>Feature sequence01 451 366 gene locus_tag LOCUS_t00010 451 366 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 823 4707 gene locus_tag LOCUS_00010 gene nifJ 823 4707 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965527.1 protein_id gnl|my_center|LOCUS_00010 4820 4960 gene locus_tag LOCUS_00020 4820 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 5426 5992 gene locus_tag LOCUS_00030 5426 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 6744 6148 gene locus_tag LOCUS_00040 gene ruvA 6744 6148 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_00040 7244 6741 gene locus_tag LOCUS_00050 gene ruvC 7244 6741 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941736.1 protein_id gnl|my_center|LOCUS_00050 7993 7241 gene locus_tag LOCUS_00060 7993 7241 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_00060 8760 8149 gene locus_tag LOCUS_00070 8760 8149 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939535.1 protein_id gnl|my_center|LOCUS_00070 9006 10580 gene locus_tag LOCUS_00080 9006 10580 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002146066.1 protein_id gnl|my_center|LOCUS_00080 10580 11569 gene locus_tag LOCUS_00090 10580 11569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 12984 11638 gene locus_tag LOCUS_00100 12984 11638 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_00100 13451 14551 gene locus_tag LOCUS_00110 gene hisC 13451 14551 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_00110 14541 15224 gene locus_tag LOCUS_00120 gene cmk 14541 15224 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106010.1 protein_id gnl|my_center|LOCUS_00120 15325 17172 gene locus_tag LOCUS_00130 15325 17172 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_00130 17351 18241 gene locus_tag LOCUS_00140 gene sppA 17351 18241 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941890.1 protein_id gnl|my_center|LOCUS_00140 18797 18252 gene locus_tag LOCUS_00150 18797 18252 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_00150 20378 18873 gene locus_tag LOCUS_00160 20378 18873 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939137.1 protein_id gnl|my_center|LOCUS_00160 21844 20456 gene locus_tag LOCUS_00170 21844 20456 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939112.1 protein_id gnl|my_center|LOCUS_00170 22936 21878 gene locus_tag LOCUS_00180 22936 21878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 24357 23302 gene locus_tag LOCUS_00190 24357 23302 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537135.1 protein_id gnl|my_center|LOCUS_00190 25025 24354 gene locus_tag LOCUS_00200 gene tmk 25025 24354 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039005.1 protein_id gnl|my_center|LOCUS_00200 25196 26173 gene locus_tag LOCUS_00210 25196 26173 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_00210 26491 26186 gene locus_tag LOCUS_00220 26491 26186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 27301 26531 gene locus_tag LOCUS_00230 27301 26531 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_00230 27831 27304 gene locus_tag LOCUS_00240 27831 27304 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023647.1 protein_id gnl|my_center|LOCUS_00240 28074 28538 gene locus_tag LOCUS_00250 28074 28538 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943986.1 protein_id gnl|my_center|LOCUS_00250 28760 29167 gene locus_tag LOCUS_00260 28760 29167 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940354.1 protein_id gnl|my_center|LOCUS_00260 29171 29986 gene locus_tag LOCUS_00270 29171 29986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 30039 30233 gene locus_tag LOCUS_00280 30039 30233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 30221 30436 gene locus_tag LOCUS_00290 30221 30436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 30476 30970 gene locus_tag LOCUS_00300 30476 30970 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545398.1 protein_id gnl|my_center|LOCUS_00300 31103 31678 gene locus_tag LOCUS_00310 31103 31678 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_00310 31811 32185 gene locus_tag LOCUS_00320 31811 32185 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940441.1 protein_id gnl|my_center|LOCUS_00320 32189 32701 gene locus_tag LOCUS_00330 32189 32701 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_00330 32871 34574 gene locus_tag LOCUS_00340 32871 34574 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938860.1 protein_id gnl|my_center|LOCUS_00340 34579 35430 gene locus_tag LOCUS_00350 34579 35430 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938861.1 protein_id gnl|my_center|LOCUS_00350 35448 35633 gene locus_tag LOCUS_00360 35448 35633 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940352.1 protein_id gnl|my_center|LOCUS_00360 35768 35926 gene locus_tag LOCUS_00370 35768 35926 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545616.1 protein_id gnl|my_center|LOCUS_00370 36044 37234 gene locus_tag LOCUS_00380 36044 37234 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940443.1 protein_id gnl|my_center|LOCUS_00380 39584 37221 gene locus_tag LOCUS_00390 39584 37221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 39846 39559 gene locus_tag LOCUS_00400 39846 39559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 40577 39891 gene locus_tag LOCUS_00410 40577 39891 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054522704.1 protein_id gnl|my_center|LOCUS_00410 41371 40718 gene locus_tag LOCUS_00420 41371 40718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 41778 41374 gene locus_tag LOCUS_00430 41778 41374 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_00430 42428 41820 gene locus_tag LOCUS_00440 gene lexA 42428 41820 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940718.1 protein_id gnl|my_center|LOCUS_00440 42636 42833 gene locus_tag LOCUS_00450 42636 42833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 43048 43254 gene locus_tag LOCUS_00460 43048 43254 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944059.1 protein_id gnl|my_center|LOCUS_00460 43765 44562 gene locus_tag LOCUS_00470 43765 44562 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939133.1 protein_id gnl|my_center|LOCUS_00470 44724 45179 gene locus_tag LOCUS_00480 gene rimI 44724 45179 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251164.1 protein_id gnl|my_center|LOCUS_00480 46625 45222 gene locus_tag LOCUS_00490 46625 45222 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_00490 47842 46625 gene locus_tag LOCUS_00500 47842 46625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 48591 48052 gene locus_tag LOCUS_00510 48591 48052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 49431 48682 gene locus_tag LOCUS_00520 49431 48682 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418348.1 protein_id gnl|my_center|LOCUS_00520 49621 50154 gene locus_tag LOCUS_00530 49621 50154 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391683.1 protein_id gnl|my_center|LOCUS_00530 52585 50321 gene locus_tag LOCUS_00540 gene priA 52585 50321 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940804.1 protein_id gnl|my_center|LOCUS_00540 53334 52699 gene locus_tag LOCUS_00550 53334 52699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926920.1 protein_id gnl|my_center|LOCUS_00550 54041 54943 gene locus_tag LOCUS_00560 54041 54943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 59793 55615 gene locus_tag LOCUS_00570 59793 55615 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200903603.1 protein_id gnl|my_center|LOCUS_00570 60956 60030 gene locus_tag LOCUS_00580 60956 60030 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933107.1 protein_id gnl|my_center|LOCUS_00580 61449 61273 gene locus_tag LOCUS_00590 61449 61273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 62040 61639 gene locus_tag LOCUS_00600 62040 61639 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_00600 63737 62070 gene locus_tag LOCUS_00610 63737 62070 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250100.1 protein_id gnl|my_center|LOCUS_00610 64848 64021 gene locus_tag LOCUS_00620 64848 64021 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225414074.1 protein_id gnl|my_center|LOCUS_00620 65181 67433 gene locus_tag LOCUS_00630 65181 67433 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924872.1 protein_id gnl|my_center|LOCUS_00630 67921 68952 gene locus_tag LOCUS_00640 67921 68952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106006607.1 protein_id gnl|my_center|LOCUS_00640 69228 69830 gene locus_tag LOCUS_00650 69228 69830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 70991 69921 gene locus_tag LOCUS_00660 70991 69921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 72684 71446 gene locus_tag LOCUS_00670 72684 71446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 74255 72966 gene locus_tag LOCUS_00680 gene hemA 74255 72966 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938754.1 protein_id gnl|my_center|LOCUS_00680 75082 74252 gene locus_tag LOCUS_00690 gene ccsB 75082 74252 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_00690 75805 75095 gene locus_tag LOCUS_00700 75805 75095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 76649 76284 gene locus_tag LOCUS_00710 76649 76284 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075358.1 protein_id gnl|my_center|LOCUS_00710 76991 76671 gene locus_tag LOCUS_00720 76991 76671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 77822 77025 gene locus_tag LOCUS_00730 77822 77025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 78406 78002 gene locus_tag LOCUS_00740 78406 78002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 79358 78366 gene locus_tag LOCUS_00750 79358 78366 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_00750 80571 79462 gene locus_tag LOCUS_00760 80571 79462 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_00760 81602 80541 gene locus_tag LOCUS_00770 gene rfaQ 81602 80541 CDS product putative lipopolysaccharide heptosyltransferase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703803.1 protein_id gnl|my_center|LOCUS_00770 82392 81592 gene locus_tag LOCUS_00780 gene lpxA 82392 81592 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941664.1 protein_id gnl|my_center|LOCUS_00780 83159 82389 gene locus_tag LOCUS_00790 83159 82389 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_00790 83335 83141 gene locus_tag LOCUS_00800 83335 83141 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937959.1 protein_id gnl|my_center|LOCUS_00800 83699 84625 gene locus_tag LOCUS_00810 83699 84625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 84552 85136 gene locus_tag LOCUS_00820 84552 85136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 86029 85331 gene locus_tag LOCUS_00830 86029 85331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 86828 86376 gene locus_tag LOCUS_00840 86828 86376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 87336 86812 gene locus_tag LOCUS_00850 87336 86812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 87752 87333 gene locus_tag LOCUS_00860 87752 87333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 87872 88492 gene locus_tag LOCUS_00870 gene yihX 87872 88492 CDS product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175743.1 protein_id gnl|my_center|LOCUS_00870 89818 88607 gene locus_tag LOCUS_00880 89818 88607 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941618.1 protein_id gnl|my_center|LOCUS_00880 90357 91532 gene locus_tag LOCUS_00890 90357 91532 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_00890 91495 92235 gene locus_tag LOCUS_00900 91495 92235 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811482.1 protein_id gnl|my_center|LOCUS_00900 92378 93124 gene locus_tag LOCUS_00910 92378 93124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 93118 93816 gene locus_tag LOCUS_00920 93118 93816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 93813 95039 gene locus_tag LOCUS_00930 93813 95039 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_00930 95278 95742 gene locus_tag LOCUS_00940 gene nrfH 95278 95742 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943776.1 protein_id gnl|my_center|LOCUS_00940 95773 97296 gene locus_tag LOCUS_00950 95773 97296 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545985.1 protein_id gnl|my_center|LOCUS_00950 98806 97505 gene locus_tag LOCUS_00960 98806 97505 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_00960 99746 98835 gene locus_tag LOCUS_00970 99746 98835 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008870867.1 protein_id gnl|my_center|LOCUS_00970 100523 99891 gene locus_tag LOCUS_00980 100523 99891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 100663 101850 gene locus_tag LOCUS_00990 100663 101850 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_00990 101891 102835 gene locus_tag LOCUS_01000 101891 102835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 103734 102832 gene locus_tag LOCUS_01010 103734 102832 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206215.1 protein_id gnl|my_center|LOCUS_01010 104204 103911 gene locus_tag LOCUS_01020 104204 103911 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114934.1 protein_id gnl|my_center|LOCUS_01020 104787 105665 gene locus_tag LOCUS_01030 104787 105665 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861239.1 protein_id gnl|my_center|LOCUS_01030 105662 106414 gene locus_tag LOCUS_01040 105662 106414 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879779.1 protein_id gnl|my_center|LOCUS_01040 106590 106883 gene locus_tag LOCUS_01050 106590 106883 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_01050 107082 108251 gene locus_tag LOCUS_01060 gene amrS 107082 108251 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_01060 108350 109444 gene locus_tag LOCUS_01070 gene ychF 108350 109444 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_01070 109451 110194 gene locus_tag LOCUS_01080 109451 110194 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_01080 110187 110714 gene locus_tag LOCUS_01090 110187 110714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 111256 110870 gene locus_tag LOCUS_01100 111256 110870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 112303 111353 gene locus_tag LOCUS_01110 112303 111353 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_01110 113386 112745 gene locus_tag LOCUS_01120 113386 112745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 114307 113798 gene locus_tag LOCUS_01130 114307 113798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 115258 114326 gene locus_tag LOCUS_01140 115258 114326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 116513 115260 gene locus_tag LOCUS_01150 116513 115260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 117316 116519 gene locus_tag LOCUS_01160 117316 116519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 118416 117313 gene locus_tag LOCUS_01170 gene clpX 118416 117313 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390063.1 protein_id gnl|my_center|LOCUS_01170 118891 118496 gene locus_tag LOCUS_01180 118891 118496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 120300 119098 gene locus_tag LOCUS_01190 120300 119098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 120824 120465 gene locus_tag LOCUS_01200 120824 120465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 121083 120817 gene locus_tag LOCUS_01210 121083 120817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 121830 121375 gene locus_tag LOCUS_01220 121830 121375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 124170 122116 gene locus_tag LOCUS_01230 gene tkt 124170 122116 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227715.1 protein_id gnl|my_center|LOCUS_01230 127861 124373 gene locus_tag LOCUS_01240 127861 124373 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930421.1 protein_id gnl|my_center|LOCUS_01240 130491 127858 gene locus_tag LOCUS_01250 130491 127858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 131480 130593 gene locus_tag LOCUS_01260 131480 130593 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546256.1 protein_id gnl|my_center|LOCUS_01260 131974 131477 gene locus_tag LOCUS_01270 131974 131477 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545293.1 protein_id gnl|my_center|LOCUS_01270 132498 132151 gene locus_tag LOCUS_01280 132498 132151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 134818 132668 gene locus_tag LOCUS_01290 134818 132668 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841931.1 protein_id gnl|my_center|LOCUS_01290 135094 134879 gene locus_tag LOCUS_01300 135094 134879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 135705 135091 gene locus_tag LOCUS_01310 135705 135091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 136265 135882 gene locus_tag LOCUS_01320 gene speD 136265 135882 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880113.1 protein_id gnl|my_center|LOCUS_01320 136470 136643 gene locus_tag LOCUS_01330 