene locus_tag LOCUS_09860 23816 24406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 24429 25211 gene locus_tag LOCUS_09870 24429 25211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 25215 27302 gene locus_tag LOCUS_09880 25215 27302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 28397 27561 gene locus_tag LOCUS_09890 28397 27561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 28561 28634 gene locus_tag LOCUS_t00180 28561 28634 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 28776 30386 gene locus_tag LOCUS_09900 28776 30386 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257013.1 protein_id gnl|my_center|LOCUS_09900 30402 31289 gene locus_tag LOCUS_09910 30402 31289 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_09910 31450 32166 gene locus_tag LOCUS_09920 31450 32166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 32282 32842 gene locus_tag LOCUS_09930 32282 32842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 32842 33846 gene locus_tag LOCUS_09940 32842 33846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 33843 35375 gene locus_tag LOCUS_09950 33843 35375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 35429 35890 gene locus_tag LOCUS_09960 35429 35890 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939839.1 protein_id gnl|my_center|LOCUS_09960 37498 36101 gene locus_tag LOCUS_09970 37498 36101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 38335 37529 gene locus_tag LOCUS_09980 38335 37529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 39179 38508 gene locus_tag LOCUS_09990 gene phoU 39179 38508 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326666.1 protein_id gnl|my_center|LOCUS_09990 40147 39338 gene locus_tag LOCUS_10000 gene pstB 40147 39338 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448479.1 protein_id gnl|my_center|LOCUS_10000 41010 40144 gene locus_tag LOCUS_10010 gene pstA 41010 40144 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809638.1 protein_id gnl|my_center|LOCUS_10010 41985 41017 gene locus_tag LOCUS_10020 gene pstC 41985 41017 CDS product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215558.1 protein_id gnl|my_center|LOCUS_10020 43155 42010 gene locus_tag LOCUS_10030 gene pstS 43155 42010 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809635.1 protein_id gnl|my_center|LOCUS_10030 43273 43145 gene locus_tag LOCUS_10040 43273 43145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 44636 43404 gene locus_tag LOCUS_10050 44636 43404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 45788 44799 gene locus_tag LOCUS_10060 45788 44799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 47257 45836 gene locus_tag LOCUS_10070 47257 45836 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_10070 48498 47602 gene locus_tag LOCUS_10080 gene dapF 48498 47602 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014772.1 protein_id gnl|my_center|LOCUS_10080 49111 48533 gene locus_tag LOCUS_10090 49111 48533 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941308.1 protein_id gnl|my_center|LOCUS_10090 49899 49108 gene locus_tag LOCUS_10100 gene trmD 49899 49108 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765874.1 protein_id gnl|my_center|LOCUS_10100 49984 52173 gene locus_tag LOCUS_10110 49984 52173 CDS product chromosome condensation regulator RCC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258200.1 protein_id gnl|my_center|LOCUS_10110 52196 54385 gene locus_tag LOCUS_10120 52196 54385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 55755 54397 gene locus_tag LOCUS_10130 55755 54397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146458090.1 protein_id gnl|my_center|LOCUS_10130 56218 57549 gene locus_tag LOCUS_10140 56218 57549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 57563 57754 gene locus_tag LOCUS_10150 57563 57754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 58282 58127 gene locus_tag LOCUS_10160 58282 58127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 58403 58579 gene locus_tag LOCUS_10170 58403 58579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 58588 60099 gene locus_tag LOCUS_10180 58588 60099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 60235 61443 gene locus_tag LOCUS_10190 60235 61443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 61741 64413 gene locus_tag LOCUS_10200 61741 64413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 64490 66232 gene locus_tag LOCUS_10210 64490 66232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 66413 67777 gene locus_tag LOCUS_10220 66413 67777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 67836 68510 gene locus_tag LOCUS_10230 67836 68510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 69194 68604 gene locus_tag LOCUS_10240 69194 68604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 70482 69331 gene locus_tag LOCUS_10250 70482 69331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 71037 70624 gene locus_tag LOCUS_10260 71037 70624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 71238 72257 gene locus_tag LOCUS_10270 71238 72257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 72302 72742 gene locus_tag LOCUS_10280 72302 72742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 77743 73034 gene locus_tag LOCUS_10290 77743 73034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 78131 78056 gene locus_tag LOCUS_t00190 78131 78056 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 78739 78251 gene locus_tag LOCUS_10300 gene folK 78739 78251 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_10300 79752 78736 gene locus_tag LOCUS_10310 79752 78736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 79935 80594 gene locus_tag LOCUS_10320 79935 80594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 80604 80840 gene locus_tag LOCUS_10330 80604 80840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 83198 81000 gene locus_tag LOCUS_10340 83198 81000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 83330 83770 gene locus_tag LOCUS_10350 83330 83770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 85665 84214 gene locus_tag LOCUS_10360 85665 84214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 89136 85720 gene locus_tag LOCUS_10370 89136 85720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 91457 89289 gene locus_tag LOCUS_10380 91457 89289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 93283 91580 gene locus_tag LOCUS_10390 gene pilB 93283 91580 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_10390 94012 93356 gene locus_tag LOCUS_10400 94012 93356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 95359 94025 gene locus_tag LOCUS_10410 95359 94025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 96315 95395 gene locus_tag LOCUS_10420 96315 95395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 96646 96329 gene locus_tag LOCUS_10430 96646 96329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 96871 97383 gene locus_tag LOCUS_10440 96871 97383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 97396 97917 gene locus_tag LOCUS_10450 97396 97917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 97934 99208 gene locus_tag LOCUS_10460 97934 99208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 101875 99224 gene locus_tag LOCUS_10470 101875 99224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 102448 101909 gene locus_tag LOCUS_10480 102448 101909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 103488 102451 gene locus_tag LOCUS_10490 103488 102451 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880304.1 protein_id gnl|my_center|LOCUS_10490 104474 103932 gene locus_tag LOCUS_10500 104474 103932 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028072.1 protein_id gnl|my_center|LOCUS_10500 106117 104471 gene locus_tag LOCUS_10510 gene gpmI 106117 104471 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_10510 106317 106416 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 107426 106470 gene locus_tag LOCUS_10520 107426 106470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 107320 107547 gene locus_tag LOCUS_10530 107320 107547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 108065 107910 gene locus_tag LOCUS_10540 108065 107910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 108186 108362 gene locus_tag LOCUS_10550 108186 108362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 108371 109831 gene locus_tag LOCUS_10560 108371 109831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 109913 110194 gene locus_tag LOCUS_10570 109913 110194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 110228 111172 gene locus_tag LOCUS_10580 110228 111172 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_10580 111232 112167 gene locus_tag LOCUS_10590 111232 112167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 112164 113444 gene locus_tag LOCUS_10600 112164 113444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10600 113441 114433 gene locus_tag LOCUS_10610 113441 114433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 114430 115242 gene locus_tag LOCUS_10620 114430 115242 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389390.1 protein_id gnl|my_center|LOCUS_10620 115247 116191 gene locus_tag LOCUS_10630 115247 116191 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081007.1 protein_id gnl|my_center|LOCUS_10630 116260 117378 gene locus_tag LOCUS_10640 gene prfB 116260 117378 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_10640 117375 118898 gene locus_tag LOCUS_10650 117375 118898 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939648.1 protein_id gnl|my_center|LOCUS_10650 118905 120629 gene locus_tag LOCUS_10660 118905 120629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 120860 121453 gene locus_tag LOCUS_10670 120860 121453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 123037 121643 gene locus_tag LOCUS_10680 123037 121643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 122924 123259 gene locus_tag LOCUS_10690 122924 123259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 124120 123320 gene locus_tag LOCUS_10700 124120 123320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 125714 124278 gene locus_tag LOCUS_10710 125714 124278 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006102898.1 protein_id gnl|my_center|LOCUS_10710 127243 125720 gene locus_tag LOCUS_10720 127243 125720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 128799 127252 gene locus_tag LOCUS_10730 128799 127252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 129020 129415 gene locus_tag LOCUS_10740 129020 129415 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941050.1 protein_id gnl|my_center|LOCUS_10740 129505 130527 gene locus_tag LOCUS_10750 gene asd 129505 130527 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256126.1 protein_id gnl|my_center|LOCUS_10750 130531 131700 gene locus_tag LOCUS_10760 130531 131700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence08 2282 69 gene locus_tag LOCUS_10770 2282 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 4538 2337 gene locus_tag LOCUS_10780 4538 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 5694 4555 gene locus_tag LOCUS_10790 5694 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 6392 5775 gene locus_tag LOCUS_10800 6392 5775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 7378 6389 gene locus_tag LOCUS_10810 7378 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 8089 7493 gene locus_tag LOCUS_10820 8089 7493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 10111 8297 gene locus_tag LOCUS_10830 gene dnaK 10111 8297 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_10830 11033 10173 gene locus_tag LOCUS_10840 11033 10173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 11197 13071 gene locus_tag LOCUS_10850 11197 13071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 13058 14014 gene locus_tag LOCUS_10860 13058 14014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 14038 15528 gene locus_tag LOCUS_10870 14038 15528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 15650 16180 gene locus_tag LOCUS_10880 15650 16180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 16330 19272 gene locus_tag LOCUS_10890 16330 19272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 20354 19473 gene locus_tag LOCUS_10900 20354 19473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 21819 20362 gene locus_tag LOCUS_10910 21819 20362 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_10910 22279 21878 gene locus_tag LOCUS_10920 gene mutT 22279 21878 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932370.1 protein_id gnl|my_center|LOCUS_10920 24831 22276 gene locus_tag LOCUS_10930 gene leuS 24831 22276 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938492.1 protein_id gnl|my_center|LOCUS_10930 26108 24939 gene locus_tag LOCUS_10940 26108 24939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 28599 26257 gene locus_tag LOCUS_10950 28599 26257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 28799 31435 gene locus_tag LOCUS_10960 28799 31435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 32449 31511 gene locus_tag LOCUS_10970 32449 31511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 32991 32779 gene locus_tag LOCUS_10980 32991 32779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 32914 34203 gene locus_tag LOCUS_10990 32914 34203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10990 33010 33109 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36313 34295 gene locus_tag LOCUS_11000 36313 34295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 38358 36775 gene locus_tag LOCUS_11010 38358 36775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 38702 38358 gene locus_tag LOCUS_11020 38702 38358 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867829.1 protein_id gnl|my_center|LOCUS_11020 39412 38699 gene locus_tag LOCUS_11030 39412 38699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 39986 39399 gene locus_tag LOCUS_11040 39986 39399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 40266 39976 gene locus_tag LOCUS_11050 40266 39976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 40517 40263 gene locus_tag LOCUS_11060 40517 40263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 40945 40514 gene locus_tag LOCUS_11070 40945 40514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 42413 41142 gene locus_tag LOCUS_11080 42413 41142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 43269 42433 gene locus_tag LOCUS_11090 43269 42433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 43758 43294 gene locus_tag LOCUS_11100 43758 43294 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207496.1 protein_id gnl|my_center|LOCUS_11100 44098 43763 gene locus_tag LOCUS_11110 44098 43763 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878370.1 protein_id gnl|my_center|LOCUS_11110 44363 44551 gene locus_tag LOCUS_11120 44363 44551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 44862 44560 gene locus_tag LOCUS_11130 44862 44560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 45067 44855 gene locus_tag LOCUS_11140 45067 44855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 45260 45646 gene locus_tag LOCUS_11150 45260 45646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 45873 45649 gene locus_tag LOCUS_11160 45873 45649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 46022 46669 gene locus_tag LOCUS_11170 46022 46669 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796792.1 protein_id gnl|my_center|LOCUS_11170 46716 49856 gene locus_tag LOCUS_11180 46716 49856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 50189 49992 gene locus_tag LOCUS_11190 50189 49992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 50158 50703 gene locus_tag LOCUS_11200 50158 50703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 51922 50774 gene locus_tag LOCUS_11210 51922 50774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 53208 51943 gene locus_tag LOCUS_11220 53208 51943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 53944 53216 gene locus_tag LOCUS_11230 53944 53216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 54334 54065 gene locus_tag LOCUS_11240 gene rpsO 54334 54065 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_11240 55323 54340 gene locus_tag LOCUS_11250 gene truB 55323 54340 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258869.1 protein_id gnl|my_center|LOCUS_11250 56306 55320 gene locus_tag LOCUS_11260 56306 55320 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_11260 56638 56303 gene locus_tag LOCUS_11270 56638 56303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 57133 56768 gene locus_tag LOCUS_11280 57133 56768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 57440 58198 gene locus_tag LOCUS_11290 57440 58198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 58226 60973 gene locus_tag LOCUS_11300 58226 60973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 60970 61461 gene locus_tag LOCUS_11310 60970 61461 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974912.1 protein_id gnl|my_center|LOCUS_11310 61536 61733 gene locus_tag LOCUS_11320 61536 61733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 62750 61743 gene locus_tag LOCUS_11330 62750 61743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 63862 62786 gene locus_tag LOCUS_11340 63862 62786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 64029 64751 gene locus_tag LOCUS_11350 64029 64751 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_11350 65097 65948 gene locus_tag LOCUS_11360 65097 65948 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939764.1 protein_id gnl|my_center|LOCUS_11360 65966 68563 gene locus_tag LOCUS_11370 gene clpB 65966 68563 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258977.1 protein_id gnl|my_center|LOCUS_11370 69602 68601 gene locus_tag LOCUS_11380 69602 68601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 70035 71090 gene locus_tag LOCUS_11390 70035 71090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 71159 74167 gene locus_tag LOCUS_11400 71159 74167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 74366 77104 gene locus_tag LOCUS_11410 74366 77104 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939279.1 protein_id gnl|my_center|LOCUS_11410 78767 77082 gene locus_tag LOCUS_11420 78767 77082 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_11420 79288 78764 gene locus_tag LOCUS_11430 79288 78764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 80941 79301 gene locus_tag LOCUS_11440 80941 79301 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256877.1 protein_id gnl|my_center|LOCUS_11440 81243 80938 gene locus_tag LOCUS_11450 81243 80938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 82805 81240 gene locus_tag LOCUS_11460 82805 81240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 84320 82818 gene locus_tag LOCUS_11470 84320 82818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 85009 84329 gene locus_tag LOCUS_11480 85009 84329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 85617 85063 gene locus_tag LOCUS_11490 85617 85063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 86648 85614 gene locus_tag LOCUS_11500 86648 85614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 86777 88129 gene locus_tag LOCUS_11510 gene mgtE 86777 88129 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003696042.1 protein_id gnl|my_center|LOCUS_11510 90638 88386 gene locus_tag LOCUS_11520 gene vpsO 90638 88386 CDS product exopolysaccharide regulatory tyrosine autokinase VpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_11520 91379 90744 gene locus_tag LOCUS_11530 91379 90744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 91660 91403 gene locus_tag LOCUS_11540 91660 91403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 91565 91807 gene locus_tag LOCUS_11550 91565 91807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 91840 93768 gene locus_tag LOCUS_11560 91840 93768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 93858 95168 gene locus_tag LOCUS_11570 93858 95168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 95165 96907 gene locus_tag LOCUS_11580 95165 96907 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_11580 97008 98195 gene locus_tag LOCUS_11590 97008 98195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 98209 98997 gene locus_tag LOCUS_11600 98209 98997 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_11600 99058 99462 gene locus_tag LOCUS_11610 99058 99462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 99552 99704 gene locus_tag LOCUS_11620 99552 99704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 99822 100067 gene locus_tag LOCUS_11630 gene rpmE 99822 100067 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_11630 100164 101198 gene locus_tag LOCUS_11640 100164 101198 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393875.1 protein_id gnl|my_center|LOCUS_11640 101200 102285 gene locus_tag LOCUS_11650 gene prfA 101200 102285 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940174.1 protein_id gnl|my_center|LOCUS_11650 102282 103094 gene locus_tag LOCUS_11660 102282 103094 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250866.1 protein_id gnl|my_center|LOCUS_11660 103179 104456 gene locus_tag LOCUS_11670 103179 104456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 104555 105892 gene locus_tag LOCUS_11680 104555 105892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 105908 106918 gene locus_tag LOCUS_11690 105908 106918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 107043 107142 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 108622 107168 gene locus_tag LOCUS_11700 108622 107168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 109406 108648 gene locus_tag LOCUS_11710 109406 108648 CDS product DtxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330364.1 protein_id gnl|my_center|LOCUS_11710 109506 110348 gene locus_tag LOCUS_11720 109506 110348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 111436 110345 gene locus_tag LOCUS_11730 111436 110345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 111570 112724 gene locus_tag LOCUS_11740 111570 112724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 114727 112925 gene locus_tag LOCUS_11750 114727 112925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 116596 114791 gene locus_tag LOCUS_11760 116596 114791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 117517 116756 gene locus_tag LOCUS_11770 117517 116756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 117756 118814 gene locus_tag LOCUS_11780 117756 118814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 118894 123171 gene locus_tag LOCUS_11790 118894 123171 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081484.1 protein_id gnl|my_center|LOCUS_11790 123173 124021 gene locus_tag LOCUS_11800 123173 124021 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671202.1 protein_id gnl|my_center|LOCUS_11800 124210 124740 gene locus_tag LOCUS_11810 124210 124740 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545215.1 protein_id gnl|my_center|LOCUS_11810 >Feature sequence09 3083 369 gene locus_tag LOCUS_11820 3083 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 3188 3931 gene locus_tag LOCUS_11830 3188 3931 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072260.1 protein_id gnl|my_center|LOCUS_11830 4415 3870 gene locus_tag LOCUS_11840 4415 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 4540 5655 gene locus_tag LOCUS_11850 4540 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 5655 6761 gene locus_tag LOCUS_11860 5655 6761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 7969 6884 gene locus_tag LOCUS_11870 7969 6884 CDS product TIGR04133 family radical SAM/SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803875.1 protein_id gnl|my_center|LOCUS_11870 8987 7980 gene locus_tag LOCUS_11880 8987 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 9116 10993 gene locus_tag LOCUS_11890 gene gor 9116 10993 CDS product glyceraldehyde-3-phosphate:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868698.1 protein_id gnl|my_center|LOCUS_11890 11045 11872 gene locus_tag LOCUS_11900 11045 11872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 11957 12988 gene locus_tag LOCUS_11910 gene queA 11957 12988 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943258.1 protein_id gnl|my_center|LOCUS_11910 12985 14139 gene locus_tag LOCUS_11920 gene tgt 12985 14139 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938027.1 protein_id gnl|my_center|LOCUS_11920 14136 15095 gene locus_tag LOCUS_11930 14136 15095 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529224.1 protein_id gnl|my_center|LOCUS_11930 15092 16465 gene locus_tag LOCUS_11940 15092 16465 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_11940 16475 17605 gene locus_tag LOCUS_11950 16475 17605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 17602 18105 gene locus_tag LOCUS_11960 17602 18105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 18139 18238 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19501 18239 gene locus_tag LOCUS_11970 19501 18239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 20223 19441 gene locus_tag LOCUS_11980 20223 19441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 21653 20220 gene locus_tag LOCUS_11990 21653 20220 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970033.1 protein_id gnl|my_center|LOCUS_11990 21879 24365 gene locus_tag LOCUS_12000 21879 24365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 24352 24726 gene locus_tag LOCUS_12010 24352 24726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 24812 25240 gene locus_tag LOCUS_12020 24812 25240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 25240 26484 gene locus_tag LOCUS_12030 25240 26484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 26494 28014 gene locus_tag LOCUS_12040 26494 28014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 31961 28323 gene locus_tag LOCUS_12050 31961 28323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 34396 31958 gene locus_tag LOCUS_12060 34396 31958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 34853 34368 gene locus_tag LOCUS_12070 34853 34368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 35221 34850 gene locus_tag LOCUS_12080 35221 34850 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921050.1 protein_id gnl|my_center|LOCUS_12080 36660 35254 gene locus_tag LOCUS_12090 36660 35254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 39765 36679 gene locus_tag LOCUS_12100 39765 36679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 40128 39778 gene locus_tag LOCUS_12110 40128 39778 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942666.1 protein_id gnl|my_center|LOCUS_12110 40317 40466 gene locus_tag LOCUS_12120 gene rpmH 40317 40466 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958535.1 protein_id gnl|my_center|LOCUS_12120 40487 40870 gene locus_tag LOCUS_12130 gene rnpA 40487 40870 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528505.1 protein_id gnl|my_center|LOCUS_12130 40867 43125 gene locus_tag LOCUS_12140 40867 43125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 43112 44419 gene locus_tag LOCUS_12150 gene mnmE 43112 44419 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887659.1 protein_id gnl|my_center|LOCUS_12150 44498 44968 gene locus_tag LOCUS_12160 gene ribE 44498 44968 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942334.1 protein_id gnl|my_center|LOCUS_12160 44965 45420 gene locus_tag LOCUS_12170 gene nusB 44965 45420 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326965.1 protein_id gnl|my_center|LOCUS_12170 45389 47227 gene locus_tag LOCUS_12180 45389 47227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 47270 48097 gene locus_tag LOCUS_12190 gene amrB 47270 48097 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545930.1 protein_id gnl|my_center|LOCUS_12190 48094 48945 gene locus_tag LOCUS_12200 gene pssA 48094 48945 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940239.1 protein_id gnl|my_center|LOCUS_12200 48942 49847 gene locus_tag LOCUS_12210 48942 49847 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085244.1 protein_id gnl|my_center|LOCUS_12210 49840 52062 gene locus_tag LOCUS_12220 49840 52062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 52198 53883 gene locus_tag LOCUS_12230 52198 53883 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229331.1 protein_id gnl|my_center|LOCUS_12230 53941 54432 gene locus_tag LOCUS_12240 53941 54432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 54487 54750 gene locus_tag LOCUS_12250 54487 54750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 54766 55329 gene locus_tag LOCUS_12260 54766 55329 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523374.1 protein_id gnl|my_center|LOCUS_12260 55392 58307 gene locus_tag LOCUS_12270 55392 58307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 58475 58846 gene locus_tag LOCUS_12280 gene rplS 58475 58846 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564764.1 protein_id gnl|my_center|LOCUS_12280 58907 60910 gene locus_tag LOCUS_12290 58907 60910 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141615.1 protein_id gnl|my_center|LOCUS_12290 60912 62267 gene locus_tag LOCUS_12300 60912 62267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 64367 62283 gene locus_tag LOCUS_12310 64367 62283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 66277 64409 gene locus_tag LOCUS_12320 66277 64409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 66929 66429 gene locus_tag LOCUS_12330 66929 66429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 68269 66926 gene locus_tag LOCUS_12340 68269 66926 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175182.1 protein_id gnl|my_center|LOCUS_12340 70171 68420 gene locus_tag LOCUS_12350 70171 68420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 70284 71129 gene locus_tag LOCUS_12360 70284 71129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 73497 71131 gene locus_tag LOCUS_12370 73497 71131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 73644 75047 gene locus_tag LOCUS_12380 73644 75047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 75786 75145 gene locus_tag LOCUS_12390 75786 75145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 76543 75800 gene locus_tag LOCUS_12400 76543 75800 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_12400 77883 76627 gene locus_tag LOCUS_12410 77883 76627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 78444 79040 gene locus_tag LOCUS_12420 78444 79040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 80889 79045 gene locus_tag LOCUS_12430 80889 79045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 81054 82280 gene locus_tag LOCUS_12440 81054 82280 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986808.1 protein_id gnl|my_center|LOCUS_12440 84491 82290 gene locus_tag LOCUS_12450 84491 82290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 85263 84640 gene locus_tag LOCUS_12460 85263 84640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 85934 85269 gene locus_tag LOCUS_12470 85934 85269 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283612.1 protein_id gnl|my_center|LOCUS_12470 86808 85963 gene locus_tag LOCUS_12480 86808 85963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 87262 86861 gene locus_tag LOCUS_12490 87262 86861 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027487.1 protein_id gnl|my_center|LOCUS_12490 87490 87356 gene locus_tag LOCUS_12500 87490 87356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 88603 87494 gene locus_tag LOCUS_12510 88603 87494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 88676 89179 gene locus_tag LOCUS_12520 88676 89179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 89247 91211 gene locus_tag LOCUS_12530 gene iorA 89247 91211 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939237.1 protein_id gnl|my_center|LOCUS_12530 91208 91810 gene locus_tag LOCUS_12540 91208 91810 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869131.1 protein_id gnl|my_center|LOCUS_12540 91843 92766 gene locus_tag LOCUS_12550 91843 92766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 92763 93104 gene locus_tag LOCUS_12560 92763 93104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 94020 93079 gene locus_tag LOCUS_12570 94020 93079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 94176 95804 gene locus_tag LOCUS_12580 gene pruA 94176 95804 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404266.1 protein_id gnl|my_center|LOCUS_12580 95974 96813 gene locus_tag LOCUS_12590 95974 96813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 96918 97844 gene locus_tag LOCUS_12600 96918 97844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 97859 100084 gene locus_tag LOCUS_12610 97859 100084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 102008 100098 gene locus_tag LOCUS_12620 102008 100098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 102600 102031 gene locus_tag LOCUS_12630 102600 102031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 103033 102701 gene locus_tag LOCUS_12640 103033 102701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 103211 103894 gene locus_tag LOCUS_12650 103211 103894 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970102.1 protein_id gnl|my_center|LOCUS_12650 104296 103898 gene locus_tag LOCUS_12660 104296 103898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 104854 104315 gene locus_tag LOCUS_12670 104854 104315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 107429 104877 gene locus_tag LOCUS_12680 107429 104877 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_12680 108296 107463 gene locus_tag LOCUS_12690 108296 107463 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306772.1 protein_id gnl|my_center|LOCUS_12690 109305 108334 gene locus_tag LOCUS_12700 109305 108334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence10 98 532 gene locus_tag LOCUS_12710 98 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 2175 433 gene locus_tag LOCUS_12720 2175 433 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918506.1 protein_id gnl|my_center|LOCUS_12720 2617 3114 gene locus_tag LOCUS_12730 2617 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 3478 3963 gene locus_tag LOCUS_12740 3478 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 5511 4048 gene locus_tag LOCUS_12750 gene guaB 5511 4048 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_12750 6372 5542 gene locus_tag LOCUS_12760 6372 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 6638 7480 gene locus_tag LOCUS_12770 6638 7480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 7606 9486 gene locus_tag LOCUS_12780 7606 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 9554 10468 gene locus_tag LOCUS_12790 9554 10468 CDS product reductive dehalogenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889925.1 protein_id gnl|my_center|LOCUS_12790 10465 11892 gene locus_tag LOCUS_12800 10465 11892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 11942 12565 gene locus_tag LOCUS_12810 11942 12565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 14950 12587 gene locus_tag LOCUS_12820 14950 12587 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869170.1 protein_id gnl|my_center|LOCUS_12820 15413 14937 gene locus_tag LOCUS_12830 15413 14937 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975049.1 protein_id gnl|my_center|LOCUS_12830 16334 15423 gene locus_tag LOCUS_12840 16334 15423 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869168.1 protein_id gnl|my_center|LOCUS_12840 17184 16366 gene locus_tag LOCUS_12850 17184 16366 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869167.1 protein_id gnl|my_center|LOCUS_12850 18621 17209 gene locus_tag LOCUS_12860 18621 17209 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393611.1 protein_id gnl|my_center|LOCUS_12860 20192 18627 gene locus_tag LOCUS_12870 gene fdrA 20192 18627 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393612.1 protein_id gnl|my_center|LOCUS_12870 21039 20194 gene locus_tag LOCUS_12880 21039 20194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 22486 21176 gene locus_tag LOCUS_12890 22486 21176 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860380.1 protein_id gnl|my_center|LOCUS_12890 25829 23136 gene locus_tag LOCUS_12900 25829 23136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 26854 26009 gene locus_tag LOCUS_12910 26854 26009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 27884 26847 gene locus_tag LOCUS_12920 27884 26847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 29146 28091 gene locus_tag LOCUS_12930 gene yddG 29146 28091 CDS product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167123.1 protein_id gnl|my_center|LOCUS_12930 29274 30296 gene locus_tag LOCUS_12940 29274 30296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 30343 30912 gene locus_tag LOCUS_12950 30343 30912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 30970 31353 gene locus_tag LOCUS_12960 30970 31353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 33229 31319 gene locus_tag LOCUS_12970 33229 31319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 35655 33286 gene locus_tag LOCUS_12980 35655 33286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 38178 35779 gene locus_tag LOCUS_12990 38178 35779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 38586 38242 gene locus_tag LOCUS_13000 38586 38242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 39357 38590 gene locus_tag LOCUS_13010 39357 38590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 42288 39364 gene locus_tag LOCUS_13020 42288 39364 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946456.1 protein_id gnl|my_center|LOCUS_13020 42798 42322 gene locus_tag LOCUS_13030 42798 42322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 43125 42871 gene locus_tag LOCUS_13040 gene rpsP 43125 42871 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071566.1 protein_id gnl|my_center|LOCUS_13040 43485 45422 gene locus_tag LOCUS_13050 43485 45422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 46984 45656 gene locus_tag LOCUS_13060 46984 45656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 48374 47043 gene locus_tag LOCUS_13070 gene wbpA 48374 47043 CDS product UDP-N-acetyl-D-glucosamine 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113429.1 protein_id gnl|my_center|LOCUS_13070 49098 48448 gene locus_tag LOCUS_13080 gene lexA 49098 48448 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_13080 49311 50108 gene locus_tag LOCUS_13090 49311 50108 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_13090 50113 51039 gene locus_tag LOCUS_13100 50113 51039 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_13100 51036 51890 gene locus_tag LOCUS_13110 gene folD 51036 51890 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811948.1 protein_id gnl|my_center|LOCUS_13110 52095 54293 gene locus_tag LOCUS_13120 52095 54293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 54591 56759 gene locus_tag LOCUS_13130 54591 56759 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787253.1 protein_id gnl|my_center|LOCUS_13130 57593 57012 gene locus_tag LOCUS_13140 57593 57012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 59554 57590 gene locus_tag LOCUS_13150 59554 57590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 61470 59551 gene locus_tag LOCUS_13160 61470 59551 CDS product DUF3857 and transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108263.1 protein_id gnl|my_center|LOCUS_13160 61503 63080 gene locus_tag LOCUS_13170 61503 63080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 63651 63301 gene locus_tag LOCUS_13180 63651 63301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 63835 65535 gene locus_tag LOCUS_13190 63835 65535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 65596 67437 gene locus_tag LOCUS_13200 65596 67437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 67434 68174 gene locus_tag LOCUS_13210 67434 68174 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259513.1 protein_id gnl|my_center|LOCUS_13210 68579 68187 gene locus_tag LOCUS_13220 68579 68187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 75963 68599 gene locus_tag LOCUS_13230 75963 68599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 78441 76261 gene locus_tag LOCUS_13240 78441 76261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 78606 78956 gene locus_tag LOCUS_13250 78606 78956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 79018 79092 gene locus_tag LOCUS_t00200 79018 79092 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 79194 79781 gene locus_tag LOCUS_13260 79194 79781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 80902 79784 gene locus_tag LOCUS_13270 80902 79784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 82206 80941 gene locus_tag LOCUS_13280 82206 80941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 84211 82295 gene locus_tag LOCUS_13290 84211 82295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 84355 85416 gene locus_tag LOCUS_13300 84355 85416 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417210.1 protein_id gnl|my_center|LOCUS_13300 85413 86060 gene locus_tag LOCUS_13310 85413 86060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 86139 87164 gene locus_tag LOCUS_13320 86139 87164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 87393 87617 gene locus_tag LOCUS_13330 87393 87617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 87614 87802 gene locus_tag LOCUS_13340 87614 87802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 88108 88578 gene locus_tag LOCUS_13350 88108 88578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 88575 90275 gene locus_tag LOCUS_13360 88575 90275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 90569 91003 gene locus_tag LOCUS_13370 90569 91003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 90996 91346 gene locus_tag LOCUS_13380 90996 91346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 91346 91585 gene locus_tag LOCUS_13390 91346 91585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 91588 91974 gene locus_tag LOCUS_13400 91588 91974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 91977 92204 gene locus_tag LOCUS_13410 91977 92204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 92617 93804 gene locus_tag LOCUS_13420 92617 93804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 93995 96967 gene locus_tag LOCUS_13430 93995 96967 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_13430 98381 97038 gene locus_tag LOCUS_13440 gene gdhA 98381 97038 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_13440 98604 100802 gene locus_tag LOCUS_13450 98604 100802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 100878 101171 gene locus_tag LOCUS_13460 100878 101171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 101874 101245 gene locus_tag LOCUS_13470 101874 101245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 102131 103132 gene locus_tag LOCUS_13480 102131 103132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 103248 104471 gene locus_tag LOCUS_13490 103248 104471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 104594 106273 gene locus_tag LOCUS_13500 104594 106273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 107410 106283 gene locus_tag LOCUS_13510 107410 106283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 108799 107489 gene locus_tag LOCUS_13520 gene glgC 108799 107489 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227648.