136470 136643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 136832 136647 gene locus_tag LOCUS_01340 136832 136647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 136831 139506 gene locus_tag LOCUS_01350 gene plsB 136831 139506 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704200.1 protein_id gnl|my_center|LOCUS_01350 139582 140622 gene locus_tag LOCUS_01360 139582 140622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 140912 142036 gene locus_tag LOCUS_01370 140912 142036 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552205.1 protein_id gnl|my_center|LOCUS_01370 142335 143198 gene locus_tag LOCUS_01380 142335 143198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 143324 144043 gene locus_tag LOCUS_01390 143324 144043 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583102.1 protein_id gnl|my_center|LOCUS_01390 144824 144123 gene locus_tag LOCUS_01400 144824 144123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 145143 147158 gene locus_tag LOCUS_01410 gene ligA 145143 147158 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_01410 147155 147439 gene locus_tag LOCUS_01420 147155 147439 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143981.1 protein_id gnl|my_center|LOCUS_01420 147662 148399 gene locus_tag LOCUS_01430 gene hisA 147662 148399 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943717.1 protein_id gnl|my_center|LOCUS_01430 148611 151100 gene locus_tag LOCUS_01440 148611 151100 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_01440 151090 152601 gene locus_tag LOCUS_01450 gene rng 151090 152601 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_01450 152687 153424 gene locus_tag LOCUS_01460 gene lmtA 152687 153424 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_01460 153574 155499 gene locus_tag LOCUS_01470 gene selB 153574 155499 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_01470 156534 155740 gene locus_tag LOCUS_01480 156534 155740 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940643.1 protein_id gnl|my_center|LOCUS_01480 156723 157232 gene locus_tag LOCUS_01490 156723 157232 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_01490 157283 157879 gene locus_tag LOCUS_01500 157283 157879 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_01500 158031 157864 gene locus_tag LOCUS_01510 158031 157864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 158239 158787 gene locus_tag LOCUS_01520 158239 158787 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939394.1 protein_id gnl|my_center|LOCUS_01520 158861 160393 gene locus_tag LOCUS_01530 158861 160393 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939396.1 protein_id gnl|my_center|LOCUS_01530 160468 160809 gene locus_tag LOCUS_01540 160468 160809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 161352 162521 gene locus_tag LOCUS_01550 161352 162521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 162536 163636 gene locus_tag LOCUS_01560 162536 163636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 163640 163894 gene locus_tag LOCUS_01570 163640 163894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 164069 163860 gene locus_tag LOCUS_01580 164069 163860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 164379 166022 gene locus_tag LOCUS_01590 164379 166022 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024233.1 protein_id gnl|my_center|LOCUS_01590 166183 167187 gene locus_tag LOCUS_01600 gene gap 166183 167187 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_01600 168570 167281 gene locus_tag LOCUS_01610 168570 167281 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791443.1 protein_id gnl|my_center|LOCUS_01610 170105 168738 gene locus_tag LOCUS_01620 170105 168738 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726975.1 protein_id gnl|my_center|LOCUS_01620 170847 171539 gene locus_tag LOCUS_01630 170847 171539 CDS product DUF5752 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978371.1 protein_id gnl|my_center|LOCUS_01630 171523 172746 gene locus_tag LOCUS_01640 171523 172746 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869050.1 protein_id gnl|my_center|LOCUS_01640 172754 174073 gene locus_tag LOCUS_01650 172754 174073 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141651.1 protein_id gnl|my_center|LOCUS_01650 174253 174519 gene locus_tag LOCUS_01660 174253 174519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 177521 174603 gene locus_tag LOCUS_01670 177521 174603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 178918 177674 gene locus_tag LOCUS_01680 178918 177674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 179916 179035 gene locus_tag LOCUS_01690 179916 179035 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436920.1 protein_id gnl|my_center|LOCUS_01690 180589 179909 gene locus_tag LOCUS_01700 180589 179909 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392706.1 protein_id gnl|my_center|LOCUS_01700 181065 180586 gene locus_tag LOCUS_01710 181065 180586 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392707.1 transl_except (pos:complement(180868..180870),aa:Sec) note codon on position 66 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_01710 185563 181076 gene locus_tag LOCUS_01720 185563 181076 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392708.1 protein_id gnl|my_center|LOCUS_01720 186465 185629 gene locus_tag LOCUS_01730 186465 185629 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_01730 187055 186474 gene locus_tag LOCUS_01740 187055 186474 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392710.1 protein_id gnl|my_center|LOCUS_01740 187761 187315 gene locus_tag LOCUS_01750 187761 187315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 189982 188138 gene locus_tag LOCUS_01760 gene nuoF 189982 188138 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_01760 192759 189997 gene locus_tag LOCUS_01770 gene fdhF 192759 189997 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_01770 193024 194103 gene locus_tag LOCUS_01780 193024 194103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 195045 194206 gene locus_tag LOCUS_01790 195045 194206 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972415.1 protein_id gnl|my_center|LOCUS_01790 196007 195042 gene locus_tag LOCUS_01800 196007 195042 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140474.1 protein_id gnl|my_center|LOCUS_01800 196607 196125 gene locus_tag LOCUS_01810 196607 196125 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545207.1 protein_id gnl|my_center|LOCUS_01810 196766 197830 gene locus_tag LOCUS_01820 gene corA 196766 197830 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_01820 197854 198969 gene locus_tag LOCUS_01830 197854 198969 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080272.1 protein_id gnl|my_center|LOCUS_01830 199052 201475 gene locus_tag LOCUS_01840 gene gyrA 199052 201475 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_01840 201462 202511 gene locus_tag LOCUS_01850 201462 202511 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_01850 202517 202912 gene locus_tag LOCUS_01860 202517 202912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 203107 205023 gene locus_tag LOCUS_01870 gene metG 203107 205023 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939333.1 protein_id gnl|my_center|LOCUS_01870 205076 205603 gene locus_tag LOCUS_01880 205076 205603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 205729 206913 gene locus_tag LOCUS_01890 205729 206913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 207686 207114 gene locus_tag LOCUS_01900 207686 207114 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392800.1 protein_id gnl|my_center|LOCUS_01900 207990 207808 gene locus_tag LOCUS_01910 207990 207808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 208498 211020 gene locus_tag LOCUS_01920 208498 211020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 211574 211999 gene locus_tag LOCUS_01930 211574 211999 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940308.1 protein_id gnl|my_center|LOCUS_01930 212050 212382 gene locus_tag LOCUS_01940 212050 212382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 212586 213089 gene locus_tag LOCUS_01950 212586 213089 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932996.1 protein_id gnl|my_center|LOCUS_01950 214363 213206 gene locus_tag LOCUS_01960 gene nrfD 214363 213206 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541886.1 protein_id gnl|my_center|LOCUS_01960 215186 214371 gene locus_tag LOCUS_01970 215186 214371 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546852.1 protein_id gnl|my_center|LOCUS_01970 215677 215186 gene locus_tag LOCUS_01980 gene dsrJ 215677 215186 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393111.1 protein_id gnl|my_center|LOCUS_01980 217312 215678 gene locus_tag LOCUS_01990 217312 215678 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_01990 218348 217314 gene locus_tag LOCUS_02000 gene dsrM 218348 217314 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544992.1 protein_id gnl|my_center|LOCUS_02000 218922 218380 gene locus_tag LOCUS_02010 218922 218380 CDS product RsbRD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393113.1 protein_id gnl|my_center|LOCUS_02010 219398 219135 gene locus_tag LOCUS_02020 219398 219135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 219921 219457 gene locus_tag LOCUS_02030 219921 219457 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707183.1 protein_id gnl|my_center|LOCUS_02030 220188 220376 gene locus_tag LOCUS_02040 220188 220376 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940534.1 protein_id gnl|my_center|LOCUS_02040 220953 220447 gene locus_tag LOCUS_02050 220953 220447 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669747.1 protein_id gnl|my_center|LOCUS_02050 221155 221616 gene locus_tag LOCUS_02060 221155 221616 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942702.1 protein_id gnl|my_center|LOCUS_02060 221913 224456 gene locus_tag LOCUS_02070 gene secA 221913 224456 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938126.1 protein_id gnl|my_center|LOCUS_02070 224930 226216 gene locus_tag LOCUS_02080 224930 226216 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448293.1 protein_id gnl|my_center|LOCUS_02080 226295 227623 gene locus_tag LOCUS_02090 226295 227623 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967826.1 protein_id gnl|my_center|LOCUS_02090 227670 228803 gene locus_tag LOCUS_02100 227670 228803 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_02100 228807 229577 gene locus_tag LOCUS_02110 228807 229577 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403122.1 protein_id gnl|my_center|LOCUS_02110 229584 230546 gene locus_tag LOCUS_02120 229584 230546 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403121.1 protein_id gnl|my_center|LOCUS_02120 230550 231164 gene locus_tag LOCUS_02130 230550 231164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 231400 234183 gene locus_tag LOCUS_02140 gene ileS 231400 234183 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_02140 234294 234776 gene locus_tag LOCUS_02150 gene lspA 234294 234776 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704644.1 protein_id gnl|my_center|LOCUS_02150 234757 235554 gene locus_tag LOCUS_02160 gene lgt 234757 235554 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_02160 235650 236456 gene locus_tag LOCUS_02170 235650 236456 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_02170 236764 237927 gene locus_tag LOCUS_02180 236764 237927 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_02180 237936 239003 gene locus_tag LOCUS_02190 gene rseP 237936 239003 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942559.1 protein_id gnl|my_center|LOCUS_02190 239106 239414 gene locus_tag LOCUS_02200 239106 239414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 239920 239468 gene locus_tag LOCUS_02210 gene ruvX 239920 239468 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393142.1 protein_id gnl|my_center|LOCUS_02210 240647 239991 gene locus_tag LOCUS_02220 240647 239991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 241128 240796 gene locus_tag LOCUS_02230 241128 240796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 241584 242564 gene locus_tag LOCUS_02240 gene hemB 241584 242564 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940811.1 protein_id gnl|my_center|LOCUS_02240 242659 243726 gene locus_tag LOCUS_02250 gene ahbD 242659 243726 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938155.1 protein_id gnl|my_center|LOCUS_02250 243723 244193 gene locus_tag LOCUS_02260 gene ahbA 243723 244193 CDS product siroheme decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938154.1 protein_id gnl|my_center|LOCUS_02260 244673 244212 gene locus_tag LOCUS_02270 244673 244212 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546571.1 protein_id gnl|my_center|LOCUS_02270 245283 244729 gene locus_tag LOCUS_02280 245283 244729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 248290 245360 gene locus_tag LOCUS_02290 248290 245360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 >Feature sequence02 1298 297 gene locus_tag LOCUS_02300 1298 297 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258144.1 protein_id gnl|my_center|LOCUS_02300 1669 1472 gene locus_tag LOCUS_02310 1669 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 1857 2765 gene locus_tag LOCUS_02320 1857 2765 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902772.1 protein_id gnl|my_center|LOCUS_02320 2948 3397 gene locus_tag LOCUS_02330 gene dtd 2948 3397 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393181.1 protein_id gnl|my_center|LOCUS_02330 3721 3425 gene locus_tag LOCUS_02340 3721 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 4800 3727 gene locus_tag LOCUS_02350 4800 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 6520 5084 gene locus_tag LOCUS_02360 6520 5084 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257475.1 protein_id gnl|my_center|LOCUS_02360 6862 6527 gene locus_tag LOCUS_02370 6862 6527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 6974 7852 gene locus_tag LOCUS_02380 gene lipA 6974 7852 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_02380 8696 9706 gene locus_tag LOCUS_02390 gene aroF 8696 9706 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393889.1 protein_id gnl|my_center|LOCUS_02390 9697 10806 gene locus_tag LOCUS_02400 gene aroB 9697 10806 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142508.1 protein_id gnl|my_center|LOCUS_02400 11099 12499 gene locus_tag LOCUS_02410 gene rimO 11099 12499 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_02410 12789 15053 gene locus_tag LOCUS_02420 12789 15053 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546286.1 protein_id gnl|my_center|LOCUS_02420 15180 16019 gene locus_tag LOCUS_02430 15180 16019 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393766.1 protein_id gnl|my_center|LOCUS_02430 16032 16589 gene locus_tag LOCUS_02440 16032 16589 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393765.1 protein_id gnl|my_center|LOCUS_02440 16796 18169 gene locus_tag LOCUS_02450 16796 18169 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938056.1 protein_id gnl|my_center|LOCUS_02450 18482 19123 gene locus_tag LOCUS_02460 18482 19123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 19231 20139 gene locus_tag LOCUS_02470 19231 20139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 20789 20864 gene locus_tag LOCUS_t00020 20789 20864 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 22281 21139 gene locus_tag LOCUS_02480 22281 21139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 22728 27935 gene locus_tag LOCUS_02490 22728 27935 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883981.1 protein_id gnl|my_center|LOCUS_02490 27923 30754 gene locus_tag LOCUS_02500 27923 30754 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_02500 30786 34838 gene locus_tag LOCUS_02510 30786 34838 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 protein_id gnl|my_center|LOCUS_02510 35358 35558 gene locus_tag LOCUS_02520 35358 35558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 35786 35699 gene locus_tag LOCUS_t00030 35786 35699 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 38441 36132 gene locus_tag LOCUS_02530 38441 36132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 38763 38494 gene locus_tag LOCUS_02540 38763 38494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 39723 41909 gene locus_tag LOCUS_02550 gene rnr 39723 41909 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942131.1 protein_id gnl|my_center|LOCUS_02550 43043 42288 gene locus_tag LOCUS_02560 gene pyrF 43043 42288 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039203.1 protein_id gnl|my_center|LOCUS_02560 44309 43077 gene locus_tag LOCUS_02570 44309 43077 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583054.1 protein_id gnl|my_center|LOCUS_02570 46220 44496 gene locus_tag LOCUS_02580 