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence11 265 534 gene locus_tag LOCUS_13530 265 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 3093 535 gene locus_tag LOCUS_13540 3093 535 CDS product chromosome condensation regulator RCC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258200.1 protein_id gnl|my_center|LOCUS_13540 3337 3978 gene locus_tag LOCUS_13550 3337 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 4647 3985 gene locus_tag LOCUS_13560 4647 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 5903 4833 gene locus_tag LOCUS_13570 5903 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 7296 5884 gene locus_tag LOCUS_13580 gene atoC 7296 5884 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125283.1 protein_id gnl|my_center|LOCUS_13580 8255 7293 gene locus_tag LOCUS_13590 8255 7293 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792172.1 protein_id gnl|my_center|LOCUS_13590 9655 8261 gene locus_tag LOCUS_13600 gene purF 9655 8261 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_13600 10596 9685 gene locus_tag LOCUS_13610 10596 9685 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681898.1 protein_id gnl|my_center|LOCUS_13610 11921 10644 gene locus_tag LOCUS_13620 gene purB 11921 10644 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080360.1 protein_id gnl|my_center|LOCUS_13620 12160 14151 gene locus_tag LOCUS_13630 12160 14151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 14148 14690 gene locus_tag LOCUS_13640 14148 14690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 14687 16198 gene locus_tag LOCUS_13650 14687 16198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 17197 16202 gene locus_tag LOCUS_13660 17197 16202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 17961 17194 gene locus_tag LOCUS_13670 17961 17194 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728822.1 protein_id gnl|my_center|LOCUS_13670 19835 17958 gene locus_tag LOCUS_13680 19835 17958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 20472 20188 gene locus_tag LOCUS_13690 20472 20188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 20943 21278 gene locus_tag LOCUS_13700 20943 21278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 21880 22311 gene locus_tag LOCUS_13710 21880 22311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 22525 25155 gene locus_tag LOCUS_13720 22525 25155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039747.1 protein_id gnl|my_center|LOCUS_13720 25137 26309 gene locus_tag LOCUS_13730 25137 26309 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039748.1 protein_id gnl|my_center|LOCUS_13730 26792 27523 gene locus_tag LOCUS_13740 26792 27523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 27666 28295 gene locus_tag LOCUS_13750 27666 28295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 28302 31541 gene locus_tag LOCUS_13760 28302 31541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 31670 32599 gene locus_tag LOCUS_13770 31670 32599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 32691 33416 gene locus_tag LOCUS_13780 32691 33416 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228853.1 protein_id gnl|my_center|LOCUS_13780 33413 34441 gene locus_tag LOCUS_13790 33413 34441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 34438 37902 gene locus_tag LOCUS_13800 gene mfd 34438 37902 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_13800 37963 39246 gene locus_tag LOCUS_13810 37963 39246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 39301 40464 gene locus_tag LOCUS_13820 39301 40464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 40477 41457 gene locus_tag LOCUS_13830 40477 41457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 41548 42243 gene locus_tag LOCUS_13840 41548 42243 CDS product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723825.1 protein_id gnl|my_center|LOCUS_13840 42293 43066 gene locus_tag LOCUS_13850 42293 43066 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394583.1 protein_id gnl|my_center|LOCUS_13850 43081 44202 gene locus_tag LOCUS_13860 gene dnaJ 43081 44202 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940501.1 protein_id gnl|my_center|LOCUS_13860 44335 47487 gene locus_tag LOCUS_13870 44335 47487 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224245890.1 protein_id gnl|my_center|LOCUS_13870 47553 48590 gene locus_tag LOCUS_13880 47553 48590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 48612 53909 gene locus_tag LOCUS_13890 48612 53909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 53947 55134 gene locus_tag LOCUS_13900 53947 55134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 56927 55224 gene locus_tag LOCUS_13910 56927 55224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 57584 57006 gene locus_tag LOCUS_13920 57584 57006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 57769 58230 gene locus_tag LOCUS_13930 57769 58230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 58236 59261 gene locus_tag LOCUS_13940 58236 59261 CDS product putative manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439447.1 protein_id gnl|my_center|LOCUS_13940 59350 60561 gene locus_tag LOCUS_13950 59350 60561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 61602 60583 gene locus_tag LOCUS_13960 61602 60583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 62300 61602 gene locus_tag LOCUS_13970 62300 61602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 62765 62400 gene locus_tag LOCUS_13980 62765 62400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 63705 62743 gene locus_tag LOCUS_13990 63705 62743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 64690 63728 gene locus_tag LOCUS_14000 64690 63728 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262600.1 protein_id gnl|my_center|LOCUS_14000 64748 65914 gene locus_tag LOCUS_14010 64748 65914 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898036.1 protein_id gnl|my_center|LOCUS_14010 65911 67245 gene locus_tag LOCUS_14020 gene tilS 65911 67245 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_14020 67318 67755 gene locus_tag LOCUS_14030 67318 67755 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143557.1 protein_id gnl|my_center|LOCUS_14030 69496 67766 gene locus_tag LOCUS_14040 69496 67766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 70547 69519 gene locus_tag LOCUS_14050 70547 69519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 70845 70588 gene locus_tag LOCUS_14060 70845 70588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986424.1 protein_id gnl|my_center|LOCUS_14060 72226 70865 gene locus_tag LOCUS_14070 72226 70865 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965302.1 protein_id gnl|my_center|LOCUS_14070 73196 72264 gene locus_tag LOCUS_14080 73196 72264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 75804 73231 gene locus_tag LOCUS_14090 75804 73231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 75999 76946 gene locus_tag LOCUS_14100 75999 76946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 77817 76996 gene locus_tag LOCUS_14110 77817 76996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 79889 77892 gene locus_tag LOCUS_14120 79889 77892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 82425 79942 gene locus_tag LOCUS_14130 82425 79942 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_14130 82541 82801 gene locus_tag LOCUS_14140 82541 82801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 82828 83328 gene locus_tag LOCUS_14150 82828 83328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 83983 83333 gene locus_tag LOCUS_14160 83983 83333 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940552.1 protein_id gnl|my_center|LOCUS_14160 84199 87003 gene locus_tag LOCUS_14170 84199 87003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 87151 88818 gene locus_tag LOCUS_14180 87151 88818 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791319.1 protein_id gnl|my_center|LOCUS_14180 89564 88815 gene locus_tag LOCUS_14190 89564 88815 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992233.1 protein_id gnl|my_center|LOCUS_14190 90512 89589 gene locus_tag LOCUS_14200 90512 89589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 91423 90620 gene locus_tag LOCUS_14210 91423 90620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 91684 92598 gene locus_tag LOCUS_14220 91684 92598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 92632 94797 gene locus_tag LOCUS_14230 92632 94797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 96099 94801 gene locus_tag LOCUS_14240 96099 94801 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_14240 98354 96168 gene locus_tag LOCUS_14250 98354 96168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 100008 98374 gene locus_tag LOCUS_14260 100008 98374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 100718 100008 gene locus_tag LOCUS_14270 100718 100008 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903416.1 protein_id gnl|my_center|LOCUS_14270 101469 100774 gene locus_tag LOCUS_14280 101469 100774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 101453 101605 gene locus_tag LOCUS_14290 101453 101605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 102106 101615 gene locus_tag LOCUS_14300 102106 101615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 102605 102141 gene locus_tag LOCUS_14310 102605 102141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 103849 102605 gene locus_tag LOCUS_14320 gene ablA 103849 102605 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence12 148 1647 gene locus_tag LOCUS_14330 148 1647 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257549.1 protein_id gnl|my_center|LOCUS_14330 1640 4333 gene locus_tag LOCUS_14340 gene gyrA 1640 4333 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210821.1 protein_id gnl|my_center|LOCUS_14340 4429 4677 gene locus_tag LOCUS_14350 4429 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 4674 6206 gene locus_tag LOCUS_14360 4674 6206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 6203 6745 gene locus_tag LOCUS_14370 6203 6745 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142877.1 protein_id gnl|my_center|LOCUS_14370 6764 7696 gene locus_tag LOCUS_14380 6764 7696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 7758 8474 gene locus_tag LOCUS_14390 7758 8474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 9046 8495 gene locus_tag LOCUS_14400 9046 8495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 9084 9183 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10222 10557 gene locus_tag LOCUS_14410 10222 10557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 12958 10826 gene locus_tag LOCUS_14420 12958 10826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 13659 12955 gene locus_tag LOCUS_14430 13659 12955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 14546 13656 gene locus_tag LOCUS_14440 14546 13656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 14666 16246 gene locus_tag LOCUS_14450 14666 16246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 16464 17375 gene locus_tag LOCUS_14460 16464 17375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 17821 17588 gene locus_tag LOCUS_14470 17821 17588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 19977 17965 gene locus_tag LOCUS_14480 gene metG 19977 17965 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072568.1 protein_id gnl|my_center|LOCUS_14480 21411 20269 gene locus_tag LOCUS_14490 21411 20269 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393452.1 protein_id gnl|my_center|LOCUS_14490 21568 22611 gene locus_tag LOCUS_14500 gene ftcD 21568 22611 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791589.1 protein_id gnl|my_center|LOCUS_14500 22662 23315 gene locus_tag LOCUS_14510 22662 23315 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666838.1 protein_id gnl|my_center|LOCUS_14510 23312 24169 gene locus_tag LOCUS_14520 23312 24169 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208036286.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14520 24174 24941 gene locus_tag LOCUS_14530 gene surE 24174 24941 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_14530 24938 25867 gene locus_tag LOCUS_14540 24938 25867 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458367.1 protein_id gnl|my_center|LOCUS_14540 25864 26391 gene locus_tag LOCUS_14550 25864 26391 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944687.1 protein_id gnl|my_center|LOCUS_14550 26411 26737 gene locus_tag LOCUS_14560 26411 26737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939234.1 protein_id gnl|my_center|LOCUS_14560 26727 27203 gene locus_tag LOCUS_14570 26727 27203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 27371 28585 gene locus_tag LOCUS_14580 27371 28585 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392999.1 protein_id gnl|my_center|LOCUS_14580 31270 28589 gene locus_tag LOCUS_14590 gene alaS 31270 28589 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931860.1 protein_id gnl|my_center|LOCUS_14590 32343 31297 gene locus_tag LOCUS_14600 gene ychF 32343 31297 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948354.1 protein_id gnl|my_center|LOCUS_14600 33069 32374 gene locus_tag LOCUS_14610 33069 32374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 35014 33125 gene locus_tag LOCUS_14620 35014 33125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 35493 36200 gene locus_tag LOCUS_14630 35493 36200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 36971 36210 gene locus_tag LOCUS_14640 36971 36210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 37259 36990 gene locus_tag LOCUS_14650 37259 36990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 37578 38069 gene locus_tag LOCUS_14660 37578 38069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 38051 39502 gene locus_tag LOCUS_14670 38051 39502 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_14670 39489 39722 gene locus_tag LOCUS_14680 39489 39722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 41225 39813 gene locus_tag LOCUS_14690 41225 39813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 42562 41222 gene locus_tag LOCUS_14700 gene fliI 42562 41222 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_14700 43238 42543 gene locus_tag LOCUS_14710 43238 42543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 44167 43235 gene locus_tag LOCUS_14720 gene nadA 44167 43235 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546803.1 protein_id gnl|my_center|LOCUS_14720 45178 44222 gene locus_tag LOCUS_14730 45178 44222 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065037.1 protein_id gnl|my_center|LOCUS_14730 45344 47419 gene locus_tag LOCUS_14740 45344 47419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 47463 47810 gene locus_tag LOCUS_14750 47463 47810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 47838 48323 gene locus_tag LOCUS_14760 47838 48323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 48397 49719 gene locus_tag LOCUS_14770 48397 49719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 49751 50452 gene locus_tag LOCUS_14780 49751 50452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 50459 51331 gene locus_tag LOCUS_14790 50459 51331 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392232.1 protein_id gnl|my_center|LOCUS_14790 51328 52875 gene locus_tag LOCUS_14800 51328 52875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 53143 53919 gene locus_tag LOCUS_14810 53143 53919 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877512.1 protein_id gnl|my_center|LOCUS_14810 53923 54207 gene locus_tag LOCUS_14820 53923 54207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 54211 55992 gene locus_tag LOCUS_14830 gene oadA 54211 55992 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020719.1 protein_id gnl|my_center|LOCUS_14830 56003 57160 gene locus_tag LOCUS_14840 56003 57160 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_14840 57366 57935 gene locus_tag LOCUS_14850 57366 57935 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817289.1 protein_id gnl|my_center|LOCUS_14850 57951 58280 gene locus_tag LOCUS_14860 57951 58280 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719341.1 protein_id gnl|my_center|LOCUS_14860 58576 59070 gene locus_tag LOCUS_14870 58576 59070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 59067 59909 gene locus_tag LOCUS_14880 59067 59909 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_14880 60022 62634 gene locus_tag LOCUS_14890 60022 62634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 62726 63145 gene locus_tag LOCUS_14900 62726 63145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 63142 63564 gene locus_tag LOCUS_14910 63142 63564 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021853.1 protein_id gnl|my_center|LOCUS_14910 64819 63725 gene locus_tag LOCUS_14920 64819 63725 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101591.1 protein_id gnl|my_center|LOCUS_14920 65294 64908 gene locus_tag LOCUS_14930 65294 64908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 65548 65282 gene locus_tag LOCUS_14940 65548 65282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 66035 65538 gene locus_tag LOCUS_14950 gene rpoE 66035 65538 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914074.1 protein_id gnl|my_center|LOCUS_14950 68093 66255 gene locus_tag LOCUS_14960 68093 66255 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037425.1 protein_id gnl|my_center|LOCUS_14960 69812 68097 gene locus_tag LOCUS_14970 69812 68097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 71103 69817 gene locus_tag LOCUS_14980 gene tyrS 71103 69817 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332625.1 protein_id gnl|my_center|LOCUS_14980 74010 71137 gene locus_tag LOCUS_14990 74010 71137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 74798 74007 gene locus_tag LOCUS_15000 74798 74007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 74692 75084 gene locus_tag LOCUS_15010 74692 75084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 77140 75029 gene locus_tag LOCUS_15020 77140 75029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 77518 78819 gene locus_tag LOCUS_15030 gene dnaA 77518 78819 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945763.1 protein_id gnl|my_center|LOCUS_15030 80176 78926 gene locus_tag LOCUS_15040 80176 78926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 80537 80235 gene locus_tag LOCUS_15050 80537 80235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 80564 81652 gene locus_tag LOCUS_15060 80564 81652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 83303 81681 gene locus_tag LOCUS_15070 83303 81681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 83476 86910 gene locus_tag LOCUS_15080 83476 86910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 86903 90316 gene locus_tag LOCUS_15090 86903 90316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 90313 92241 gene locus_tag LOCUS_15100 90313 92241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 92313 94889 gene locus_tag LOCUS_15110 92313 94889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 96515 94905 gene locus_tag LOCUS_15120 96515 94905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 97450 96512 gene locus_tag LOCUS_15130 97450 96512 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113004.1 protein_id gnl|my_center|LOCUS_15130 97642 98535 gene locus_tag LOCUS_15140 gene galU 97642 98535 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941523.1 protein_id gnl|my_center|LOCUS_15140 98532 100904 gene locus_tag LOCUS_15150 98532 100904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence13 1253 117 gene locus_tag LOCUS_15160 gene scfB 1253 117 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462310.1 protein_id gnl|my_center|LOCUS_15160 2236 1250 gene locus_tag LOCUS_15170 2236 1250 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838603.1 protein_id gnl|my_center|LOCUS_15170 2452 3219 gene locus_tag LOCUS_15180 2452 3219 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235485.1 protein_id gnl|my_center|LOCUS_15180 3216 5315 gene locus_tag LOCUS_15190 3216 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 8629 5420 gene locus_tag LOCUS_15200 8629 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 9274 8720 gene locus_tag LOCUS_15210 9274 8720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 10775 9285 gene locus_tag LOCUS_15220 10775 9285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 10977 11243 gene locus_tag LOCUS_15230 10977 11243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 11292 11825 gene locus_tag LOCUS_15240 11292 11825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 11822 12517 gene locus_tag LOCUS_15250 11822 12517 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795919.1 protein_id gnl|my_center|LOCUS_15250 12514 14265 gene locus_tag LOCUS_15260 12514 14265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 14331 15929 gene locus_tag LOCUS_15270 14331 15929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 15926 16315 gene locus_tag LOCUS_15280 15926 16315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 16312 18729 gene locus_tag LOCUS_15290 16312 18729 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225895010.1 protein_id gnl|my_center|LOCUS_15290 18824 21271 gene locus_tag LOCUS_15300 18824 21271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 protein_id gnl|my_center|LOCUS_15300 23953 21299 gene locus_tag LOCUS_15310 gene mutS 23953 21299 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_15310 24341 23925 gene locus_tag LOCUS_15320 24341 23925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 25648 24338 gene locus_tag LOCUS_15330 gene ssnA 25648 24338 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706028.1 protein_id gnl|my_center|LOCUS_15330 27138 25630 gene locus_tag LOCUS_15340 gene hydA 27138 25630 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030900.1 protein_id gnl|my_center|LOCUS_15340 27287 29446 gene locus_tag LOCUS_15350 27287 29446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 29457 30416 gene locus_tag LOCUS_15360 29457 30416 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_15360 30539 31864 gene locus_tag LOCUS_15370 30539 31864 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_15370 31989 33062 gene locus_tag LOCUS_15380 31989 33062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 33633 34601 gene locus_tag LOCUS_15390 33633 34601 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401697.1 protein_id gnl|my_center|LOCUS_15390 34626 36188 gene locus_tag LOCUS_15400 34626 36188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 36203 37678 gene locus_tag LOCUS_15410 36203 37678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 37678 38664 gene locus_tag LOCUS_15420 37678 38664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 38667 39923 gene locus_tag LOCUS_15430 38667 39923 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224485.1 protein_id gnl|my_center|LOCUS_15430 40201 40533 gene locus_tag LOCUS_15440 40201 40533 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942767.1 protein_id gnl|my_center|LOCUS_15440 40760 40452 gene locus_tag LOCUS_15450 40760 40452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 40642 41274 gene locus_tag LOCUS_15460 40642 41274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 41315 43606 gene locus_tag LOCUS_15470 41315 43606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 43603 44226 gene locus_tag LOCUS_15480 gene rnhB 43603 44226 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876654.1 protein_id gnl|my_center|LOCUS_15480 44323 45282 gene locus_tag LOCUS_15490 44323 45282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 46353 45292 gene locus_tag LOCUS_15500 46353 45292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 49430 46350 gene locus_tag LOCUS_15510 49430 46350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 50280 49462 gene locus_tag LOCUS_15520 50280 49462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 51944 50277 gene locus_tag LOCUS_15530 51944 50277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 52789 51989 gene locus_tag LOCUS_15540 gene zupT 52789 51989 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861091.1 protein_id gnl|my_center|LOCUS_15540 52974 53420 gene locus_tag LOCUS_15550 52974 53420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 53454 53612 gene locus_tag LOCUS_15560 53454 53612 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869872.1 protein_id gnl|my_center|LOCUS_15560 53636 54193 gene locus_tag LOCUS_15570 53636 54193 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_15570 54235 54753 gene locus_tag LOCUS_15580 54235 54753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 56016 54994 gene locus_tag LOCUS_15590 56016 54994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 56750 56013 gene locus_tag LOCUS_15600 gene cps4B 56750 56013 CDS product capsular polysaccharide biosynthesis protein Cps4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922734.1 protein_id gnl|my_center|LOCUS_15600 57231 56764 gene locus_tag LOCUS_15610 57231 56764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 57403 58323 gene locus_tag LOCUS_15620 57403 58323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 59940 58405 gene locus_tag LOCUS_15630 59940 58405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 61180 59960 gene locus_tag LOCUS_15640 gene add 61180 59960 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838307.1 protein_id gnl|my_center|LOCUS_15640 62120 61206 gene locus_tag LOCUS_15650 62120 61206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 62285 63163 gene locus_tag LOCUS_15660 62285 63163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 64340 63708 gene locus_tag LOCUS_15670 64340 63708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 65366 64344 gene locus_tag LOCUS_15680 65366 64344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 66261 65374 gene locus_tag LOCUS_15690 66261 65374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 66605 66240 gene locus_tag LOCUS_15700 66605 66240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 68033 66627 gene locus_tag LOCUS_15710 68033 66627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 68172 69596 gene locus_tag LOCUS_15720 68172 69596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 69707 69976 gene locus_tag LOCUS_15730 69707 69976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 69984 70682 gene locus_tag LOCUS_15740 69984 70682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 73586 70731 gene locus_tag LOCUS_15750 73586 70731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 73760 73687 gene locus_tag LOCUS_t00210 73760 73687 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 73937 75859 gene locus_tag LOCUS_15760 73937 75859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 75876 76391 gene locus_tag LOCUS_15770 75876 76391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 76385 77431 gene locus_tag LOCUS_15780 76385 77431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 77481 80225 gene locus_tag LOCUS_15790 77481 80225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 80408 82312 gene locus_tag LOCUS_15800 80408 82312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 82305 86165 gene locus_tag LOCUS_15810 82305 86165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 86328 87254 gene locus_tag LOCUS_15820 86328 87254 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_15820 87360 87638 gene locus_tag LOCUS_15830 gene ihfA 87360 87638 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300715.1 protein_id gnl|my_center|LOCUS_15830 87673 88884 gene locus_tag LOCUS_15840 87673 88884 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673537.1 protein_id gnl|my_center|LOCUS_15840 88959 89300 gene locus_tag LOCUS_15850 88959 89300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence14 374 808 gene locus_tag LOCUS_15860 374 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 823 1299 gene locus_tag LOCUS_15870 823 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 2792 1422 gene locus_tag LOCUS_15880 2792 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 3558 2995 gene locus_tag LOCUS_15890 3558 2995 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840180.1 protein_id gnl|my_center|LOCUS_15890 4112 3579 gene locus_tag LOCUS_15900 4112 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 4893 4099 gene locus_tag LOCUS_15910 4893 4099 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057759.1 protein_id gnl|my_center|LOCUS_15910 5936 4890 gene locus_tag LOCUS_15920 5936 4890 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144194.1 protein_id gnl|my_center|LOCUS_15920 7966 5942 gene locus_tag LOCUS_15930 7966 5942 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964061.1 protein_id gnl|my_center|LOCUS_15930 8211 16226 gene locus_tag LOCUS_15940 8211 16226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 16231 17394 gene locus_tag LOCUS_15950 16231 17394 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939838.1 protein_id gnl|my_center|LOCUS_15950 19791 17407 gene locus_tag LOCUS_15960 19791 17407 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720592.1 protein_id gnl|my_center|LOCUS_15960 20778 19825 gene locus_tag LOCUS_15970 20778 19825 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_15970 21849 20815 gene locus_tag LOCUS_15980 21849 20815 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262600.1 protein_id gnl|my_center|LOCUS_15980 23342 21864 gene locus_tag LOCUS_15990 gene glpK 23342 21864 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_15990 25512 23347 gene locus_tag LOCUS_16000 25512 23347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 25723 28707 gene locus_tag LOCUS_16010 25723 28707 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940439.1 protein_id gnl|my_center|LOCUS_16010 28707 29534 gene locus_tag LOCUS_16020 28707 29534 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938913.1 protein_id gnl|my_center|LOCUS_16020 29538 29954 gene locus_tag LOCUS_16030 29538 29954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 31571 30060 gene locus_tag LOCUS_16040 31571 30060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 31772 32785 gene locus_tag LOCUS_16050 31772 32785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 32782 35316 gene locus_tag LOCUS_16060 32782 35316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 37368 35332 gene locus_tag LOCUS_16070 37368 35332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 38574 37498 gene locus_tag LOCUS_16080 38574 37498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 38808 41303 gene locus_tag LOCUS_16090 38808 41303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 43880 41379 gene locus_tag LOCUS_16100 43880 41379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 46006 43985 gene locus_tag LOCUS_16110 46006 43985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 47970 46003 gene locus_tag LOCUS_16120 47970 46003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 49973 48018 gene locus_tag LOCUS_16130 49973 48018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 51999 49981 gene locus_tag LOCUS_16140 51999 49981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 52376 53365 gene locus_tag LOCUS_16150 52376 53365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 53362 53787 gene locus_tag LOCUS_16160 gene glmS 53362 53787 CDS product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710390.1 protein_id gnl|my_center|LOCUS_16160 53790 55160 gene locus_tag LOCUS_16170 gene glmL 53790 55160 CDS product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167707.1 protein_id gnl|my_center|LOCUS_16170 55201 56646 gene locus_tag LOCUS_16180 55201 56646 CDS product methylaspartate mutase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423320.1 protein_id gnl|my_center|LOCUS_16180 56691 58037 gene locus_tag LOCUS_16190 56691 58037 CDS product methylaspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817376.1 protein_id gnl|my_center|LOCUS_16190 58126 59289 gene locus_tag LOCUS_16200 58126 59289 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391938.1 protein_id gnl|my_center|LOCUS_16200 59291 59587 gene locus_tag LOCUS_16210 59291 59587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391939.1 protein_id gnl|my_center|LOCUS_16210 59590 60492 gene locus_tag LOCUS_16220 59590 60492 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391940.1 protein_id gnl|my_center|LOCUS_16220 60498 61442 gene locus_tag LOCUS_16230 60498 61442 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391941.1 protein_id gnl|my_center|LOCUS_16230 61482 62420 gene locus_tag LOCUS_16240 61482 62420 CDS product alanine-tRNA synthetase second additional domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816923.1 protein_id gnl|my_center|LOCUS_16240 62477 63760 gene locus_tag LOCUS_16250 62477 63760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 63854 66073 gene locus_tag LOCUS_16260 63854 66073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 66148 66936 gene locus_tag LOCUS_16270 66148 66936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 66965 69589 gene locus_tag LOCUS_16280 66965 69589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 69700 72339 gene locus_tag LOCUS_16290 69700 72339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 72697 72350 gene locus_tag LOCUS_16300 72697 72350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 74763 72694 gene locus_tag LOCUS_16310 74763 72694 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_16310 75557 74772 gene locus_tag LOCUS_16320 75557 74772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 76510 75659 gene locus_tag LOCUS_16330 76510 75659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 76646 77068 gene locus_tag LOCUS_16340 76646 77068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 77567 77100 gene locus_tag LOCUS_16350 77567 77100 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279207.1 protein_id gnl|my_center|LOCUS_16350 79809 77608 gene locus_tag LOCUS_16360 79809 77608 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142622.1 protein_id gnl|my_center|LOCUS_16360 81298 79850 gene locus_tag LOCUS_16370 81298 79850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 81391 82143 gene locus_tag LOCUS_16380 81391 82143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 82210 83466 gene locus_tag LOCUS_16390 82210 83466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 83463 84044 gene locus_tag LOCUS_16400 83463 84044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 84155 84856 gene locus_tag LOCUS_16410 84155 84856 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938652.1 protein_id gnl|my_center|LOCUS_16410 84853 86262 gene locus_tag LOCUS_16420 84853 86262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 88587 86269 gene locus_tag LOCUS_16430 88587 86269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 89064 88618 gene locus_tag LOCUS_16440 89064 88618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 >Feature sequence15 169 966 gene locus_tag LOCUS_16450 gene thiD 169 966 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088646.1 protein_id gnl|my_center|LOCUS_16450 1090 2046 gene locus_tag LOCUS_16460 1090 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 2046 2984 gene locus_tag LOCUS_16470 2046 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 2992 3471 gene locus_tag LOCUS_16480 2992 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 3487 5163 gene locus_tag LOCUS_16490 3487 5163 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929181.1 protein_id gnl|my_center|LOCUS_16490 5174 5785 gene locus_tag LOCUS_16500 5174 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 6166 5795 gene locus_tag LOCUS_16510 6166 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 7145 6171 gene locus_tag LOCUS_16520 7145 6171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 7905 7180 gene locus_tag LOCUS_16530 7905 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 9884 8013 gene locus_tag LOCUS_16540 9884 8013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 10907 9888 gene locus_tag LOCUS_16550 10907 9888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 11155 12285 gene locus_tag LOCUS_16560 11155 12285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 12282 13265 gene locus_tag LOCUS_16570 12282 13265 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583585.1 protein_id gnl|my_center|LOCUS_16570 13262 17047 gene locus_tag LOCUS_16580 13262 17047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 17044 17799 gene locus_tag LOCUS_16590 17044 17799 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044922.1 protein_id gnl|my_center|LOCUS_16590 19066 17822 gene locus_tag LOCUS_16600 19066 17822 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297122.1 protein_id gnl|my_center|LOCUS_16600 20375 19095 gene locus_tag LOCUS_16610 20375 19095 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566866.1 protein_id gnl|my_center|LOCUS_16610 21069 20368 gene locus_tag LOCUS_16620 21069 20368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 21365 21204 gene locus_tag LOCUS_16630 21365 21204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 21435 22280 gene locus_tag LOCUS_16640 21435 22280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 23552 22317 gene locus_tag LOCUS_16650 gene clpX 23552 22317 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229613.1 protein_id gnl|my_center|LOCUS_16650 24096 23665 gene locus_tag LOCUS_16660 24096 23665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 24801 24238 gene locus_tag LOCUS_16670 24801 24238 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813074.1 protein_id gnl|my_center|LOCUS_16670 26998 24812 gene locus_tag LOCUS_16680 26998 24812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 28644 27133 gene locus_tag LOCUS_16690 28644 27133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 29829 28690 gene locus_tag LOCUS_16700 29829 28690 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457344.1 protein_id gnl|my_center|LOCUS_16700 30765 29836 gene locus_tag LOCUS_16710 30765 29836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 33187 30878 gene locus_tag LOCUS_16720 33187 30878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 33391 36069 gene locus_tag LOCUS_16730 33391 36069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 36081 37130 gene locus_tag LOCUS_16740 gene tsaD 36081 37130 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942510.1 protein_id gnl|my_center|LOCUS_16740 37127 38191 gene locus_tag LOCUS_16750 37127 38191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 38188 39159 gene locus_tag LOCUS_16760 38188 39159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 39152 39652 gene locus_tag LOCUS_16770 39152 39652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 39642 40187 gene locus_tag LOCUS_16780 39642 40187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 40800 40093 gene locus_tag LOCUS_16790 40800 40093 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530633.1 protein_id gnl|my_center|LOCUS_16790 41344 40808 gene locus_tag LOCUS_16800 41344 40808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 42555 41464 gene locus_tag LOCUS_16810 42555 41464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 43927 42761 gene locus_tag LOCUS_16820 43927 42761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 44718 43924 gene locus_tag LOCUS_16830 44718 43924 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122379.1 protein_id gnl|my_center|LOCUS_16830 45998 44715 gene locus_tag LOCUS_16840 45998 44715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191774878.1 protein_id gnl|my_center|LOCUS_16840 46406 46331 gene locus_tag LOCUS_t00220 46406 46331 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 46512 46611 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47764 47126 gene locus_tag LOCUS_16850 47764 47126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 48216 50558 gene locus_tag LOCUS_16860 48216 50558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 51826 51428 gene locus_tag LOCUS_16870 51826 51428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 51825 53366 gene locus_tag LOCUS_16880 51825 53366 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403192.1 protein_id gnl|my_center|LOCUS_16880 55379 53715 gene locus_tag LOCUS_16890 55379 53715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 55632 55387 gene locus_tag LOCUS_16900 55632 55387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 55720 56028 gene locus_tag LOCUS_16910 55720 56028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 56113 58710 gene locus_tag LOCUS_16920 56113 58710 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089686.1 protein_id gnl|my_center|LOCUS_16920 58724 59446 gene locus_tag LOCUS_16930 58724 59446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 59452 60384 gene locus_tag LOCUS_16940 59452 60384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 60681 60385 gene locus_tag LOCUS_16950 60681 60385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 61733 62080 gene locus_tag LOCUS_16960 61733 62080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 63556 62120 gene locus_tag LOCUS_16970 63556 62120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 64162 63857 gene locus_tag LOCUS_16980 64162 63857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 65259 64162 gene locus_tag LOCUS_16990 gene mltG 65259 64162 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_16990 65627 65256 gene locus_tag LOCUS_17000 65627 65256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 65757 66140 gene locus_tag LOCUS_17010 65757 66140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 66258 68318 gene locus_tag LOCUS_17020 66258 68318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 68331 69335 gene locus_tag LOCUS_17030 68331 69335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 69355 70101 gene locus_tag LOCUS_17040 69355 70101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 70104 71447 gene locus_tag LOCUS_17050 70104 71447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 71452 72081 gene locus_tag LOCUS_17060 71452 72081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 73356 72457 gene locus_tag LOCUS_17070 73356 72457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 74754 73450 gene locus_tag LOCUS_17080 74754 73450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 75956 74790 gene locus_tag LOCUS_17090 75956 74790 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_17090 77265 75961 gene locus_tag LOCUS_17100 77265 75961 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230479.1 protein_id gnl|my_center|LOCUS_17100 77472 79124 gene locus_tag LOCUS_17110 77472 79124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 79300 79746 gene locus_tag LOCUS_17120 79300 79746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 79931 80149 gene locus_tag LOCUS_17130 gene infA 79931 80149 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006583256.1 protein_id gnl|my_center|LOCUS_17130 80204 81256 gene locus_tag LOCUS_17140 gene kdd 80204 81256 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_17140 81998 81276 gene locus_tag LOCUS_17150 81998 81276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 81910 82176 gene locus_tag LOCUS_17160 81910 82176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 82173 85007 gene locus_tag LOCUS_17170 82173 85007 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968623.1 protein_id gnl|my_center|LOCUS_17170 87442 85646 gene locus_tag LOCUS_17180 87442 85646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 >Feature sequence16 241 1110 gene locus_tag LOCUS_17190 gene metF 241 1110 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933036.1 protein_id gnl|my_center|LOCUS_17190 1147 2613 gene locus_tag LOCUS_17200 1147 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 2630 4492 gene locus_tag LOCUS_17210 2630 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 4598 4858 gene locus_tag LOCUS_17220 4598 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 4896 6962 gene locus_tag LOCUS_17230 4896 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 7048 7827 gene locus_tag LOCUS_17240 7048 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 7868 8710 gene locus_tag LOCUS_17250 7868 8710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 8682 10220 gene locus_tag LOCUS_17260 gene xseA 8682 10220 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113813.1 protein_id gnl|my_center|LOCUS_17260 10217 10885 gene locus_tag LOCUS_17270 10217 10885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 12510 10981 gene locus_tag LOCUS_17280 12510 10981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 16664 12510 gene locus_tag LOCUS_17290 16664 12510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 16974 17642 gene locus_tag LOCUS_17300 16974 17642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 18100 18025 gene locus_tag LOCUS_t00230 18100 18025 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 18745 18395 gene locus_tag LOCUS_17310 18745 18395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 20083 18755 gene locus_tag LOCUS_17320 20083 18755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 20454 20080 gene locus_tag LOCUS_17330 20454 20080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 20600 21673 gene locus_tag LOCUS_17340 20600 21673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 21670 22566 gene locus_tag LOCUS_17350 21670 22566 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229024.1 protein_id gnl|my_center|LOCUS_17350 22602 23012 gene locus_tag LOCUS_17360 22602 23012 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_17360 23331 24833 gene locus_tag LOCUS_17370 23331 24833 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940922.1 protein_id gnl|my_center|LOCUS_17370 24942 26408 gene locus_tag LOCUS_17380 24942 26408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 26425 27096 gene locus_tag LOCUS_17390 26425 27096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 27089 29512 gene locus_tag LOCUS_17400 27089 29512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 29509 30864 gene locus_tag LOCUS_17410 29509 30864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 30952 31755 gene locus_tag LOCUS_17420 30952 31755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 31752 33578 gene locus_tag LOCUS_17430 31752 33578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 33609 34631 gene locus_tag LOCUS_17440 gene ansA 33609 34631 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722312.1 protein_id gnl|my_center|LOCUS_17440 34639 35382 gene locus_tag LOCUS_17450 gene rnc 34639 35382 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938733.1 protein_id gnl|my_center|LOCUS_17450 35379 36983 gene locus_tag LOCUS_17460 35379 36983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 36994 38187 gene locus_tag LOCUS_17470 36994 38187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 39476 38526 gene locus_tag LOCUS_17480 39476 38526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 39567 41141 gene locus_tag LOCUS_17490 39567 41141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 41154 42062 gene locus_tag LOCUS_17500 gene menA 41154 42062 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081897.1 protein_id gnl|my_center|LOCUS_17500 42108 43136 gene locus_tag LOCUS_17510 42108 43136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 43192 43470 gene locus_tag LOCUS_17520 43192 43470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 43501 44346 gene locus_tag LOCUS_17530 43501 44346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 44343 46064 gene locus_tag LOCUS_17540 44343 46064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 46077 46985 gene locus_tag LOCUS_17550 gene menA 46077 46985 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081897.1 protein_id gnl|my_center|LOCUS_17550 47031 48059 gene locus_tag LOCUS_17560 47031 48059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 48115 48393 gene locus_tag LOCUS_17570 48115 48393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 48424 49269 gene locus_tag LOCUS_17580 48424 49269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 49266 50345 gene locus_tag LOCUS_17590 49266 50345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 50923 50570 gene locus_tag LOCUS_17600 gene queF 50923 50570 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056073.1 protein_id gnl|my_center|LOCUS_17600 53229 50998 gene locus_tag LOCUS_17610 53229 50998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 54741 53404 gene locus_tag LOCUS_17620 54741 53404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 57215 54822 gene locus_tag LOCUS_17630 57215 54822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 58053 57223 gene locus_tag LOCUS_17640 58053 57223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 59874 58114 gene locus_tag LOCUS_17650 59874 58114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 60307 62253 gene locus_tag LOCUS_17660 60307 62253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 62268 63476 gene locus_tag LOCUS_17670 62268 63476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 64429 63722 gene locus_tag LOCUS_17680 64429 63722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 64495 64866 gene locus_tag LOCUS_17690 64495 64866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 64993 65475 gene locus_tag LOCUS_17700 64993 65475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 67600 65534 gene locus_tag LOCUS_17710 67600 65534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 67706 68002 gene locus_tag LOCUS_17720 67706 68002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 68692 68351 gene locus_tag LOCUS_17730 68692 68351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 69102 69734 gene locus_tag LOCUS_17740 69102 69734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 69981 70080 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 71183 70212 gene locus_tag LOCUS_17750 71183 70212 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937586.1 protein_id gnl|my_center|LOCUS_17750 73209 71206 gene locus_tag LOCUS_17760 73209 71206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 74008 73226 gene locus_tag LOCUS_17770 74008 73226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 74927 74136 gene locus_tag LOCUS_17780 74927 74136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 74914 75144 gene locus_tag LOCUS_17790 74914 75144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 75250 76278 gene locus_tag LOCUS_17800 gene ltaE 75250 76278 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943783.1 protein_id gnl|my_center|LOCUS_17800 76285 77091 gene locus_tag LOCUS_17810 76285 77091 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762787.1 protein_id gnl|my_center|LOCUS_17810 78312 77404 gene locus_tag LOCUS_17820 78312 77404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 78609 80438 gene locus_tag LOCUS_17830 78609 80438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 80742 81008 gene locus_tag LOCUS_17840 80742 81008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 81396 81031 gene locus_tag LOCUS_17850 81396 81031 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963569.1 protein_id gnl|my_center|LOCUS_17850 83004 81421 gene locus_tag LOCUS_17860 83004 81421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 84940 83036 gene locus_tag LOCUS_17870 84940 83036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 86388 84997 gene locus_tag LOCUS_17880 86388 84997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 86729 86421 gene locus_tag LOCUS_17890 86729 86421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence17 138 767 gene locus_tag LOCUS_17900 138 767 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528992.1 protein_id gnl|my_center|LOCUS_17900 896 1519 gene locus_tag LOCUS_17910 896 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 1519 2166 gene locus_tag LOCUS_17920 1519 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 4739 2364 gene locus_tag LOCUS_17930 4739 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 4865 6031 gene locus_tag LOCUS_17940 4865 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 6101 7543 gene locus_tag LOCUS_17950 6101 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 7560 8465 gene locus_tag LOCUS_17960 7560 8465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 10007 8466 gene locus_tag LOCUS_17970 10007 8466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 10438 10142 gene locus_tag LOCUS_17980 10438 10142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 11364 10435 gene locus_tag LOCUS_17990 11364 10435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 11574 12563 gene locus_tag LOCUS_18000 11574 12563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 12744 14015 gene locus_tag LOCUS_18010 12744 14015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 14123 15271 gene locus_tag LOCUS_18020 14123 15271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 17372 15276 gene locus_tag LOCUS_18030 17372 15276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 19566 17473 gene locus_tag LOCUS_18040 19566 17473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 19766 23017 gene locus_tag LOCUS_18050 19766 23017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 23055 25355 gene locus_tag LOCUS_18060 23055 25355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 25456 26481 gene locus_tag LOCUS_18070 25456 26481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 26641 29223 gene locus_tag LOCUS_18080 26641 29223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 29519 29743 gene locus_tag LOCUS_18090 29519 29743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 30600 29872 gene locus_tag LOCUS_18100 30600 29872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 30961 31638 gene locus_tag LOCUS_18110 30961 31638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 31982 32152 gene locus_tag LOCUS_18120 31982 32152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 32291 32390 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32758 33744 gene locus_tag LOCUS_18130 32758 33744 CDS product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206121.1 protein_id gnl|my_center|LOCUS_18130 33757 34866 gene locus_tag LOCUS_18140 33757 34866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 36386 35106 gene locus_tag LOCUS_18150 36386 35106 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224220.1 protein_id gnl|my_center|LOCUS_18150 37638 36379 gene locus_tag LOCUS_18160 37638 36379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 38618 37635 gene locus_tag LOCUS_18170 38618 37635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 39599 38694 gene locus_tag LOCUS_18180 39599 38694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 40453 39611 gene locus_tag LOCUS_18190 40453 39611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 40724 40476 gene locus_tag LOCUS_18200 40724 40476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 40893 42293 gene locus_tag LOCUS_18210 40893 42293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 42325 43743 gene locus_tag LOCUS_18220 42325 43743 CDS product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 protein_id gnl|my_center|LOCUS_18220 45497 43878 gene locus_tag LOCUS_18230 45497 43878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 45506 45605 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45854 48574 gene locus_tag LOCUS_18240 45854 48574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 48599 50224 gene locus_tag LOCUS_18250 48599 50224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 50288 51250 gene locus_tag LOCUS_18260 50288 51250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 51256 53472 gene locus_tag LOCUS_18270 51256 53472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 53602 54084 gene locus_tag LOCUS_18280 53602 54084 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943436.1 protein_id gnl|my_center|LOCUS_18280 54161 54655 gene locus_tag LOCUS_18290 54161 54655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 55351 54683 gene locus_tag LOCUS_18300 55351 54683 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666310.1 protein_id gnl|my_center|LOCUS_18300 56832 55348 gene locus_tag LOCUS_18310 56832 55348 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_18310 57710 56829 gene locus_tag LOCUS_18320 57710 56829 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813250.1 protein_id gnl|my_center|LOCUS_18320 57798 57722 gene locus_tag LOCUS_t00240 57798 57722 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 57904 57816 gene locus_tag LOCUS_t00250 57904 57816 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 58027 57942 gene locus_tag LOCUS_t00260 58027 57942 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 58873 58151 gene locus_tag LOCUS_18330 58873 58151 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227223.1 protein_id gnl|my_center|LOCUS_18330 60662 58884 gene locus_tag LOCUS_18340 60662 58884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 62190 60736 gene locus_tag LOCUS_18350 62190 60736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 63487 62351 gene locus_tag LOCUS_18360 gene nifS 63487 62351 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670052.1 protein_id gnl|my_center|LOCUS_18360 65264 63480 gene locus_tag LOCUS_18370 gene lnt 65264 63480 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939146.1 protein_id gnl|my_center|LOCUS_18370 65158 65388 gene locus_tag LOCUS_18380 65158 65388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 65795 65370 gene locus_tag LOCUS_18390 65795 65370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 66185 68605 gene locus_tag LOCUS_18400 66185 68605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 68609 71230 gene locus_tag LOCUS_18410 gene pepN 68609 71230 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940973.1 protein_id gnl|my_center|LOCUS_18410 71301 73565 gene locus_tag LOCUS_18420 71301 73565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 74965 73805 gene locus_tag LOCUS_18430 74965 73805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 75806 75015 gene locus_tag LOCUS_18440 75806 75015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 76071 75883 gene locus_tag LOCUS_18450 76071 75883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 77233 76166 gene locus_tag LOCUS_18460 77233 76166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 78750 77221 gene locus_tag LOCUS_18470 78750 77221 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484466.1 protein_id gnl|my_center|LOCUS_18470 78850 79821 gene locus_tag LOCUS_18480 gene murB 78850 79821 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_18480 79818 80393 gene locus_tag LOCUS_18490 79818 80393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 >Feature sequence18 1534 74 gene locus_tag LOCUS_18500 1534 74 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707191.1 protein_id gnl|my_center|LOCUS_18500 3125 1593 gene locus_tag LOCUS_18510 3125 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 3414 3109 gene locus_tag LOCUS_18520 3414 3109 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427739.1 protein_id gnl|my_center|LOCUS_18520 4063 3416 gene locus_tag LOCUS_18530 4063 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 4582 4127 gene locus_tag LOCUS_18540 4582 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 4780 6174 gene locus_tag LOCUS_18550 4780 6174 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_18550 8541 6193 gene locus_tag LOCUS_18560 gene uvrA 8541 6193 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122979.1 protein_id gnl|my_center|LOCUS_18560 8975 8538 gene locus_tag LOCUS_18570 gene tolR 8975 8538 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390003.1 protein_id gnl|my_center|LOCUS_18570 9695 8985 gene locus_tag LOCUS_18580 gene tolQ 9695 8985 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_18580 10090 9764 gene locus_tag LOCUS_18590 10090 9764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 10496 10191 gene locus_tag LOCUS_18600 10496 10191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 10635 11597 gene locus_tag LOCUS_18610 10635 11597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 11602 12084 gene locus_tag LOCUS_18620 11602 12084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 13789 12098 gene locus_tag LOCUS_18630 13789 12098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 13922 15274 gene locus_tag LOCUS_18640 13922 15274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 15274 16491 gene locus_tag LOCUS_18650 15274 16491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 16610 27115 gene locus_tag LOCUS_18660 16610 27115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 27121 27327 gene locus_tag LOCUS_18670 27121 27327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 27375 28949 gene locus_tag LOCUS_18680 27375 28949 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_18680 28940 29701 gene locus_tag LOCUS_18690 28940 29701 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_18690 29708 31279 gene locus_tag LOCUS_18700 gene rny 29708 31279 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_18700 31276 31851 gene locus_tag LOCUS_18710 31276 31851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 31976 32407 gene locus_tag LOCUS_18720 31976 32407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 32455 35277 gene locus_tag LOCUS_18730 gene uvrA 32455 35277 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_18730 35288 35710 gene locus_tag LOCUS_18740 35288 35710 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583880.1 protein_id gnl|my_center|LOCUS_18740 36411 36596 gene locus_tag LOCUS_18750 36411 36596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 36586 37071 gene locus_tag LOCUS_18760 36586 37071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 38134 37085 gene locus_tag LOCUS_18770 38134 37085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 39498 38632 gene locus_tag LOCUS_18780 39498 38632 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_18780 41147 39495 gene locus_tag LOCUS_18790 41147 39495 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961616.1 protein_id gnl|my_center|LOCUS_18790 42553 41144 gene locus_tag LOCUS_18800 42553 41144 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_18800 43377 42550 gene locus_tag LOCUS_18810 43377 42550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 43349 43660 gene locus_tag LOCUS_18820 43349 43660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 44568 43657 gene locus_tag LOCUS_18830 44568 43657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 45487 44585 gene locus_tag LOCUS_18840 gene cysK 45487 44585 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_18840 47186 45519 gene locus_tag LOCUS_18850 47186 45519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 48221 47370 gene locus_tag LOCUS_18860 48221 47370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 49465 48269 gene locus_tag LOCUS_18870 gene ftsW 49465 48269 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_18870 49566 50180 gene locus_tag LOCUS_18880 49566 50180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 51661 50162 gene locus_tag LOCUS_18890 gene malQ 51661 50162 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_18890 52738 51725 gene locus_tag LOCUS_18900 52738 51725 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080830.1 protein_id gnl|my_center|LOCUS_18900 54527 52743 gene locus_tag LOCUS_18910 54527 52743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 54843 54499 gene locus_tag LOCUS_18920 54843 54499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 56362 54911 gene locus_tag LOCUS_18930 56362 54911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 57126 56365 gene locus_tag LOCUS_18940 57126 56365 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_18940 58359 57136 gene locus_tag LOCUS_18950 58359 57136 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261735.1 protein_id gnl|my_center|LOCUS_18950 60082 58379 gene locus_tag LOCUS_18960 60082 58379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 60855 60097 gene locus_tag LOCUS_18970 60855 60097 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261734.1 protein_id gnl|my_center|LOCUS_18970 61643 60852 gene locus_tag LOCUS_18980 61643 60852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 61866 62798 gene locus_tag LOCUS_18990 61866 62798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 62811 64718 gene locus_tag LOCUS_19000 62811 64718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 64732 65973 gene locus_tag LOCUS_19010 64732 65973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 65989 66774 gene locus_tag LOCUS_19020 65989 66774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 66779 66958 gene locus_tag LOCUS_19030 66779 66958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 71485 67004 gene locus_tag LOCUS_19040 71485 67004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 72479 71775 gene locus_tag LOCUS_19050 72479 71775 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932971.1 protein_id gnl|my_center|LOCUS_19050 73797 72481 gene locus_tag LOCUS_19060 73797 72481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 76256 73800 gene locus_tag LOCUS_19070 76256 73800 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402856.1 protein_id gnl|my_center|LOCUS_19070 78060 76258 gene locus_tag LOCUS_19080 gene guaA 78060 76258 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234667.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence19 679 233 gene locus_tag LOCUS_19090 679 233 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938921.1 protein_id gnl|my_center|LOCUS_19090 1338 844 gene locus_tag LOCUS_19100 1338 844 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_19100 4151 1338 gene locus_tag LOCUS_19110 4151 1338 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203665.1 protein_id gnl|my_center|LOCUS_19110 4219 5877 gene locus_tag LOCUS_19120 gene groL 4219 5877 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_19120 6036 8261 gene locus_tag LOCUS_19130 gene pcrA 6036 8261 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233919.1 protein_id gnl|my_center|LOCUS_19130 8877 8248 gene locus_tag LOCUS_19140 8877 8248 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057562.1 protein_id gnl|my_center|LOCUS_19140 9061 9612 gene locus_tag LOCUS_19150 9061 9612 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458820.1 protein_id gnl|my_center|LOCUS_19150 10238 9609 gene locus_tag LOCUS_19160 10238 9609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 10774 10238 gene locus_tag LOCUS_19170 10774 10238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 11371 11470 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13251 11707 gene locus_tag LOCUS_19180 13251 11707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 13400 14635 gene locus_tag LOCUS_19190 13400 14635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 14722 16005 gene locus_tag LOCUS_19200 14722 16005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 16023 17510 gene locus_tag LOCUS_19210 16023 17510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 17572 18564 gene locus_tag LOCUS_19220 17572 18564 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932731.1 protein_id gnl|my_center|LOCUS_19220 19491 18586 gene locus_tag LOCUS_19230 19491 18586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 20513 19488 gene locus_tag LOCUS_19240 gene fni 20513 19488 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057243.1 protein_id gnl|my_center|LOCUS_19240 22568 20517 gene locus_tag LOCUS_19250 22568 20517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 22832 24217 gene locus_tag LOCUS_19260 22832 24217 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939396.1 protein_id gnl|my_center|LOCUS_19260 24278 26569 gene locus_tag LOCUS_19270 24278 26569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 26585 28819 gene locus_tag LOCUS_19280 26585 28819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 28816 30405 gene locus_tag LOCUS_19290 28816 30405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 30444 31715 gene locus_tag LOCUS_19300 30444 31715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 31797 31874 gene locus_tag LOCUS_t00270 31797 31874 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 31880 31953 gene locus_tag LOCUS_t00280 31880 31953 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 32713 32096 gene locus_tag LOCUS_19310 32713 32096 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249791.1 protein_id gnl|my_center|LOCUS_19310 33297 32722 gene locus_tag LOCUS_19320 33297 32722 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_19320 34364 33369 gene locus_tag LOCUS_19330 34364 33369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 35372 34395 gene locus_tag LOCUS_19340 35372 34395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 37488 35446 gene locus_tag LOCUS_19350 37488 35446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 37715 38377 gene locus_tag LOCUS_19360 37715 38377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 38423 39769 gene locus_tag LOCUS_19370 38423 39769 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870788.1 protein_id gnl|my_center|LOCUS_19370 41069 39774 gene locus_tag LOCUS_19380 41069 39774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 41255 42211 gene locus_tag LOCUS_19390 41255 42211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 42232 44451 gene locus_tag LOCUS_19400 42232 44451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 44603 46264 gene locus_tag LOCUS_19410 44603 46264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 49199 46293 gene locus_tag LOCUS_19420 49199 46293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 50179 49559 gene locus_tag LOCUS_19430 50179 49559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 50515 50183 gene locus_tag LOCUS_19440 50515 50183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 51051 50512 gene locus_tag LOCUS_19450 51051 50512 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813613.1 protein_id gnl|my_center|LOCUS_19450 51344 51117 gene locus_tag LOCUS_19460 51344 51117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 52273 51260 gene locus_tag LOCUS_19470 52273 51260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 53288 52341 gene locus_tag LOCUS_19480 53288 52341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 53743 53264 gene locus_tag LOCUS_19490 53743 53264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 54540 53740 gene locus_tag LOCUS_19500 54540 53740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 54697 55824 gene locus_tag LOCUS_19510 54697 55824 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000539776.1 protein_id gnl|my_center|LOCUS_19510 58643 55836 gene locus_tag LOCUS_19520 58643 55836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 56994 57110 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggcgcgggctccgtcaccgg 58814 59473 gene locus_tag LOCUS_19530 58814 59473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 61486 59483 gene locus_tag LOCUS_19540 61486 59483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940971.1 protein_id gnl|my_center|LOCUS_19540 62640 61483 gene locus_tag LOCUS_19550 62640 61483 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256145.1 protein_id gnl|my_center|LOCUS_19550 62766 63632 gene locus_tag LOCUS_19560 62766 63632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 65926 63629 gene locus_tag LOCUS_19570 65926 63629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 67730 65991 gene locus_tag LOCUS_19580 67730 65991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 67923 68453 gene locus_tag LOCUS_19590 67923 68453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 68622 69800 gene locus_tag LOCUS_19600 68622 69800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 69797 70183 gene locus_tag LOCUS_19610 69797 70183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 70245 72569 gene locus_tag LOCUS_19620 70245 72569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 73619 72570 gene locus_tag LOCUS_19630 73619 72570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 >Feature sequence20 169 1422 gene locus_tag LOCUS_19640 169 1422 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705890.1 protein_id gnl|my_center|LOCUS_19640 1409 1888 gene locus_tag LOCUS_19650 1409 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 2910 1993 gene locus_tag LOCUS_19660 2910 1993 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259391.1 protein_id gnl|my_center|LOCUS_19660 4769 3123 gene locus_tag LOCUS_19670 4769 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 5451 4924 gene locus_tag LOCUS_19680 5451 4924 CDS product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257683.1 protein_id gnl|my_center|LOCUS_19680 6680 5451 gene locus_tag LOCUS_19690 6680 5451 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257682.1 protein_id gnl|my_center|LOCUS_19690 7039 6761 gene locus_tag LOCUS_19700 7039 6761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 7871 8104 gene locus_tag LOCUS_19710 7871 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 9877 8153 gene locus_tag LOCUS_19720 9877 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 12216 9958 gene locus_tag LOCUS_19730 12216 9958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 13850 12480 gene locus_tag LOCUS_19740 13850 12480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 15400 13832 gene locus_tag LOCUS_19750 15400 13832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 18029 17442 gene locus_tag LOCUS_19760 18029 17442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 18202 18411 gene locus_tag LOCUS_19770 18202 18411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 18408 19349 gene locus_tag LOCUS_19780 18408 19349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 20232 19747 gene locus_tag LOCUS_19790 20232 19747 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943074.1 protein_id gnl|my_center|LOCUS_19790 21777 20389 gene locus_tag LOCUS_19800 21777 20389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 21853 22077 gene locus_tag LOCUS_19810 21853 22077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 22074 22403 gene locus_tag LOCUS_19820 22074 22403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 22770 23042 gene locus_tag LOCUS_19830 22770 23042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 23517 23002 gene locus_tag LOCUS_19840 23517 23002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 24851 23538 gene locus_tag LOCUS_19850 24851 23538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 26125 24878 gene locus_tag LOCUS_19860 26125 24878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 27457 26321 gene locus_tag LOCUS_19870 27457 26321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 28682 27468 gene locus_tag LOCUS_19880 28682 27468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 30154 28682 gene locus_tag LOCUS_19890 30154 28682 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941686.1 protein_id gnl|my_center|LOCUS_19890 30223 30939 gene locus_tag LOCUS_19900 30223 30939 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541081.1 protein_id gnl|my_center|LOCUS_19900 33073 30827 gene locus_tag LOCUS_19910 33073 30827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 34315 33359 gene locus_tag LOCUS_19920 34315 33359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 35152 34370 gene locus_tag LOCUS_19930 35152 34370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 35270 35369 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35440 35940 gene locus_tag LOCUS_19940 35440 35940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 37568 36033 gene locus_tag LOCUS_19950 37568 36033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941782.1 protein_id gnl|my_center|LOCUS_19950 38319 37582 gene locus_tag LOCUS_19960 38319 37582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 38562 38332 gene locus_tag LOCUS_19970 38562 38332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 38694 40028 gene locus_tag LOCUS_19980 38694 40028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 40947 40033 gene locus_tag LOCUS_19990 40947 40033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 42314 40944 gene locus_tag LOCUS_20000 42314 40944 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_20000 44268 42328 gene locus_tag LOCUS_20010 44268 42328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 45014 44358 gene locus_tag LOCUS_20020 45014 44358 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139327955.1 protein_id gnl|my_center|LOCUS_20020 45162 47303 gene locus_tag LOCUS_20030 45162 47303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 48192 47317 gene locus_tag LOCUS_20040 48192 47317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 48362 48286 gene locus_tag LOCUS_t00290 48362 48286 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 49126 48416 gene locus_tag LOCUS_20050 49126 48416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 49263 52199 gene locus_tag LOCUS_20060 49263 52199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 53465 52206 gene locus_tag LOCUS_20070 53465 52206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 55342 53468 gene locus_tag LOCUS_20080 55342 53468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 57532 55385 gene locus_tag LOCUS_20090 57532 55385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 57768 57562 gene locus_tag LOCUS_20100 57768 57562 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943808.1 protein_id gnl|my_center|LOCUS_20100 59494 57773 gene locus_tag LOCUS_20110 59494 57773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 60252 59494 gene locus_tag LOCUS_20120 60252 59494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 62570 60375 gene locus_tag LOCUS_20130 62570 60375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 62742 64505 gene locus_tag LOCUS_20140 62742 64505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 64495 65313 gene locus_tag LOCUS_20150 gene mazG 64495 65313 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 protein_id gnl|my_center|LOCUS_20150 68267 65328 gene locus_tag LOCUS_20160 68267 65328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 70061 68334 gene locus_tag LOCUS_20170 70061 68334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 71935 70157 gene locus_tag LOCUS_20180 gene aspS 71935 70157 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence21 2121 3008 gene locus_tag LOCUS_20190 gene hslO 2121 3008 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943960.1 protein_id gnl|my_center|LOCUS_20190 6461 3027 gene locus_tag LOCUS_20200 6461 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 8038 6530 gene locus_tag LOCUS_20210 8038 6530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 10335 8038 gene locus_tag LOCUS_20220 10335 8038 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_20220 10483 11289 gene locus_tag LOCUS_20230 10483 11289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 11371 13464 gene locus_tag LOCUS_20240 11371 13464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 13472 14791 gene locus_tag LOCUS_20250 13472 14791 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942159.1 protein_id gnl|my_center|LOCUS_20250 16075 14795 gene locus_tag LOCUS_20260 16075 14795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 17261 16065 gene locus_tag LOCUS_20270 17261 16065 CDS product aconitase X catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250200.1 protein_id gnl|my_center|LOCUS_20270 18508 17261 gene locus_tag LOCUS_20280 18508 17261 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762608.1 protein_id gnl|my_center|LOCUS_20280 19517 18489 gene locus_tag LOCUS_20290 19517 18489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 19818 20558 gene locus_tag LOCUS_20300 19818 20558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 20598 21893 gene locus_tag LOCUS_20310 20598 21893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 23944 21917 gene locus_tag LOCUS_20320 23944 21917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 24783 23962 gene locus_tag LOCUS_20330 24783 23962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 25372 24797 gene locus_tag LOCUS_20340 25372 24797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 25887 25375 gene locus_tag LOCUS_20350 25887 25375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 25783 26100 gene locus_tag LOCUS_20360 25783 26100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 27244 26540 gene locus_tag LOCUS_20370 27244 26540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 27628 28923 gene locus_tag LOCUS_20380 27628 28923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 28983 29057 gene locus_tag LOCUS_t00300 28983 29057 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 29117 29827 gene locus_tag LOCUS_20390 29117 29827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 30823 29894 gene locus_tag LOCUS_20400 30823 29894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 32767 30848 gene locus_tag LOCUS_20410 32767 30848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 32929 34128 gene locus_tag LOCUS_20420 gene rocD 32929 34128 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391213.1 protein_id gnl|my_center|LOCUS_20420 34780 34160 gene locus_tag LOCUS_20430 34780 34160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 34977 35978 gene locus_tag LOCUS_20440 34977 35978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 36114 37622 gene locus_tag LOCUS_20450 36114 37622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 37398 37497 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 37597 38142 gene locus_tag LOCUS_20460 37597 38142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 38123 38725 gene locus_tag LOCUS_20470 38123 38725 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973807.1 protein_id gnl|my_center|LOCUS_20470 38891 39760 gene locus_tag LOCUS_20480 gene rpsB 38891 39760 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942566.1 protein_id gnl|my_center|LOCUS_20480 39789 40439 gene locus_tag LOCUS_20490 gene tsf 39789 40439 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392547.1 protein_id gnl|my_center|LOCUS_20490 40459 41169 gene locus_tag LOCUS_20500 gene pyrH 40459 41169 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904124.1 protein_id gnl|my_center|LOCUS_20500 41236 41886 gene locus_tag LOCUS_20510 41236 41886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 44762 42126 gene locus_tag LOCUS_20520 44762 42126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 44969 46702 gene locus_tag LOCUS_20530 gene argS 44969 46702 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869400.1 protein_id gnl|my_center|LOCUS_20530 46705 47319 gene locus_tag LOCUS_20540 46705 47319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 47484 49373 gene locus_tag LOCUS_20550 47484 49373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 49723 50193 gene locus_tag LOCUS_20560 49723 50193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 55200 50551 gene locus_tag LOCUS_20570 55200 50551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 55305 56837 gene locus_tag LOCUS_20580 55305 56837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 57735 56905 gene locus_tag LOCUS_20590 57735 56905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 58173 58907 gene locus_tag LOCUS_20600 58173 58907 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037072.1 protein_id gnl|my_center|LOCUS_20600 58990 59062 gene locus_tag LOCUS_t00310 58990 59062 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 59127 60071 gene locus_tag LOCUS_20610 59127 60071 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_20610 60170 60829 gene locus_tag LOCUS_20620 60170 60829 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976390.1 protein_id gnl|my_center|LOCUS_20620 60857 61429 gene locus_tag LOCUS_20630 gene pth 60857 61429 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941324.1 protein_id gnl|my_center|LOCUS_20630 61537 64056 gene locus_tag LOCUS_20640 61537 64056 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_20640 65562 64348 gene locus_tag LOCUS_20650 65562 64348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 65632 66147 gene locus_tag LOCUS_20660 65632 66147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 66208 67584 gene locus_tag LOCUS_20670 66208 67584 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839227.1 protein_id gnl|my_center|LOCUS_20670 67677 68468 gene locus_tag LOCUS_20680 67677 68468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 68605 69819 gene locus_tag LOCUS_20690 68605 69819 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459119.1 protein_id gnl|my_center|LOCUS_20690 <72196 69887 gene locus_tag LOCUS_20700 <72196 69887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545466.1:endopeptidase La >Feature sequence22 612 1820 gene locus_tag LOCUS_20710 612 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 1829 2956 gene locus_tag LOCUS_20720 gene bamB 1829 2956 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092789.1 protein_id gnl|my_center|LOCUS_20720 2967 3626 gene locus_tag LOCUS_20730 2967 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 3710 4513 gene locus_tag LOCUS_20740 3710 4513 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943860.1 protein_id gnl|my_center|LOCUS_20740 4608 5546 gene locus_tag LOCUS_20750 gene rsmH 4608 5546 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939782.1 protein_id gnl|my_center|LOCUS_20750 5543 6100 gene locus_tag LOCUS_20760 5543 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 6094 8331 gene locus_tag LOCUS_20770 6094 8331 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_20770 8321 9853 gene locus_tag LOCUS_20780 8321 9853 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943699.1 protein_id gnl|my_center|LOCUS_20780 9857 11269 gene locus_tag LOCUS_20790 9857 11269 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_20790 12356 11280 gene locus_tag LOCUS_20800 12356 11280 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031746.1 