46220 44496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 47342 46326 gene locus_tag LOCUS_02590 47342 46326 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107441.1 protein_id gnl|my_center|LOCUS_02590 48434 47424 gene locus_tag LOCUS_02600 48434 47424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 49893 48655 gene locus_tag LOCUS_02610 49893 48655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 51486 50023 gene locus_tag LOCUS_02620 gene rfaE1 51486 50023 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942727.1 protein_id gnl|my_center|LOCUS_02620 53819 51594 gene locus_tag LOCUS_02630 gene lptD 53819 51594 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792614.1 protein_id gnl|my_center|LOCUS_02630 53843 54055 gene locus_tag LOCUS_02640 53843 54055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 54747 54052 gene locus_tag LOCUS_02650 54747 54052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 57686 55053 gene locus_tag LOCUS_02660 57686 55053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 59251 57683 gene locus_tag LOCUS_02670 59251 57683 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870869.1 protein_id gnl|my_center|LOCUS_02670 60768 59350 gene locus_tag LOCUS_02680 60768 59350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 61467 60781 gene locus_tag LOCUS_02690 61467 60781 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392706.1 protein_id gnl|my_center|LOCUS_02690 61894 61478 gene locus_tag LOCUS_02700 61894 61478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 63378 62050 gene locus_tag LOCUS_02710 gene glnA 63378 62050 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545065.1 protein_id gnl|my_center|LOCUS_02710 63965 63561 gene locus_tag LOCUS_02720 63965 63561 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389838.1 protein_id gnl|my_center|LOCUS_02720 65205 63979 gene locus_tag LOCUS_02730 65205 63979 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_02730 67130 66300 gene locus_tag LOCUS_02740 gene folE2 67130 66300 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_02740 68624 67335 gene locus_tag LOCUS_02750 gene hisD 68624 67335 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060775.1 protein_id gnl|my_center|LOCUS_02750 69387 68809 gene locus_tag LOCUS_02760 69387 68809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 70175 69429 gene locus_tag LOCUS_02770 70175 69429 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_02770 71028 70363 gene locus_tag LOCUS_02780 71028 70363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 72880 70997 gene locus_tag LOCUS_02790 72880 70997 CDS product KinB sensor domain-containing domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114120.1 protein_id gnl|my_center|LOCUS_02790 73618 72953 gene locus_tag LOCUS_02800 73618 72953 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485336.1 protein_id gnl|my_center|LOCUS_02800 75018 73615 gene locus_tag LOCUS_02810 75018 73615 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062283476.1 protein_id gnl|my_center|LOCUS_02810 76916 75075 gene locus_tag LOCUS_02820 76916 75075 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942985.1 protein_id gnl|my_center|LOCUS_02820 77540 77289 gene locus_tag LOCUS_02830 77540 77289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 79543 77687 gene locus_tag LOCUS_02840 79543 77687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 80092 81087 gene locus_tag LOCUS_02850 80092 81087 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026837.1 protein_id gnl|my_center|LOCUS_02850 82120 81305 gene locus_tag LOCUS_02860 82120 81305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 83612 82272 gene locus_tag LOCUS_02870 83612 82272 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546477.1 protein_id gnl|my_center|LOCUS_02870 83757 83894 gene locus_tag LOCUS_02880 83757 83894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 84216 85352 gene locus_tag LOCUS_02890 gene msrB 84216 85352 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261262.1 protein_id gnl|my_center|LOCUS_02890 85616 86008 gene locus_tag LOCUS_02900 gene ndhC 85616 86008 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140750.1 protein_id gnl|my_center|LOCUS_02900 85981 86469 gene locus_tag LOCUS_02910 85981 86469 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392493.1 protein_id gnl|my_center|LOCUS_02910 86471 86911 gene locus_tag LOCUS_02920 86471 86911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 86916 88028 gene locus_tag LOCUS_02930 gene nuoD 86916 88028 CDS product NADH-quinone oxidoreductase subunit NuoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621434.1 protein_id gnl|my_center|LOCUS_02930 88107 89072 gene locus_tag LOCUS_02940 gene nuoH 88107 89072 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_02940 89128 89658 gene locus_tag LOCUS_02950 89128 89658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 89655 90176 gene locus_tag LOCUS_02960 89655 90176 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392498.1 protein_id gnl|my_center|LOCUS_02960 90201 90512 gene locus_tag LOCUS_02970 gene nuoK 90201 90512 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_02970 90515 92443 gene locus_tag LOCUS_02980 gene nuoL 90515 92443 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_02980 92497 93969 gene locus_tag LOCUS_02990 92497 93969 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392501.1 protein_id gnl|my_center|LOCUS_02990 93973 95397 gene locus_tag LOCUS_03000 93973 95397 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392502.1 protein_id gnl|my_center|LOCUS_03000 95570 98731 gene locus_tag LOCUS_03010 95570 98731 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791698.1 protein_id gnl|my_center|LOCUS_03010 99610 98798 gene locus_tag LOCUS_03020 gene uppP 99610 98798 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392108.1 protein_id gnl|my_center|LOCUS_03020 101120 99654 gene locus_tag LOCUS_03030 gene gatA 101120 99654 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_03030 101422 101138 gene locus_tag LOCUS_03040 gene gatC 101422 101138 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_03040 101986 101753 gene locus_tag LOCUS_03050 gene csrA 101986 101753 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213314.1 protein_id gnl|my_center|LOCUS_03050 102270 102551 gene locus_tag LOCUS_03060 102270 102551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 103512 102526 gene locus_tag LOCUS_03070 103512 102526 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942346.1 protein_id gnl|my_center|LOCUS_03070 104197 103532 gene locus_tag LOCUS_03080 104197 103532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 104342 105199 gene locus_tag LOCUS_03090 104342 105199 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877350.1 protein_id gnl|my_center|LOCUS_03090 105301 106014 gene locus_tag LOCUS_03100 105301 106014 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938322.1 protein_id gnl|my_center|LOCUS_03100 106149 106937 gene locus_tag LOCUS_03110 106149 106937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 107199 107822 gene locus_tag LOCUS_03120 gene rdgC 107199 107822 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939729.1 protein_id gnl|my_center|LOCUS_03120 107953 108483 gene locus_tag LOCUS_03130 107953 108483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791831.1 protein_id gnl|my_center|LOCUS_03130 108574 109440 gene locus_tag LOCUS_03140 gene mutM 108574 109440 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462495.1 protein_id gnl|my_center|LOCUS_03140 109445 109927 gene locus_tag LOCUS_03150 109445 109927 CDS product DUF3124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139455833.1 protein_id gnl|my_center|LOCUS_03150 109954 110988 gene locus_tag LOCUS_03160 109954 110988 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_03160 111868 111257 gene locus_tag LOCUS_03170 111868 111257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 113297 111966 gene locus_tag LOCUS_03180 gene apgM2 113297 111966 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase ApgM2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869503.1 protein_id gnl|my_center|LOCUS_03180 113899 113309 gene locus_tag LOCUS_03190 113899 113309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 113819 114034 gene locus_tag LOCUS_03200 113819 114034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 115152 114202 gene locus_tag LOCUS_03210 115152 114202 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938071.1 protein_id gnl|my_center|LOCUS_03210 115893 115309 gene locus_tag LOCUS_03220 115893 115309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 116436 116263 gene locus_tag LOCUS_03230 116436 116263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 117042 117878 gene locus_tag LOCUS_03240 117042 117878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 117956 119089 gene locus_tag LOCUS_03250 117956 119089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 121709 119163 gene locus_tag LOCUS_03260 121709 119163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 121931 123271 gene locus_tag LOCUS_03270 gene mgtE 121931 123271 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125941.1 protein_id gnl|my_center|LOCUS_03270 124253 123231 gene locus_tag LOCUS_03280 124253 123231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274381.1 protein_id gnl|my_center|LOCUS_03280 125086 124211 gene locus_tag LOCUS_03290 125086 124211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 125833 125141 gene locus_tag LOCUS_03300 gene bioH 125833 125141 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704304.1 protein_id gnl|my_center|LOCUS_03300 127088 125856 gene locus_tag LOCUS_03310 gene bioF 127088 125856 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_03310 127953 127204 gene locus_tag LOCUS_03320 gene bioD 127953 127204 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942228.1 protein_id gnl|my_center|LOCUS_03320 128888 127950 gene locus_tag LOCUS_03330 gene bioB 128888 127950 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_03330 129247 129816 gene locus_tag LOCUS_03340 129247 129816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 129991 130605 gene locus_tag LOCUS_03350 129991 130605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 130796 131815 gene locus_tag LOCUS_03360 130796 131815 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974772.1 protein_id gnl|my_center|LOCUS_03360 131922 132416 gene locus_tag LOCUS_03370 131922 132416 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524404.1 protein_id gnl|my_center|LOCUS_03370 132419 132781 gene locus_tag LOCUS_03380 132419 132781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 133246 132983 gene locus_tag LOCUS_03390 133246 132983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 134773 133373 gene locus_tag LOCUS_03400 134773 133373 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937837.1 protein_id gnl|my_center|LOCUS_03400 135537 134860 gene locus_tag LOCUS_03410 135537 134860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937838.1 protein_id gnl|my_center|LOCUS_03410 135719 135576 gene locus_tag LOCUS_03420 135719 135576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 136958 135732 gene locus_tag LOCUS_03430 gene nrfD 136958 135732 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937840.1 protein_id gnl|my_center|LOCUS_03430 138042 136960 gene locus_tag LOCUS_03440 138042 136960 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937841.1 protein_id gnl|my_center|LOCUS_03440 139684 138047 gene locus_tag LOCUS_03450 139684 138047 CDS product high-molecular-weight cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524248.1 protein_id gnl|my_center|LOCUS_03450 141000 140467 gene locus_tag LOCUS_03460 gene cobO 141000 140467 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948638.1 protein_id gnl|my_center|LOCUS_03460 141284 141832 gene locus_tag LOCUS_03470 gene cobU 141284 141832 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206639.1 protein_id gnl|my_center|LOCUS_03470 142010 143122 gene locus_tag LOCUS_03480 gene cobT 142010 143122 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943639.1 protein_id gnl|my_center|LOCUS_03480 143165 143905 gene locus_tag LOCUS_03490 gene cobS 143165 143905 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943638.1 protein_id gnl|my_center|LOCUS_03490 144152 144853 gene locus_tag LOCUS_03500 144152 144853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 145110 146489 gene locus_tag LOCUS_03510 gene miaB 145110 146489 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942838.1 protein_id gnl|my_center|LOCUS_03510 146483 146980 gene locus_tag LOCUS_03520 146483 146980 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583213.1 protein_id gnl|my_center|LOCUS_03520 147053 147724 gene locus_tag LOCUS_03530 147053 147724 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545579.1 protein_id gnl|my_center|LOCUS_03530 147870 148256 gene locus_tag LOCUS_03540 147870 148256 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583691.1 protein_id gnl|my_center|LOCUS_03540 148368 149153 gene locus_tag LOCUS_03550 148368 149153 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095636.1 protein_id gnl|my_center|LOCUS_03550 149285 150160 gene locus_tag LOCUS_03560 149285 150160 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463551.1 protein_id gnl|my_center|LOCUS_03560 150679 150897 gene locus_tag LOCUS_03570 150679 150897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 150894 151775 gene locus_tag LOCUS_03580 150894 151775 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_03580 151768 152772 gene locus_tag LOCUS_03590 151768 152772 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939380.1 protein_id gnl|my_center|LOCUS_03590 152772 153173 gene locus_tag LOCUS_03600 152772 153173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 154391 153348 gene locus_tag LOCUS_03610 154391 153348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 155383 154433 gene locus_tag LOCUS_03620 155383 154433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 156302 155454 gene locus_tag LOCUS_03630 156302 155454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 156834 157370 gene locus_tag LOCUS_03640 156834 157370 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876490.1 protein_id gnl|my_center|LOCUS_03640 157424 158680 gene locus_tag LOCUS_03650 157424 158680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 159156 159368 gene locus_tag LOCUS_03660 159156 159368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 159548 159739 gene locus_tag LOCUS_03670 159548 159739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 161188 159917 gene locus_tag LOCUS_03680 gene thiC 161188 159917 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392914.1 protein_id gnl|my_center|LOCUS_03680 161673 162065 gene locus_tag LOCUS_03690 161673 162065 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842486.1 protein_id gnl|my_center|LOCUS_03690 162126 162698 gene locus_tag LOCUS_03700 gene pyrE 162126 162698 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057665.1 protein_id gnl|my_center|LOCUS_03700 162691 163959 gene locus_tag LOCUS_03710 162691 163959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 164109 164657 gene locus_tag LOCUS_03720 164109 164657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 164979 164830 gene locus_tag LOCUS_03730 164979 164830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 165010 165504 gene locus_tag LOCUS_03740 165010 165504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 165592 165903 gene locus_tag LOCUS_03750 165592 165903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 166144 167049 gene locus_tag LOCUS_03760 gene xerC 166144 167049 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_03760 167240 167794 gene locus_tag LOCUS_03770 gene hslV 167240 167794 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769770.1 protein_id gnl|my_center|LOCUS_03770 167862 169250 gene locus_tag LOCUS_03780 gene hslU 167862 169250 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_03780 169301 169558 gene locus_tag LOCUS_03790 169301 169558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 169779 170660 gene locus_tag LOCUS_03800 gene argB 169779 170660 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940826.1 protein_id gnl|my_center|LOCUS_03800 170986 172158 gene locus_tag LOCUS_03810 170986 172158 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_03810 172200 173108 gene locus_tag LOCUS_03820 gene argF 172200 173108 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940828.1 protein_id gnl|my_center|LOCUS_03820 173458 174666 gene locus_tag LOCUS_03830 173458 174666 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227831.1 protein_id gnl|my_center|LOCUS_03830 174719 176113 gene locus_tag LOCUS_03840 gene argH 174719 176113 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940832.1 protein_id gnl|my_center|LOCUS_03840 176232 177284 gene locus_tag LOCUS_03850 176232 177284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 177320 178591 gene locus_tag LOCUS_03860 gene lysA 177320 178591 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940834.1 protein_id gnl|my_center|LOCUS_03860 178891 179715 gene locus_tag LOCUS_03870 gene dapF 178891 179715 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_03870 179728 180600 gene locus_tag LOCUS_03880 gene dapA 179728 180600 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939154.1 protein_id gnl|my_center|LOCUS_03880 180651 181454 gene locus_tag LOCUS_03890 gene dapB 180651 181454 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_03890 181815 182618 gene locus_tag LOCUS_03900 181815 182618 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393001.1 protein_id gnl|my_center|LOCUS_03900 182572 183162 gene locus_tag LOCUS_03910 182572 183162 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226951.1 protein_id gnl|my_center|LOCUS_03910 183189 184355 gene locus_tag LOCUS_03920 183189 184355 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065191.1 protein_id gnl|my_center|LOCUS_03920 184429 184908 gene locus_tag LOCUS_03930 184429 184908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 185279 185803 gene locus_tag LOCUS_03940 gene folK 185279 185803 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396552.1 protein_id gnl|my_center|LOCUS_03940 185811 186065 gene locus_tag LOCUS_03950 185811 186065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 186102 186761 gene locus_tag LOCUS_03960 gene fsa 186102 186761 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943606.1 protein_id gnl|my_center|LOCUS_03960 186763 187332 gene locus_tag LOCUS_03970 gene pgsA 186763 187332 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939132.1 protein_id gnl|my_center|LOCUS_03970 187808 188047 gene locus_tag LOCUS_03980 187808 188047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 188050 190308 gene locus_tag LOCUS_03990 188050 190308 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836945.1 protein_id gnl|my_center|LOCUS_03990 190341 190916 gene locus_tag LOCUS_04000 190341 190916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 190948 191721 gene locus_tag LOCUS_04010 190948 191721 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941299.1 protein_id gnl|my_center|LOCUS_04010 191806 192276 gene locus_tag LOCUS_04020 191806 192276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 192337 193863 gene locus_tag LOCUS_04030 192337 193863 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_04030 193982 194968 gene locus_tag LOCUS_04040 193982 194968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 195188 194940 gene locus_tag LOCUS_04050 195188 194940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 196309 195530 gene locus_tag LOCUS_04060 196309 195530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 196668 196306 gene locus_tag LOCUS_04070 196668 196306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 197384 196782 gene locus_tag LOCUS_04080 197384 196782 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546460.1 protein_id gnl|my_center|LOCUS_04080 197727 198011 gene locus_tag LOCUS_04090 197727 198011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 198989 198096 gene locus_tag LOCUS_04100 198989 198096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546145.1 protein_id gnl|my_center|LOCUS_04100 200741 199308 gene locus_tag LOCUS_04110 200741 199308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 201274 200750 gene locus_tag LOCUS_04120 201274 200750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 201458 201931 gene locus_tag LOCUS_04130 201458 201931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 202505 201903 gene locus_tag LOCUS_04140 202505 201903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 203680 202520 gene locus_tag LOCUS_04150 203680 202520 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258602.1 protein_id gnl|my_center|LOCUS_04150 204889 203684 gene locus_tag LOCUS_04160 gene ilvA 204889 203684 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_04160 205402 204965 gene locus_tag LOCUS_04170 205402 204965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 205956 206132 gene locus_tag LOCUS_04180 205956 206132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 208222 206813 gene locus_tag LOCUS_04190 208222 206813 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870705.1 protein_id gnl|my_center|LOCUS_04190 209176 208232 gene locus_tag LOCUS_04200 gene mvhG 209176 208232 CDS product F420-non-reducing hydrogenase subunit MvhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876759.1 protein_id gnl|my_center|LOCUS_04200 210319 209189 gene locus_tag LOCUS_04210 210319 209189 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024396.1 protein_id gnl|my_center|LOCUS_04210 210491 210333 gene locus_tag LOCUS_04220 210491 210333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04220 210764 210561 gene locus_tag LOCUS_04230 210764 210561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04230 214348 210986 gene locus_tag LOCUS_04240 214348 210986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:complement(213866..213868),aa:Sec) note codon on position 161 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_04240 214884 214345 gene locus_tag LOCUS_04250 gene frhD 214884 214345 CDS product coenzyme F420-reducing hydrogenase, FrhD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869751.1 protein_id gnl|my_center|LOCUS_04250 215677 215054 gene locus_tag LOCUS_04260 215677 215054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 216684 215746 gene locus_tag LOCUS_04270 216684 215746 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947761.1 protein_id gnl|my_center|LOCUS_04270 217699 216866 gene locus_tag LOCUS_04280 217699 216866 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454839.1 protein_id gnl|my_center|LOCUS_04280 219021 217870 gene locus_tag LOCUS_04290 219021 217870 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294607.1 protein_id gnl|my_center|LOCUS_04290 219631 219068 gene locus_tag LOCUS_04300 219631 219068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 220883 219768 gene locus_tag LOCUS_04310 gene cfa 220883 219768 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258479.1 protein_id gnl|my_center|LOCUS_04310 221715 220951 gene locus_tag LOCUS_04320 gene hisF 221715 220951 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878322.1 protein_id gnl|my_center|LOCUS_04320 222610 221921 gene locus_tag LOCUS_04330 222610 221921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 222945 222610 gene locus_tag LOCUS_04340 222945 222610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 223897 222926 gene locus_tag LOCUS_04350 223897 222926 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155366946.1 protein_id gnl|my_center|LOCUS_04350 225455 223890 gene locus_tag LOCUS_04360 225455 223890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 226259 225543 gene locus_tag LOCUS_04370 226259 225543 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940040.1 protein_id gnl|my_center|LOCUS_04370 226538 227488 gene locus_tag LOCUS_04380 226538 227488 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881382.1 protein_id gnl|my_center|LOCUS_04380 227610 229067 gene locus_tag LOCUS_04390 227610 229067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 229664 229200 gene locus_tag LOCUS_04400 229664 229200 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932613.1 protein_id gnl|my_center|LOCUS_04400 230405 229665 gene locus_tag LOCUS_04410 230405 229665 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929254.1 protein_id gnl|my_center|LOCUS_04410 231554 230541 gene locus_tag LOCUS_04420 gene pheS 231554 230541 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_04420 232035 231682 gene locus_tag LOCUS_04430 gene rplT 232035 231682 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939805.1 protein_id gnl|my_center|LOCUS_04430 232245 232048 gene locus_tag LOCUS_04440 gene rpmI 232245 232048 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_04440 232966 232487 gene locus_tag LOCUS_04450 gene infC 232966 232487 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942163.1 protein_id gnl|my_center|LOCUS_04450 234886 233027 gene locus_tag LOCUS_04460 gene thrS 234886 233027 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360261.1 protein_id gnl|my_center|LOCUS_04460 235312 236151 gene locus_tag LOCUS_04470 235312 236151 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391812.1 protein_id gnl|my_center|LOCUS_04470 236952 236266 gene locus_tag LOCUS_04480 236952 236266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 237537 237130 gene locus_tag LOCUS_04490 237537 237130 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_04490 238973 237561 gene locus_tag LOCUS_04500 gene atpD 238973 237561 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_04500 239869 239000 gene locus_tag LOCUS_04510 239869 239000 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938077.1 protein_id gnl|my_center|LOCUS_04510 241428 239908 gene locus_tag LOCUS_04520 gene atpA 241428 239908 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938078.1 protein_id gnl|my_center|LOCUS_04520 241980 241429 gene locus_tag LOCUS_04530 gene atpH 241980 241429 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940786.1 protein_id gnl|my_center|LOCUS_04530 242582 241977 gene locus_tag LOCUS_04540 gene atpF 242582 241977 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545851.1 protein_id gnl|my_center|LOCUS_04540 243007 242579 gene locus_tag LOCUS_04550 243007 242579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 244484 243366 gene locus_tag LOCUS_04560 gene rodA 244484 243366 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_04560 245196 244582 gene locus_tag LOCUS_04570 gene recR 245196 244582 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143488.1 protein_id gnl|my_center|LOCUS_04570 245538 245227 gene locus_tag LOCUS_04580 245538 245227 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391577.1 protein_id gnl|my_center|LOCUS_04580 247197 245539 gene locus_tag LOCUS_04590 gene dnaX 247197 245539 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_04590 >Feature sequence03 166 1587 gene locus_tag LOCUS_04600 166 1587 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943437.1 protein_id gnl|my_center|LOCUS_04600 1891 2394 gene locus_tag LOCUS_04610 gene def 1891 2394 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_04610 2391 3332 gene locus_tag LOCUS_04620 gene fmt 2391 3332 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392417.1 protein_id gnl|my_center|LOCUS_04620 3335 4156 gene locus_tag LOCUS_04630 3335 4156 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940807.1 protein_id gnl|my_center|LOCUS_04630 4153 5553 gene locus_tag LOCUS_04640 gene rsmB 4153 5553 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_04640 5752 7851 gene locus_tag LOCUS_04650 5752 7851 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_04650 8201 8938 gene locus_tag LOCUS_04660 gene cobB 8201 8938 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_04660 9285 9127 gene locus_tag LOCUS_04670 9285 9127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 12242 9501 gene locus_tag LOCUS_04680 12242 9501 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257097.1 protein_id gnl|my_center|LOCUS_04680 12973 12239 gene locus_tag LOCUS_04690 12973 12239 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_04690 13270 13076 gene locus_tag LOCUS_04700 13270 13076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 13294 14559 gene locus_tag LOCUS_04710 gene zraR 13294 14559 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148503.1 protein_id gnl|my_center|LOCUS_04710 14646 16904 gene locus_tag LOCUS_04720 14646 16904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 17637 17077 gene locus_tag LOCUS_04730 17637 17077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 18357 17782 gene locus_tag LOCUS_04740 18357 17782 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_04740 19377 18424 gene locus_tag LOCUS_04750 gene miaA 19377 18424 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_04750 19685 20518 gene locus_tag LOCUS_04760 19685 20518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 21532 20807 gene locus_tag LOCUS_04770 21532 20807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 22139 21606 gene locus_tag LOCUS_04780 22139 21606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 22739 22167 gene locus_tag LOCUS_04790 22739 22167 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022274.1 protein_id gnl|my_center|LOCUS_04790 23181 22789 gene locus_tag LOCUS_04800 23181 22789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 23923 23189 gene locus_tag LOCUS_04810 23923 23189 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881424.1 protein_id gnl|my_center|LOCUS_04810 24477 23962 gene locus_tag LOCUS_04820 24477 23962 CDS product BCAM0308 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943963.1 protein_id gnl|my_center|LOCUS_04820 24818 25426 gene locus_tag LOCUS_04830 24818 25426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 25691 26980 gene locus_tag LOCUS_04840 25691 26980 CDS product bifunctional hexulose-6-phosphate synthase/ribonuclease regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878362.1 protein_id gnl|my_center|LOCUS_04840 27014 27676 gene locus_tag LOCUS_04850 27014 27676 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942171.1 protein_id gnl|my_center|LOCUS_04850 29758 27860 gene locus_tag LOCUS_04860 gene mrdA 29758 27860 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_04860 30281 29769 gene locus_tag LOCUS_04870 30281 29769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 31144 30293 gene locus_tag LOCUS_04880 gene mreC 31144 30293 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_04880 32171 31137 gene locus_tag LOCUS_04890 32171 31137 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_04890 33057 32845 gene locus_tag LOCUS_04900 33057 32845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 33109 33321 gene locus_tag LOCUS_04910 33109 33321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 33314 33523 gene locus_tag LOCUS_04920 gene yidD 33314 33523 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229076.1 protein_id gnl|my_center|LOCUS_04920 33661 35358 gene locus_tag LOCUS_04930 gene yidC 33661 35358 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_04930 35376 36110 gene locus_tag LOCUS_04940 35376 36110 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462331.1 protein_id gnl|my_center|LOCUS_04940 36107 37477 gene locus_tag LOCUS_04950 gene mnmE 36107 37477 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393996.1 protein_id gnl|my_center|LOCUS_04950 37563 37805 gene locus_tag LOCUS_04960 37563 37805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 38471 37884 gene locus_tag LOCUS_04970 38471 37884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 38679 39029 gene locus_tag LOCUS_04980 38679 39029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 39037 39507 gene locus_tag LOCUS_04990 39037 39507 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393684.1 protein_id gnl|my_center|LOCUS_04990 39579 40874 gene locus_tag LOCUS_05000 gene hemL 39579 40874 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_05000 41612 42904 gene locus_tag LOCUS_05010 41612 42904 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459119.1 protein_id gnl|my_center|LOCUS_05010 43056 43706 gene locus_tag LOCUS_05020 43056 43706 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_05020 45001 43703 gene locus_tag LOCUS_05030 45001 43703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 46506 45391 gene locus_tag LOCUS_05040 gene hemW 46506 45391 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203488.1 protein_id gnl|my_center|LOCUS_05040 48309 46510 gene locus_tag LOCUS_05050 gene lepA 48309 46510 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957093.1 protein_id gnl|my_center|LOCUS_05050 49830 50672 gene locus_tag LOCUS_05060 49830 50672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 50951 52369 gene locus_tag LOCUS_05070 50951 52369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 52369 53103 gene locus_tag LOCUS_05080 52369 53103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 53157 54107 gene locus_tag LOCUS_05090 53157 54107 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657813.1 protein_id gnl|my_center|LOCUS_05090 56139 54226 gene locus_tag LOCUS_05100 gene uvrC 56139 54226 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_05100 56499 57377 gene locus_tag LOCUS_05110 56499 57377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 57537 57992 gene locus_tag LOCUS_05120 57537 57992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 57973 58671 gene