protein_id gnl|my_center|LOCUS_20800 12475 14910 gene locus_tag LOCUS_20810 12475 14910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 14936 16870 gene locus_tag LOCUS_20820 14936 16870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 19050 16894 gene locus_tag LOCUS_20830 19050 16894 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939360.1 protein_id gnl|my_center|LOCUS_20830 19670 19047 gene locus_tag LOCUS_20840 gene gmk 19670 19047 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938199.1 protein_id gnl|my_center|LOCUS_20840 20533 19673 gene locus_tag LOCUS_20850 20533 19673 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942879.1 protein_id gnl|my_center|LOCUS_20850 20654 21343 gene locus_tag LOCUS_20860 20654 21343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 21352 21768 gene locus_tag LOCUS_20870 21352 21768 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933077.1 protein_id gnl|my_center|LOCUS_20870 21789 23015 gene locus_tag LOCUS_20880 21789 23015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 23139 24167 gene locus_tag LOCUS_20890 23139 24167 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229369.1 protein_id gnl|my_center|LOCUS_20890 24172 25167 gene locus_tag LOCUS_20900 24172 25167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 28174 25175 gene locus_tag LOCUS_20910 28174 25175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 28450 29541 gene locus_tag LOCUS_20920 28450 29541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 29921 29607 gene locus_tag LOCUS_20930 29921 29607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 32094 30169 gene locus_tag LOCUS_20940 32094 30169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 33339 32173 gene locus_tag LOCUS_20950 33339 32173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 33657 33430 gene locus_tag LOCUS_20960 33657 33430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 34129 34836 gene locus_tag LOCUS_20970 34129 34836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 34958 35539 gene locus_tag LOCUS_20980 34958 35539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 37653 35962 gene locus_tag LOCUS_20990 37653 35962 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460998.1 protein_id gnl|my_center|LOCUS_20990 39877 37994 gene locus_tag LOCUS_21000 39877 37994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 41464 40235 gene locus_tag LOCUS_21010 41464 40235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 42460 41624 gene locus_tag LOCUS_21020 42460 41624 CDS product PP2C family serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173287.1 protein_id gnl|my_center|LOCUS_21020 43223 42525 gene locus_tag LOCUS_21030 43223 42525 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105161.1 protein_id gnl|my_center|LOCUS_21030 44529 43372 gene locus_tag LOCUS_21040 44529 43372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 45105 44545 gene locus_tag LOCUS_21050 45105 44545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 45160 45411 gene locus_tag LOCUS_21060 45160 45411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 46534 46839 gene locus_tag LOCUS_21070 46534 46839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 48231 47392 gene locus_tag LOCUS_21080 gene proC 48231 47392 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258104.1 protein_id gnl|my_center|LOCUS_21080 50046 48241 gene locus_tag LOCUS_21090 50046 48241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 51760 50111 gene locus_tag LOCUS_21100 51760 50111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 52334 51951 gene locus_tag LOCUS_21110 52334 51951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 53513 52383 gene locus_tag LOCUS_21120 53513 52383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 53913 53503 gene locus_tag LOCUS_21130 53913 53503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 55913 53910 gene locus_tag LOCUS_21140 55913 53910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 57618 55903 gene locus_tag LOCUS_21150 57618 55903 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_21150 59622 57631 gene locus_tag LOCUS_21160 gene nuoF 59622 57631 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_21160 60107 59610 gene locus_tag LOCUS_21170 gene nuoE 60107 59610 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_21170 60747 60100 gene locus_tag LOCUS_21180 60747 60100 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003710514.1 protein_id gnl|my_center|LOCUS_21180 63591 60910 gene locus_tag LOCUS_21190 63591 60910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 63578 65353 gene locus_tag LOCUS_21200 63578 65353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 66706 65372 gene locus_tag LOCUS_21210 66706 65372 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762594.1 protein_id gnl|my_center|LOCUS_21210 68303 66720 gene locus_tag LOCUS_21220 68303 66720 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767052.1 protein_id gnl|my_center|LOCUS_21220 69535 68336 gene locus_tag LOCUS_21230 69535 68336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 71462 69813 gene locus_tag LOCUS_21240 71462 69813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 >Feature sequence23 1334 138 gene locus_tag LOCUS_21250 1334 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 1513 1752 gene locus_tag LOCUS_21260 1513 1752 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_21260 1778 3256 gene locus_tag LOCUS_21270 1778 3256 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272434.1 protein_id gnl|my_center|LOCUS_21270 3630 4391 gene locus_tag LOCUS_21280 3630 4391 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111779.1 protein_id gnl|my_center|LOCUS_21280 4578 5756 gene locus_tag LOCUS_21290 4578 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 7842 6016 gene locus_tag LOCUS_21300 gene typA 7842 6016 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941168.1 protein_id gnl|my_center|LOCUS_21300 9894 7996 gene locus_tag LOCUS_21310 9894 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 10105 14517 gene locus_tag LOCUS_21320 10105 14517 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200903603.1 protein_id gnl|my_center|LOCUS_21320 14773 15681 gene locus_tag LOCUS_21330 14773 15681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 16025 17305 gene locus_tag LOCUS_21340 16025 17305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 17309 17668 gene locus_tag LOCUS_21350 17309 17668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 17672 18910 gene locus_tag LOCUS_21360 17672 18910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 18923 19975 gene locus_tag LOCUS_21370 18923 19975 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671073.1 protein_id gnl|my_center|LOCUS_21370 19980 21206 gene locus_tag LOCUS_21380 19980 21206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 22890 21427 gene locus_tag LOCUS_21390 22890 21427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 23159 23395 gene locus_tag LOCUS_21400 23159 23395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 23392 23865 gene locus_tag LOCUS_21410 23392 23865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 23915 25552 gene locus_tag LOCUS_21420 23915 25552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 25556 26380 gene locus_tag LOCUS_21430 gene panB 25556 26380 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942349.1 protein_id gnl|my_center|LOCUS_21430 26377 27237 gene locus_tag LOCUS_21440 gene panC 26377 27237 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458948.1 protein_id gnl|my_center|LOCUS_21440 27289 28692 gene locus_tag LOCUS_21450 27289 28692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 29677 28634 gene locus_tag LOCUS_21460 gene recA 29677 28634 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688695.1 protein_id gnl|my_center|LOCUS_21460 30084 29674 gene locus_tag LOCUS_21470 30084 29674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 32405 30225 gene locus_tag LOCUS_21480 32405 30225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 32573 33838 gene locus_tag LOCUS_21490 32573 33838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 33843 35249 gene locus_tag LOCUS_21500 33843 35249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 35251 36558 gene locus_tag LOCUS_21510 35251 36558 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140777.1 protein_id gnl|my_center|LOCUS_21510 36565 39654 gene locus_tag LOCUS_21520 36565 39654 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057001.1 protein_id gnl|my_center|LOCUS_21520 40698 39661 gene locus_tag LOCUS_21530 40698 39661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 41232 40714 gene locus_tag LOCUS_21540 41232 40714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 41372 42268 gene locus_tag LOCUS_21550 gene dapA 41372 42268 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940835.1 protein_id gnl|my_center|LOCUS_21550 42272 44848 gene locus_tag LOCUS_21560 42272 44848 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136932681.1 protein_id gnl|my_center|LOCUS_21560 44850 46328 gene locus_tag LOCUS_21570 44850 46328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 46334 47698 gene locus_tag LOCUS_21580 46334 47698 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404498.1 protein_id gnl|my_center|LOCUS_21580 47818 49224 gene locus_tag LOCUS_21590 47818 49224 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392701.1 protein_id gnl|my_center|LOCUS_21590 50998 49283 gene locus_tag LOCUS_21600 50998 49283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 51217 51966 gene locus_tag LOCUS_21610 gene cobB 51217 51966 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868319.1 protein_id gnl|my_center|LOCUS_21610 51977 52777 gene locus_tag LOCUS_21620 51977 52777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 52805 53206 gene locus_tag LOCUS_21630 52805 53206 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228632.1 protein_id gnl|my_center|LOCUS_21630 53368 54999 gene locus_tag LOCUS_21640 gene hcp 53368 54999 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870473.1 protein_id gnl|my_center|LOCUS_21640 55619 55002 gene locus_tag LOCUS_21650 55619 55002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 56149 55805 gene locus_tag LOCUS_21660 56149 55805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 56317 57996 gene locus_tag LOCUS_21670 56317 57996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 58004 59266 gene locus_tag LOCUS_21680 58004 59266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 59289 59861 gene locus_tag LOCUS_21690 59289 59861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 60057 63185 gene locus_tag LOCUS_21700 60057 63185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 63905 63291 gene locus_tag LOCUS_21710 gene rpsD 63905 63291 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056002.1 protein_id gnl|my_center|LOCUS_21710 65709 64051 gene locus_tag LOCUS_21720 65709 64051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 67151 65793 gene locus_tag LOCUS_21730 67151 65793 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_21730 68296 67148 gene locus_tag LOCUS_21740 68296 67148 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_21740 >Feature sequence24 1376 2092 gene locus_tag LOCUS_21750 1376 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 2140 2787 gene locus_tag LOCUS_21760 2140 2787 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707003.1 protein_id gnl|my_center|LOCUS_21760 4432 2768 gene locus_tag LOCUS_21770 4432 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 4759 5436 gene locus_tag LOCUS_21780 4759 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 7147 5567 gene locus_tag LOCUS_21790 7147 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 7659 7180 gene locus_tag LOCUS_21800 7659 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 7887 8114 gene locus_tag LOCUS_21810 7887 8114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 8317 8111 gene locus_tag LOCUS_21820 8317 8111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 8216 9136 gene locus_tag LOCUS_21830 gene pdxA 8216 9136 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384456.1 protein_id gnl|my_center|LOCUS_21830 9129 9719 gene locus_tag LOCUS_21840 9129 9719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 9858 10739 gene locus_tag LOCUS_21850 gene glyQ 9858 10739 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392140.1 protein_id gnl|my_center|LOCUS_21850 10732 12789 gene locus_tag LOCUS_21860 gene glyS 10732 12789 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941242.1 protein_id gnl|my_center|LOCUS_21860 12786 13097 gene locus_tag LOCUS_21870 12786 13097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 13142 14467 gene locus_tag LOCUS_21880 13142 14467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 14469 16973 gene locus_tag LOCUS_21890 14469 16973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 17067 18092 gene locus_tag LOCUS_21900 gene flhB 17067 18092 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870058.1 protein_id gnl|my_center|LOCUS_21900 18192 18944 gene locus_tag LOCUS_21910 18192 18944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 18983 20353 gene locus_tag LOCUS_21920 18983 20353 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_21920 22216 20357 gene locus_tag LOCUS_21930 22216 20357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 22482 23021 gene locus_tag LOCUS_21940 22482 23021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 23686 23027 gene locus_tag LOCUS_21950 23686 23027 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918895.1 protein_id gnl|my_center|LOCUS_21950 23810 25126 gene locus_tag LOCUS_21960 23810 25126 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388621.1 protein_id gnl|my_center|LOCUS_21960 25263 26918 gene locus_tag LOCUS_21970 25263 26918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 26932 27657 gene locus_tag LOCUS_21980 26932 27657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 27657 29807 gene locus_tag LOCUS_21990 27657 29807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 29816 31282 gene locus_tag LOCUS_22000 29816 31282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 31311 32264 gene locus_tag LOCUS_22010 31311 32264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 33214 33945 gene locus_tag LOCUS_22020 33214 33945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 34024 34758 gene locus_tag LOCUS_22030 gene pyrF 34024 34758 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039203.1 protein_id gnl|my_center|LOCUS_22030 34755 35531 gene locus_tag LOCUS_22040 gene rlmB 34755 35531 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887393.1 protein_id gnl|my_center|LOCUS_22040 35539 38082 gene locus_tag LOCUS_22050 35539 38082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 38145 40595 gene locus_tag LOCUS_22060 38145 40595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 40585 42123 gene locus_tag LOCUS_22070 40585 42123 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294598.1 protein_id gnl|my_center|LOCUS_22070 43888 42269 gene locus_tag LOCUS_22080 43888 42269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 44870 43893 gene locus_tag LOCUS_22090 44870 43893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 45453 44938 gene locus_tag LOCUS_22100 45453 44938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 46029 45544 gene locus_tag LOCUS_22110 46029 45544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 46212 46754 gene locus_tag LOCUS_22120 gene lspA 46212 46754 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039646.1 protein_id gnl|my_center|LOCUS_22120 46758 47966 gene locus_tag LOCUS_22130 46758 47966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 48099 49889 gene locus_tag LOCUS_22140 48099 49889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 49945 53580 gene locus_tag LOCUS_22150 49945 53580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 53598 55454 gene locus_tag LOCUS_22160 53598 55454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 55552 56031 gene locus_tag LOCUS_22170 55552 56031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 56054 56809 gene locus_tag LOCUS_22180 56054 56809 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_22180 56796 57317 gene locus_tag LOCUS_22190 gene ruvC 56796 57317 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941736.1 protein_id gnl|my_center|LOCUS_22190 57314 57937 gene locus_tag LOCUS_22200 gene ruvA 57314 57937 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460360.1 protein_id gnl|my_center|LOCUS_22200 57938 59020 gene locus_tag LOCUS_22210 gene ruvB 57938 59020 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388844.1 protein_id gnl|my_center|LOCUS_22210 59151 60191 gene locus_tag LOCUS_22220 59151 60191 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_22220 60207 61130 gene locus_tag LOCUS_22230 gene mreC 60207 61130 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461822.1 protein_id gnl|my_center|LOCUS_22230 61139 61660 gene locus_tag LOCUS_22240 61139 61660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 61666 63528 gene locus_tag LOCUS_22250 gene mrdA 61666 63528 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_22250 63543 64646 gene locus_tag LOCUS_22260 gene rodA 63543 64646 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_22260 66036 64684 gene locus_tag LOCUS_22270 66036 64684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 67504 66152 gene locus_tag LOCUS_22280 67504 66152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence25 698 189 gene locus_tag LOCUS_22290 gene def 698 189 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114101.1 protein_id gnl|my_center|LOCUS_22290 1986 766 gene locus_tag LOCUS_22300 1986 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 3731 1986 gene locus_tag LOCUS_22310 3731 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 3643 3960 gene locus_tag LOCUS_22320 3643 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 5058 3961 gene locus_tag LOCUS_22330 gene serC 5058 3961 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_22330 5911 5180 gene locus_tag LOCUS_22340 5911 5180 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038010.1 protein_id gnl|my_center|LOCUS_22340 7227 5929 gene locus_tag LOCUS_22350 7227 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 8186 7224 gene locus_tag LOCUS_22360 8186 7224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 8858 8205 gene locus_tag LOCUS_22370 8858 8205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 8992 9981 gene locus_tag LOCUS_22380 gene holA 8992 9981 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942847.1 protein_id gnl|my_center|LOCUS_22380 10826 10185 gene locus_tag LOCUS_22390 gene udk 10826 10185 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257573.1 protein_id gnl|my_center|LOCUS_22390 13308 10870 gene locus_tag LOCUS_22400 gene pheT 13308 10870 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405510.1 protein_id gnl|my_center|LOCUS_22400 14348 13305 gene locus_tag LOCUS_22410 gene pheS 14348 13305 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053743.1 protein_id gnl|my_center|LOCUS_22410 14619 15299 gene locus_tag LOCUS_22420 14619 15299 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813002.1 protein_id gnl|my_center|LOCUS_22420 16051 15296 gene locus_tag LOCUS_22430 16051 15296 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583102.1 protein_id gnl|my_center|LOCUS_22430 16460 16056 gene locus_tag LOCUS_22440 16460 16056 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583101.1 protein_id gnl|my_center|LOCUS_22440 17644 16457 gene locus_tag LOCUS_22450 17644 16457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 18010 18906 gene locus_tag LOCUS_22460 18010 18906 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140077.1 protein_id gnl|my_center|LOCUS_22460 18974 19456 gene locus_tag LOCUS_22470 18974 19456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 20888 19758 gene locus_tag LOCUS_22480 20888 19758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 22173 20932 gene locus_tag LOCUS_22490 22173 20932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 22766 22170 gene locus_tag LOCUS_22500 22766 22170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 25626 22744 gene locus_tag LOCUS_22510 25626 22744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 26048 25623 gene locus_tag LOCUS_22520 26048 25623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 26710 26045 gene locus_tag LOCUS_22530 26710 26045 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_22530 28646 26718 gene locus_tag LOCUS_22540 28646 26718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 29283 28747 gene locus_tag LOCUS_22550 29283 28747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 30232 29270 gene locus_tag LOCUS_22560 30232 29270 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967295.1 protein_id gnl|my_center|LOCUS_22560 32919 30223 gene locus_tag LOCUS_22570 32919 30223 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224267.1 protein_id gnl|my_center|LOCUS_22570 33225 34823 gene locus_tag LOCUS_22580 33225 34823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 34992 37289 gene locus_tag LOCUS_22590 34992 37289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 38232 37411 gene locus_tag LOCUS_22600 38232 37411 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065510.1 protein_id gnl|my_center|LOCUS_22600 38396 39790 gene locus_tag LOCUS_22610 38396 39790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 40774 39812 gene locus_tag LOCUS_22620 40774 39812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 42954 40933 gene locus_tag LOCUS_22630 42954 40933 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_22630 44839 42962 gene locus_tag LOCUS_22640 44839 42962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 46620 44875 gene locus_tag LOCUS_22650 46620 44875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 46756 49983 gene locus_tag LOCUS_22660 46756 49983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 50090 51082 gene locus_tag LOCUS_22670 50090 51082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 51745 51083 gene locus_tag LOCUS_22680 51745 51083 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191181.1 protein_id gnl|my_center|LOCUS_22680 52401 51748 gene locus_tag LOCUS_22690 gene atoD 52401 51748 CDS product acetate CoA-transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850540.1 protein_id gnl|my_center|LOCUS_22690 52298 53998 gene locus_tag LOCUS_22700 52298 53998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 53995 56298 gene locus_tag LOCUS_22710 53995 56298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 56295 56849 gene locus_tag LOCUS_22720 56295 56849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 56960 58804 gene locus_tag LOCUS_22730 56960 58804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 60969 58966 gene locus_tag LOCUS_22740 60969 58966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 61324 61031 gene locus_tag LOCUS_22750 61324 61031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 61606 62997 gene locus_tag LOCUS_22760 61606 62997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 64900 63014 gene locus_tag LOCUS_22770 64900 63014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 66371 64884 gene locus_tag LOCUS_22780 66371 64884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 67145 66465 gene locus_tag LOCUS_22790 67145 66465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 >Feature sequence26 220 2892 gene locus_tag LOCUS_22800 gene ppdK 220 2892 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082976.1 protein_id gnl|my_center|LOCUS_22800 2948 3796 gene locus_tag LOCUS_22810 2948 3796 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065352.1 protein_id gnl|my_center|LOCUS_22810 4826 3864 gene locus_tag LOCUS_22820 4826 3864 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026644807.1 protein_id gnl|my_center|LOCUS_22820 4960 5547 gene locus_tag LOCUS_22830 4960 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 5552 5719 gene locus_tag LOCUS_22840 5552 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 6219 5749 gene locus_tag LOCUS_22850 gene bcp 6219 5749 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_22850 6333 7709 gene locus_tag LOCUS_22860 6333 7709 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_22860 8186 7755 gene locus_tag LOCUS_22870 8186 7755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 8971 8276 gene locus_tag LOCUS_22880 8971 8276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 10266 9007 gene locus_tag LOCUS_22890 10266 9007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 10449 12206 gene locus_tag LOCUS_22900 10449 12206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 13415 12210 gene locus_tag LOCUS_22910 13415 12210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 13524 13937 gene locus_tag LOCUS_22920 13524 13937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 14015 14302 gene locus_tag LOCUS_22930 14015 14302 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942061.1 protein_id gnl|my_center|LOCUS_22930 14398 15048 gene locus_tag LOCUS_22940 14398 15048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 15071 15604 gene locus_tag LOCUS_22950 15071 15604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 15585 16856 gene locus_tag LOCUS_22960 15585 16856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 18527 17208 gene locus_tag LOCUS_22970 18527 17208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 19034 18531 gene locus_tag LOCUS_22980 gene purE 19034 18531 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544997.1 protein_id gnl|my_center|LOCUS_22980 20292 19039 gene locus_tag LOCUS_22990 gene purD 20292 19039 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_22990 20891 20295 gene locus_tag LOCUS_23000 20891 20295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 21102 22736 gene locus_tag LOCUS_23010 21102 22736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 22702 23526 gene locus_tag LOCUS_23020 22702 23526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 23539 25020 gene locus_tag LOCUS_23030 23539 25020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 25112 25690 gene locus_tag LOCUS_23040 gene rsxA 25112 25690 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_23040 25687 26616 gene locus_tag LOCUS_23050 25687 26616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 26613 27950 gene locus_tag LOCUS_23060 gene rsxC 26613 27950 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428488.1 protein_id gnl|my_center|LOCUS_23060 27955 29001 gene locus_tag LOCUS_23070 27955 29001 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788156.1 protein_id gnl|my_center|LOCUS_23070 28998 29891 gene locus_tag LOCUS_23080 28998 29891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 29891 30517 gene locus_tag LOCUS_23090 29891 30517 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761246.1 protein_id gnl|my_center|LOCUS_23090 30664 31215 gene locus_tag LOCUS_23100 30664 31215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 31225 32661 gene locus_tag LOCUS_23110 31225 32661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 32665 34704 gene locus_tag LOCUS_23120 32665 34704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 34958 36679 gene locus_tag LOCUS_23130 34958 36679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 36693 37934 gene locus_tag LOCUS_23140 gene coaBC 36693 37934 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_23140 38722 37862 gene locus_tag LOCUS_23150 gene lgt 38722 37862 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204658.1 protein_id gnl|my_center|LOCUS_23150 41362 38951 gene locus_tag LOCUS_23160 41362 38951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 43387 41492 gene locus_tag LOCUS_23170 gene dnaK 43387 41492 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_23170 44442 43507 gene locus_tag LOCUS_23180 44442 43507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008194003.1 protein_id gnl|my_center|LOCUS_23180 44629 46494 gene locus_tag LOCUS_23190 44629 46494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 46587 47087 gene locus_tag LOCUS_23200 46587 47087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 47106 47972 gene locus_tag LOCUS_23210 47106 47972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 48069 48707 gene locus_tag LOCUS_23220 48069 48707 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_23220 48710 49495 gene locus_tag LOCUS_23230 48710 49495 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_23230 49476 50309 gene locus_tag LOCUS_23240 49476 50309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 50296 51102 gene locus_tag LOCUS_23250 50296 51102 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_23250 51238 51312 gene locus_tag LOCUS_t00320 51238 51312 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 51320 51393 gene locus_tag LOCUS_t00330 51320 51393 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 51460 52332 gene locus_tag LOCUS_23260 51460 52332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 52424 53041 gene locus_tag LOCUS_23270 gene wrbA 52424 53041 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971828.1 protein_id gnl|my_center|LOCUS_23270 53161 53607 gene locus_tag LOCUS_23280 53161 53607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 54528 53614 gene locus_tag LOCUS_23290 54528 53614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 56398 54539 gene locus_tag LOCUS_23300 56398 54539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 58970 56562 gene locus_tag LOCUS_23310 58970 56562 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 protein_id gnl|my_center|LOCUS_23310 60042 58993 gene locus_tag LOCUS_23320 gene recA 60042 58993 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537720.1 protein_id gnl|my_center|LOCUS_23320 61572 60046 gene locus_tag LOCUS_23330 61572 60046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 62092 61565 gene locus_tag LOCUS_23340 62092 61565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 62871 62143 gene locus_tag LOCUS_23350 62871 62143 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354922.1 protein_id gnl|my_center|LOCUS_23350 64328 63003 gene locus_tag LOCUS_23360 gene rimO 64328 63003 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_23360 64860 64321 gene locus_tag LOCUS_23370 64860 64321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 64951 66339 gene locus_tag LOCUS_23380 gene glmU 64951 66339 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015965.1 protein_id gnl|my_center|LOCUS_23380 66547 66620 gene locus_tag LOCUS_t00340 66547 66620 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 66628 66704 gene locus_tag LOCUS_t00350 66628 66704 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence27 1572 133 gene locus_tag LOCUS_23390 1572 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 2063 1719 gene locus_tag LOCUS_23400 2063 1719 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719393.1 protein_id gnl|my_center|LOCUS_23400 2373 2095 gene locus_tag LOCUS_23410 2373 2095 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357513.1 protein_id gnl|my_center|LOCUS_23410 2686 2387 gene locus_tag LOCUS_23420 2686 2387 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721582.1 protein_id gnl|my_center|LOCUS_23420 3185 2688 gene locus_tag LOCUS_23430 gene rpiB 3185 2688 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199035.1 protein_id gnl|my_center|LOCUS_23430 4109 3189 gene locus_tag LOCUS_23440 gene tpiA 4109 3189 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942272.1 protein_id gnl|my_center|LOCUS_23440 4417 4106 gene locus_tag LOCUS_23450 4417 4106 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868835.1 protein_id gnl|my_center|LOCUS_23450 5025 4420 gene locus_tag LOCUS_23460 5025 4420 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810294.1 protein_id gnl|my_center|LOCUS_23460 6388 5036 gene locus_tag LOCUS_23470 6388 5036 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810293.1 protein_id gnl|my_center|LOCUS_23470 7887 6412 gene locus_tag LOCUS_23480 7887 6412 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075682.1 protein_id gnl|my_center|LOCUS_23480 8200 7910 gene locus_tag LOCUS_23490 8200 7910 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324359.1 protein_id gnl|my_center|LOCUS_23490 8987 8211 gene locus_tag LOCUS_23500 8987 8211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 9684 8992 gene locus_tag LOCUS_23510 9684 8992 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861641.1 protein_id gnl|my_center|LOCUS_23510 9891 10733 gene locus_tag LOCUS_23520 9891 10733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 10730 11707 gene locus_tag LOCUS_23530 gene lipA 10730 11707 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174105.1 protein_id gnl|my_center|LOCUS_23530 11709 12842 gene locus_tag LOCUS_23540 11709 12842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 12925 13314 gene locus_tag LOCUS_23550 12925 13314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 13336 13485 gene locus_tag LOCUS_23560 13336 13485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 13550 15502 gene locus_tag LOCUS_23570 13550 15502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 15513 16001 gene locus_tag LOCUS_23580 15513 16001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 16272 17639 gene locus_tag LOCUS_23590 gene pilR 16272 17639 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_23590 17793 18320 gene locus_tag LOCUS_23600 17793 18320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 18363 18932 gene locus_tag LOCUS_23610 18363 18932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 19011 19538 gene locus_tag LOCUS_23620 19011 19538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 22795 19760 gene locus_tag LOCUS_23630 22795 19760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 23102 22854 gene locus_tag LOCUS_23640 23102 22854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 23014 24099 gene locus_tag LOCUS_23650 23014 24099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 26149 24101 gene locus_tag LOCUS_23660 26149 24101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 26258 27532 gene locus_tag LOCUS_23670 26258 27532 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943766.1 protein_id gnl|my_center|LOCUS_23670 27549 28979 gene locus_tag LOCUS_23680 27549 28979 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480009.1 protein_id gnl|my_center|LOCUS_23680 30365 28989 gene locus_tag LOCUS_23690 30365 28989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 30858 30948 gene locus_tag LOCUS_t00360 30858 30948 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 32307 30979 gene locus_tag LOCUS_23700 32307 30979 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940922.1 protein_id gnl|my_center|LOCUS_23700 33664 32300 gene locus_tag LOCUS_23710 33664 32300 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461820.1 protein_id gnl|my_center|LOCUS_23710 34725 33661 gene locus_tag LOCUS_23720 34725 33661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 35912 34722 gene locus_tag LOCUS_23730 35912 34722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 37042 35909 gene locus_tag LOCUS_23740 gene lysA 37042 35909 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939836.1 protein_id gnl|my_center|LOCUS_23740 38926 37064 gene locus_tag LOCUS_23750 gene rpoD 38926 37064 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_23750 39129 39228 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41185 39335 gene locus_tag LOCUS_23760 41185 39335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 41472 42107 gene locus_tag LOCUS_23770 41472 42107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 42128 44017 gene locus_tag LOCUS_23780 42128 44017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 44027 45478 gene locus_tag LOCUS_23790 44027 45478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 45547 47286 gene locus_tag LOCUS_23800 gene recJ 45547 47286 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_23800 47283 47573 gene locus_tag LOCUS_23810 47283 47573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 47592 49256 gene locus_tag LOCUS_23820 47592 49256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 49330 50670 gene locus_tag LOCUS_23830 49330 50670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 50681 51301 gene locus_tag LOCUS_23840 50681 51301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 51338 52114 gene locus_tag LOCUS_23850 51338 52114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 52175 52933 gene locus_tag LOCUS_23860 52175 52933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 53027 53776 gene locus_tag LOCUS_23870 53027 53776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 53841 54488 gene locus_tag LOCUS_23880 53841 54488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 54494 55555 gene locus_tag LOCUS_23890 54494 55555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 55563 57086 gene locus_tag LOCUS_23900 55563 57086 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971521.1 protein_id gnl|my_center|LOCUS_23900 57086 58516 gene locus_tag LOCUS_23910 57086 58516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 58602 60629 gene locus_tag LOCUS_23920 58602 60629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 60126 60225 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 60655 62040 gene locus_tag LOCUS_23930 gene pyk 60655 62040 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584142.1 protein_id gnl|my_center|LOCUS_23930 62388 62059 gene locus_tag LOCUS_23940 62388 62059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 63517 62399 gene locus_tag LOCUS_23950 63517 62399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 63657 64778 gene locus_tag LOCUS_23960 63657 64778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 >Feature sequence28 2535 1213 gene locus_tag LOCUS_23970 2535 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 2728 3861 gene locus_tag LOCUS_23980 2728 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 4103 5476 gene locus_tag LOCUS_23990 4103 5476 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867786.1 protein_id gnl|my_center|LOCUS_23990 7502 5484 gene locus_tag LOCUS_24000 7502 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 9151 7523 gene locus_tag LOCUS_24010 9151 7523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 9260 10960 gene locus_tag LOCUS_24020 gene hflX 9260 10960 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941674.1 protein_id gnl|my_center|LOCUS_24020 10965 12887 gene locus_tag LOCUS_24030 10965 12887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 14128 13043 gene locus_tag LOCUS_24040 14128 13043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 14215 15933 gene locus_tag LOCUS_24050 14215 15933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 16003 17640 gene locus_tag LOCUS_24060 16003 17640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 17900 18745 gene locus_tag LOCUS_24070 17900 18745 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391812.1 protein_id gnl|my_center|LOCUS_24070 18788 19864 gene locus_tag LOCUS_24080 gene mnmA 18788 19864 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_24080 20198 20297 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20437 20892 gene locus_tag LOCUS_24090 gene tnpA 20437 20892 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_24090 21694 21065 gene locus_tag LOCUS_24100 21694 21065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 21878 23761 gene locus_tag LOCUS_24110 21878 23761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 23834 25747 gene locus_tag LOCUS_24120 23834 25747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 26017 26472 gene locus_tag LOCUS_24130 gene tnpA 26017 26472 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_24130 27006 26674 gene locus_tag LOCUS_24140 27006 26674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 27278 27003 gene locus_tag LOCUS_24150 27278 27003 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888120.1 protein_id gnl|my_center|LOCUS_24150 27750 27460 gene locus_tag LOCUS_24160 27750 27460 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064812.1 protein_id gnl|my_center|LOCUS_24160 28660 29202 gene locus_tag LOCUS_24170 28660 29202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 29477 30415 gene locus_tag LOCUS_24180 29477 30415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926903.1 protein_id gnl|my_center|LOCUS_24180 30994 30734 gene locus_tag LOCUS_24190 30994 30734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 31723 31373 gene locus_tag LOCUS_24200 31723 31373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 31996 32391 gene locus_tag LOCUS_24210 31996 32391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 32384 32695 gene locus_tag LOCUS_24220 32384 32695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 32983 33177 gene locus_tag LOCUS_24230 32983 33177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 33783 33340 gene locus_tag LOCUS_24240 33783 33340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 34339 33788 gene locus_tag LOCUS_24250 34339 33788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 34687 34893 gene locus_tag LOCUS_24260 34687 34893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 34894 35175 gene locus_tag LOCUS_24270 34894 35175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 35495 35202 gene locus_tag LOCUS_24280 35495 35202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 35686 35486 gene locus_tag LOCUS_24290 35686 35486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 35685 35984 gene locus_tag LOCUS_24300 35685 35984 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_24300 39381 35992 gene locus_tag LOCUS_24310 39381 35992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 39866 40132 gene locus_tag LOCUS_24320 39866 40132 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_24320 40142 40381 gene locus_tag LOCUS_24330 40142 40381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 40760 41524 gene locus_tag LOCUS_24340 40760 41524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 41919 41563 gene locus_tag LOCUS_24350 41919 41563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 42038 42382 gene locus_tag LOCUS_24360 42038 42382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 43380 42547 gene locus_tag LOCUS_24370 43380 42547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 43626 44798 gene locus_tag LOCUS_24380 43626 44798 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895560.1 protein_id gnl|my_center|LOCUS_24380 44828 45949 gene locus_tag LOCUS_24390 44828 45949 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808458.1 protein_id gnl|my_center|LOCUS_24390 46344 45973 gene locus_tag LOCUS_24400 46344 45973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 46650 46345 gene locus_tag LOCUS_24410 46650 46345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 48406 49419 gene locus_tag LOCUS_24420 gene pseB 48406 49419 