locus_tag LOCUS_05130 57973 58671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 58896 58618 gene locus_tag LOCUS_05140 58896 58618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 59287 58934 gene locus_tag LOCUS_05150 59287 58934 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546385.1 protein_id gnl|my_center|LOCUS_05150 61682 59304 gene locus_tag LOCUS_05160 61682 59304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 63159 61672 gene locus_tag LOCUS_05170 gene glgA 63159 61672 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546609.1 protein_id gnl|my_center|LOCUS_05170 64209 63193 gene locus_tag LOCUS_05180 gene galT 64209 63193 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546259.1 protein_id gnl|my_center|LOCUS_05180 64621 64409 gene locus_tag LOCUS_05190 64621 64409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 64870 65856 gene locus_tag LOCUS_05200 64870 65856 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_05200 66683 66027 gene locus_tag LOCUS_05210 66683 66027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 67179 66688 gene locus_tag LOCUS_05220 67179 66688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 67760 68278 gene locus_tag LOCUS_05230 67760 68278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 69472 68315 gene locus_tag LOCUS_05240 69472 68315 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108945.1 protein_id gnl|my_center|LOCUS_05240 70194 70039 gene locus_tag LOCUS_05250 70194 70039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 70503 72797 gene locus_tag LOCUS_05260 70503 72797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05260 72784 74133 gene locus_tag LOCUS_05270 72784 74133 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_05270 74186 74824 gene locus_tag LOCUS_05280 74186 74824 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584147.1 protein_id gnl|my_center|LOCUS_05280 75650 74748 gene locus_tag LOCUS_05290 75650 74748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 76367 75726 gene locus_tag LOCUS_05300 76367 75726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 76665 77495 gene locus_tag LOCUS_05310 76665 77495 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 protein_id gnl|my_center|LOCUS_05310 77550 78455 gene locus_tag LOCUS_05320 77550 78455 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941707.1 protein_id gnl|my_center|LOCUS_05320 78714 78481 gene locus_tag LOCUS_05330 78714 78481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 79057 79566 gene locus_tag LOCUS_05340 79057 79566 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203496.1 protein_id gnl|my_center|LOCUS_05340 80485 79571 gene locus_tag LOCUS_05350 gene nadA 80485 79571 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940699.1 protein_id gnl|my_center|LOCUS_05350 81231 80557 gene locus_tag LOCUS_05360 81231 80557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 81639 82136 gene locus_tag LOCUS_05370 81639 82136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 82449 84545 gene locus_tag LOCUS_05380 82449 84545 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257267.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05380 84542 85930 gene locus_tag LOCUS_05390 84542 85930 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_05390 85971 87317 gene locus_tag LOCUS_05400 gene bioA 85971 87317 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880055.1 protein_id gnl|my_center|LOCUS_05400 88101 87343 gene locus_tag LOCUS_05410 gene kdsB 88101 87343 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072444.1 protein_id gnl|my_center|LOCUS_05410 88220 90811 gene locus_tag LOCUS_05420 gene clpB 88220 90811 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_05420 91232 92104 gene locus_tag LOCUS_05430 91232 92104 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546697.1 protein_id gnl|my_center|LOCUS_05430 92122 93054 gene locus_tag LOCUS_05440 92122 93054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 93350 93706 gene locus_tag LOCUS_05450 93350 93706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 93829 93978 gene locus_tag LOCUS_05460 93829 93978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 94069 94145 gene locus_tag LOCUS_t00040 94069 94145 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 94323 95042 gene locus_tag LOCUS_05470 gene pgeF 94323 95042 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_05470 95427 95290 gene locus_tag LOCUS_05480 95427 95290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 96120 95476 gene locus_tag LOCUS_05490 96120 95476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 96577 96164 gene locus_tag LOCUS_05500 96577 96164 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933604.1 protein_id gnl|my_center|LOCUS_05500 96843 97715 gene locus_tag LOCUS_05510 96843 97715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 98099 97887 gene locus_tag LOCUS_05520 98099 97887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 98311 100272 gene locus_tag LOCUS_05530 98311 100272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 100288 101142 gene locus_tag LOCUS_05540 100288 101142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 101176 102288 gene locus_tag LOCUS_05550 101176 102288 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023106.1 protein_id gnl|my_center|LOCUS_05550 102361 102825 gene locus_tag LOCUS_05560 102361 102825 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_05560 102818 103147 gene locus_tag LOCUS_05570 102818 103147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 103436 103666 gene locus_tag LOCUS_05580 103436 103666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 104555 106126 gene locus_tag LOCUS_05590 gene rny 104555 106126 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_05590 106216 107031 gene locus_tag LOCUS_05600 106216 107031 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_05600 107124 107882 gene locus_tag LOCUS_05610 107124 107882 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944071.1 protein_id gnl|my_center|LOCUS_05610 107916 108104 gene locus_tag LOCUS_05620 107916 108104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 108219 109376 gene locus_tag LOCUS_05630 gene sucC 108219 109376 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244732.1 protein_id gnl|my_center|LOCUS_05630 109623 110495 gene locus_tag LOCUS_05640 gene sucD 109623 110495 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007647520.1 protein_id gnl|my_center|LOCUS_05640 110522 111070 gene locus_tag LOCUS_05650 110522 111070 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_05650 111332 112873 gene locus_tag LOCUS_05660 gene cobA 111332 112873 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_05660 112884 114857 gene locus_tag LOCUS_05670 112884 114857 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403289.1 protein_id gnl|my_center|LOCUS_05670 115001 115936 gene locus_tag LOCUS_05680 115001 115936 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_05680 116089 116730 gene locus_tag LOCUS_05690 116089 116730 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_05690 116882 119542 gene locus_tag LOCUS_05700 gene secDF 116882 119542 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531306.1 protein_id gnl|my_center|LOCUS_05700 119707 120534 gene locus_tag LOCUS_05710 119707 120534 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938913.1 protein_id gnl|my_center|LOCUS_05710 120708 121118 gene locus_tag LOCUS_05720 120708 121118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 121115 123286 gene locus_tag LOCUS_05730 121115 123286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 123535 124479 gene locus_tag LOCUS_05740 123535 124479 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_05740 124586 124828 gene locus_tag LOCUS_05750 124586 124828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 126074 125001 gene locus_tag LOCUS_05760 gene rfbB 126074 125001 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056311.1 protein_id gnl|my_center|LOCUS_05760 126727 126278 gene locus_tag LOCUS_05770 126727 126278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 127410 127150 gene locus_tag LOCUS_05780 127410 127150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 129030 127429 gene locus_tag LOCUS_05790 gene pckA 129030 127429 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227826.1 protein_id gnl|my_center|LOCUS_05790 129391 130824 gene locus_tag LOCUS_05800 gene pyk 129391 130824 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066546.1 protein_id gnl|my_center|LOCUS_05800 131188 130982 gene locus_tag LOCUS_05810 131188 130982 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941573.1 protein_id gnl|my_center|LOCUS_05810 131682 131434 gene locus_tag LOCUS_05820 131682 131434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 131987 131685 gene locus_tag LOCUS_05830 131987 131685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 133267 131993 gene locus_tag LOCUS_05840 133267 131993 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056626.1 protein_id gnl|my_center|LOCUS_05840 133423 133499 gene locus_tag LOCUS_t00050 133423 133499 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 133792 133616 gene locus_tag LOCUS_05850 133792 133616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 135200 133779 gene locus_tag LOCUS_05860 135200 133779 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546645.1 protein_id gnl|my_center|LOCUS_05860 135316 135855 gene locus_tag LOCUS_05870 135316 135855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 135935 137131 gene locus_tag LOCUS_05880 135935 137131 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941766.1 protein_id gnl|my_center|LOCUS_05880 137324 137488 gene locus_tag LOCUS_05890 137324 137488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 138747 137638 gene locus_tag LOCUS_05900 138747 137638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 139196 138744 gene locus_tag LOCUS_05910 139196 138744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 140222 139305 gene locus_tag LOCUS_05920 gene era 140222 139305 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546764.1 protein_id gnl|my_center|LOCUS_05920 142321 140804 gene locus_tag LOCUS_05930 gene lnt 142321 140804 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_05930 142659 143273 gene locus_tag LOCUS_05940 gene wrbA 142659 143273 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941470.1 protein_id gnl|my_center|LOCUS_05940 144340 143372 gene locus_tag LOCUS_05950 144340 143372 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937763.1 protein_id gnl|my_center|LOCUS_05950 147175 144470 gene locus_tag LOCUS_05960 147175 144470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 148455 147172 gene locus_tag LOCUS_05970 148455 147172 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965775.1 protein_id gnl|my_center|LOCUS_05970 148674 148922 gene locus_tag LOCUS_05980 148674 148922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 148903 149220 gene locus_tag LOCUS_05990 148903 149220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 150880 149498 gene locus_tag LOCUS_06000 gene mgtE 150880 149498 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870202.1 protein_id gnl|my_center|LOCUS_06000 150873 151007 gene locus_tag LOCUS_06010 150873 151007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 151459 152757 gene locus_tag LOCUS_06020 151459 152757 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_06020 154590 152869 gene locus_tag LOCUS_06030 154590 152869 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939485.1 protein_id gnl|my_center|LOCUS_06030 155033 155278 gene locus_tag LOCUS_06040 gene copZ 155033 155278 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723406.1 protein_id gnl|my_center|LOCUS_06040 155275 157533 gene locus_tag LOCUS_06050 155275 157533 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_06050 157715 159130 gene locus_tag LOCUS_06060 157715 159130 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391671.1 protein_id gnl|my_center|LOCUS_06060 159400 160029 gene locus_tag LOCUS_06070 159400 160029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 160978 160346 gene locus_tag LOCUS_06080 160978 160346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 161130 160975 gene locus_tag LOCUS_06090 161130 160975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 161731 161321 gene locus_tag LOCUS_06100 161731 161321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 161893 162432 gene locus_tag LOCUS_06110 161893 162432 CDS product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704792.1 protein_id gnl|my_center|LOCUS_06110 162486 163082 gene locus_tag LOCUS_06120 162486 163082 CDS product DNA polymerase ligase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031607.1 protein_id gnl|my_center|LOCUS_06120 163581 163201 gene locus_tag LOCUS_06130 163581 163201 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942448.1 protein_id gnl|my_center|LOCUS_06130 166011 163594 gene locus_tag LOCUS_06140 gene lon 166011 163594 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_06140 166494 166045 gene locus_tag LOCUS_06150 166494 166045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 168376 166811 gene locus_tag LOCUS_06160 168376 166811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 168776 171157 gene locus_tag LOCUS_06170 168776 171157 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924828.1 protein_id gnl|my_center|LOCUS_06170 171251 171652 gene locus_tag LOCUS_06180 171251 171652 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546768.1 protein_id gnl|my_center|LOCUS_06180 171732 174278 gene locus_tag LOCUS_06190 171732 174278 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545874.1 protein_id gnl|my_center|LOCUS_06190 174605 178018 gene locus_tag LOCUS_06200 174605 178018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 178025 178699 gene locus_tag LOCUS_06210 178025 178699 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939847.1 protein_id gnl|my_center|LOCUS_06210 179040 180764 gene locus_tag LOCUS_06220 179040 180764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 181653 180895 gene locus_tag LOCUS_06230 gene pstB 181653 180895 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391662.1 protein_id gnl|my_center|LOCUS_06230 182751 181990 gene locus_tag LOCUS_06240 gene pstB 182751 181990 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_06240 183607 182771 gene locus_tag LOCUS_06250 gene pstA 183607 182771 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877336.1 protein_id gnl|my_center|LOCUS_06250 184460 183618 gene locus_tag LOCUS_06260 gene pstC 184460 183618 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877335.1 protein_id gnl|my_center|LOCUS_06260 185283 184468 gene locus_tag LOCUS_06270 185283 184468 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330362.1 protein_id gnl|my_center|LOCUS_06270 186231 185500 gene locus_tag LOCUS_06280 gene phoU 186231 185500 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_06280 186552 187238 gene locus_tag LOCUS_06290 186552 187238 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_06290 187243 189018 gene locus_tag LOCUS_06300 gene phoR 187243 189018 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_06300 189256 190305 gene locus_tag LOCUS_06310 gene pstS 189256 190305 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965256.1 protein_id gnl|my_center|LOCUS_06310 190442 191407 gene locus_tag LOCUS_06320 gene pstC 190442 191407 CDS product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175159.1 protein_id gnl|my_center|LOCUS_06320 191404 192249 gene locus_tag LOCUS_06330 gene pstA 191404 192249 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369014.1 protein_id gnl|my_center|LOCUS_06330 192246 193094 gene locus_tag LOCUS_06340 gene pstB 192246 193094 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083914.1 protein_id gnl|my_center|LOCUS_06340 193491 194207 gene locus_tag LOCUS_06350 gene phoU 193491 194207 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326666.1 protein_id gnl|my_center|LOCUS_06350 195185 194226 gene locus_tag LOCUS_06360 195185 194226 CDS product HpnL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535304.1 protein_id gnl|my_center|LOCUS_06360 196560 195172 gene locus_tag LOCUS_06370 196560 195172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 197690 196557 gene locus_tag LOCUS_06380 197690 196557 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767816.1 protein_id gnl|my_center|LOCUS_06380 198543 197776 gene locus_tag LOCUS_06390 198543 197776 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878638.1 protein_id gnl|my_center|LOCUS_06390 199654 198545 gene locus_tag LOCUS_06400 gene aepY 199654 198545 CDS product phosphonopyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530031.1 protein_id gnl|my_center|LOCUS_06400 201399 199651 gene locus_tag LOCUS_06410 gene aepX 201399 199651 CDS product phosphoenolpyruvate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525540.1 protein_id gnl|my_center|LOCUS_06410 203836 201536 gene locus_tag LOCUS_06420 gene topA 203836 201536 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940644.1 protein_id gnl|my_center|LOCUS_06420 205121 204027 gene locus_tag LOCUS_06430 gene dprA 205121 204027 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_06430 207334 205121 gene locus_tag LOCUS_06440 207334 205121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 207349 207519 gene locus_tag LOCUS_06450 207349 207519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 207901 207560 gene locus_tag LOCUS_06460 gene yajC 207901 207560 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943256.1 protein_id gnl|my_center|LOCUS_06460 209015 207894 gene locus_tag LOCUS_06470 gene tgt 209015 207894 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_06470 209621 209160 gene locus_tag LOCUS_06480 gene smpB 209621 209160 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545050.1 protein_id gnl|my_center|LOCUS_06480 211475 209667 gene locus_tag LOCUS_06490 gene ptsP 211475 209667 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_06490 211750 211472 gene locus_tag LOCUS_06500 211750 211472 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135899.1 protein_id gnl|my_center|LOCUS_06500 212734 211811 gene locus_tag LOCUS_06510 gene rsmI 212734 211811 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391594.1 protein_id gnl|my_center|LOCUS_06510 213099 212743 gene locus_tag LOCUS_06520 213099 212743 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392503.1 protein_id gnl|my_center|LOCUS_06520 213775 213128 gene locus_tag LOCUS_06530 gene rnhB 213775 213128 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063751.1 protein_id gnl|my_center|LOCUS_06530 214140 213790 gene locus_tag LOCUS_06540 gene rplS 214140 213790 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056983.1 protein_id gnl|my_center|LOCUS_06540 215047 214298 gene locus_tag LOCUS_06550 gene trmD 215047 214298 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_06550 215420 215037 gene locus_tag LOCUS_06560 215420 215037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 215781 215551 gene locus_tag LOCUS_06570 215781 215551 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_06570 216232 215987 gene locus_tag LOCUS_06580 gene rpsP 216232 215987 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039642952.1 protein_id gnl|my_center|LOCUS_06580 217714 216371 gene locus_tag LOCUS_06590 gene ffh 217714 216371 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941303.1 protein_id gnl|my_center|LOCUS_06590 219241 217793 gene locus_tag LOCUS_06600 219241 217793 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546530.1 protein_id gnl|my_center|LOCUS_06600 220374 219436 gene locus_tag LOCUS_06610 220374 219436 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121084.1 protein_id gnl|my_center|LOCUS_06610 221242 220493 gene locus_tag LOCUS_06620 221242 220493 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_06620 222457 221246 gene locus_tag LOCUS_06630 gene coaBC 222457 221246 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_06630 223226 222603 gene locus_tag LOCUS_06640 223226 222603 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_06640 223949 223302 gene locus_tag LOCUS_06650 223949 223302 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392339.1 protein_id gnl|my_center|LOCUS_06650 224728 224078 gene locus_tag LOCUS_06660 224728 224078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 225079 226278 gene locus_tag LOCUS_06670 225079 226278 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122967.1 protein_id gnl|my_center|LOCUS_06670 227520 226336 gene locus_tag LOCUS_06680 227520 226336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 228293 227862 gene locus_tag LOCUS_06690 228293 227862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 228680 228339 gene locus_tag LOCUS_06700 228680 228339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 228888 228658 gene locus_tag LOCUS_06710 228888 228658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 229388 228903 gene locus_tag LOCUS_06720 229388 228903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 230831 229404 gene locus_tag LOCUS_06730 230831 229404 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878473.1 protein_id gnl|my_center|LOCUS_06730 232325 230832 gene locus_tag LOCUS_06740 232325 230832 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878474.1 protein_id gnl|my_center|LOCUS_06740 232503 232342 gene locus_tag LOCUS_06750 232503 232342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 235156 232868 gene locus_tag LOCUS_06760 235156 232868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 235388 236872 gene locus_tag LOCUS_06770 235388 236872 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258188.1 protein_id gnl|my_center|LOCUS_06770 237088 237777 gene locus_tag LOCUS_06780 237088 237777 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256490.1 protein_id gnl|my_center|LOCUS_06780 239013 237937 gene locus_tag LOCUS_06790 239013 237937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 239853 239080 gene locus_tag LOCUS_06800 239853 239080 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879137.1 protein_id gnl|my_center|LOCUS_06800 240403 240092 gene locus_tag LOCUS_06810 240403 240092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 240634 240828 gene locus_tag LOCUS_06820 240634 240828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 241448 241101 gene locus_tag LOCUS_06830 241448 241101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 242177 241545 gene locus_tag LOCUS_06840 242177 241545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 242176 244026 gene locus_tag LOCUS_06850 242176 244026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06850 243936 244838 gene locus_tag LOCUS_06860 243936 244838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06860 244923 244997 gene locus_tag LOCUS_t00060 244923 244997 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 245018 245092 gene locus_tag LOCUS_t00070 245018 245092 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence04 492 1256 gene locus_tag LOCUS_06870 492 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 1855 1367 gene locus_tag LOCUS_06880 1855 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 2214 2139 gene locus_tag LOCUS_t00080 2214 2139 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4060 2330 gene locus_tag LOCUS_06890 gene recJ 4060 2330 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_06890 4790 4074 gene locus_tag LOCUS_06900 4790 4074 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258401.1 protein_id gnl|my_center|LOCUS_06900 5801 4806 gene locus_tag LOCUS_06910 5801 4806 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792329.1 protein_id gnl|my_center|LOCUS_06910 6057 6683 gene locus_tag LOCUS_06920 6057 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 6770 7354 gene locus_tag LOCUS_06930 gene hisB 6770 7354 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_06930 7815 8738 gene locus_tag LOCUS_06940 7815 8738 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791427.1 protein_id gnl|my_center|LOCUS_06940 8719 9501 gene locus_tag LOCUS_06950 gene whiG 8719 9501 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667112.1 protein_id gnl|my_center|LOCUS_06950 9701 11425 gene locus_tag LOCUS_06960 gene ade 9701 11425 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 protein_id gnl|my_center|LOCUS_06960 11648 12916 gene locus_tag LOCUS_06970 11648 12916 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941550.1 protein_id gnl|my_center|LOCUS_06970 13053 14048 gene locus_tag LOCUS_06980 gene ala 13053 14048 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879161.1 protein_id gnl|my_center|LOCUS_06980 14265 14053 gene locus_tag LOCUS_06990 14265 14053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 14659 16116 gene locus_tag LOCUS_07000 14659 16116 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_07000 16147 17616 gene locus_tag LOCUS_07010 16147 17616 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791433.1 protein_id gnl|my_center|LOCUS_07010 17705 19072 gene locus_tag LOCUS_07020 17705 19072 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_07020 19144 20637 gene locus_tag LOCUS_07030 gene thrC 19144 20637 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791440.1 protein_id gnl|my_center|LOCUS_07030 21873 20710 gene locus_tag LOCUS_07040 21873 20710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 22337 21912 gene locus_tag LOCUS_07050 22337 21912 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583101.1 protein_id gnl|my_center|LOCUS_07050 25669 22688 gene locus_tag LOCUS_07060 25669 22688 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942279.1 protein_id gnl|my_center|LOCUS_07060 27134 26358 gene locus_tag LOCUS_07070 27134 26358 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941391.1 protein_id gnl|my_center|LOCUS_07070 27632 27222 gene locus_tag LOCUS_07080 27632 27222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 28667 27786 gene locus_tag LOCUS_07090 gene hisG 28667 27786 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937425.1 protein_id gnl|my_center|LOCUS_07090 29031 28654 gene locus_tag LOCUS_07100 gene hisI 29031 28654 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937424.1 protein_id gnl|my_center|LOCUS_07100 29224 29574 gene locus_tag LOCUS_07110 29224 29574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 31363 30413 gene locus_tag LOCUS_07120 31363 30413 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545174.1 protein_id gnl|my_center|LOCUS_07120 31372 31671 gene locus_tag LOCUS_07130 31372 31671 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940862.1 protein_id gnl|my_center|LOCUS_07130 33113 31878 gene locus_tag LOCUS_07140 33113 31878 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939114.1 protein_id gnl|my_center|LOCUS_07140 33943 33110 gene locus_tag LOCUS_07150 33943 33110 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460938.1 protein_id gnl|my_center|LOCUS_07150 34928 33927 gene locus_tag LOCUS_07160 34928 33927 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460939.1 protein_id gnl|my_center|LOCUS_07160 35692 35258 gene locus_tag LOCUS_07170 35692 35258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 36482 35781 gene locus_tag LOCUS_07180 36482 35781 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_07180 38863 36668 gene locus_tag LOCUS_07190 gene feoB 38863 36668 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931750.1 protein_id gnl|my_center|LOCUS_07190 39111 38863 gene locus_tag LOCUS_07200 39111 38863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 39588 39175 gene locus_tag LOCUS_07210 39588 39175 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405106.1 protein_id gnl|my_center|LOCUS_07210 39881 40411 gene locus_tag LOCUS_07220 gene pyrR 39881 40411 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938679.1 protein_id gnl|my_center|LOCUS_07220 40415 41635 gene locus_tag LOCUS_07230 40415 41635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 41726 42124 gene locus_tag LOCUS_07240 41726 42124 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_07240 42117 43904 gene locus_tag LOCUS_07250 42117 43904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938972.1 protein_id gnl|my_center|LOCUS_07250 44151 43882 gene locus_tag LOCUS_07260 44151 43882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 44032 44646 gene locus_tag LOCUS_07270 gene rsmG 44032 44646 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258170.1 protein_id gnl|my_center|LOCUS_07270 44719 44973 gene locus_tag LOCUS_07280 44719 44973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 45107 46015 gene locus_tag LOCUS_07290 45107 46015 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 protein_id gnl|my_center|LOCUS_07290 45927 46481 gene locus_tag LOCUS_07300 45927 46481 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940878.1 protein_id gnl|my_center|LOCUS_07300 46540 46737 gene locus_tag LOCUS_07310 46540 46737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 47250 46834 gene locus_tag LOCUS_07320 47250 46834 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938935.1 protein_id gnl|my_center|LOCUS_07320 48194 47247 gene locus_tag LOCUS_07330 48194 47247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 49339 48212 gene locus_tag LOCUS_07340 49339 48212 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545696.1 protein_id gnl|my_center|LOCUS_07340 51083 49329 gene locus_tag LOCUS_07350 51083 49329 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546649.1 protein_id gnl|my_center|LOCUS_07350 52162 51065 gene locus_tag LOCUS_07360 52162 51065 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545543.1 protein_id gnl|my_center|LOCUS_07360 53752 52304 gene locus_tag LOCUS_07370 53752 52304 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853666.1 protein_id gnl|my_center|LOCUS_07370 55959 53758 gene locus_tag LOCUS_07380 55959 53758 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731007.1 protein_id gnl|my_center|LOCUS_07380 56926 56276 gene locus_tag LOCUS_07390 56926 56276 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259121.1 protein_id gnl|my_center|LOCUS_07390 59841 57400 gene locus_tag LOCUS_07400 59841 57400 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937404.1 protein_id gnl|my_center|LOCUS_07400 60641 59922 gene locus_tag LOCUS_07410 60641 59922 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391993.1 protein_id gnl|my_center|LOCUS_07410 61369 60638 gene locus_tag LOCUS_07420 61369 60638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 61646 61425 gene locus_tag LOCUS_07430 61646 61425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 61712 63538 gene locus_tag LOCUS_07440 61712 63538 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453777.1 protein_id gnl|my_center|LOCUS_07440 63643 63903 gene locus_tag LOCUS_07450 63643 63903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 64482 64111 gene locus_tag LOCUS_07460 64482 64111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 64910 65599 gene locus_tag LOCUS_07470 64910 65599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 65665 68751 gene locus_tag LOCUS_07480 65665 68751 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012596252.1 protein_id gnl|my_center|LOCUS_07480 69073 70266 gene locus_tag LOCUS_07490 gene metK 69073 70266 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056822.1 protein_id gnl|my_center|LOCUS_07490 70263 71471 gene locus_tag LOCUS_07500 70263 71471 CDS product BtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117868.1 protein_id gnl|my_center|LOCUS_07500 71468 72121 gene locus_tag LOCUS_07510 71468 72121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 72207 72761 gene locus_tag LOCUS_07520 72207 72761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 73611 72856 gene locus_tag LOCUS_07530 73611 72856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 77060 76509 gene locus_tag LOCUS_07540 77060 76509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 78199 77147 gene locus_tag LOCUS_07550 78199 77147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 79538 78255 gene locus_tag LOCUS_07560 79538 78255 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942498.1 protein_id gnl|my_center|LOCUS_07560 80588 79584 gene locus_tag LOCUS_07570 80588 79584 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_07570 81727 80579 gene locus_tag LOCUS_07580 81727 80579 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 protein_id gnl|my_center|LOCUS_07580 82791 81745 gene locus_tag LOCUS_07590 82791 81745 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870574.1 protein_id gnl|my_center|LOCUS_07590 84012 83146 gene locus_tag LOCUS_07600 84012 83146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 85672 84560 gene locus_tag LOCUS_07610 85672 84560 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 protein_id gnl|my_center|LOCUS_07610 86701 87621 gene locus_tag LOCUS_07620 gene rfbA 86701 87621 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364387.1 protein_id gnl|my_center|LOCUS_07620 89474 87732 gene locus_tag LOCUS_07630 gene ispH 89474 87732 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011417689.1 protein_id gnl|my_center|LOCUS_07630 89737 90654 gene locus_tag LOCUS_07640 89737 90654 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942543.1 protein_id gnl|my_center|LOCUS_07640 91395 90574 gene locus_tag LOCUS_07650 91395 90574 CDS product MTA/SAH nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942542.1 protein_id gnl|my_center|LOCUS_07650 92308 91556 gene locus_tag LOCUS_07660 92308 91556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 92807 92370 gene locus_tag LOCUS_07670 gene ybgC 92807 92370 