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015759.1 protein_id gnl|my_center|LOCUS_24420 49429 50277 gene locus_tag LOCUS_24430 49429 50277 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_24430 50277 51719 gene locus_tag LOCUS_24440 50277 51719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 51709 52758 gene locus_tag LOCUS_24450 gene pseI 51709 52758 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965486.1 protein_id gnl|my_center|LOCUS_24450 52763 53950 gene locus_tag LOCUS_24460 gene pseC 52763 53950 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 protein_id gnl|my_center|LOCUS_24460 53960 54589 gene locus_tag LOCUS_24470 53960 54589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 54826 55617 gene locus_tag LOCUS_24480 54826 55617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 55711 57063 gene locus_tag LOCUS_24490 55711 57063 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870353.1 protein_id gnl|my_center|LOCUS_24490 57236 58315 gene locus_tag LOCUS_24500 57236 58315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 58464 60485 gene locus_tag LOCUS_24510 58464 60485 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_24510 60782 62095 gene locus_tag LOCUS_24520 60782 62095 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_24520 63583 62393 gene locus_tag LOCUS_24530 63583 62393 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462475.1 protein_id gnl|my_center|LOCUS_24530 64216 63587 gene locus_tag LOCUS_24540 64216 63587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24540 64806 64213 gene locus_tag LOCUS_24550 64806 64213 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462478.1 protein_id gnl|my_center|LOCUS_24550 65081 65350 gene locus_tag LOCUS_24560 65081 65350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 >Feature sequence29 1295 198 gene locus_tag LOCUS_24570 1295 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 2332 1292 gene locus_tag LOCUS_24580 2332 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 4364 2340 gene locus_tag LOCUS_24590 4364 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 4531 5808 gene locus_tag LOCUS_24600 4531 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 5831 8107 gene locus_tag LOCUS_24610 5831 8107 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640383.1 protein_id gnl|my_center|LOCUS_24610 8226 11054 gene locus_tag LOCUS_24620 8226 11054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 11097 12047 gene locus_tag LOCUS_24630 11097 12047 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_24630 12050 13291 gene locus_tag LOCUS_24640 12050 13291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 13916 14605 gene locus_tag LOCUS_24650 13916 14605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 17845 14783 gene locus_tag LOCUS_24660 17845 14783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 20509 18284 gene locus_tag LOCUS_24670 20509 18284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 21503 20586 gene locus_tag LOCUS_24680 21503 20586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 21795 22403 gene locus_tag LOCUS_24690 21795 22403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 22400 23839 gene locus_tag LOCUS_24700 22400 23839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 23867 24928 gene locus_tag LOCUS_24710 23867 24928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 25436 24939 gene locus_tag LOCUS_24720 25436 24939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 26308 25445 gene locus_tag LOCUS_24730 26308 25445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 26990 26346 gene locus_tag LOCUS_24740 26990 26346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 28399 27155 gene locus_tag LOCUS_24750 28399 27155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 29371 28739 gene locus_tag LOCUS_24760 29371 28739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 33804 29398 gene locus_tag LOCUS_24770 33804 29398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 34567 33848 gene locus_tag LOCUS_24780 34567 33848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 36294 34654 gene locus_tag LOCUS_24790 36294 34654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 36485 37426 gene locus_tag LOCUS_24800 36485 37426 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_24800 37460 38416 gene locus_tag LOCUS_24810 37460 38416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 38430 40559 gene locus_tag LOCUS_24820 38430 40559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 40556 41734 gene locus_tag LOCUS_24830 40556 41734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 42022 42372 gene locus_tag LOCUS_24840 42022 42372 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_24840 42672 44006 gene locus_tag LOCUS_24850 42672 44006 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147002.1 protein_id gnl|my_center|LOCUS_24850 44504 46810 gene locus_tag LOCUS_24860 44504 46810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 46964 48373 gene locus_tag LOCUS_24870 46964 48373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 48351 49601 gene locus_tag LOCUS_24880 48351 49601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 50489 49932 gene locus_tag LOCUS_24890 50489 49932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 52174 50999 gene locus_tag LOCUS_24900 gene nifS 52174 50999 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_24900 53051 52197 gene locus_tag LOCUS_24910 gene nifU 53051 52197 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942655.1 protein_id gnl|my_center|LOCUS_24910 54142 53123 gene locus_tag LOCUS_24920 54142 53123 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_24920 54368 54165 gene locus_tag LOCUS_24930 54368 54165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 55500 54445 gene locus_tag LOCUS_24940 gene mtnA 55500 54445 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_24940 56948 55497 gene locus_tag LOCUS_24950 gene gatB 56948 55497 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_24950 58450 56945 gene locus_tag LOCUS_24960 gene gatA 58450 56945 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141527.1 protein_id gnl|my_center|LOCUS_24960 58745 58437 gene locus_tag LOCUS_24970 gene gatC 58745 58437 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457086.1 protein_id gnl|my_center|LOCUS_24970 61712 58908 gene locus_tag LOCUS_24980 61712 58908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 63163 62075 gene locus_tag LOCUS_24990 63163 62075 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765630.1 protein_id gnl|my_center|LOCUS_24990 64292 63180 gene locus_tag LOCUS_25000 64292 63180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107436.1 protein_id gnl|my_center|LOCUS_25000 >Feature sequence30 5438 1863 gene locus_tag LOCUS_25010 5438 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 7480 5702 gene locus_tag LOCUS_25020 7480 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 9025 7529 gene locus_tag LOCUS_25030 9025 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 10857 9022 gene locus_tag LOCUS_25040 10857 9022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 11680 13089 gene locus_tag LOCUS_25050 gene lpdA 11680 13089 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049374229.1 protein_id gnl|my_center|LOCUS_25050 13095 13451 gene locus_tag LOCUS_25060 13095 13451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 13579 13651 gene locus_tag LOCUS_t00370 13579 13651 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 13749 15494 gene locus_tag LOCUS_25070 gene thrS 13749 15494 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_25070 15614 16132 gene locus_tag LOCUS_25080 15614 16132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 16163 16675 gene locus_tag LOCUS_25090 16163 16675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 16704 17729 gene locus_tag LOCUS_25100 16704 17729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 18030 18545 gene locus_tag LOCUS_25110 18030 18545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 18738 19283 gene locus_tag LOCUS_25120 18738 19283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 19280 19552 gene locus_tag LOCUS_25130 19280 19552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 19618 21273 gene locus_tag LOCUS_25140 19618 21273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 21270 21668 gene locus_tag LOCUS_25150 21270 21668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 21665 21952 gene locus_tag LOCUS_25160 21665 21952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 22034 22258 gene locus_tag LOCUS_25170 22034 22258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 22251 22583 gene locus_tag LOCUS_25180 22251 22583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 22588 22827 gene locus_tag LOCUS_25190 22588 22827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 22829 23191 gene locus_tag LOCUS_25200 22829 23191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 23205 23423 gene locus_tag LOCUS_25210 23205 23423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 23496 24620 gene locus_tag LOCUS_25220 23496 24620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 24723 25412 gene locus_tag LOCUS_25230 24723 25412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 25435 26442 gene locus_tag LOCUS_25240 25435 26442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 26453 27193 gene locus_tag LOCUS_25250 26453 27193 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_25250 27193 27987 gene locus_tag LOCUS_25260 27193 27987 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719613.1 protein_id gnl|my_center|LOCUS_25260 28002 28796 gene locus_tag LOCUS_25270 28002 28796 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920880.1 protein_id gnl|my_center|LOCUS_25270 28800 29555 gene locus_tag LOCUS_25280 28800 29555 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_25280 31881 29824 gene locus_tag LOCUS_25290 31881 29824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 32339 31890 gene locus_tag LOCUS_25300 32339 31890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 32492 33766 gene locus_tag LOCUS_25310 32492 33766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 33791 35053 gene locus_tag LOCUS_25320 gene murA 33791 35053 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_25320 35399 35055 gene locus_tag LOCUS_25330 35399 35055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 35500 35835 gene locus_tag LOCUS_25340 35500 35835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 35839 36231 gene locus_tag LOCUS_25350 35839 36231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 36707 36195 gene locus_tag LOCUS_25360 gene tatB 36707 36195 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115042.1 protein_id gnl|my_center|LOCUS_25360 38126 36723 gene locus_tag LOCUS_25370 38126 36723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 38452 38246 gene locus_tag LOCUS_25380 38452 38246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 38430 40412 gene locus_tag LOCUS_25390 38430 40412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 40467 42038 gene locus_tag LOCUS_25400 40467 42038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 42041 43333 gene locus_tag LOCUS_25410 42041 43333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 43410 44240 gene locus_tag LOCUS_25420 43410 44240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 44248 45531 gene locus_tag LOCUS_25430 gene mtaB 44248 45531 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_25430 45510 46172 gene locus_tag LOCUS_25440 45510 46172 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082723.1 protein_id gnl|my_center|LOCUS_25440 46163 47032 gene locus_tag LOCUS_25450 46163 47032 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082725.1 protein_id gnl|my_center|LOCUS_25450 47166 48275 gene locus_tag LOCUS_25460 47166 48275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 50714 50295 gene locus_tag LOCUS_25470 50714 50295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 52154 51921 gene locus_tag LOCUS_25480 52154 51921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 52707 53039 gene locus_tag LOCUS_25490 52707 53039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 53047 53655 gene locus_tag LOCUS_25500 53047 53655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 55607 53685 gene locus_tag LOCUS_25510 55607 53685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 56103 55738 gene locus_tag LOCUS_25520 56103 55738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 56347 57924 gene locus_tag LOCUS_25530 56347 57924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 57943 59913 gene locus_tag LOCUS_25540 57943 59913 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141594.1 protein_id gnl|my_center|LOCUS_25540 59981 60739 gene locus_tag LOCUS_25550 59981 60739 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083961.1 protein_id gnl|my_center|LOCUS_25550 61018 61818 gene locus_tag LOCUS_25560 61018 61818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 61967 62506 gene locus_tag LOCUS_25570 61967 62506 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229712.1 protein_id gnl|my_center|LOCUS_25570 62528 63469 gene locus_tag LOCUS_25580 62528 63469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 >Feature sequence31 3598 746 gene locus_tag LOCUS_25590 3598 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 4062 3730 gene locus_tag LOCUS_25600 4062 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 4627 4028 gene locus_tag LOCUS_25610 4627 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 5579 4632 gene locus_tag LOCUS_25620 5579 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 6590 5583 gene locus_tag LOCUS_25630 6590 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 8536 6608 gene locus_tag LOCUS_25640 8536 6608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 9452 8589 gene locus_tag LOCUS_25650 9452 8589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 12881 9495 gene locus_tag LOCUS_25660 12881 9495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 13092 15473 gene locus_tag LOCUS_25670 13092 15473 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466031.1 protein_id gnl|my_center|LOCUS_25670 15548 17335 gene locus_tag LOCUS_25680 15548 17335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 18365 17685 gene locus_tag LOCUS_25690 18365 17685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 19312 18362 gene locus_tag LOCUS_25700 19312 18362 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256061.1 protein_id gnl|my_center|LOCUS_25700 20112 19549 gene locus_tag LOCUS_25710 20112 19549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 20570 20133 gene locus_tag LOCUS_25720 20570 20133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 20716 22737 gene locus_tag LOCUS_25730 20716 22737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 24588 22759 gene locus_tag LOCUS_25740 24588 22759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 25511 24645 gene locus_tag LOCUS_25750 25511 24645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 25636 26139 gene locus_tag LOCUS_25760 25636 26139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 28184 26151 gene locus_tag LOCUS_25770 28184 26151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 28364 30052 gene locus_tag LOCUS_25780 gene ettA 28364 30052 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_25780 30062 30985 gene locus_tag LOCUS_25790 30062 30985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 32391 31033 gene locus_tag LOCUS_25800 32391 31033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 32589 33899 gene locus_tag LOCUS_25810 32589 33899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 34631 33921 gene locus_tag LOCUS_25820 34631 33921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 36863 34647 gene locus_tag LOCUS_25830 36863 34647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 37636 36920 gene locus_tag LOCUS_25840 37636 36920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 37913 38524 gene locus_tag LOCUS_25850 37913 38524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 38651 41740 gene locus_tag LOCUS_25860 38651 41740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 41834 43132 gene locus_tag LOCUS_25870 41834 43132 CDS product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706316.1 protein_id gnl|my_center|LOCUS_25870 43201 43869 gene locus_tag LOCUS_25880 43201 43869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 43901 45190 gene locus_tag LOCUS_25890 43901 45190 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_25890 45338 47815 gene locus_tag LOCUS_25900 45338 47815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 47955 49454 gene locus_tag LOCUS_25910 47955 49454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 50592 49624 gene locus_tag LOCUS_25920 50592 49624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 51497 50589 gene locus_tag LOCUS_25930 51497 50589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 55347 51556 gene locus_tag LOCUS_25940 55347 51556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 55444 56478 gene locus_tag LOCUS_25950 55444 56478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 56560 56997 gene locus_tag LOCUS_25960 56560 56997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 57018 57203 gene locus_tag LOCUS_25970 57018 57203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 57356 59926 gene locus_tag LOCUS_25980 57356 59926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 60514 59936 gene locus_tag LOCUS_25990 60514 59936 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_25990 61271 60519 gene locus_tag LOCUS_26000 gene ubiE 61271 60519 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403588.1 protein_id gnl|my_center|LOCUS_26000 >Feature sequence32 1790 516 gene locus_tag LOCUS_26010 1790 516 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152423784.1 protein_id gnl|my_center|LOCUS_26010 2431 1787 gene locus_tag LOCUS_26020 2431 1787 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584159.1 protein_id gnl|my_center|LOCUS_26020 2671 3261 gene locus_tag LOCUS_26030 gene rsmD 2671 3261 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583502.1 protein_id gnl|my_center|LOCUS_26030 3224 3709 gene locus_tag LOCUS_26040 gene coaD 3224 3709 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941899.1 protein_id gnl|my_center|LOCUS_26040 4884 3814 gene locus_tag LOCUS_26050 4884 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 4979 5395 gene locus_tag LOCUS_26060 4979 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 5401 7347 gene locus_tag LOCUS_26070 5401 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 7344 7832 gene locus_tag LOCUS_26080 7344 7832 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803694.1 protein_id gnl|my_center|LOCUS_26080 8306 7962 gene locus_tag LOCUS_26090 8306 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 10214 8340 gene locus_tag LOCUS_26100 10214 8340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 11118 10435 gene locus_tag LOCUS_26110 11118 10435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 11956 11237 gene locus_tag LOCUS_26120 11956 11237 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_26120 12085 12522 gene locus_tag LOCUS_26130 12085 12522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 12519 13892 gene locus_tag LOCUS_26140 12519 13892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 14014 15093 gene locus_tag LOCUS_26150 14014 15093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 15201 16274 gene locus_tag LOCUS_26160 15201 16274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 16279 16872 gene locus_tag LOCUS_26170 16279 16872 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107707.1 protein_id gnl|my_center|LOCUS_26170 16905 19142 gene locus_tag LOCUS_26180 16905 19142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 20693 19152 gene locus_tag LOCUS_26190 20693 19152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 20946 22835 gene locus_tag LOCUS_26200 20946 22835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 23363 22971 gene locus_tag LOCUS_26210 23363 22971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 24584 23457 gene locus_tag LOCUS_26220 24584 23457 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878191.1 protein_id gnl|my_center|LOCUS_26220 25264 24581 gene locus_tag LOCUS_26230 25264 24581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 25978 25265 gene locus_tag LOCUS_26240 25978 25265 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_26240 26606 25971 gene locus_tag LOCUS_26250 26606 25971 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_26250 28030 26603 gene locus_tag LOCUS_26260 gene trmFO 28030 26603 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943183.1 protein_id gnl|my_center|LOCUS_26260 30329 28017 gene locus_tag LOCUS_26270 gene topA 30329 28017 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940644.1 protein_id gnl|my_center|LOCUS_26270 31339 30326 gene locus_tag LOCUS_26280 gene dprA 31339 30326 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114641.1 protein_id gnl|my_center|LOCUS_26280 31544 32002 gene locus_tag LOCUS_26290 31544 32002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 32019 33176 gene locus_tag LOCUS_26300 gene hemW 32019 33176 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_26300 33176 34003 gene locus_tag LOCUS_26310 33176 34003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 34019 34810 gene locus_tag LOCUS_26320 34019 34810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 34807 35202 gene locus_tag LOCUS_26330 34807 35202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 35199 35873 gene locus_tag LOCUS_26340 gene sctR 35199 35873 CDS product type III secretion system export apparatus subunit SctR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176700.1 protein_id gnl|my_center|LOCUS_26340 35878 36144 gene locus_tag LOCUS_26350 35878 36144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 36154 36912 gene locus_tag LOCUS_26360 36154 36912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 37049 41251 gene locus_tag LOCUS_26370 37049 41251 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200903603.1 protein_id gnl|my_center|LOCUS_26370 42173 41457 gene locus_tag LOCUS_26380 42173 41457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 43046 43819 gene locus_tag LOCUS_26390 43046 43819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 49178 43875 gene locus_tag LOCUS_26400 49178 43875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 51413 50910 gene locus_tag LOCUS_26410 51413 50910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 51973 51410 gene locus_tag LOCUS_26420 51973 51410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 52745 51963 gene locus_tag LOCUS_26430 52745 51963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 54348 52855 gene locus_tag LOCUS_26440 54348 52855 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022102.1 protein_id gnl|my_center|LOCUS_26440 55736 54345 gene locus_tag LOCUS_26450 55736 54345 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138985883.1 protein_id gnl|my_center|LOCUS_26450 58521 55747 gene locus_tag LOCUS_26460 58521 55747 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022108.1 protein_id gnl|my_center|LOCUS_26460 59617 58742 gene locus_tag LOCUS_26470 59617 58742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 >Feature sequence33 2 826 gene locus_tag LOCUS_26480 2 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 3230 834 gene locus_tag LOCUS_26490 3230 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 3392 4513 gene locus_tag LOCUS_26500 3392 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 4667 5371 gene locus_tag LOCUS_26510 4667 5371 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_26510 5355 7850 gene locus_tag LOCUS_26520 gene bamA 5355 7850 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_26520 7850 8362 gene locus_tag LOCUS_26530 7850 8362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 8444 8998 gene locus_tag LOCUS_26540 8444 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 9006 10697 gene locus_tag LOCUS_26550 9006 10697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 10758 12626 gene locus_tag LOCUS_26560 10758 12626 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048401.1 protein_id gnl|my_center|LOCUS_26560 13825 12929 gene locus_tag LOCUS_26570 gene xerD 13825 12929 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942464.1 protein_id gnl|my_center|LOCUS_26570 13957 18321 gene locus_tag LOCUS_26580 13957 18321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 18451 19338 gene locus_tag LOCUS_26590 18451 19338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 19443 20843 gene locus_tag LOCUS_26600 19443 20843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 20878 23451 gene locus_tag LOCUS_26610 20878 23451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 24539 23466 gene locus_tag LOCUS_26620 24539 23466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 25920 24643 gene locus_tag LOCUS_26630 25920 24643 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151982.1 protein_id gnl|my_center|LOCUS_26630 26274 26020 gene locus_tag LOCUS_26640 26274 26020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 26950 26306 gene locus_tag LOCUS_26650 26950 26306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 27221 27745 gene locus_tag LOCUS_26660 27221 27745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 27765 29195 gene locus_tag LOCUS_26670 27765 29195 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785475.1 protein_id gnl|my_center|LOCUS_26670 29287 31614 gene locus_tag LOCUS_26680 29287 31614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 31625 32290 gene locus_tag LOCUS_26690 31625 32290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 32407 34716 gene locus_tag LOCUS_26700 32407 34716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 34732 36348 gene locus_tag LOCUS_26710 34732 36348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 36419 38137 gene locus_tag LOCUS_26720 36419 38137 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174683.1 protein_id gnl|my_center|LOCUS_26720 39434 38364 gene locus_tag LOCUS_26730 39434 38364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 40516 39431 gene locus_tag LOCUS_26740 40516 39431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 41184 40582 gene locus_tag LOCUS_26750 gene coaE 41184 40582 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393338.1 protein_id gnl|my_center|LOCUS_26750 41597 41181 gene locus_tag LOCUS_26760 41597 41181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 44968 41861 gene locus_tag LOCUS_26770 44968 41861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 45462 45034 gene locus_tag LOCUS_26780 45462 45034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 45610 45813 gene locus_tag LOCUS_26790 45610 45813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 45844 46038 gene locus_tag LOCUS_26800 45844 46038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 46346 46065 gene locus_tag LOCUS_26810 46346 46065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 47083 46343 gene locus_tag LOCUS_26820 47083 46343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 47909 47256 gene locus_tag LOCUS_26830 47909 47256 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937593.1 protein_id gnl|my_center|LOCUS_26830 49463 50641 gene locus_tag LOCUS_26840 49463 50641 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460999.1 protein_id gnl|my_center|LOCUS_26840 51981 50650 gene locus_tag LOCUS_26850 51981 50650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 52926 51997 gene locus_tag LOCUS_26860 52926 51997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 53103 53606 gene locus_tag LOCUS_26870 53103 53606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 53613 55640 gene locus_tag LOCUS_26880 gene bcrD 53613 55640 CDS product SctV family type III secretion system export apparatus subunit BcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039314.1 protein_id gnl|my_center|LOCUS_26880 55657 56994 gene locus_tag LOCUS_26890 55657 56994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 57051 59144 gene locus_tag LOCUS_26900 57051 59144 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206614.1 protein_id gnl|my_center|LOCUS_26900 >Feature sequence34 1450 272 gene locus_tag LOCUS_26910 gene thiI 1450 272 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_26910 2435 1467 gene locus_tag LOCUS_26920 gene arcC 2435 1467 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251108.1 protein_id gnl|my_center|LOCUS_26920 3242 2496 gene locus_tag LOCUS_26930 3242 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 3836 3252 gene locus_tag LOCUS_26940 3836 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 4442 3882 gene locus_tag LOCUS_26950 4442 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 4587 5261 gene locus_tag LOCUS_26960 4587 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 5456 5929 gene locus_tag LOCUS_26970 5456 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 6049 7380 gene locus_tag LOCUS_26980 6049 7380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 8352 7390 gene locus_tag LOCUS_26990 8352 7390 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258828.1 protein_id gnl|my_center|LOCUS_26990 9137 8466 gene locus_tag LOCUS_27000 9137 8466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 9775 9134 gene locus_tag LOCUS_27010 9775 9134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 11365 9782 gene locus_tag LOCUS_27020 11365 9782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 12229 11369 gene locus_tag LOCUS_27030 12229 11369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 12692 12222 gene locus_tag LOCUS_27040 12692 12222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 12580 12822 gene locus_tag LOCUS_27050 12580 12822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 13732 12776 gene locus_tag LOCUS_27060 13732 12776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 15192 13750 gene locus_tag LOCUS_27070 15192 13750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 17362 15347 gene locus_tag LOCUS_27080 gene pepF 17362 15347 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003393.1 protein_id gnl|my_center|LOCUS_27080 17465 17968 gene locus_tag LOCUS_27090 17465 17968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 18057 18830 gene locus_tag LOCUS_27100 18057 18830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 18820 19302 gene locus_tag LOCUS_27110 18820 19302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 19299 20714 gene locus_tag LOCUS_27120 19299 20714 CDS product VanW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944666.1 protein_id gnl|my_center|LOCUS_27120 21140 20727 gene locus_tag LOCUS_27130 21140 20727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 22801 21227 gene locus_tag LOCUS_27140 22801 21227 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917973.1 protein_id gnl|my_center|LOCUS_27140 23020 24237 gene locus_tag LOCUS_27150 23020 24237 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941822.1 protein_id gnl|my_center|LOCUS_27150 24234 27389 gene locus_tag LOCUS_27160 24234 27389 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762065.1 protein_id gnl|my_center|LOCUS_27160 27386 27727 gene locus_tag LOCUS_27170 27386 27727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 29660 27744 gene locus_tag LOCUS_27180 29660 27744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 30708 29749 gene locus_tag LOCUS_27190 30708 29749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 30823 32013 gene locus_tag LOCUS_27200 30823 32013 CDS product DUF2891 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184801.1 protein_id gnl|my_center|LOCUS_27200 32037 33086 gene locus_tag LOCUS_27210 32037 33086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 33674 33087 gene locus_tag LOCUS_27220 33674 33087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 34288 33671 gene locus_tag LOCUS_27230 34288 33671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 35564 34704 gene locus_tag LOCUS_27240 35564 34704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 37326 35728 gene locus_tag LOCUS_27250 37326 35728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 38760 37330 gene locus_tag LOCUS_27260 38760 37330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 39056 39964 gene locus_tag LOCUS_27270 39056 39964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 40264 39878 gene locus_tag LOCUS_27280 40264 39878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 40476 41585 gene locus_tag LOCUS_27290 40476 41585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 42597 41635 gene locus_tag LOCUS_27300 42597 41635 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921669.1 protein_id gnl|my_center|LOCUS_27300 42947 42612 gene locus_tag LOCUS_27310 42947 42612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 44982 42955 gene locus_tag LOCUS_27320 44982 42955 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036303.1 protein_id gnl|my_center|LOCUS_27320 45148 46866 gene locus_tag LOCUS_27330 45148 46866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 46863 47570 gene locus_tag LOCUS_27340 46863 47570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 47704 48186 gene locus_tag LOCUS_27350 gene rimP 47704 48186 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 protein_id gnl|my_center|LOCUS_27350 48240 49853 gene locus_tag LOCUS_27360 gene nusA 48240 49853 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391526.1 protein_id gnl|my_center|LOCUS_27360 49876 50304 gene locus_tag LOCUS_27370 49876 50304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 50294 53095 gene locus_tag LOCUS_27380 gene infB 50294 53095 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942233.1 protein_id gnl|my_center|LOCUS_27380 53126 53743 gene locus_tag LOCUS_27390 53126 53743 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 protein_id gnl|my_center|LOCUS_27390 53751 54284 gene locus_tag LOCUS_27400 53751 54284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 55457 55287 gene locus_tag LOCUS_27410 55457 55287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 55659 56894 gene locus_tag LOCUS_27420 55659 56894 CDS product IS91-like element ISVsa3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120888.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27420 >Feature sequence35 465 1313 gene locus_tag LOCUS_27430 465 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 2793 1324 gene locus_tag LOCUS_27440 2793 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 2990 4105 gene locus_tag LOCUS_27450 2990 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 4158 5027 gene locus_tag LOCUS_27460 4158 5027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 7562 5064 gene locus_tag LOCUS_27470 7562 5064 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_27470 8755 7703 gene locus_tag LOCUS_27480 8755 7703 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074319.1 protein_id gnl|my_center|LOCUS_27480 11869 8897 gene locus_tag LOCUS_27490 11869 8897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 12195 11866 gene locus_tag LOCUS_27500 12195 11866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 15313 12362 gene locus_tag LOCUS_27510 15313 12362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 15662 17521 gene locus_tag LOCUS_27520 15662 17521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 17511 18260 gene locus_tag LOCUS_27530 17511 18260 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_27530 18257 19183 gene locus_tag LOCUS_27540 18257 19183 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_27540 19180 19839 gene locus_tag LOCUS_27550 gene cmk 19180 19839 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208396322.1 protein_id gnl|my_center|LOCUS_27550 19853 20032 gene locus_tag LOCUS_27560 19853 20032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 20257 20943 gene locus_tag LOCUS_27570 20257 20943 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400924.1 protein_id gnl|my_center|LOCUS_27570 20988 22142 gene locus_tag LOCUS_27580 20988 22142 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963492.1 protein_id gnl|my_center|LOCUS_27580 22121 22657 gene locus_tag LOCUS_27590 gene purE 22121 22657 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963493.1 protein_id gnl|my_center|LOCUS_27590 22650 23636 gene locus_tag LOCUS_27600 22650 23636 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383387.1 protein_id gnl|my_center|LOCUS_27600 23643 24281 gene locus_tag LOCUS_27610 gene can 23643 24281 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_27610 29046 24295 gene locus_tag LOCUS_27620 29046 24295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 32445 29062 gene locus_tag LOCUS_27630 32445 29062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 34897 32468 gene locus_tag LOCUS_27640 34897 32468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 37338 34951 gene locus_tag LOCUS_27650 37338 34951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 38269 37511 gene locus_tag LOCUS_27660 gene bpsR 38269 37511 CDS product autoinducer-binding transcriptional regulator BpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184923.1 protein_id gnl|my_center|LOCUS_27660 39564 38359 gene locus_tag LOCUS_27670 39564 38359 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202073.1 protein_id gnl|my_center|LOCUS_27670 40922 39561 gene locus_tag LOCUS_27680 gene thrC 40922 39561 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_27680 42418 40958 gene locus_tag LOCUS_27690 42418 40958 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207853.1 protein_id gnl|my_center|LOCUS_27690 45028 42536 gene locus_tag LOCUS_27700 45028 42536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 47115 45091 gene locus_tag LOCUS_27710 47115 45091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 47324 48694 gene locus_tag LOCUS_27720 47324 48694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 48761 50341 gene locus_tag LOCUS_27730 48761 50341 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144137.1 protein_id gnl|my_center|LOCUS_27730 50338 51486 gene locus_tag LOCUS_27740 50338 51486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 51679 53751 gene locus_tag LOCUS_27750 51679 53751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 53755 54927 gene locus_tag LOCUS_27760 53755 54927 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022798454.1 protein_id gnl|my_center|LOCUS_27760 >Feature sequence36 1686 61 gene locus_tag LOCUS_27770 1686 61 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143151.1 protein_id gnl|my_center|LOCUS_27770 2986 1916 gene locus_tag LOCUS_27780 2986 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 3283 3065 gene locus_tag LOCUS_27790 3283 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 3667 3320 gene locus_tag LOCUS_27800 3667 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 3972 3667 gene locus_tag LOCUS_27810 3972 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 4241 3981 gene locus_tag LOCUS_27820 4241 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 4550 4248 gene locus_tag LOCUS_27830 4550 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 4965 4543 gene locus_tag LOCUS_27840 4965 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 6843 5245 gene locus_tag LOCUS_27850 6843 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 7183 6914 gene locus_tag LOCUS_27860 7183 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 7160 7435 gene locus_tag LOCUS_27870 7160 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 8133 7948 gene locus_tag LOCUS_27880 8133 7948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 8384 8130 gene locus_tag LOCUS_27890 8384 8130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 8623 8381 gene locus_tag LOCUS_27900 8623 8381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 8920 9897 gene locus_tag LOCUS_27910 gene argF 8920 9897 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930280.1 protein_id gnl|my_center|LOCUS_27910 9998 10858 gene locus_tag LOCUS_27920 9998 10858 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107699.1 protein_id gnl|my_center|LOCUS_27920 10851 11642 gene locus_tag LOCUS_27930 10851 11642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 11644 12033 gene locus_tag LOCUS_27940 11644 12033 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804269.1 protein_id gnl|my_center|LOCUS_27940 12020 12739 gene locus_tag LOCUS_27950 12020 12739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 15205 12959 gene locus_tag LOCUS_27960 15205 12959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 16013 15231 gene locus_tag LOCUS_27970 16013 15231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 18462 16006 gene locus_tag LOCUS_27980 gene gyrB 18462 16006 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070020.1 protein_id gnl|my_center|LOCUS_27980 19945 18620 gene locus_tag LOCUS_27990 19945 18620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 22884 19942 gene locus_tag LOCUS_28000 22884 19942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 23581 22895 gene locus_tag LOCUS_28010 23581 22895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 25797 23578 gene locus_tag LOCUS_28020 gene ligA 25797 23578 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393509.1 protein_id gnl|my_center|LOCUS_28020 26718 25819 gene locus_tag LOCUS_28030 26718 25819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 28337 26808 gene locus_tag LOCUS_28040 28337 26808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 30364 28337 gene locus_tag LOCUS_28050 30364 28337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 30490 30828 gene locus_tag LOCUS_28060 30490 30828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 30838 31155 gene locus_tag LOCUS_28070 30838 31155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 31176 31736 gene locus_tag LOCUS_28080 31176 31736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 31756 32301 gene locus_tag LOCUS_28090 31756 32301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 33449 32517 gene locus_tag LOCUS_28100 33449 32517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 33701 35719 gene locus_tag LOCUS_28110 33701 35719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 36692 35928 gene locus_tag LOCUS_28120 36692 35928 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061125.1 protein_id gnl|my_center|LOCUS_28120 37440 36694 gene locus_tag LOCUS_28130 37440 36694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 38270 37437 gene locus_tag LOCUS_28140 38270 37437 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_28140 39148 38267 gene locus_tag LOCUS_28150 39148 38267 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879451.1 protein_id gnl|my_center|LOCUS_28150 40278 39145 gene locus_tag LOCUS_28160 40278 39145 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939810.1 protein_id gnl|my_center|LOCUS_28160 41732 40275 gene locus_tag LOCUS_28170 41732 40275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 43377 41992 gene locus_tag LOCUS_28180 gene nhaC 43377 41992 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 protein_id gnl|my_center|LOCUS_28180 44095 43433 gene locus_tag LOCUS_28190 44095 43433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 44334 45176 gene locus_tag LOCUS_28200 44334 45176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 45184 46563 gene locus_tag LOCUS_28210 45184 46563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 46577 49330 gene locus_tag LOCUS_28220 46577 49330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 49356 51422 gene locus_tag LOCUS_28230 49356 51422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 51547 53037 gene locus_tag LOCUS_28240 51547 53037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 53139 54308 gene locus_tag LOCUS_28250 53139 54308 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870216.1 protein_id gnl|my_center|LOCUS_28250 54386 55249 gene locus_tag LOCUS_28260 54386 55249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 55939 55259 gene locus_tag LOCUS_28270 55939 55259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 >Feature sequence37 377 451 gene locus_tag LOCUS_t00380 377 451 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1037 474 gene locus_tag LOCUS_28280 1037 474 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967402.1 protein_id gnl|my_center|LOCUS_28280 3234 1039 gene locus_tag LOCUS_28290 3234 1039 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 protein_id gnl|my_center|LOCUS_28290 3346 4416 gene locus_tag LOCUS_28300 3346 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 4521 6905 gene locus_tag LOCUS_28310 4521 6905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 7379 8164 gene locus_tag LOCUS_28320 7379 8164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 8282 9070 gene locus_tag LOCUS_28330 8282 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 9084 10229 gene locus_tag LOCUS_28340 9084 10229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 10226 10978 gene locus_tag LOCUS_28350 10226 10978 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_28350 12066 10951 gene locus_tag LOCUS_28360 12066 10951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 13194 12073 gene locus_tag LOCUS_28370 gene hisC 13194 12073 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_28370 14835 13351 gene locus_tag LOCUS_28380 14835 13351 CDS product choice-of-anchor Q domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256176.1 protein_id gnl|my_center|LOCUS_28380 16183 14942 gene locus_tag LOCUS_28390 16183 14942 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528130.1 protein_id gnl|my_center|LOCUS_28390 17790 16213 gene locus_tag LOCUS_28400 17790 16213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 18611 17787 gene locus_tag LOCUS_28410 18611 17787 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_28410 20618 18642 gene locus_tag LOCUS_28420 20618 18642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 20899 21729 gene locus_tag LOCUS_28430 20899 21729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 21843 23345 gene locus_tag LOCUS_28440 21843 23345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 24432 23353 gene locus_tag LOCUS_28450 24432 23353 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_28450 24606 25175 gene locus_tag LOCUS_28460 24606 25175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 26684 25326 gene locus_tag LOCUS_28470 26684 25326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 27834 26746 gene locus_tag LOCUS_28480 27834 26746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 29180 27843 gene locus_tag LOCUS_28490 29180 27843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 29788 29177 gene locus_tag LOCUS_28500 29788 29177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 30050 34459 gene locus_tag LOCUS_28510 30050 34459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 34487 35110 gene locus_tag LOCUS_28520 34487 35110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 35546 35250 gene locus_tag LOCUS_28530 35546 35250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 36116 37345 gene locus_tag LOCUS_28540 36116 37345 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_28540 37588 37346 gene locus_tag LOCUS_28550 37588 37346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 37869 39101 gene locus_tag LOCUS_28560 37869 39101 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_28560 39306 41537 gene locus_tag LOCUS_28570 39306 41537 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_28570 41615 42304 gene locus_tag LOCUS_28580 gene aqpZ 41615 42304 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262065.1 protein_id gnl|my_center|LOCUS_28580 42752 42282 gene locus_tag LOCUS_28590 42752 42282 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039646035.1 protein_id gnl|my_center|LOCUS_28590 44219 42762 gene locus_tag LOCUS_28600 44219 42762 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787371.1 protein_id gnl|my_center|LOCUS_28600 44395 46509 gene locus_tag LOCUS_28610 44395 46509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 47376 46513 gene locus_tag LOCUS_28620 47376 46513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_28620 47535 49472 gene locus_tag LOCUS_28630 47535 49472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 51584 49650 gene locus_tag LOCUS_28640 51584 49650 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224279.1 protein_id gnl|my_center|LOCUS_28640 51744 52142 gene locus_tag LOCUS_28650 51744 52142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 53718 52210 gene locus_tag LOCUS_28660 53718 52210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 >Feature sequence38 1152 64 gene locus_tag LOCUS_28670 gene nqrF 1152 64 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103964.1 protein_id gnl|my_center|LOCUS_28670 1802 1167 gene locus_tag LOCUS_28680 gene nqrE 1802 1167 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071351.1 protein_id gnl|my_center|LOCUS_28680 2392 1799 gene locus_tag LOCUS_28690 2392 1799 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456515.1 protein_id gnl|my_center|LOCUS_28690 3015 2389 gene locus_tag LOCUS_28700 3015 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 4084 3008 gene locus_tag LOCUS_28710 4084 3008 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763477.1 protein_id gnl|my_center|LOCUS_28710 5424 4081 gene locus_tag LOCUS_28720 5424 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28720 5691 5891 gene locus_tag LOCUS_28730 5691 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 6293 6018 gene locus_tag LOCUS_28740 6293 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 6409 6573 gene locus_tag LOCUS_28750 6409 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 7054 6590 gene locus_tag LOCUS_28760 7054 6590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 9661 7076 gene locus_tag LOCUS_28770 gene polA 9661 7076 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_28770 10325 9663 gene locus_tag LOCUS_28780 10325 9663 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706961.1 protein_id gnl|my_center|LOCUS_28780 11278 10325 gene locus_tag LOCUS_28790 11278 10325 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267575.1 protein_id gnl|my_center|LOCUS_28790 12276 11275 gene locus_tag LOCUS_28800 12276 11275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 13418 12288 gene locus_tag LOCUS_28810 13418 12288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 13603 15171 gene locus_tag LOCUS_28820 13603 15171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 15312 16877 gene locus_tag LOCUS_28830 15312 16877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 16911 17960 gene locus_tag LOCUS_28840 16911 17960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 18108 19667 gene locus_tag LOCUS_28850 18108 19667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 20946 19744 gene locus_tag LOCUS_28860 20946 19744 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103653.1 protein_id gnl|my_center|LOCUS_28860 23000 20946 gene locus_tag LOCUS_28870 23000 20946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 24665 23076 gene locus_tag LOCUS_28880 24665 23076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 26177 24675 gene locus_tag LOCUS_28890 26177 24675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 26994 26416 gene locus_tag LOCUS_28900 26994 26416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 28238 26991 gene locus_tag LOCUS_28910 28238 26991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 28959 28390 gene locus_tag LOCUS_28920 28959 28390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 29559 28969 gene locus_tag LOCUS_28930 29559 28969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 31142 29583 gene locus_tag LOCUS_28940 31142 29583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 32153 31167 gene locus_tag LOCUS_28950 32153 31167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 34363 32150 gene locus_tag LOCUS_28960 34363 32150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 36957 34360 gene locus_tag LOCUS_28970 36957 34360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 37346 37966 gene locus_tag LOCUS_28980 37346 37966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 38322 39371 gene locus_tag LOCUS_28990 38322 39371 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215055.1 protein_id gnl|my_center|LOCUS_28990 39368 39892 gene locus_tag LOCUS_29000 39368 39892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 40212 39922 gene locus_tag LOCUS_29010 40212 39922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 42036 40216 gene locus_tag LOCUS_29020 gene cas1 42036 40216 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_29020 42437 42536 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42537 43809 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccgcttcctccgggaagcggccccattgaagc 43810 43909 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43910 45037 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccgcttcctccgggaagcggccccattgaagc 45100 45321 gene locus_tag LOCUS_29030 45100 45321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 45982 45311 gene locus_tag LOCUS_29040 45982 45311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 47184 46168 gene locus_tag LOCUS_29050 47184 46168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 48728 47505 gene locus_tag LOCUS_29060 48728 47505 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 protein_id gnl|my_center|LOCUS_29060 49415 48900 gene locus_tag LOCUS_29070 49415 48900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 49589 50161 gene locus_tag LOCUS_29080 49589 50161 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225037.1 protein_id gnl|my_center|LOCUS_29080 50158 50493 gene locus_tag LOCUS_29090 50158 50493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 50490 50969 gene locus_tag LOCUS_29100 50490 50969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 53461 50954 gene locus_tag LOCUS_29110 53461 50954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 53793 54023 gene locus_tag LOCUS_29120 53793 54023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 >Feature sequence39 467 985 gene locus_tag LOCUS_29130 467 985 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_29130 1150 1899 gene locus_tag LOCUS_29140 1150 1899 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647871.1 protein_id gnl|my_center|LOCUS_29140 1857 2432 gene locus_tag LOCUS_29150 1857 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 2844 2542 gene locus_tag LOCUS_29160 2844 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 3200 2841 gene locus_tag LOCUS_29170 3200 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 4072 4590 gene locus_tag LOCUS_29180 4072 4590 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_29180 4747 5100 gene locus_tag LOCUS_29190 4747 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 5293 5955 gene locus_tag LOCUS_29200 5293 5955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 5952 6563 gene locus_tag LOCUS_29210 5952 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 7270 8583 gene locus_tag LOCUS_29220 7270 8583 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_29220 9200 8934 gene locus_tag LOCUS_29230 9200 8934 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986881.1 protein_id gnl|my_center|LOCUS_29230 10163 9291 gene locus_tag LOCUS_29240 10163 9291 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_29240 10755 10156 gene locus_tag LOCUS_29250 10755 10156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942017.1 protein_id gnl|my_center|LOCUS_29250 10967 11386 gene locus_tag LOCUS_29260 10967 11386 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957957.1 protein_id gnl|my_center|LOCUS_29260 11379 11669 gene locus_tag LOCUS_29270 11379 11669 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957958.1 protein_id gnl|my_center|LOCUS_29270 11697 11858 gene locus_tag LOCUS_29280 11697 11858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 11855 16066 gene locus_tag LOCUS_29290 11855 16066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 16162 16587 gene locus_tag LOCUS_29300 16162 16587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 16584 16718 gene locus_tag LOCUS_29310 16584 16718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 18970 16877 gene locus_tag LOCUS_29320 18970 16877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 20058 18994 gene locus_tag LOCUS_29330 20058 18994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 20127 20201 gene locus_tag LOCUS_t00390 20127 20201 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 21868 21020 gene locus_tag LOCUS_29340 21868 21020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 21900 21975 gene locus_tag LOCUS_t00400 21900 21975 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 23175 21985 gene locus_tag LOCUS_29350 23175 21985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 23401 23500 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23706 27989 gene locus_tag LOCUS_29360 23706 27989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 28000 32034 gene locus_tag LOCUS_29370 28000 32034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 32168 32482 gene locus_tag LOCUS_29380 gene rplU 32168 32482 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869646.1 protein_id gnl|my_center|LOCUS_29380 32493 32756 gene locus_tag LOCUS_29390 gene rpmA 32493 32756 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140826.1 protein_id gnl|my_center|LOCUS_29390 32797 33798 gene locus_tag LOCUS_29400 gene obgE 32797 33798 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194312.1 protein_id gnl|my_center|LOCUS_29400 33979 35823 gene locus_tag LOCUS_29410 33979 35823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 35887 36705 gene locus_tag LOCUS_29420 35887 36705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 36758 37591 gene locus_tag LOCUS_29430 36758 37591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 37746 38564 gene locus_tag LOCUS_29440 37746 38564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 38581 39423 gene locus_tag LOCUS_29450 38581 39423 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136348290.1 protein_id gnl|my_center|LOCUS_29450 39441 40301 gene locus_tag LOCUS_29460 39441 40301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 40302 41711 gene locus_tag LOCUS_29470 40302 41711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 41730 44348 gene locus_tag LOCUS_29480 41730 44348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 44357 44860 gene locus_tag LOCUS_29490 44357 44860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 45184 46539 gene locus_tag LOCUS_29500 gene cotH 45184 46539 CDS product spore coat protein CotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227854.1 protein_id gnl|my_center|LOCUS_29500 46541 47701 gene locus_tag LOCUS_29510 46541 47701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 47714 50590 gene locus_tag LOCUS_29520 47714 50590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 50587 51201 gene locus_tag LOCUS_29530 50587 51201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 51185 51940 gene locus_tag LOCUS_29540 51185 51940 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065332.1 protein_id gnl|my_center|LOCUS_29540 51933 52628 gene locus_tag LOCUS_29550 51933 52628 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065331.1 protein_id gnl|my_center|LOCUS_29550 >Feature sequence40 1448 255 gene locus_tag LOCUS_29560 1448 255 CDS product ISAs1-like element ISEc5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421020.1 protein_id gnl|my_center|LOCUS_29560 1644 2762 gene locus_tag LOCUS_29570 1644 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 2768 3580 gene locus_tag LOCUS_29580 2768 3580 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941055.1 protein_id gnl|my_center|LOCUS_29580 3661 4593 gene locus_tag LOCUS_29590 3661 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 4584 6542 gene locus_tag LOCUS_29600 4584 6542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 6663 8003 gene locus_tag LOCUS_29610 6663 8003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 8062 8493 gene locus_tag LOCUS_29620 8062 8493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 8612 8803 gene locus_tag LOCUS_29630 gene rpmB 8612 8803 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416297.1 protein_id gnl|my_center|LOCUS_29630 8815 9405 gene locus_tag LOCUS_29640 8815 9405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 9453 10658 gene locus_tag LOCUS_29650 9453 10658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 10655 12259 gene locus_tag LOCUS_29660 10655 12259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 13449 12271 gene locus_tag LOCUS_29670 13449 12271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 14168 13482 gene locus_tag LOCUS_29680 14168 13482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 15077 14175 gene locus_tag LOCUS_29690 15077 14175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 16474 15077 gene locus_tag LOCUS_29700 16474 15077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 17150 16479 gene locus_tag LOCUS_29710 17150 16479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 17951 17256 gene locus_tag LOCUS_29720 17951 17256 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_29720 18140 17952 gene locus_tag LOCUS_29730 18140 17952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 20206 18137 gene locus_tag LOCUS_29740 20206 18137 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_29740 20927 22105 gene locus_tag LOCUS_29750 20927 22105 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927165.1 protein_id gnl|my_center|LOCUS_29750 22126 22557 gene locus_tag LOCUS_29760 22126 22557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 22554 23462 gene locus_tag LOCUS_29770 22554 23462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 25524 23647 gene locus_tag LOCUS_29780 25524 23647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 25656 27710 gene locus_tag LOCUS_29790 25656 27710 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640383.1 protein_id gnl|my_center|LOCUS_29790 28335 27721 gene locus_tag LOCUS_29800 28335 27721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 28485 29246 gene locus_tag LOCUS_29810 28485 29246 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962337.1 protein_id gnl|my_center|LOCUS_29810 31806 29470 gene locus_tag LOCUS_29820 31806 29470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 32417 31803 gene locus_tag LOCUS_29830 32417 31803 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261151.1 protein_id gnl|my_center|LOCUS_29830 33793 32417 gene locus_tag LOCUS_29840 33793 32417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 34475 33822 gene locus_tag LOCUS_29850 34475 33822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 35998 34658 gene locus_tag LOCUS_29860 gene hisS 35998 34658 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964121.1 protein_id gnl|my_center|LOCUS_29860 36111 37247 gene locus_tag LOCUS_29870 36111 37247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 37263 45533 gene locus_tag LOCUS_29880 37263 45533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 45536 45946 gene locus_tag LOCUS_29890 45536 45946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 45943 47814 gene locus_tag LOCUS_29900 45943 47814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 47811 49232 gene locus_tag LOCUS_29910 47811 49232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 49254 50792 gene locus_tag LOCUS_29920 49254 50792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 50933 50796 gene locus_tag LOCUS_29930 50933 50796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 52415 51033 gene locus_tag LOCUS_29940 52415 51033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 >Feature sequence41 856 149 gene locus_tag LOCUS_29950 856 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 1278 3725 gene locus_tag LOCUS_29960 1278 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 3738 4298 gene locus_tag LOCUS_29970 3738 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 4638 5162 gene locus_tag LOCUS_29980 4638 5162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 5914 5183 gene locus_tag LOCUS_29990 5914 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 7115 6579 gene locus_tag LOCUS_30000 7115 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 7759 8076 gene locus_tag LOCUS_30010 7759 8076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 8786 9547 gene locus_tag LOCUS_30020 8786 9547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 11618 9567 gene locus_tag LOCUS_30030 11618 9567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 11789 17872 gene locus_tag LOCUS_30040 11789 17872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 17869 18819 gene locus_tag LOCUS_30050 17869 18819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 18932 19510 gene locus_tag LOCUS_30060 18932 19510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 20388 19507 gene locus_tag LOCUS_30070 20388 19507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 20521 22335 gene locus_tag LOCUS_30080 20521 22335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 22429 23259 gene locus_tag LOCUS_30090 22429 23259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 23256 25790 gene locus_tag LOCUS_30100 23256 25790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 25810 28191 gene locus_tag LOCUS_30110 25810 28191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 31308 28210 gene locus_tag LOCUS_30120 31308 28210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 31563 32684 gene locus_tag LOCUS_30130 31563 32684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 32681 33292 gene locus_tag LOCUS_30140 32681 33292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 35029 33338 gene locus_tag LOCUS_30150 35029 33338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 34870 34969 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35132 35452 gene locus_tag LOCUS_30160 35132 35452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 36027 38318 gene locus_tag LOCUS_30170 36027 38318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 41048 38331 gene locus_tag LOCUS_30180 41048 38331 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943038.1 protein_id gnl|my_center|LOCUS_30180 41143 41277 gene locus_tag LOCUS_30190 41143 41277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 41338 41745 gene locus_tag LOCUS_30200 41338 41745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 41800 44271 gene locus_tag LOCUS_30210 41800 44271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 44659 47016 gene locus_tag LOCUS_30220 44659 47016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 48839 47031 gene locus_tag LOCUS_30230 48839 47031 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257769.1 protein_id gnl|my_center|LOCUS_30230 49455 50384 gene locus_tag LOCUS_30240 49455 50384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 >Feature sequence42 370 92 gene locus_tag LOCUS_30250 370 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 294 1865 gene locus_tag LOCUS_30260 294 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 2751 1849 gene locus_tag LOCUS_30270 2751 1849 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_30270 3402 2755 gene locus_tag LOCUS_30280 3402 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 4247 3405 gene locus_tag LOCUS_30290 gene mtnP 4247 3405 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_30290 4417 5076 gene locus_tag LOCUS_30300 4417 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 5109 6998 gene locus_tag LOCUS_30310 5109 6998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 8659 8758 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8923 9474 gene locus_tag LOCUS_30320 8923 9474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 9480 10472 gene locus_tag LOCUS_30330 9480 10472 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922072.1 protein_id gnl|my_center|LOCUS_30330 10504 11436 gene locus_tag LOCUS_30340 10504 11436 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121418.1 protein_id gnl|my_center|LOCUS_30340 11433 13559 gene locus_tag LOCUS_30350 11433 13559 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259247.1 protein_id gnl|my_center|LOCUS_30350 13658 16456 gene locus_tag LOCUS_30360 13658 16456 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922073.1 protein_id gnl|my_center|LOCUS_30360 17864 16557 gene locus_tag LOCUS_30370 17864 16557 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250733.1 protein_id gnl|my_center|LOCUS_30370 18369 18118 gene locus_tag LOCUS_30380 18369 18118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 18386 20545 gene locus_tag LOCUS_30390 18386 20545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 20637 21398 gene locus_tag LOCUS_30400 20637 21398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420704.1 protein_id gnl|my_center|LOCUS_30400 21446 21679 gene locus_tag LOCUS_30410 21446 21679 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869641.1 protein_id gnl|my_center|LOCUS_30410 21689 22777 gene locus_tag LOCUS_30420 21689 22777 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869339.1 protein_id gnl|my_center|LOCUS_30420 22774 23517 gene locus_tag LOCUS_30430 22774 23517 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_30430 23530 24105 gene locus_tag LOCUS_30440 23530 24105 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869337.1 protein_id gnl|my_center|LOCUS_30440 24105 24584 gene locus_tag LOCUS_30450 24105 24584 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869222.1 protein_id gnl|my_center|LOCUS_30450 24581 26488 gene locus_tag LOCUS_30460 gene nuoF 24581 26488 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393387.1 protein_id gnl|my_center|LOCUS_30460 26494 27273 gene locus_tag LOCUS_30470 26494 27273 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869224.1 protein_id gnl|my_center|LOCUS_30470 27277 27684 gene locus_tag LOCUS_30480 27277 27684 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392242.1 protein_id gnl|my_center|LOCUS_30480 27790 28905 gene locus_tag LOCUS_30490 27790 28905 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_30490 28931 29338 gene locus_tag LOCUS_30500 28931 29338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 29462 31240 gene locus_tag LOCUS_30510 29462 31240 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_30510 31263 31640 gene locus_tag LOCUS_30520 31263 31640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 31637 31972 gene locus_tag LOCUS_30530 31637 31972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 32876 31974 gene locus_tag LOCUS_30540 32876 31974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 34569 32938 gene locus_tag LOCUS_30550 34569 32938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 36019 34562 gene locus_tag LOCUS_30560 36019 34562 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_30560 37793 36030 gene locus_tag LOCUS_30570 37793 36030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 38702 37815 gene locus_tag LOCUS_30580 38702 37815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 39769 38699 gene locus_tag LOCUS_30590 39769 38699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 39848 40732 gene locus_tag LOCUS_30600 39848 40732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 40729 44115 gene locus_tag LOCUS_30610 40729 44115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 46906 44174 gene locus_tag LOCUS_30620 46906 44174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 >Feature sequence43 2208 349 gene locus_tag LOCUS_30630 2208 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 4363 2189 gene locus_tag LOCUS_30640 4363 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 6984 4417 gene locus_tag LOCUS_30650 6984 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 8582 6981 gene locus_tag LOCUS_30660 8582 6981 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462181.1 protein_id gnl|my_center|LOCUS_30660 9974 8796 gene locus_tag LOCUS_30670 9974 8796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 12482 9984 gene locus_tag LOCUS_30680 12482 9984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 12628 12548 gene locus_tag LOCUS_t00410 12628 12548 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13266 12670 gene locus_tag LOCUS_30690 13266 12670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 14604 13921 gene locus_tag LOCUS_30700 14604 13921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 15251 14706 gene locus_tag LOCUS_30710 15251 14706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 15651 18170 gene locus_tag LOCUS_30720 15651 18170 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785097.1 protein_id gnl|my_center|LOCUS_30720 18258 20021 gene locus_tag LOCUS_30730 18258 20021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 20032 20913 gene locus_tag LOCUS_30740 20032 20913 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765521.1 protein_id gnl|my_center|LOCUS_30740 21906 20923 gene locus_tag LOCUS_30750 21906 20923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 22095 23801 gene locus_tag LOCUS_30760 22095 23801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 24044 23808 gene locus_tag LOCUS_30770 24044 23808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 24303 25436 gene locus_tag LOCUS_30780 24303 25436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 25490 25828 gene locus_tag LOCUS_30790 25490 25828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 26719 25841 gene locus_tag LOCUS_30800 gene speB 26719 25841 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_30800 28935 26857 gene locus_tag LOCUS_30810 gene fusA 28935 26857 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_30810 30518 28932 gene locus_tag LOCUS_30820 30518 28932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 30704 32863 gene locus_tag LOCUS_30830 30704 32863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 33770 32805 gene locus_tag LOCUS_30840 33770 32805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 33903 34727 gene locus_tag LOCUS_30850 33903 34727 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_30850 34852 35901 gene locus_tag LOCUS_30860 34852 35901 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257479.1 protein_id gnl|my_center|LOCUS_30860 36136 36309 gene locus_tag LOCUS_30870 36136 36309 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390530.1 protein_id gnl|my_center|LOCUS_30870 36370 38442 gene locus_tag LOCUS_30880 gene fusA 36370 38442 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_30880 38555 41017 gene locus_tag LOCUS_30890 38555 41017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 44407 41027 gene locus_tag LOCUS_30900 44407 41027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 45660 44413 gene locus_tag LOCUS_30910 45660 44413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 >Feature sequence44 2464 482 gene locus_tag LOCUS_30920 2464 482 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583112.1 protein_id gnl|my_center|LOCUS_30920 4255 2495 gene locus_tag LOCUS_30930 4255 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 5681 4341 gene locus_tag LOCUS_30940 5681 4341 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064444.1 protein_id gnl|my_center|LOCUS_30940 7150 5750 gene locus_tag LOCUS_30950 7150 5750 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865209.1 protein_id gnl|my_center|LOCUS_30950 7873 8718 gene locus_tag LOCUS_30960 7873 8718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 8754 10130 gene locus_tag LOCUS_30970 8754 10130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 10283 11341 gene locus_tag LOCUS_30980 10283 11341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 12142 11591 gene locus_tag LOCUS_30990 gene amrA 12142 11591 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941768.1 protein_id gnl|my_center|LOCUS_30990 14093 12117 gene locus_tag LOCUS_31000 14093 12117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 14685 14095 gene locus_tag LOCUS_31010 14685 14095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 15472 14672 gene locus_tag LOCUS_31020 gene truA 15472 14672 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_31020 16201 15482 gene locus_tag LOCUS_31030 16201 15482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 17480 16194 gene locus_tag LOCUS_31040 17480 16194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 17404 17658 gene locus_tag LOCUS_31050 17404 17658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 17703 18632 gene locus_tag LOCUS_31060 17703 18632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 19666 18665 gene locus_tag LOCUS_31070 19666 18665 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919044.1 protein_id gnl|my_center|LOCUS_31070 20487 20586 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22591 20822 gene locus_tag LOCUS_31080 22591 20822 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943502.1 protein_id gnl|my_center|LOCUS_31080 22680 22606 gene locus_tag LOCUS_t00420 22680 22606 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 22836 22908 gene locus_tag LOCUS_t00430 22836 22908 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 23043 24362 gene locus_tag LOCUS_31090 23043 24362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 24512 24883 gene locus_tag LOCUS_31100 24512 24883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 24880 26331 gene locus_tag LOCUS_31110 24880 26331 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_31110 26337 27221 gene locus_tag LOCUS_31120 26337 27221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 27223 29775 gene locus_tag LOCUS_31130 27223 29775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 29929 30384 gene locus_tag LOCUS_31140 gene nuoE 29929 30384 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584034.1 protein_id gnl|my_center|LOCUS_31140 30397 31539 gene locus_tag LOCUS_31150 gene nuoF 30397 31539 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969255.1 protein_id gnl|my_center|LOCUS_31150 31568 33388 gene locus_tag LOCUS_31160 31568 33388 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_31160 33627 34736 gene locus_tag LOCUS_31170 33627 34736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 34829 35419 gene locus_tag LOCUS_31180 34829 35419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 35416 36555 gene locus_tag LOCUS_31190 35416 36555 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973327.1 protein_id gnl|my_center|LOCUS_31190 36552 39668 gene locus_tag LOCUS_31200 36552 39668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 39722 40912 gene locus_tag LOCUS_31210 39722 40912 CDS product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948785.1 protein_id gnl|my_center|LOCUS_31210 >Feature sequence45 127 1095 gene locus_tag LOCUS_31220 127 1095 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921409.1 protein_id gnl|my_center|LOCUS_31220 1224 2933 gene locus_tag LOCUS_31230 1224 2933 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_31230 2944 3567 gene locus_tag LOCUS_31240 2944 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 4595 3564 gene locus_tag LOCUS_31250 4595 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 6234 4702 gene locus_tag LOCUS_31260 6234 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 8702 6372 gene locus_tag LOCUS_31270 8702 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 8924 10438 gene locus_tag LOCUS_31280 8924 10438 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_31280 10691 10446 gene locus_tag LOCUS_31290 10691 10446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 10719 11972 gene locus_tag LOCUS_31300 10719 11972 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056442.1 protein_id gnl|my_center|LOCUS_31300 12885 11980 gene locus_tag LOCUS_31310 12885 11980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 12901 13251 gene locus_tag LOCUS_31320 12901 13251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 13277 13927 gene locus_tag LOCUS_31330 13277 13927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 15692 13899 gene locus_tag LOCUS_31340 15692 13899 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480577.1 protein_id gnl|my_center|LOCUS_31340 15878 17104 gene locus_tag LOCUS_31350 15878 17104 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929863.1 protein_id gnl|my_center|LOCUS_31350 17118 17867 gene locus_tag LOCUS_31360 17118 17867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 18672 17923 gene locus_tag LOCUS_31370 18672 17923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 19820 18885 gene locus_tag LOCUS_31380 19820 18885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 22513 19820 gene locus_tag LOCUS_31390 22513 19820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 23322 22603 gene locus_tag LOCUS_31400 23322 22603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 23791 23333 gene locus_tag LOCUS_31410 23791 23333 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919048.1 protein_id gnl|my_center|LOCUS_31410 24492 23788 gene locus_tag LOCUS_31420 24492 23788 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177702.1 protein_id gnl|my_center|LOCUS_31420 25502 24558 gene locus_tag LOCUS_31430 25502 24558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 25640 25715 gene locus_tag LOCUS_t00440 25640 25715 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 25715 26422 gene locus_tag LOCUS_31440 25715 26422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 26468 27400 gene locus_tag LOCUS_31450 26468 27400 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943599.1 protein_id gnl|my_center|LOCUS_31450 28207 27632 gene locus_tag LOCUS_31460 28207 27632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 29866 28268 gene locus_tag LOCUS_31470 29866 28268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 32742 29866 gene locus_tag LOCUS_31480 32742 29866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 34349 33396 gene locus_tag LOCUS_31490 34349 33396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 34798 34607 gene locus_tag LOCUS_31500 34798 34607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 34725 37112 gene locus_tag LOCUS_31510 34725 37112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 37236 40541 gene locus_tag LOCUS_31520 37236 40541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 >Feature sequence46 342 2195 gene locus_tag LOCUS_31530 gene ftsH 342 2195 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_31530 2210 3097 gene locus_tag LOCUS_31540 gene folP 2210 3097 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644433.1 protein_id gnl|my_center|LOCUS_31540 3227 4285 gene locus_tag LOCUS_31550 3227 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 5786 4488 gene locus_tag LOCUS_31560 5786 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 7003 5831 gene locus_tag LOCUS_31570 7003 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 7628 7011 gene locus_tag LOCUS_31580 7628 7011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 7959 7756 gene locus_tag LOCUS_31590 7959 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 8327 8055 gene locus_tag LOCUS_31600 gene groES 8327 8055 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_31600 10665 8557 gene locus_tag LOCUS_31610 10665 8557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 11728 10640 gene locus_tag LOCUS_31620 gene hydE 11728 10640 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393236.1 protein_id gnl|my_center|LOCUS_31620 12177 11725 gene locus_tag LOCUS_31630 12177 11725 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419409.1 protein_id gnl|my_center|LOCUS_31630 12497 12261 gene locus_tag LOCUS_31640 12497 12261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 13711 12500 gene locus_tag LOCUS_31650 13711 12500 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940443.1 protein_id gnl|my_center|LOCUS_31650 14278 13763 gene locus_tag LOCUS_31660 14278 13763 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870310.1 protein_id gnl|my_center|LOCUS_31660 14655 14275 gene locus_tag LOCUS_31670 14655 14275 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940441.1 protein_id gnl|my_center|LOCUS_31670 15143 14715 gene locus_tag LOCUS_31680 15143 14715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 16116 15259 gene locus_tag LOCUS_31690 16116 15259 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023015.1 protein_id gnl|my_center|LOCUS_31690 17809 16109 gene locus_tag LOCUS_31700 17809 16109 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080205.1 protein_id gnl|my_center|LOCUS_31700 18761 17832 gene locus_tag LOCUS_31710 18761 17832 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937965.1 protein_id gnl|my_center|LOCUS_31710 18898 19239 gene locus_tag LOCUS_31720 18898 19239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 19366 20514 gene locus_tag LOCUS_31730 19366 20514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 20524 23649 gene locus_tag LOCUS_31740 20524 23649 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_31740 23800 24450 gene locus_tag LOCUS_31750 23800 24450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 24484 25104 gene locus_tag LOCUS_31760 24484 25104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 25109 25486 gene locus_tag LOCUS_31770 25109 25486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 25483 26346 gene locus_tag LOCUS_31780 25483 26346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 26376 26597 gene locus_tag LOCUS_31790 26376 26597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 26628 26852 gene locus_tag LOCUS_31800 26628 26852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 27864 26809 gene locus_tag LOCUS_31810 27864 26809 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062349.1 protein_id gnl|my_center|LOCUS_31810 29179 27941 gene locus_tag LOCUS_31820 29179 27941 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_31820 29363 30466 gene locus_tag LOCUS_31830 29363 30466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 30549 31127 gene locus_tag LOCUS_31840 