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338403.1 protein_id gnl|my_center|LOCUS_07670 93118 94203 gene locus_tag LOCUS_07680 93118 94203 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404739.1 protein_id gnl|my_center|LOCUS_07680 94500 97298 gene locus_tag LOCUS_07690 gene ppdK 94500 97298 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 protein_id gnl|my_center|LOCUS_07690 97376 97753 gene locus_tag LOCUS_07700 97376 97753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 98735 97884 gene locus_tag LOCUS_07710 98735 97884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 100193 98763 gene locus_tag LOCUS_07720 100193 98763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 101349 100393 gene locus_tag LOCUS_07730 101349 100393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 102478 101342 gene locus_tag LOCUS_07740 102478 101342 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546260.1 protein_id gnl|my_center|LOCUS_07740 103685 102468 gene locus_tag LOCUS_07750 103685 102468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 103958 103809 gene locus_tag LOCUS_07760 103958 103809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 105958 104090 gene locus_tag LOCUS_07770 105958 104090 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391425.1 protein_id gnl|my_center|LOCUS_07770 106499 106125 gene locus_tag LOCUS_07780 106499 106125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 107713 106538 gene locus_tag LOCUS_07790 107713 106538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 107924 108493 gene locus_tag LOCUS_07800 107924 108493 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172421.1 protein_id gnl|my_center|LOCUS_07800 108512 109687 gene locus_tag LOCUS_07810 108512 109687 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_07810 110361 109921 gene locus_tag LOCUS_07820 110361 109921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 110480 111367 gene locus_tag LOCUS_07830 gene xerD 110480 111367 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723602.1 protein_id gnl|my_center|LOCUS_07830 111632 114292 gene locus_tag LOCUS_07840 111632 114292 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942226.1 protein_id gnl|my_center|LOCUS_07840 114806 114378 gene locus_tag LOCUS_07850 114806 114378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 115982 115095 gene locus_tag LOCUS_07860 gene prmC 115982 115095 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_07860 117052 115979 gene locus_tag LOCUS_07870 gene prfA 117052 115979 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947982.1 protein_id gnl|my_center|LOCUS_07870 118140 117193 gene locus_tag LOCUS_07880 118140 117193 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943726.1 protein_id gnl|my_center|LOCUS_07880 118377 118144 gene locus_tag LOCUS_07890 gene rpmE 118377 118144 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_07890 118832 119152 gene locus_tag LOCUS_07900 118832 119152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 119122 119481 gene locus_tag LOCUS_07910 119122 119481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 119838 119635 gene locus_tag LOCUS_07920 119838 119635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 121213 119816 gene locus_tag LOCUS_07930 gene radA 121213 119816 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940957.1 protein_id gnl|my_center|LOCUS_07930 122076 121372 gene locus_tag LOCUS_07940 122076 121372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 124001 122121 gene locus_tag LOCUS_07950 gene ftsH 124001 122121 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869596.1 protein_id gnl|my_center|LOCUS_07950 124249 124680 gene locus_tag LOCUS_07960 124249 124680 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792757.1 protein_id gnl|my_center|LOCUS_07960 124677 126458 gene locus_tag LOCUS_07970 124677 126458 CDS product aldehyde ferredoxin oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792756.1 protein_id gnl|my_center|LOCUS_07970 126695 128263 gene locus_tag LOCUS_07980 126695 128263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 128265 132536 gene locus_tag LOCUS_07990 128265 132536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 132537 133748 gene locus_tag LOCUS_08000 132537 133748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 134461 134183 gene locus_tag LOCUS_08010 134461 134183 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939083.1 protein_id gnl|my_center|LOCUS_08010 135937 134840 gene locus_tag LOCUS_08020 gene lptG 135937 134840 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942568.1 protein_id gnl|my_center|LOCUS_08020 135985 136875 gene locus_tag LOCUS_08030 135985 136875 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938520.1 protein_id gnl|my_center|LOCUS_08030 137254 136817 gene locus_tag LOCUS_08040 137254 136817 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021674.1 protein_id gnl|my_center|LOCUS_08040 137558 138547 gene locus_tag LOCUS_08050 137558 138547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 138677 139555 gene locus_tag LOCUS_08060 138677 139555 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_08060 139589 141490 gene locus_tag LOCUS_08070 gene asnB 139589 141490 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_08070 141601 143022 gene locus_tag LOCUS_08080 141601 143022 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_08080 143237 144664 gene locus_tag LOCUS_08090 143237 144664 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_08090 144667 145719 gene locus_tag LOCUS_08100 144667 145719 CDS product UPF0104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496874.1 protein_id gnl|my_center|LOCUS_08100 145766 146926 gene locus_tag LOCUS_08110 145766 146926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 147074 147397 gene locus_tag LOCUS_08120 gene trxA 147074 147397 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939125.1 protein_id gnl|my_center|LOCUS_08120 147415 148347 gene locus_tag LOCUS_08130 gene trxB 147415 148347 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229015.1 protein_id gnl|my_center|LOCUS_08130 148351 149076 gene locus_tag LOCUS_08140 148351 149076 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792195.1 protein_id gnl|my_center|LOCUS_08140 150188 149424 gene locus_tag LOCUS_08150 gene surE 150188 149424 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404579.1 protein_id gnl|my_center|LOCUS_08150 150644 150844 gene locus_tag LOCUS_08160 150644 150844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 150832 151326 gene locus_tag LOCUS_08170 150832 151326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 151670 151461 gene locus_tag LOCUS_08180 151670 151461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 151575 152807 gene locus_tag LOCUS_08190 151575 152807 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393460.1 protein_id gnl|my_center|LOCUS_08190 152943 154190 gene locus_tag LOCUS_08200 152943 154190 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_08200 154640 156091 gene locus_tag LOCUS_08210 154640 156091 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_08210 156093 156845 gene locus_tag LOCUS_08220 156093 156845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 156858 159119 gene locus_tag LOCUS_08230 gene wzc 156858 159119 CDS product tyrosine-protein kinase Wzc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137223.1 protein_id gnl|my_center|LOCUS_08230 159216 159881 gene locus_tag LOCUS_08240 159216 159881 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391463.1 protein_id gnl|my_center|LOCUS_08240 159884 160039 gene locus_tag LOCUS_08250 159884 160039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 160094 161587 gene locus_tag LOCUS_08260 160094 161587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 162341 161565 gene locus_tag LOCUS_08270 162341 161565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 162429 163220 gene locus_tag LOCUS_08280 162429 163220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 163226 164392 gene locus_tag LOCUS_08290 163226 164392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 164413 165918 gene locus_tag LOCUS_08300 164413 165918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 165899 167170 gene locus_tag LOCUS_08310 165899 167170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 167158 168450 gene locus_tag LOCUS_08320 167158 168450 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803854.1 protein_id gnl|my_center|LOCUS_08320 168398 169294 gene locus_tag LOCUS_08330 168398 169294 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024331.1 protein_id gnl|my_center|LOCUS_08330 169284 170024 gene locus_tag LOCUS_08340 169284 170024 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393842.1 protein_id gnl|my_center|LOCUS_08340 172014 170140 gene locus_tag LOCUS_08350 172014 170140 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085400.1 protein_id gnl|my_center|LOCUS_08350 172279 172485 gene locus_tag LOCUS_08360 172279 172485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 174167 172713 gene locus_tag LOCUS_08370 174167 172713 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_08370 175446 174343 gene locus_tag LOCUS_08380 175446 174343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 175850 176875 gene locus_tag LOCUS_08390 175850 176875 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174361.1 protein_id gnl|my_center|LOCUS_08390 176940 178286 gene locus_tag LOCUS_08400 176940 178286 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545209.1 protein_id gnl|my_center|LOCUS_08400 180736 178682 gene locus_tag LOCUS_08410 180736 178682 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223895.1 protein_id gnl|my_center|LOCUS_08410 181779 180844 gene locus_tag LOCUS_08420 181779 180844 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941566.1 protein_id gnl|my_center|LOCUS_08420 182295 182921 gene locus_tag LOCUS_08430 182295 182921 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495802.1 protein_id gnl|my_center|LOCUS_08430 183876 183001 gene locus_tag LOCUS_08440 183876 183001 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938651.1 protein_id gnl|my_center|LOCUS_08440 184534 183917 gene locus_tag LOCUS_08450 gene yedF 184534 183917 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938959.1 protein_id gnl|my_center|LOCUS_08450 184766 186061 gene locus_tag LOCUS_08460 gene purB 184766 186061 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942277.1 protein_id gnl|my_center|LOCUS_08460 186167 187132 gene locus_tag LOCUS_08470 186167 187132 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_08470 187129 187860 gene locus_tag LOCUS_08480 187129 187860 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065164.1 protein_id gnl|my_center|LOCUS_08480 189444 187948 gene locus_tag LOCUS_08490 189444 187948 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549809.1 protein_id gnl|my_center|LOCUS_08490 189934 189473 gene locus_tag LOCUS_08500 189934 189473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 190755 190471 gene locus_tag LOCUS_08510 190755 190471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 191138 194026 gene locus_tag LOCUS_08520 191138 194026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 194186 195103 gene locus_tag LOCUS_08530 194186 195103 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791450.1 protein_id gnl|my_center|LOCUS_08530 195164 195355 gene locus_tag LOCUS_08540 195164 195355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 195777 195352 gene locus_tag LOCUS_08550 195777 195352 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071464.1 protein_id gnl|my_center|LOCUS_08550 196896 195847 gene locus_tag LOCUS_08560 196896 195847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392352.1 protein_id gnl|my_center|LOCUS_08560 197246 197578 gene locus_tag LOCUS_08570 197246 197578 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664575.1 protein_id gnl|my_center|LOCUS_08570 197838 197746 gene locus_tag LOCUS_t00090 197838 197746 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 198708 198388 gene locus_tag LOCUS_08580 198708 198388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 198870 199409 gene locus_tag LOCUS_08590 198870 199409 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872605.1 protein_id gnl|my_center|LOCUS_08590 200239 199508 gene locus_tag LOCUS_08600 200239 199508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 200362 200874 gene locus_tag LOCUS_08610 200362 200874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 200918 201193 gene locus_tag LOCUS_08620 200918 201193 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940201.1 protein_id gnl|my_center|LOCUS_08620 201279 201857 gene locus_tag LOCUS_08630 201279 201857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 202624 201854 gene locus_tag LOCUS_08640 202624 201854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 202974 202633 gene locus_tag LOCUS_08650 202974 202633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 203119 203346 gene locus_tag LOCUS_08660 203119 203346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 203355 204110 gene locus_tag LOCUS_08670 203355 204110 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 protein_id gnl|my_center|LOCUS_08670 204122 204343 gene locus_tag LOCUS_08680 204122 204343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 204327 205250 gene locus_tag LOCUS_08690 204327 205250 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987089.1 protein_id gnl|my_center|LOCUS_08690 205972 207039 gene locus_tag LOCUS_08700 205972 207039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 207254 207490 gene locus_tag LOCUS_08710 207254 207490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 207487 209175 gene locus_tag LOCUS_08720 gene ilvB 207487 209175 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545836.1 protein_id gnl|my_center|LOCUS_08720 209189 209671 gene locus_tag LOCUS_08730 gene ilvN 209189 209671 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938672.1 protein_id gnl|my_center|LOCUS_08730 209684 210538 gene locus_tag LOCUS_08740 209684 210538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 210574 211566 gene locus_tag LOCUS_08750 gene ilvC 210574 211566 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_08750 211608 212249 gene locus_tag LOCUS_08760 211608 212249 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971370.1 protein_id gnl|my_center|LOCUS_08760 212246 213040 gene locus_tag LOCUS_08770 gene pssA 212246 213040 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_08770 213256 214800 gene locus_tag LOCUS_08780 213256 214800 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_08780 214981 216246 gene locus_tag LOCUS_08790 gene leuC 214981 216246 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545762.1 protein_id gnl|my_center|LOCUS_08790 216603 216256 gene locus_tag LOCUS_08800 216603 216256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 216768 216926 gene locus_tag LOCUS_08810 216768 216926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 216969 217646 gene locus_tag LOCUS_08820 216969 217646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 218412 217636 gene locus_tag LOCUS_08830 218412 217636 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373316.1 protein_id gnl|my_center|LOCUS_08830 218891 219904 gene locus_tag LOCUS_08840 gene gap 218891 219904 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942274.1 protein_id gnl|my_center|LOCUS_08840 219924 221132 gene locus_tag LOCUS_08850 gene pgk 219924 221132 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942273.1 protein_id gnl|my_center|LOCUS_08850 221137 221901 gene locus_tag LOCUS_08860 gene tpiA 221137 221901 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942272.1 protein_id gnl|my_center|LOCUS_08860 221982 222284 gene locus_tag LOCUS_08870 221982 222284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 222294 222379 gene locus_tag LOCUS_t00100 222294 222379 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 223205 223032 gene locus_tag LOCUS_08880 223205 223032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 223848 224216 gene locus_tag LOCUS_08890 223848 224216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 224605 224775 gene locus_tag LOCUS_08900 224605 224775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 224954 225607 gene locus_tag LOCUS_08910 224954 225607 CDS product DUF1956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792895.1 protein_id gnl|my_center|LOCUS_08910 225604 226740 gene locus_tag LOCUS_08920 225604 226740 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188120.1 protein_id gnl|my_center|LOCUS_08920 226743 227447 gene locus_tag LOCUS_08930 226743 227447 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932239.1 protein_id gnl|my_center|LOCUS_08930 227437 228519 gene locus_tag LOCUS_08940 227437 228519 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187814.1 