gene fpvI 30549 31127 CDS product pyoverdine signaling pathway sigma factor FpvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103620.1 protein_id gnl|my_center|LOCUS_31840 31124 32101 gene locus_tag LOCUS_31850 31124 32101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 32589 32227 gene locus_tag LOCUS_31860 32589 32227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 32846 32595 gene locus_tag LOCUS_31870 32846 32595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 33021 33815 gene locus_tag LOCUS_31880 33021 33815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 34497 33751 gene locus_tag LOCUS_31890 34497 33751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 35881 34694 gene locus_tag LOCUS_31900 35881 34694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 36393 36007 gene locus_tag LOCUS_31910 36393 36007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 37206 36403 gene locus_tag LOCUS_31920 37206 36403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 38661 37228 gene locus_tag LOCUS_31930 38661 37228 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_31930 39626 38832 gene locus_tag LOCUS_31940 39626 38832 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259198.1 protein_id gnl|my_center|LOCUS_31940 >Feature sequence47 640 266 gene locus_tag LOCUS_31950 640 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 1789 644 gene locus_tag LOCUS_31960 1789 644 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931301.1 protein_id gnl|my_center|LOCUS_31960 1949 3205 gene locus_tag LOCUS_31970 1949 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 3244 3741 gene locus_tag LOCUS_31980 gene arfB 3244 3741 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387858.1 protein_id gnl|my_center|LOCUS_31980 7336 3875 gene locus_tag LOCUS_31990 7336 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 7515 8408 gene locus_tag LOCUS_32000 7515 8408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 8463 8741 gene locus_tag LOCUS_32010 8463 8741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 9241 8744 gene locus_tag LOCUS_32020 9241 8744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 9606 9530 gene locus_tag LOCUS_t00450 9606 9530 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 9723 10649 gene locus_tag LOCUS_32030 9723 10649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 10646 11428 gene locus_tag LOCUS_32040 10646 11428 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_32040 11421 12257 gene locus_tag LOCUS_32050 11421 12257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 12359 13147 gene locus_tag LOCUS_32060 12359 13147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 13180 15705 gene locus_tag LOCUS_32070 13180 15705 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545339.1 protein_id gnl|my_center|LOCUS_32070 15702 16121 gene locus_tag LOCUS_32080 15702 16121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 16265 17569 gene locus_tag LOCUS_32090 16265 17569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 17592 19370 gene locus_tag LOCUS_32100 17592 19370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 19370 20230 gene locus_tag LOCUS_32110 19370 20230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 20284 21450 gene locus_tag LOCUS_32120 20284 21450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 22848 21460 gene locus_tag LOCUS_32130 22848 21460 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_32130 23898 22894 gene locus_tag LOCUS_32140 23898 22894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 24075 25262 gene locus_tag LOCUS_32150 24075 25262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 25292 25483 gene locus_tag LOCUS_32160 25292 25483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 25486 25902 gene locus_tag LOCUS_32170 25486 25902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 25899 27272 gene locus_tag LOCUS_32180 gene asnS 25899 27272 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941817.1 protein_id gnl|my_center|LOCUS_32180 27283 28140 gene locus_tag LOCUS_32190 27283 28140 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_32190 28133 29851 gene locus_tag LOCUS_32200 gene recN 28133 29851 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_32200 29848 30327 gene locus_tag LOCUS_32210 29848 30327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 30422 31765 gene locus_tag LOCUS_32220 30422 31765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 31778 32254 gene locus_tag LOCUS_32230 31778 32254 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615653.1 protein_id gnl|my_center|LOCUS_32230 32266 33294 gene locus_tag LOCUS_32240 32266 33294 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529671.1 protein_id gnl|my_center|LOCUS_32240 34756 33506 gene locus_tag LOCUS_32250 34756 33506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 34879 35472 gene locus_tag LOCUS_32260 34879 35472 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020385.1 protein_id gnl|my_center|LOCUS_32260 35531 36937 gene locus_tag LOCUS_32270 35531 36937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 37034 38539 gene locus_tag LOCUS_32280 37034 38539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 38661 39575 gene locus_tag LOCUS_32290 38661 39575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 >Feature sequence48 287 568 gene locus_tag LOCUS_32300 287 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 565 1842 gene locus_tag LOCUS_32310 565 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 3238 1847 gene locus_tag LOCUS_32320 3238 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 4478 3369 gene locus_tag LOCUS_32330 4478 3369 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384817.1 protein_id gnl|my_center|LOCUS_32330 6406 4535 gene locus_tag LOCUS_32340 6406 4535 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_32340 7172 8275 gene locus_tag LOCUS_32350 7172 8275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 9573 8449 gene locus_tag LOCUS_32360 gene rsgA 9573 8449 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143435.1 protein_id gnl|my_center|LOCUS_32360 11340 9862 gene locus_tag LOCUS_32370 11340 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 11591 11322 gene locus_tag LOCUS_32380 11591 11322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 13027 11588 gene locus_tag LOCUS_32390 13027 11588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 13995 13015 gene locus_tag LOCUS_32400 13995 13015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 14327 15046 gene locus_tag LOCUS_32410 14327 15046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 15260 15712 gene locus_tag LOCUS_32420 15260 15712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 17169 15688 gene locus_tag LOCUS_32430 17169 15688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 18485 17172 gene locus_tag LOCUS_32440 18485 17172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 19852 18482 gene locus_tag LOCUS_32450 19852 18482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 20112 20729 gene locus_tag LOCUS_32460 20112 20729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 23880 20749 gene locus_tag LOCUS_32470 23880 20749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 24410 23871 gene locus_tag LOCUS_32480 24410 23871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 25417 24407 gene locus_tag LOCUS_32490 gene lgt 25417 24407 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_32490 25458 27062 gene locus_tag LOCUS_32500 gene nadB 25458 27062 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_32500 27260 27667 gene locus_tag LOCUS_32510 27260 27667 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948605.1 protein_id gnl|my_center|LOCUS_32510 27670 27996 gene locus_tag LOCUS_32520 27670 27996 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948606.1 protein_id gnl|my_center|LOCUS_32520 28328 29236 gene locus_tag LOCUS_32530 28328 29236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 29730 30353 gene locus_tag LOCUS_32540 29730 30353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 30366 31076 gene locus_tag LOCUS_32550 30366 31076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 31073 32851 gene locus_tag LOCUS_32560 31073 32851 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669362.1 protein_id gnl|my_center|LOCUS_32560 32844 34151 gene locus_tag LOCUS_32570 32844 34151 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556695.1 protein_id gnl|my_center|LOCUS_32570 34155 34772 gene locus_tag LOCUS_32580 34155 34772 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679385.1 protein_id gnl|my_center|LOCUS_32580 34769 36577 gene locus_tag LOCUS_32590 34769 36577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 36623 37138 gene locus_tag LOCUS_32600 36623 37138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 37558 37208 gene locus_tag LOCUS_32610 37558 37208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 37977 37558 gene locus_tag LOCUS_32620 37977 37558 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257767.1 protein_id gnl|my_center|LOCUS_32620 38126 38500 gene locus_tag LOCUS_32630 38126 38500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 >Feature sequence49 186 1481 gene locus_tag LOCUS_32640 186 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 2131 1748 gene locus_tag LOCUS_32650 2131 1748 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925454.1 protein_id gnl|my_center|LOCUS_32650 3408 2128 gene locus_tag LOCUS_32660 3408 2128 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964633.1 protein_id gnl|my_center|LOCUS_32660 4928 3393 gene locus_tag LOCUS_32670 4928 3393 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865341.1 protein_id gnl|my_center|LOCUS_32670 6891 5008 gene locus_tag LOCUS_32680 6891 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 8461 7103 gene locus_tag LOCUS_32690 8461 7103 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_32690 8744 9991 gene locus_tag LOCUS_32700 gene rho 8744 9991 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_32700 10008 10496 gene locus_tag LOCUS_32710 10008 10496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 10509 11318 gene locus_tag LOCUS_32720 10509 11318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 11329 13470 gene locus_tag LOCUS_32730 11329 13470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 13479 14588 gene locus_tag LOCUS_32740 13479 14588 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249749.1 protein_id gnl|my_center|LOCUS_32740 14607 14756 gene locus_tag LOCUS_32750 14607 14756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 15094 16893 gene locus_tag LOCUS_32760 15094 16893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 18440 16914 gene locus_tag LOCUS_32770 18440 16914 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436996.1 protein_id gnl|my_center|LOCUS_32770 18824 20509 gene locus_tag LOCUS_32780 18824 20509 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920680.1 protein_id gnl|my_center|LOCUS_32780 20684 21691 gene locus_tag LOCUS_32790 20684 21691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 24057 21790 gene locus_tag LOCUS_32800 24057 21790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 24217 24399 gene locus_tag LOCUS_32810 24217 24399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 24785 24459 gene locus_tag LOCUS_32820 24785 24459 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 protein_id gnl|my_center|LOCUS_32820 25201 24782 gene locus_tag LOCUS_32830 25201 24782 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948605.1 protein_id gnl|my_center|LOCUS_32830 26718 25333 gene locus_tag LOCUS_32840 26718 25333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 26989 28500 gene locus_tag LOCUS_32850 26989 28500 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390163.1 protein_id gnl|my_center|LOCUS_32850 28569 29645 gene locus_tag LOCUS_32860 28569 29645 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537580.1 protein_id gnl|my_center|LOCUS_32860 30349 29663 gene locus_tag LOCUS_32870 30349 29663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 31630 30443 gene locus_tag LOCUS_32880 31630 30443 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898036.1 protein_id gnl|my_center|LOCUS_32880 32366 31752 gene locus_tag LOCUS_32890 32366 31752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 32644 33354 gene locus_tag LOCUS_32900 32644 33354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 33448 34818 gene locus_tag LOCUS_32910 gene hydG 33448 34818 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939053.1 protein_id gnl|my_center|LOCUS_32910 35039 36439 gene locus_tag LOCUS_32920 35039 36439 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939054.1 protein_id gnl|my_center|LOCUS_32920 36436 37680 gene locus_tag LOCUS_32930 gene hydF 36436 37680 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392791.1 protein_id gnl|my_center|LOCUS_32930 >Feature sequence50 148 483 gene locus_tag LOCUS_32940 148 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 905 504 gene locus_tag LOCUS_32950 905 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 2233 914 gene locus_tag LOCUS_32960 2233 914 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_32960 2795 2457 gene locus_tag LOCUS_32970 2795 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 3555 2857 gene locus_tag LOCUS_32980 3555 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 4923 3733 gene locus_tag LOCUS_32990 4923 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 5140 5415 gene locus_tag LOCUS_33000 5140 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 6503 5490 gene locus_tag LOCUS_33010 6503 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 7251 8564 gene locus_tag LOCUS_33020 7251 8564 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958607.1 protein_id gnl|my_center|LOCUS_33020 9655 8690 gene locus_tag LOCUS_33030 9655 8690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 10743 9592 gene locus_tag LOCUS_33040 10743 9592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 10898 11344 gene locus_tag LOCUS_33050 10898 11344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 11389 13059 gene locus_tag LOCUS_33060 11389 13059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 13119 14651 gene locus_tag LOCUS_33070 13119 14651 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250733.1 protein_id gnl|my_center|LOCUS_33070 14720 16126 gene locus_tag LOCUS_33080 14720 16126 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_33080 16152 17624 gene locus_tag LOCUS_33090 16152 17624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 23703 17638 gene locus_tag LOCUS_33100 23703 17638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 23841 26054 gene locus_tag LOCUS_33110 23841 26054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 27013 26042 gene locus_tag LOCUS_33120 27013 26042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 27735 27013 gene locus_tag LOCUS_33130 27735 27013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 28189 27758 gene locus_tag LOCUS_33140 28189 27758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 28310 28381 gene locus_tag LOCUS_t00460 28310 28381 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 28872 28354 gene locus_tag LOCUS_33150 28872 28354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 28946 30250 gene locus_tag LOCUS_33160 gene miaB 28946 30250 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392626.1 protein_id gnl|my_center|LOCUS_33160 30381 30878 gene locus_tag LOCUS_33170 30381 30878 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938863.1 protein_id gnl|my_center|LOCUS_33170 30886 31062 gene locus_tag LOCUS_33180 30886 31062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 31084 33102 gene locus_tag LOCUS_33190 31084 33102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 33158 33370 gene locus_tag LOCUS_33200 33158 33370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 34556 33378 gene locus_tag LOCUS_33210 34556 33378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 34679 34604 gene locus_tag LOCUS_t00470 34679 34604 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 34779 35717 gene locus_tag LOCUS_33220 34779 35717 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_33220 35714 36517 gene locus_tag LOCUS_33230 35714 36517 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939732.1 protein_id gnl|my_center|LOCUS_33230 >Feature sequence51 1635 118 gene locus_tag LOCUS_33240 1635 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 1835 1656 gene locus_tag LOCUS_33250 1835 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 3710 1854 gene locus_tag LOCUS_33260 3710 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 4873 3737 gene locus_tag LOCUS_33270 4873 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 6447 4984 gene locus_tag LOCUS_33280 6447 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 9575 6444 gene locus_tag LOCUS_33290 gene vmeI 9575 6444 CDS product efflux RND transporter permease subunit VmeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478902.1 protein_id gnl|my_center|LOCUS_33290 10634 9588 gene locus_tag LOCUS_33300 10634 9588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 11368 10643 gene locus_tag LOCUS_33310 11368 10643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 13493 11472 gene locus_tag LOCUS_33320 13493 11472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 17098 13427 gene locus_tag LOCUS_33330 17098 13427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 17359 18348 gene locus_tag LOCUS_33340 17359 18348 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_33340 18377 19255 gene locus_tag LOCUS_33350 18377 19255 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_33350 19252 20898 gene locus_tag LOCUS_33360 19252 20898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 20885 22039 gene locus_tag LOCUS_33370 20885 22039 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_33370 22036 23094 gene locus_tag LOCUS_33380 22036 23094 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839879.1 protein_id gnl|my_center|LOCUS_33380 23091 24134 gene locus_tag LOCUS_33390 23091 24134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 24164 26083 gene locus_tag LOCUS_33400 24164 26083 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405278.1 protein_id gnl|my_center|LOCUS_33400 26088 26945 gene locus_tag LOCUS_33410 26088 26945 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962306.1 protein_id gnl|my_center|LOCUS_33410 29343 27202 gene locus_tag LOCUS_33420 29343 27202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 31008 29644 gene locus_tag LOCUS_33430 31008 29644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 34886 31005 gene locus_tag LOCUS_33440 34886 31005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 35809 35393 gene locus_tag LOCUS_33450 35809 35393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 >Feature sequence52 130 1470 gene locus_tag LOCUS_33460 130 1470 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111848.1 protein_id gnl|my_center|LOCUS_33460 3786 1492 gene locus_tag LOCUS_33470 3786 1492 CDS product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083797.1 protein_id gnl|my_center|LOCUS_33470 4247 3783 gene locus_tag LOCUS_33480 4247 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 4959 4327 gene locus_tag LOCUS_33490 4959 4327 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_33490 5241 6710 gene locus_tag LOCUS_33500 5241 6710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 7679 6918 gene locus_tag LOCUS_33510 7679 6918 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975730.1 protein_id gnl|my_center|LOCUS_33510 8251 7676 gene locus_tag LOCUS_33520 8251 7676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 8382 9485 gene locus_tag LOCUS_33530 8382 9485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 9546 9779 gene locus_tag LOCUS_33540 9546 9779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 9766 10029 gene locus_tag LOCUS_33550 9766 10029 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020108.1 protein_id gnl|my_center|LOCUS_33550 10981 10262 gene locus_tag LOCUS_33560 10981 10262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 12890 10983 gene locus_tag LOCUS_33570 gene nuoF 12890 10983 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817338.1 protein_id gnl|my_center|LOCUS_33570 13377 12904 gene locus_tag LOCUS_33580 gene nuoE 13377 12904 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_33580 14318 13380 gene locus_tag LOCUS_33590 gene porB 14318 13380 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496444.1 protein_id gnl|my_center|LOCUS_33590 15490 14315 gene locus_tag LOCUS_33600 gene porA 15490 14315 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250933.1 protein_id gnl|my_center|LOCUS_33600 15783 15490 gene locus_tag LOCUS_33610 gene porD 15783 15490 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869765.1 protein_id gnl|my_center|LOCUS_33610 16339 15776 gene locus_tag LOCUS_33620 16339 15776 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_33620 16609 18006 gene locus_tag LOCUS_33630 16609 18006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 18078 19406 gene locus_tag LOCUS_33640 18078 19406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 19475 20800 gene locus_tag LOCUS_33650 19475 20800 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087700.1 protein_id gnl|my_center|LOCUS_33650 20797 21942 gene locus_tag LOCUS_33660 20797 21942 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937369.1 protein_id gnl|my_center|LOCUS_33660 21944 25039 gene locus_tag LOCUS_33670 21944 25039 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086886.1 protein_id gnl|my_center|LOCUS_33670 25011 25319 gene locus_tag LOCUS_33680 25011 25319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 25341 26372 gene locus_tag LOCUS_33690 25341 26372 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753043.1 protein_id gnl|my_center|LOCUS_33690 28168 26603 gene locus_tag LOCUS_33700 28168 26603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 29517 28183 gene locus_tag LOCUS_33710 29517 28183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 32437 29609 gene locus_tag LOCUS_33720 gene uvrA 32437 29609 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_33720 33862 32450 gene locus_tag LOCUS_33730 33862 32450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 >Feature sequence53 922 245 gene locus_tag LOCUS_33740 922 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 1174 1016 gene locus_tag LOCUS_33750 1174 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 2341 1592 gene locus_tag LOCUS_33760 2341 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 3125 2355 gene locus_tag LOCUS_33770 3125 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 3085 3783 gene locus_tag LOCUS_33780 3085 3783 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545169.1 protein_id gnl|my_center|LOCUS_33780 3915 4856 gene locus_tag LOCUS_33790 3915 4856 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775309.1 protein_id gnl|my_center|LOCUS_33790 4991 7165 gene locus_tag LOCUS_33800 4991 7165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 7188 7925 gene locus_tag LOCUS_33810 7188 7925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 7965 11615 gene locus_tag LOCUS_33820 gene dnaE 7965 11615 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_33820 12955 11828 gene locus_tag LOCUS_33830 12955 11828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 13128 14036 gene locus_tag LOCUS_33840 13128 14036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 14986 14336 gene locus_tag LOCUS_33850 14986 14336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 17429 15015 gene locus_tag LOCUS_33860 17429 15015 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143626.1 protein_id gnl|my_center|LOCUS_33860 18314 17433 gene locus_tag LOCUS_33870 18314 17433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 18931 18311 gene locus_tag LOCUS_33880 18931 18311 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939535.1 protein_id gnl|my_center|LOCUS_33880 19632 18973 gene locus_tag LOCUS_33890 gene rplC 19632 18973 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892823.1 protein_id gnl|my_center|LOCUS_33890 19842 21917 gene locus_tag LOCUS_33900 19842 21917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 22034 24706 gene locus_tag LOCUS_33910 22034 24706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 24912 25991 gene locus_tag LOCUS_33920 24912 25991 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770245.1 protein_id gnl|my_center|LOCUS_33920 25988 26875 gene locus_tag LOCUS_33930 25988 26875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 27006 28124 gene locus_tag LOCUS_33940 27006 28124 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_33940 28575 29804 gene locus_tag LOCUS_33950 28575 29804 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_33950 30653 30369 gene locus_tag LOCUS_33960 30653 30369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 30902 31225 gene locus_tag LOCUS_33970 30902 31225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 31859 31194 gene locus_tag LOCUS_33980 31859 31194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 32193 32498 gene locus_tag LOCUS_33990 32193 32498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 >Feature sequence54 254 997 gene locus_tag LOCUS_34000 gene sfsA 254 997 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920525.1 protein_id gnl|my_center|LOCUS_34000 1113 4781 gene locus_tag LOCUS_34010 1113 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 10256 4806 gene locus_tag LOCUS_34020 10256 4806 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226015.1 protein_id gnl|my_center|LOCUS_34020 10705 10253 gene locus_tag LOCUS_34030 gene acpS 10705 10253 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256379.1 protein_id gnl|my_center|LOCUS_34030 19634 10710 gene locus_tag LOCUS_34040 19634 10710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 19915 20478 gene locus_tag LOCUS_34050 19915 20478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 20528 21799 gene locus_tag LOCUS_34060 20528 21799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 21792 22508 gene locus_tag LOCUS_34070 21792 22508 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_34070 23222 22560 gene locus_tag LOCUS_34080 23222 22560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 23835 23401 gene locus_tag LOCUS_34090 23835 23401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 24992 23856 gene locus_tag LOCUS_34100 24992 23856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 25102 27066 gene locus_tag LOCUS_34110 25102 27066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 27088 28662 gene locus_tag LOCUS_34120 27088 28662 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765024.1 protein_id gnl|my_center|LOCUS_34120 28667 29536 gene locus_tag LOCUS_34130 gene ttcA 28667 29536 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189298.1 protein_id gnl|my_center|LOCUS_34130 29533 30282 gene locus_tag LOCUS_34140 29533 30282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 >Feature sequence55 1770 154 gene locus_tag LOCUS_34150 1770 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 2155 3474 gene locus_tag LOCUS_34160 2155 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 3490 4581 gene locus_tag LOCUS_34170 3490 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 7191 4573 gene locus_tag LOCUS_34180 7191 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 9362 7188 gene locus_tag LOCUS_34190 9362 7188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 9820 10236 gene locus_tag LOCUS_34200 9820 10236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 10526 12250 gene locus_tag LOCUS_34210 10526 12250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 12413 13843 gene locus_tag LOCUS_34220 12413 13843 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_34220 13941 14993 gene locus_tag LOCUS_34230 gene pilM 13941 14993 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181416674.1 protein_id gnl|my_center|LOCUS_34230 15020 15673 gene locus_tag LOCUS_34240 15020 15673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 15698 16375 gene locus_tag LOCUS_34250 15698 16375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 16387 17109 gene locus_tag LOCUS_34260 16387 17109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 17106 21461 gene locus_tag LOCUS_34270 17106 21461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 21490 22209 gene locus_tag LOCUS_34280 21490 22209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 22241 23287 gene locus_tag LOCUS_34290 gene purM 22241 23287 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_34290 23284 24507 gene locus_tag LOCUS_34300 23284 24507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 24574 27198 gene locus_tag LOCUS_34310 24574 27198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 27368 27616 gene locus_tag LOCUS_34320 27368 27616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 27696 29825 gene locus_tag LOCUS_34330 27696 29825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 >Feature sequence56 1085 3214 gene locus_tag LOCUS_34340 1085 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 4884 3238 gene locus_tag LOCUS_34350 4884 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 7014 4996 gene locus_tag LOCUS_34360 7014 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 9164 7134 gene locus_tag LOCUS_34370 9164 7134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 10120 9212 gene locus_tag LOCUS_34380 10120 9212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 12461 10125 gene locus_tag LOCUS_34390 12461 10125 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082972.1 protein_id gnl|my_center|LOCUS_34390 14620 12563 gene locus_tag LOCUS_34400 14620 12563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 16829 14703 gene locus_tag LOCUS_34410 16829 14703 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444553.1 protein_id gnl|my_center|LOCUS_34410 19266 16846 gene locus_tag LOCUS_34420 19266 16846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 18206 18305 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19639 21426 gene locus_tag LOCUS_34430 19639 21426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 22105 21470 gene locus_tag LOCUS_34440 22105 21470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 22673 22107 gene locus_tag LOCUS_34450 22673 22107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 22821 23357 gene locus_tag LOCUS_34460 22821 23357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 23410 25629 gene locus_tag LOCUS_34470 23410 25629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 25929 28619 gene locus_tag LOCUS_34480 25929 28619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112529604.1 protein_id gnl|my_center|LOCUS_34480 28781 29689 gene locus_tag LOCUS_34490 28781 29689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 >Feature sequence57 1446 85 gene locus_tag LOCUS_34500 1446 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 2860 1469 gene locus_tag LOCUS_34510 2860 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 3204 4892 gene locus_tag LOCUS_34520 3204 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086388.1 protein_id gnl|my_center|LOCUS_34520 4972 6615 gene locus_tag LOCUS_34530 gene pgi 4972 6615 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455828.1 protein_id gnl|my_center|LOCUS_34530 6672 7298 gene locus_tag LOCUS_34540 6672 7298 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903437.1 protein_id gnl|my_center|LOCUS_34540 7646 7362 gene locus_tag LOCUS_34550 7646 7362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 8965 7772 gene locus_tag LOCUS_34560 gene chrA 8965 7772 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384124.1 protein_id gnl|my_center|LOCUS_34560 9306 8962 gene locus_tag LOCUS_34570 9306 8962 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879039.1 protein_id gnl|my_center|LOCUS_34570 10704 9481 gene locus_tag LOCUS_34580 10704 9481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 11103 10747 gene locus_tag LOCUS_34590 11103 10747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 11835 11635 gene locus_tag LOCUS_34600 11835 11635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 12845 11952 gene locus_tag LOCUS_34610 12845 11952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 16082 14079 gene locus_tag LOCUS_34620 16082 14079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 16224 17846 gene locus_tag LOCUS_34630 16224 17846 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393460.1 protein_id gnl|my_center|LOCUS_34630 17843 18559 gene locus_tag LOCUS_34640 17843 18559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 18792 18604 gene locus_tag LOCUS_34650 18792 18604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 18971 19351 gene locus_tag LOCUS_34660 18971 19351 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462120.1 protein_id gnl|my_center|LOCUS_34660 19476 19814 gene locus_tag LOCUS_34670 19476 19814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 19827 20198 gene locus_tag LOCUS_34680 19827 20198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 20203 21108 gene locus_tag LOCUS_34690 20203 21108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 21105 22310 gene locus_tag LOCUS_34700 21105 22310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 23277 22318 gene locus_tag LOCUS_34710 23277 22318 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920359.1 protein_id gnl|my_center|LOCUS_34710 23963 23463 gene locus_tag LOCUS_34720 23963 23463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 26197 23960 gene locus_tag LOCUS_34730 26197 23960 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_34730 26240 26782 gene locus_tag LOCUS_34740 26240 26782 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 protein_id gnl|my_center|LOCUS_34740 27826 26972 gene locus_tag LOCUS_34750 27826 26972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 >Feature sequence58 278 1066 gene locus_tag LOCUS_34760 278 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 1663 1172 gene locus_tag LOCUS_34770 1663 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 3160 2171 gene locus_tag LOCUS_34780 3160 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 3303 3803 gene locus_tag LOCUS_34790 3303 3803 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256622.1 protein_id gnl|my_center|LOCUS_34790 5310 3811 gene locus_tag LOCUS_34800 5310 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 5809 5384 gene locus_tag LOCUS_34810 5809 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 5995 8247 gene locus_tag LOCUS_34820 5995 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 8308 9627 gene locus_tag LOCUS_34830 8308 9627 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_34830 9716 10783 gene locus_tag LOCUS_34840 9716 10783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 10877 12799 gene locus_tag LOCUS_34850 10877 12799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 14149 12806 gene locus_tag LOCUS_34860 14149 12806 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141651.1 protein_id gnl|my_center|LOCUS_34860 14748 14164 gene locus_tag LOCUS_34870 14748 14164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 14970 16136 gene locus_tag LOCUS_34880 14970 16136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 16251 17684 gene locus_tag LOCUS_34890 16251 17684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 17974 18981 gene locus_tag LOCUS_34900 17974 18981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 19452 19003 gene locus_tag LOCUS_34910 19452 19003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 19921 19571 gene locus_tag LOCUS_34920 19921 19571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 20065 20769 gene locus_tag LOCUS_34930 20065 20769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942024.1 protein_id gnl|my_center|LOCUS_34930 20813 21559 gene locus_tag LOCUS_34940 gene uppS 20813 21559 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705097.1 protein_id gnl|my_center|LOCUS_34940 21570 22394 gene locus_tag LOCUS_34950 21570 22394 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_34950 22493 23728 gene locus_tag LOCUS_34960 22493 23728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 26095 23777 gene locus_tag LOCUS_34970 26095 23777 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920015.1 protein_id gnl|my_center|LOCUS_34970 27060 26266 gene locus_tag LOCUS_34980 27060 26266 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081793.1 protein_id gnl|my_center|LOCUS_34980 27665 27108 gene locus_tag LOCUS_34990 gene frr 27665 27108 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942563.1 protein_id gnl|my_center|LOCUS_34990 >Feature sequence59 1304 189 gene locus_tag LOCUS_35000 1304 189 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_35000 1835 3010 gene locus_tag LOCUS_35010 1835 3010 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_35010 4948 3020 gene locus_tag LOCUS_35020 4948 3020 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_35020 5113 7695 gene locus_tag LOCUS_35030 5113 7695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 7791 8414 gene locus_tag LOCUS_35040 7791 8414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 8703 9038 gene locus_tag LOCUS_35050 8703 9038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 9923 9252 gene locus_tag LOCUS_35060 9923 9252 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260949.1 protein_id gnl|my_center|LOCUS_35060 11164 9920 gene locus_tag LOCUS_35070 11164 9920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 11508 13490 gene locus_tag LOCUS_35080 11508 13490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 16089 13624 gene locus_tag LOCUS_35090 16089 13624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 17935 16094 gene locus_tag LOCUS_35100 gene acs 17935 16094 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_35100 19677 18286 gene locus_tag LOCUS_35110 19677 18286 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142321.1 protein_id gnl|my_center|LOCUS_35110 19727 19894 gene locus_tag LOCUS_35120 19727 19894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 20765 20001 gene locus_tag LOCUS_35130 20765 20001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 21904 20828 gene locus_tag LOCUS_35140 gene amrS 21904 20828 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942373.1 protein_id gnl|my_center|LOCUS_35140 24428 21918 gene locus_tag LOCUS_35150 24428 21918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 26542 24425 gene locus_tag LOCUS_35160 gene pnp 26542 24425 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_35160 27270 26641 gene locus_tag LOCUS_35170 27270 26641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 >Feature sequence60 1589 162 gene locus_tag LOCUS_35180 1589 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 2790 1591 gene locus_tag LOCUS_35190 gene ydfH 2790 1591 CDS product two-component system sensor histidine kinase YdfH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886422.1 protein_id gnl|my_center|LOCUS_35190 2890 3300 gene locus_tag LOCUS_35200 2890 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 3329 4426 gene locus_tag LOCUS_35210 3329 4426 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113340.1 protein_id gnl|my_center|LOCUS_35210 4511 5362 gene locus_tag LOCUS_35220 4511 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 5835 5479 gene locus_tag LOCUS_35230 5835 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 6039 10328 gene locus_tag LOCUS_35240 6039 10328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 10476 13010 gene locus_tag LOCUS_35250 10476 13010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 13021 15666 gene locus_tag LOCUS_35260 13021 15666 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929460.1 protein_id gnl|my_center|LOCUS_35260 15680 18040 gene locus_tag LOCUS_35270 15680 18040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 18066 19013 gene locus_tag LOCUS_35280 18066 19013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 19010 19759 gene locus_tag LOCUS_35290 19010 19759 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250288.1 protein_id gnl|my_center|LOCUS_35290 19756 21111 gene locus_tag LOCUS_35300 19756 21111 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081357.1 protein_id gnl|my_center|LOCUS_35300 21210 25085 gene locus_tag LOCUS_35310 21210 25085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 25206 27161 gene locus_tag LOCUS_35320 25206 27161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 >Feature sequence61 110 934 gene locus_tag LOCUS_35330 gene pgeF 110 934 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940760.1 protein_id gnl|my_center|LOCUS_35330 931 1773 gene locus_tag LOCUS_35340 931 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 1790 5872 gene locus_tag LOCUS_35350 1790 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 5979 6683 gene locus_tag LOCUS_35360 5979 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 7262 6960 gene locus_tag LOCUS_35370 7262 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 7514 8050 gene locus_tag LOCUS_35380 7514 8050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 8054 8500 gene locus_tag LOCUS_35390 8054 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 8497 9657 gene locus_tag LOCUS_35400 gene orr 8497 9657 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986511.1 protein_id gnl|my_center|LOCUS_35400 9657 10163 gene locus_tag LOCUS_35410 9657 10163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 10160 11356 gene locus_tag LOCUS_35420 gene alr 10160 11356 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982425.1 protein_id gnl|my_center|LOCUS_35420 17526 11362 gene locus_tag LOCUS_35430 17526 11362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 17762 19258 gene locus_tag LOCUS_35440 17762 19258 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071688.1 protein_id gnl|my_center|LOCUS_35440 19269 20432 gene locus_tag LOCUS_35450 19269 20432 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144029.1 protein_id gnl|my_center|LOCUS_35450 20439 20939 gene locus_tag LOCUS_35460 20439 20939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 21075 21611 gene locus_tag LOCUS_35470 gene hslV 21075 21611 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081403.1 protein_id gnl|my_center|LOCUS_35470 21631 22986 gene locus_tag LOCUS_35480 gene hslU 21631 22986 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_35480 23073 24440 gene locus_tag LOCUS_35490 23073 24440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 25869 24454 gene locus_tag LOCUS_35500 25869 24454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 >Feature sequence62 198 884 gene locus_tag LOCUS_35510 198 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 3299 1449 gene locus_tag LOCUS_35520 3299 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 6418 3296 gene locus_tag LOCUS_35530 6418 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 7180 6452 gene locus_tag LOCUS_35540 7180 6452 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967636.1 protein_id gnl|my_center|LOCUS_35540 7518 7177 gene locus_tag LOCUS_35550 7518 7177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 7827 7600 gene locus_tag LOCUS_35560 7827 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 9319 8030 gene locus_tag LOCUS_35570 9319 8030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 9637 9401 gene locus_tag LOCUS_35580 9637 9401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 9932 10501 gene locus_tag LOCUS_35590 gene rpoE 9932 10501 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_35590 10503 11201 gene locus_tag LOCUS_35600 10503 11201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 11215 11739 gene locus_tag LOCUS_35610 11215 11739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 11743 13800 gene locus_tag LOCUS_35620 11743 13800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 14347 14030 gene locus_tag LOCUS_35630 14347 14030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 14595 14410 gene locus_tag LOCUS_35640 14595 14410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 15337 14627 gene locus_tag LOCUS_35650 15337 14627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 16563 15433 gene locus_tag LOCUS_35660 16563 15433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 16781 17530 gene locus_tag LOCUS_35670 16781 17530 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943078.1 protein_id gnl|my_center|LOCUS_35670 18244 17624 gene locus_tag LOCUS_35680 18244 17624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 19111 18392 gene locus_tag LOCUS_35690 19111 18392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 19739 19290 gene locus_tag LOCUS_35700 19739 19290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 20145 19969 gene locus_tag LOCUS_35710 20145 19969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 20159 20374 gene locus_tag LOCUS_35720 20159 20374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 20378 22108 gene locus_tag LOCUS_35730 20378 22108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 23037 22318 gene locus_tag LOCUS_35740 23037 22318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 23198 23953 gene locus_tag LOCUS_35750 23198 23953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 24190 23990 gene locus_tag LOCUS_35760 24190 23990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 25110 24310 gene locus_tag LOCUS_35770 25110 24310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 25712 25200 gene locus_tag LOCUS_35780 25712 25200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 >Feature sequence63 1055 369 gene locus_tag LOCUS_35790 gene queC 1055 369 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_35790 2960 1065 gene locus_tag LOCUS_35800 2960 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 4509 3022 gene locus_tag LOCUS_35810 gene gcvPB 4509 3022 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460674.1 protein_id gnl|my_center|LOCUS_35810 5871 4510 gene locus_tag LOCUS_35820 gene gcvPA 5871 4510 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390797.1 protein_id gnl|my_center|LOCUS_35820 6340 5954 gene locus_tag LOCUS_35830 gene gcvH 6340 5954 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903167.1 protein_id gnl|my_center|LOCUS_35830 7512 6400 gene locus_tag LOCUS_35840 gene gcvT 7512 6400 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_35840 8393 7629 gene locus_tag LOCUS_35850 8393 7629 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403704.1 protein_id gnl|my_center|LOCUS_35850 9294 8464 gene locus_tag LOCUS_35860 9294 8464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 9356 10996 gene locus_tag LOCUS_35870 9356 10996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 11766 11230 gene locus_tag LOCUS_35880 11766 11230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 12266 11790 gene locus_tag LOCUS_35890 gene smpB 12266 11790 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971340.1 protein_id gnl|my_center|LOCUS_35890 13506 12295 gene locus_tag LOCUS_35900 13506 12295 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933267.1 protein_id gnl|my_center|LOCUS_35900 14850 13615 gene locus_tag LOCUS_35910 14850 13615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 15899 14889 gene locus_tag LOCUS_35920 gene amrB 15899 14889 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880539.1 protein_id gnl|my_center|LOCUS_35920 16478 17275 gene locus_tag LOCUS_35930 16478 17275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 17315 18223 gene locus_tag LOCUS_35940 17315 18223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 18233 19171 gene locus_tag LOCUS_35950 18233 19171 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783522.1 protein_id gnl|my_center|LOCUS_35950 20004 19417 gene locus_tag LOCUS_35960 20004 19417 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_35960 20489 20016 gene locus_tag LOCUS_35970 20489 20016 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940775.1 protein_id gnl|my_center|LOCUS_35970 20763 21587 gene locus_tag LOCUS_35980 20763 21587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 21596 23443 gene locus_tag LOCUS_35990 21596 23443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 23457 24995 gene locus_tag LOCUS_36000 23457 24995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 >Feature sequence64 210 413 gene locus_tag LOCUS_36010 210 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 410 781 gene locus_tag LOCUS_36020 410 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 1459 1013 gene locus_tag LOCUS_36030 1459 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 2117 2785 gene locus_tag LOCUS_36040 2117 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 3786 3076 gene locus_tag LOCUS_36050 3786 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 5072 4392 gene locus_tag LOCUS_36060 5072 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 6278 5076 gene locus_tag LOCUS_36070 6278 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 6678 6295 gene locus_tag LOCUS_36080 6678 6295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 7424 6678 gene locus_tag LOCUS_36090 7424 6678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 8908 7436 gene locus_tag LOCUS_36100 8908 7436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 9000 9704 gene locus_tag LOCUS_36110 9000 9704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 9770 11131 gene locus_tag LOCUS_36120 9770 11131 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_36120 11142 15461 gene locus_tag LOCUS_36130 11142 15461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 16236 15943 gene locus_tag LOCUS_36140 16236 15943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 16897 16292 gene locus_tag LOCUS_36150 16897 16292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 17138 17512 gene locus_tag LOCUS_36160 17138 17512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 17534 18610 gene locus_tag LOCUS_36170 17534 18610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 19583 18612 gene locus_tag LOCUS_36180 19583 18612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122551.1 protein_id gnl|my_center|LOCUS_36180 22031 19599 gene locus_tag LOCUS_36190 22031 19599 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545339.1 protein_id gnl|my_center|LOCUS_36190 23409 22072 gene locus_tag LOCUS_36200 23409 22072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 >Feature sequence65 446 2275 gene locus_tag LOCUS_36210 446 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 2335 2931 gene locus_tag LOCUS_36220 2335 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 3227 4441 gene locus_tag LOCUS_36230 3227 4441 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_36230 4563 4880 gene locus_tag LOCUS_36240 4563 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 4880 6004 gene locus_tag LOCUS_36250 4880 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 6069 8135 gene locus_tag LOCUS_36260 6069 8135 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770054.1 protein_id gnl|my_center|LOCUS_36260 8262 10211 gene locus_tag LOCUS_36270 8262 10211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 10257 12050 gene locus_tag LOCUS_36280 10257 12050 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040201.1 protein_id gnl|my_center|LOCUS_36280 12103 12441 gene locus_tag LOCUS_36290 12103 12441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 12447 14354 gene locus_tag LOCUS_36300 12447 14354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 14351 15250 gene locus_tag LOCUS_36310 14351 15250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 15352 16116 gene locus_tag LOCUS_36320 15352 16116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 16113 16592 gene locus_tag LOCUS_36330 16113 16592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 18846 16669 gene locus_tag LOCUS_36340 18846 16669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 19215 20318 gene locus_tag LOCUS_36350 19215 20318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 20339 22831 gene locus_tag LOCUS_36360 20339 22831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 >Feature sequence66 2411 177 gene locus_tag LOCUS_36370 2411 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 2972 2520 gene locus_tag LOCUS_36380 2972 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 3114 3213 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3681 5480 gene locus_tag LOCUS_36390 3681 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 6144 5512 gene locus_tag LOCUS_36400 6144 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 6290 8071 gene locus_tag LOCUS_36410 6290 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 9723 8092 gene locus_tag LOCUS_36420 9723 8092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 10629 9802 gene locus_tag LOCUS_36430 10629 9802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 10514 10825 gene locus_tag LOCUS_36440 10514 10825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 11247 10750 gene locus_tag LOCUS_36450 11247 10750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 13164 11317 gene locus_tag LOCUS_36460 13164 11317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 14286 13309 gene locus_tag LOCUS_36470 gene trpS 14286 13309 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016366.1 protein_id gnl|my_center|LOCUS_36470 14432 16234 gene locus_tag LOCUS_36480 gene lepA 14432 16234 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941921.1 protein_id gnl|my_center|LOCUS_36480 16227 17285 gene locus_tag LOCUS_36490 16227 17285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 17403 19223 gene locus_tag LOCUS_36500 17403 19223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 19287 20375 gene locus_tag LOCUS_36510 19287 20375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 20401 21243 gene locus_tag LOCUS_36520 20401 21243 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141322.1 protein_id gnl|my_center|LOCUS_36520 23121 21259 gene locus_tag LOCUS_36530 23121 21259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 >Feature sequence67 887 492 gene locus_tag LOCUS_36540 887 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 1369 890 gene locus_tag LOCUS_36550 1369 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 2145 1366 gene locus_tag LOCUS_36560 2145 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 2962 2273 gene locus_tag LOCUS_36570 2962 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 3266 4357 gene locus_tag LOCUS_36580 3266 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 4446 5003 gene locus_tag LOCUS_36590 4446 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 5569 5237 gene locus_tag LOCUS_36600 5569 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 6074 5745 gene locus_tag LOCUS_36610 6074 5745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 5958 7496 gene locus_tag LOCUS_36620 5958 7496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 7540 8517 gene locus_tag LOCUS_36630 7540 8517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 8543 10750 gene locus_tag LOCUS_36640 8543 10750 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765304.1 protein_id gnl|my_center|LOCUS_36640 14026 10814 gene locus_tag LOCUS_36650 14026 10814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 15090 14422 gene locus_tag LOCUS_36660 15090 14422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 16376 15615 gene locus_tag LOCUS_36670 16376 15615 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_36670 17907 16393 gene locus_tag LOCUS_36680 17907 16393 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941403.1 protein_id gnl|my_center|LOCUS_36680 19388 17904 gene locus_tag LOCUS_36690 19388 17904 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816730.1 protein_id gnl|my_center|LOCUS_36690 20034 19393 gene locus_tag LOCUS_36700 20034 19393 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941401.1 protein_id gnl|my_center|LOCUS_36700 20954 20031 gene locus_tag LOCUS_36710 20954 20031 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941400.1 protein_id gnl|my_center|LOCUS_36710 22947 20959 gene locus_tag LOCUS_36720 22947 20959 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941395.1 protein_id gnl|my_center|LOCUS_36720 >Feature sequence68 689 75 gene locus_tag LOCUS_36730 689 75 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_36730 1155 691 gene locus_tag LOCUS_36740 1155 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 5612 1164 gene locus_tag LOCUS_36750 5612 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 5940 6899 gene locus_tag LOCUS_36760 5940 6899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 6916 8055 gene locus_tag LOCUS_36770 6916 8055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 8058 9821 gene locus_tag LOCUS_36780 8058 9821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 9844 12192 gene locus_tag LOCUS_36790 9844 12192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 12381 19661 gene locus_tag LOCUS_36800 12381 19661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 >Feature sequence69 386 778 gene locus_tag LOCUS_36810 386 778 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706111.1 protein_id gnl|my_center|LOCUS_36810 775 1998 gene locus_tag LOCUS_36820 gene arsB 775 1998 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 protein_id gnl|my_center|LOCUS_36820 2002 3636 gene locus_tag LOCUS_36830 2002 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 3633 3800 gene locus_tag LOCUS_36840 3633 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 3867 6365 gene locus_tag LOCUS_36850 3867 6365 CDS product chromosome condensation regulator RCC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258200.1 protein_id gnl|my_center|LOCUS_36850 6376 7422 gene locus_tag LOCUS_36860 6376 7422 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922490.1 protein_id gnl|my_center|LOCUS_36860 7454 9169 gene locus_tag LOCUS_36870 7454 9169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 9280 9540 gene locus_tag LOCUS_36880 9280 9540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 9533 10363 gene locus_tag LOCUS_36890 9533 10363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 10368 10937 gene locus_tag LOCUS_36900 10368 10937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 10968 11810 gene locus_tag LOCUS_36910 gene cdaA 10968 11810 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_36910 11817 12731 gene locus_tag LOCUS_36920 11817 12731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 13955 12741 gene locus_tag LOCUS_36930 13955 12741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 16051 14177 gene locus_tag LOCUS_36940 16051 14177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 16750 16103 gene locus_tag LOCUS_36950 16750 16103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 16935 19352 gene locus_tag LOCUS_36960 16935 19352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 19369 20040 gene locus_tag LOCUS_36970 19369 20040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 20297 20767 gene locus_tag LOCUS_36980 20297 20767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 >Feature sequence70 3280 152 gene locus_tag LOCUS_36990 3280 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 3450 3719 gene locus_tag LOCUS_37000 3450 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 4382 3738 gene locus_tag LOCUS_37010 4382 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 7120 4379 gene locus_tag LOCUS_37020 7120 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 7392 9548 gene locus_tag LOCUS_37030 7392 9548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 10476 9616 gene locus_tag LOCUS_37040 10476 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 11077 10613 gene locus_tag LOCUS_37050 11077 10613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 12164 11091 gene locus_tag LOCUS_37060 12164 11091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 13498 12401 gene locus_tag LOCUS_37070 13498 12401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 14495 13503 gene locus_tag LOCUS_37080 14495 13503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 15410 14550 gene locus_tag LOCUS_37090 15410 14550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 16639 15476 gene locus_tag LOCUS_37100 16639 15476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 18434 16647 gene locus_tag LOCUS_37110 gene ptsP 18434 16647 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_37110 18705 18439 gene locus_tag LOCUS_37120 18705 18439 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626594.1 protein_id gnl|my_center|LOCUS_37120 19588 18737 gene locus_tag LOCUS_37130 gene rapZ 19588 18737 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545545.1 protein_id gnl|my_center|LOCUS_37130 20563 19604 gene locus_tag LOCUS_37140 gene hprK 20563 19604 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942530.1 protein_id gnl|my_center|LOCUS_37140 >Feature sequence71 2052 703 gene locus_tag LOCUS_37150 gene eno 2052 703 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_37150 2301 5594 gene locus_tag LOCUS_37160 2301 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 5667 7580 gene locus_tag LOCUS_37170 5667 7580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 7641 8354 gene locus_tag LOCUS_37180 7641 8354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 8395 10791 gene locus_tag LOCUS_37190 8395 10791 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939521.1 protein_id gnl|my_center|LOCUS_37190 10822 12633 gene locus_tag LOCUS_37200 10822 12633 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403150.1 protein_id gnl|my_center|LOCUS_37200 13844 12630 gene locus_tag LOCUS_37210 13844 12630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 14687 14193 gene locus_tag LOCUS_37220 14687 14193 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174302.1 protein_id gnl|my_center|LOCUS_37220 14772 16397 gene locus_tag LOCUS_37230 14772 16397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 16411 17355 gene locus_tag LOCUS_37240 16411 17355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 17357 18136 gene locus_tag LOCUS_37250 17357 18136 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973507.1 protein_id gnl|my_center|LOCUS_37250 18133 19125 gene locus_tag LOCUS_37260 18133 19125 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121063.1 protein_id gnl|my_center|LOCUS_37260 19646 19969 gene locus_tag LOCUS_37270 19646 19969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 >Feature sequence72 2147 639 gene locus_tag LOCUS_37280 2147 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 3153 2173 gene locus_tag LOCUS_37290 3153 2173 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122178.1 protein_id gnl|my_center|LOCUS_37290 3881 3150 gene locus_tag LOCUS_37300 gene tsaB 3881 3150 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337317.1 protein_id gnl|my_center|LOCUS_37300 5683 3884 gene locus_tag LOCUS_37310 5683 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 6564 5743 gene locus_tag LOCUS_37320 gene murI 6564 5743 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_37320 7367 6561 gene locus_tag LOCUS_37330 gene xth 7367 6561 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_37330 7590 7976 gene locus_tag LOCUS_37340 7590 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 8086 8916 gene locus_tag LOCUS_37350 8086 8916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 9021 10955 gene locus_tag LOCUS_37360 9021 10955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 10987 12111 gene locus_tag LOCUS_37370 gene mraY 10987 12111 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_37370 12238 13149 gene locus_tag LOCUS_37380 12238 13149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 13146 14681 gene locus_tag LOCUS_37390 13146 14681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 14726 16717 gene locus_tag LOCUS_37400 14726 16717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 16717 18660 gene locus_tag LOCUS_37410 16717 18660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 >Feature sequence73 372 181 gene locus_tag LOCUS_37420 372 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 2414 450 gene locus_tag LOCUS_37430 2414 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 2514 3761 gene locus_tag LOCUS_37440 2514 3761 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403427.1 protein_id gnl|my_center|LOCUS_37440 3885 4406 gene locus_tag LOCUS_37450 3885 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 4578 6305 gene locus_tag LOCUS_37460 4578 6305 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329982.1 protein_id gnl|my_center|LOCUS_37460 6395 7768 gene locus_tag LOCUS_37470 6395 7768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 8927 8019 gene locus_tag LOCUS_37480 8927 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 10229 9147 gene locus_tag LOCUS_37490 10229 9147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 10962 10246 gene locus_tag LOCUS_37500 10962 10246 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031156.1 protein_id gnl|my_center|LOCUS_37500 11108 13180 gene locus_tag LOCUS_37510 11108 13180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 13194 15104 gene locus_tag LOCUS_37520 13194 15104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 15232 15519 gene locus_tag LOCUS_37530 15232 15519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 15578 17803 gene locus_tag LOCUS_37540 15578 17803 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923343.1 protein_id gnl|my_center|LOCUS_37540 17900 18829 gene locus_tag LOCUS_37550 17900 18829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 >Feature sequence74 597 214 gene locus_tag LOCUS_37560 597 214 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_37560 1157 594 gene locus_tag LOCUS_37570 1157 594 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039237.1 protein_id gnl|my_center|LOCUS_37570 1618 1154 gene locus_tag LOCUS_37580 1618 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021936.1 protein_id gnl|my_center|LOCUS_37580 2842 1628 gene locus_tag LOCUS_37590 2842 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 6483 2965 gene locus_tag LOCUS_37600 6483 2965 CDS product YhaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922355.1 protein_id gnl|my_center|LOCUS_37600 7745 6480 gene locus_tag LOCUS_37610 7745 6480 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_37610 7931 9433 gene locus_tag LOCUS_37620 7931 9433 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258274.1 protein_id gnl|my_center|LOCUS_37620 9650 9474 gene locus_tag LOCUS_37630 9650 9474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 10048 9695 gene locus_tag LOCUS_37640 10048 9695 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869620.1 protein_id gnl|my_center|LOCUS_37640 10334 10038 gene locus_tag LOCUS_37650 10334 10038 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228377.1 protein_id gnl|my_center|LOCUS_37650 10982 10713 gene locus_tag LOCUS_37660 10982 10713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 11242 11451 gene locus_tag LOCUS_37670 11242 11451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 12644 11436 gene locus_tag LOCUS_37680 12644 11436 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108877.1 protein_id gnl|my_center|LOCUS_37680 12862 13236 gene locus_tag LOCUS_37690 12862 13236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 15272 13272 gene locus_tag LOCUS_37700 15272 13272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 15434 16036 gene locus_tag LOCUS_37710 15434 16036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 16625 16059 gene locus_tag LOCUS_37720 16625 16059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 >Feature sequence75 115 996 gene locus_tag LOCUS_37730 115 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 996 2786 gene locus_tag LOCUS_37740 996 2786 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675527.1 protein_id gnl|my_center|LOCUS_37740 2977 3537 gene locus_tag LOCUS_37750 2977 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 3534 5246 gene locus_tag LOCUS_37760 3534 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 6969 5251 gene locus_tag LOCUS_37770 6969 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 8390 7200 gene locus_tag LOCUS_37780 8390 7200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 10375 8579 gene locus_tag LOCUS_37790 10375 8579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 12434 10596 gene locus_tag LOCUS_37800 gene uvrB 12434 10596 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_37800 13465 12590 gene locus_tag LOCUS_37810 13465 12590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 13953 13462 gene locus_tag LOCUS_37820 13953 13462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 14756 13959 gene locus_tag LOCUS_37830 14756 13959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 14941 16401 gene locus_tag LOCUS_37840 14941 16401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 16398 17399 gene locus_tag LOCUS_37850 gene dusB 16398 17399 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391694.1 protein_id gnl|my_center|LOCUS_37850 >Feature sequence76 703 113 gene locus_tag LOCUS_37860 703 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 2860 755 gene locus_tag LOCUS_37870 2860 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 4126 2873 gene locus_tag LOCUS_37880 gene pepT 4126 2873 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401270.1 protein_id gnl|my_center|LOCUS_37880 4565 6517 gene locus_tag LOCUS_37890 gene acs 4565 6517 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529021.1 protein_id gnl|my_center|LOCUS_37890 6730 8043 gene locus_tag LOCUS_37900 6730 8043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 8058 9071 gene locus_tag LOCUS_37910 8058 9071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 9091 10740 gene locus_tag LOCUS_37920 gene ffh 9091 10740 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362591.1 protein_id gnl|my_center|LOCUS_37920 10746 11756 gene locus_tag LOCUS_37930 10746 11756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 11784 12968 gene locus_tag LOCUS_37940 11784 12968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 12979 14223 gene locus_tag LOCUS_37950 12979 14223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 14623 14234 gene locus_tag LOCUS_37960 14623 14234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 16176 14689 gene locus_tag LOCUS_37970 16176 14689 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258284.1 protein_id gnl|my_center|LOCUS_37970 16601 16212 gene locus_tag LOCUS_37980 16601 16212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 >Feature sequence77 1079 255 gene locus_tag LOCUS_37990 1079 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 1492 1133 gene locus_tag LOCUS_38000 1492 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 2313 1504 gene locus_tag LOCUS_38010 2313 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 3673 2303 gene locus_tag LOCUS_38020 gene der 3673 2303 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_38020 4587 3670 gene locus_tag LOCUS_38030 gene era 4587 3670 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036468.1 protein_id gnl|my_center|LOCUS_38030 6353 4839 gene locus_tag LOCUS_38040 6353 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 6561 6968 gene locus_tag LOCUS_38050 6561 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 6965 9115 gene locus_tag LOCUS_38060 6965 9115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 9801 9133 gene locus_tag LOCUS_38070 9801 9133 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766706.1 protein_id gnl|my_center|LOCUS_38070 10733 9798 gene locus_tag LOCUS_38080 10733 9798 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390112.1 protein_id gnl|my_center|LOCUS_38080 11088 10741 gene locus_tag LOCUS_38090 11088 10741 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_38090 11276 13621 gene locus_tag LOCUS_38100 11276 13621 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975149.1 protein_id gnl|my_center|LOCUS_38100 13761 15284 gene locus_tag LOCUS_38110 13761 15284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 >Feature sequence78 1931 1140 gene locus_tag LOCUS_38120 1931 1140 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082267.1 protein_id gnl|my_center|LOCUS_38120 2019 1935 gene locus_tag LOCUS_t00480 2019 1935 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2109 2033 gene locus_tag LOCUS_t00490 2109 2033 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2310 2588 gene locus_tag LOCUS_38130 2310 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 2822 4384 gene locus_tag LOCUS_38140 gene rny 2822 4384 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_38140 4374 5207 gene locus_tag LOCUS_38150 4374 5207 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_38150 5204 6643 gene locus_tag LOCUS_38160 5204 6643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 6653 7699 gene locus_tag LOCUS_38170 6653 7699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 7736 9580 gene locus_tag LOCUS_38180 7736 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 9598 10251 gene locus_tag LOCUS_38190 9598 10251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 10261 11190 gene locus_tag LOCUS_38200 10261 11190 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080645.1 protein_id gnl|my_center|LOCUS_38200 11635 11234 gene locus_tag LOCUS_38210 11635 11234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 11523 13202 gene locus_tag LOCUS_38220 11523 13202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 14376 13468 gene locus_tag LOCUS_38230 14376 13468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 >Feature sequence79 696 1322 gene locus_tag LOCUS_38240 696 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 1764 2189 gene locus_tag LOCUS_38250 1764 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 2388 3737 gene locus_tag LOCUS_38260 2388 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 3789 5051 gene locus_tag LOCUS_38270 3789 5051 CDS product TIGR04013 family B12-binding domain/radical SAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082817.1 protein_id gnl|my_center|LOCUS_38270 5242 9078 gene locus_tag LOCUS_38280 5242 9078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 10183 9281 gene locus_tag LOCUS_38290 10183 9281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 11894 10194 gene locus_tag LOCUS_38300 11894 10194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 13247 12255 gene locus_tag LOCUS_38310 13247 12255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 >Feature sequence80 217 1929 gene locus_tag LOCUS_38320 217 1929 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230221.1 protein_id gnl|my_center|LOCUS_38320 2040 2471 gene locus_tag LOCUS_38330 2040 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 2587 3189 gene locus_tag LOCUS_38340 2587 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 3563 3237 gene locus_tag LOCUS_38350 3563 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 4630 3560 gene locus_tag LOCUS_38360 4630 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 5330 4623 gene locus_tag LOCUS_38370 5330 4623 CDS product DUF5714 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673563.1 protein_id gnl|my_center|LOCUS_38370 5595 5981 gene locus_tag LOCUS_38380 5595 5981 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418999.1 protein_id gnl|my_center|LOCUS_38380 5978 7069 gene locus_tag LOCUS_38390 gene arsB 5978 7069 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462028.1 protein_id gnl|my_center|LOCUS_38390 7081 8679 gene locus_tag LOCUS_38400 7081 8679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 8959 8657 gene locus_tag LOCUS_38410 8959 8657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 9492 8956 gene locus_tag LOCUS_38420 9492 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 9896 9513 gene locus_tag LOCUS_38430 9896 9513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 10176 10550 gene locus_tag LOCUS_38440 10176 10550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 10535 10774 gene locus_tag LOCUS_38450 10535 10774 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080561.1 protein_id gnl|my_center|LOCUS_38450 10950 11426 gene locus_tag LOCUS_38460 10950 11426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 11423 12112 gene locus_tag LOCUS_38470 11423 12112 CDS product aromatic aminobenezylarsenical efflux permease ArsG family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107453.1 protein_id gnl|my_center|LOCUS_38470 12653 12129 gene locus_tag LOCUS_38480 12653 12129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 >Feature sequence81 3596 1686 gene locus_tag LOCUS_38490 3596 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 3756 6209 gene locus_tag LOCUS_38500 3756 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 6274 7875 gene locus_tag LOCUS_38510 6274 7875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 7902 9077 gene locus_tag LOCUS_38520 7902 9077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 9958 9380 gene locus_tag LOCUS_38530 9958 9380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 10174 11802 gene locus_tag LOCUS_38540 10174 11802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 11841 12059 gene locus_tag LOCUS_38550 11841 12059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 >Feature sequence82 2688 286 gene locus_tag LOCUS_38560 2688 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 3926 2685 gene locus_tag LOCUS_38570 3926 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 5392 3923 gene locus_tag LOCUS_38580 5392 3923 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_38580 6776 5502 gene locus_tag LOCUS_38590 6776 5502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 9040 6848 gene locus_tag LOCUS_38600 9040 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 9762 9136 gene locus_tag LOCUS_38610 9762 9136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 10532 9753 gene locus_tag LOCUS_38620 10532 9753 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 protein_id gnl|my_center|LOCUS_38620 >Feature sequence83 1164 619 gene locus_tag LOCUS_38630 1164 619 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932570.1 protein_id gnl|my_center|LOCUS_38630 3290 1242 gene locus_tag LOCUS_38640 3290 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 3401 5572 gene locus_tag LOCUS_38650 3401 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 5596 6423 gene locus_tag LOCUS_38660 5596 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 6656 7141 gene locus_tag LOCUS_38670 6656 7141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 7792 7190 gene locus_tag LOCUS_38680 7792 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 7952 8491 gene locus_tag LOCUS_38690 7952 8491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 8590 9687 gene locus_tag LOCUS_38700 8590 9687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 9709 10236 gene locus_tag LOCUS_38710 9709 10236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 >Feature sequence84 2500 227 gene locus_tag LOCUS_38720 2500 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 3569 2535 gene locus_tag LOCUS_38730 3569 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 4051 3566 gene locus_tag LOCUS_38740 gene tadA 4051 3566 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815124.1 protein_id gnl|my_center|LOCUS_38740 4828 4052 gene locus_tag LOCUS_38750 gene tpiA 4828 4052 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927032.1 protein_id gnl|my_center|LOCUS_38750 6037 4847 gene locus_tag LOCUS_38760 6037 4847 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_38760 7100 6099 gene locus_tag LOCUS_38770 gene gap 7100 6099 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942274.1 protein_id gnl|my_center|LOCUS_38770 7463 7885 gene locus_tag LOCUS_38780 7463 7885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 7948 9228 gene locus_tag LOCUS_38790 7948 9228 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163760282.1 protein_id gnl|my_center|LOCUS_38790 9239 10042 gene locus_tag LOCUS_38800 9239 10042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 >Feature sequence85 1191 73 gene locus_tag LOCUS_38810 1191 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 2722 1193 gene locus_tag LOCUS_38820 2722 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 3095 2736 gene locus_tag LOCUS_38830 3095 2736 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146466.1 protein_id gnl|my_center|LOCUS_38830 4888 3113 gene locus_tag LOCUS_38840 4888 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 5447 4986 gene locus_tag LOCUS_38850 5447 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 5604 6488 gene locus_tag LOCUS_38860 5604 6488 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869302.1 protein_id gnl|my_center|LOCUS_38860 6526 7770 gene locus_tag LOCUS_38870 6526 7770 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_38870 >Feature sequence86 254 586 gene locus_tag LOCUS_38880 254 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 1213 1926 gene locus_tag LOCUS_38890 1213 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 3217 2090 gene locus_tag LOCUS_38900 3217 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 3562 4812 gene locus_tag LOCUS_38910 3562 4812 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257970.1 protein_id gnl|my_center|LOCUS_38910 6759 4825 gene locus_tag LOCUS_38920 6759 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 7315 6863 gene locus_tag LOCUS_38930 7315 6863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 7668 7312 gene locus_tag LOCUS_38940 7668 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 8219 7665 gene locus_tag LOCUS_38950 8219 7665 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 protein_id gnl|my_center|LOCUS_38950 8380 8874 gene locus_tag LOCUS_38960 8380 8874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 9272 9093 gene locus_tag LOCUS_38970 9272 9093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 >Feature sequence87 4250 2529 gene locus_tag LOCUS_38980 4250 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 7522 4262 gene locus_tag LOCUS_38990 7522 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 8281 7628 gene locus_tag LOCUS_39000 8281 7628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 8629 8309 gene locus_tag LOCUS_39010 8629 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 >Feature sequence88 68 1543 gene locus_tag LOCUS_39020 68 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 1798 2586 gene locus_tag LOCUS_39030 1798 2586 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795042.1 protein_id gnl|my_center|LOCUS_39030 3772 2618 gene locus_tag LOCUS_39040 3772 2618 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_39040 4267 3857 gene locus_tag LOCUS_39050 gene trxA 4267 3857 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027416.1 protein_id gnl|my_center|LOCUS_39050 5995 4424 gene locus_tag LOCUS_39060 5995 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 6894 6025 gene locus_tag LOCUS_39070 6894 6025 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434727.1 protein_id gnl|my_center|LOCUS_39070 >Feature sequence89 2950 518 gene locus_tag LOCUS_39080 gene hrpB 2950 518 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 protein_id gnl|my_center|LOCUS_39080 3016 4389 gene locus_tag LOCUS_39090 3016 4389 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937720.1 protein_id gnl|my_center|LOCUS_39090 4386 5048 gene locus_tag LOCUS_39100 4386 5048 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937719.1 protein_id gnl|my_center|LOCUS_39100 5052 6434 gene locus_tag LOCUS_39110 5052 6434 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937720.1 protein_id gnl|my_center|LOCUS_39110 6431 7099 gene locus_tag LOCUS_39120 6431 7099 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_39120 7104 7667 gene locus_tag LOCUS_39130 7104 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 >Feature sequence90 179 1405 gene locus_tag LOCUS_39140 179 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122044.1 protein_id gnl|my_center|LOCUS_39140 1600 1986 gene locus_tag LOCUS_39150 1600 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 2194 2006 gene locus_tag LOCUS_39160 2194 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 2121 2621 gene locus_tag LOCUS_39170 2121 2621 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932287.1 protein_id gnl|my_center|LOCUS_39170 2642 3691 gene locus_tag LOCUS_39180 2642 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 3754 4170 gene locus_tag LOCUS_39190 3754 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 4216 4569 gene locus_tag LOCUS_39200 4216 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 4607 5125 gene locus_tag LOCUS_39210 4607 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 6092 5130 gene locus_tag LOCUS_39220 6092 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 6263 6928 gene locus_tag LOCUS_39230 6263 6928 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476288.1 protein_id gnl|my_center|LOCUS_39230 >Feature sequence91 1969 125 gene locus_tag LOCUS_39240 1969 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 3015 3728 gene locus_tag LOCUS_39250 3015 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 3834 5972 gene locus_tag LOCUS_39260 3834 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 6493 5915 gene locus_tag LOCUS_39270 6493 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 >Feature sequence92 652 1428 gene locus_tag LOCUS_39280 652 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 1469 2014 gene locus_tag LOCUS_39290 gene tsaA 1469 2014 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943048.1 protein_id gnl|my_center|LOCUS_39290 2142 3512 gene locus_tag LOCUS_39300 2142 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 5856 3535 gene locus_tag LOCUS_39310 5856 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 >Feature sequence93 1231 2736 gene locus_tag LOCUS_39320 1231 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 2826 5033 gene locus_tag LOCUS_39330 2826 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330