protein_id gnl|my_center|LOCUS_08940 228681 230111 gene locus_tag LOCUS_08950 228681 230111 CDS product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926880.1 protein_id gnl|my_center|LOCUS_08950 230242 230484 gene locus_tag LOCUS_08960 230242 230484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08960 230792 230613 gene locus_tag LOCUS_08970 230792 230613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 231236 231048 gene locus_tag LOCUS_08980 231236 231048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 231333 231641 gene locus_tag LOCUS_08990 231333 231641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08990 231626 231808 gene locus_tag LOCUS_09000 231626 231808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 >Feature sequence05 1705 176 gene locus_tag LOCUS_09010 gene nagZ 1705 176 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963506.1 protein_id gnl|my_center|LOCUS_09010 1749 3287 gene locus_tag LOCUS_09020 1749 3287 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223797.1 protein_id gnl|my_center|LOCUS_09020 3580 3389 gene locus_tag LOCUS_09030 3580 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 3879 4280 gene locus_tag LOCUS_09040 3879 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 4498 6927 gene locus_tag LOCUS_09050 4498 6927 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065180.1 protein_id gnl|my_center|LOCUS_09050 7332 7258 gene locus_tag LOCUS_t00110 7332 7258 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 8078 7413 gene locus_tag LOCUS_09060 8078 7413 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064948.1 protein_id gnl|my_center|LOCUS_09060 8767 8234 gene locus_tag LOCUS_09070 8767 8234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 9520 9062 gene locus_tag LOCUS_09080 9520 9062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 10553 9513 gene locus_tag LOCUS_09090 10553 9513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 10811 10611 gene locus_tag LOCUS_09100 10811 10611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 10933 11625 gene locus_tag LOCUS_09110 gene radC 10933 11625 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133415038.1 protein_id gnl|my_center|LOCUS_09110 11642 11836 gene locus_tag LOCUS_09120 11642 11836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 12137 13375 gene locus_tag LOCUS_09130 12137 13375 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_09130 13407 15077 gene locus_tag LOCUS_09140 gene cimA 13407 15077 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942443.1 protein_id gnl|my_center|LOCUS_09140 15145 15735 gene locus_tag LOCUS_09150 15145 15735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 15767 17014 gene locus_tag LOCUS_09160 15767 17014 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_09160 17011 17631 gene locus_tag LOCUS_09170 17011 17631 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224619.1 protein_id gnl|my_center|LOCUS_09170 17694 19418 gene locus_tag LOCUS_09180 17694 19418 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760603.1 protein_id gnl|my_center|LOCUS_09180 19741 20568 gene locus_tag LOCUS_09190 gene ilvE 19741 20568 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005489.1 protein_id gnl|my_center|LOCUS_09190 20976 20554 gene locus_tag LOCUS_09200 20976 20554 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937702.1 protein_id gnl|my_center|LOCUS_09200 21346 22749 gene locus_tag LOCUS_09210 21346 22749 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963552.1 protein_id gnl|my_center|LOCUS_09210 22831 23424 gene locus_tag LOCUS_09220 22831 23424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 23613 25790 gene locus_tag LOCUS_09230 23613 25790 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_09230 26426 26001 gene locus_tag LOCUS_09240 26426 26001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 28042 26912 gene locus_tag LOCUS_09250 28042 26912 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_09250 29180 28047 gene locus_tag LOCUS_09260 29180 28047 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_09260 30344 29349 gene locus_tag LOCUS_09270 30344 29349 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393400.1 protein_id gnl|my_center|LOCUS_09270 31324 30344 gene locus_tag LOCUS_09280 31324 30344 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_09280 32312 31293 gene locus_tag LOCUS_09290 32312 31293 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_09290 33159 32410 gene locus_tag LOCUS_09300 33159 32410 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_09300 33397 35613 gene locus_tag LOCUS_09310 33397 35613 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942516.1 protein_id gnl|my_center|LOCUS_09310 36304 36480 gene locus_tag LOCUS_09320 36304 36480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 36565 36876 gene locus_tag LOCUS_09330 36565 36876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 36873 37055 gene locus_tag LOCUS_09340 36873 37055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 37136 37525 gene locus_tag LOCUS_09350 37136 37525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 37632 38798 gene locus_tag LOCUS_09360 37632 38798 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870216.1 protein_id gnl|my_center|LOCUS_09360 38905 39132 gene locus_tag LOCUS_09370 38905 39132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 39164 39874 gene locus_tag LOCUS_09380 39164 39874 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943348.1 protein_id gnl|my_center|LOCUS_09380 40394 40056 gene locus_tag LOCUS_09390 40394 40056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 40500 40330 gene locus_tag LOCUS_09400 40500 40330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 41264 40542 gene locus_tag LOCUS_09410 41264 40542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 41863 42069 gene locus_tag LOCUS_09420 41863 42069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 42516 42097 gene locus_tag LOCUS_09430 42516 42097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 42876 42592 gene locus_tag LOCUS_09440 42876 42592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 43654 43001 gene locus_tag LOCUS_09450 43654 43001 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545523.1 protein_id gnl|my_center|LOCUS_09450 43918 43993 gene locus_tag LOCUS_t00120 43918 43993 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 44004 44081 gene locus_tag LOCUS_t00130 44004 44081 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 44517 45296 gene locus_tag LOCUS_09460 gene scpB 44517 45296 CDS product methylmalonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122080.1 protein_id gnl|my_center|LOCUS_09460 46716 45409 gene locus_tag LOCUS_09470 46716 45409 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940915.1 protein_id gnl|my_center|LOCUS_09470 46934 47527 gene locus_tag LOCUS_09480 46934 47527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 47524 48498 gene locus_tag LOCUS_09490 47524 48498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_09490 48468 48869 gene locus_tag LOCUS_09500 48468 48869 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393092.1 protein_id gnl|my_center|LOCUS_09500 48924 49148 gene locus_tag LOCUS_09510 48924 49148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 49264 49839 gene locus_tag LOCUS_09520 49264 49839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 49984 50370 gene locus_tag LOCUS_09530 49984 50370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 51365 50463 gene locus_tag LOCUS_09540 gene folD 51365 50463 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230259.1 protein_id gnl|my_center|LOCUS_09540 51545 52276 gene locus_tag LOCUS_09550 gene ubiE 51545 52276 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941531.1 protein_id gnl|my_center|LOCUS_09550 52959 52351 gene locus_tag LOCUS_09560 52959 52351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 55534 53072 gene locus_tag LOCUS_09570 gene ppsA 55534 53072 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_09570 55993 57321 gene locus_tag LOCUS_09580 55993 57321 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_09580 57416 58294 gene locus_tag LOCUS_09590 gene glyQ 57416 58294 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941241.1 protein_id gnl|my_center|LOCUS_09590 58450 60522 gene locus_tag LOCUS_09600 gene glyS 58450 60522 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941242.1 protein_id gnl|my_center|LOCUS_09600 60894 62003 gene locus_tag LOCUS_09610 gene ftsY 60894 62003 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_09610 62074 62571 gene locus_tag LOCUS_09620 62074 62571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 62623 64002 gene locus_tag LOCUS_09630 62623 64002 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545053.1 protein_id gnl|my_center|LOCUS_09630 63986 65362 gene locus_tag LOCUS_09640 63986 65362 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546417.1 protein_id gnl|my_center|LOCUS_09640 65377 66846 gene locus_tag LOCUS_09650 65377 66846 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_09650 68945 67635 gene locus_tag LOCUS_09660 68945 67635 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108817.1 protein_id gnl|my_center|LOCUS_09660 70106 69210 gene locus_tag LOCUS_09670 70106 69210 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_09670 70972 70268 gene locus_tag LOCUS_09680 70972 70268 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227935.1 protein_id gnl|my_center|LOCUS_09680 71788 70988 gene locus_tag LOCUS_09690 71788 70988 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_09690 72874 71873 gene locus_tag LOCUS_09700 72874 71873 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940008.1 protein_id gnl|my_center|LOCUS_09700 73769 72861 gene locus_tag LOCUS_09710 73769 72861 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_09710 74990 73833 gene locus_tag LOCUS_09720 74990 73833 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940010.1 protein_id gnl|my_center|LOCUS_09720 75648 76088 gene locus_tag LOCUS_09730 75648 76088 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 protein_id gnl|my_center|LOCUS_09730 76316 77284 gene locus_tag LOCUS_09740 76316 77284 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545320.1 protein_id gnl|my_center|LOCUS_09740 77306 79702 gene locus_tag LOCUS_09750 gene pheT 77306 79702 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_09750 79719 80093 gene locus_tag LOCUS_09760 79719 80093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 80336 81388 gene locus_tag LOCUS_09770 80336 81388 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943997.1 protein_id gnl|my_center|LOCUS_09770 81690 82202 gene locus_tag LOCUS_09780 gene purE 81690 82202 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393549.1 protein_id gnl|my_center|LOCUS_09780 82255 83364 gene locus_tag LOCUS_09790 gene alr 82255 83364 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_09790 83368 83550 gene locus_tag LOCUS_09800 83368 83550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546002.1 protein_id gnl|my_center|LOCUS_09800 84016 85641 gene locus_tag LOCUS_09810 gene argS 84016 85641 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393887.1 protein_id gnl|my_center|LOCUS_09810 85652 85870 gene locus_tag LOCUS_09820 85652 85870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 85994 86854 gene locus_tag LOCUS_09830 85994 86854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 87268 87924 gene locus_tag LOCUS_09840 gene hisH 87268 87924 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815798.1 protein_id gnl|my_center|LOCUS_09840 87914 88693 gene locus_tag LOCUS_09850 gene hisF 87914 88693 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937595.1 protein_id gnl|my_center|LOCUS_09850 88813 89811 gene locus_tag LOCUS_09860 88813 89811 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938875.1 protein_id gnl|my_center|LOCUS_09860 90050 90487 gene locus_tag LOCUS_09870 90050 90487 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081556.1 protein_id gnl|my_center|LOCUS_09870 90468 90767 gene locus_tag LOCUS_09880 90468 90767 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230139.1 protein_id gnl|my_center|LOCUS_09880 90783 91919 gene locus_tag LOCUS_09890 gene dnaJ 90783 91919 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095211.1 protein_id gnl|my_center|LOCUS_09890 92060 92224 gene locus_tag LOCUS_09900 92060 92224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 92395 92204 gene locus_tag LOCUS_09910 92395 92204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 92459 93487 gene locus_tag LOCUS_09920 92459 93487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 93557 94255 gene locus_tag LOCUS_09930 93557 94255 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161962652.1 protein_id gnl|my_center|LOCUS_09930 94261 95826 gene locus_tag LOCUS_09940 94261 95826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 95872 96633 gene locus_tag LOCUS_09950 95872 96633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 96751 97749 gene locus_tag LOCUS_09960 gene tsaD 96751 97749 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942510.1 protein_id gnl|my_center|LOCUS_09960 98656 97757 gene locus_tag LOCUS_09970 98656 97757 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941053.1 protein_id gnl|my_center|LOCUS_09970 100085 98661 gene locus_tag LOCUS_09980 100085 98661 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763152.1 protein_id gnl|my_center|LOCUS_09980 103488 100159 gene locus_tag LOCUS_09990 103488 100159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 103908 104630 gene locus_tag LOCUS_10000 103908 104630 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583200.1 protein_id gnl|my_center|LOCUS_10000 104627 107185 gene locus_tag LOCUS_10010 104627 107185 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255972.1 protein_id gnl|my_center|LOCUS_10010 107946 107491 gene locus_tag LOCUS_10020 107946 107491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 109227 108070 gene locus_tag LOCUS_10030 gene ispG 109227 108070 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541503.1 protein_id gnl|my_center|LOCUS_10030 110295 109381 gene locus_tag LOCUS_10040 110295 109381 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_10040 110896 110375 gene locus_tag LOCUS_10050 110896 110375 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642674.1 protein_id gnl|my_center|LOCUS_10050 112956 111070 gene locus_tag LOCUS_10060 112956 111070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 113678 113340 gene locus_tag LOCUS_10070 gene glnB 113678 113340 CDS product nitrogen regulator P-II GlnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880011.1 protein_id gnl|my_center|LOCUS_10070 114921 113701 gene locus_tag LOCUS_10080 114921 113701 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_10080 115387 116697 gene locus_tag LOCUS_10090 115387 116697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 118126 116816 gene locus_tag LOCUS_10100 gene asnS 118126 116816 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583296.1 protein_id gnl|my_center|LOCUS_10100 119123 118176 gene locus_tag LOCUS_10110 119123 118176 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_10110 122596 119120 gene locus_tag LOCUS_10120 gene mfd 122596 119120 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_10120 122906 123319 gene locus_tag LOCUS_10130 gene mce 122906 123319 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_10130 123367 124143 gene locus_tag LOCUS_10140 123367 124143 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943982.1 protein_id gnl|my_center|LOCUS_10140 124398 124195 gene locus_tag LOCUS_10150 124398 124195 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546429.1 protein_id gnl|my_center|LOCUS_10150 124757 125938 gene locus_tag LOCUS_10160 gene alaC 124757 125938 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546347.1 protein_id gnl|my_center|LOCUS_10160 125935 127260 gene locus_tag LOCUS_10170 125935 127260 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_10170 127935 128011 gene locus_tag LOCUS_t00140 127935 128011 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 128106 129230 gene locus_tag LOCUS_10180 128106 129230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 130091 129294 gene locus_tag LOCUS_10190 130091 129294 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144685205.1 protein_id gnl|my_center|LOCUS_10190 130498 130157 gene locus_tag LOCUS_10200 130498 130157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 132165 130606 gene locus_tag LOCUS_10210 132165 130606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 132164 132355 gene locus_tag LOCUS_10220 132164 132355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 132561 132761 gene locus_tag LOCUS_10230 132561 132761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 132825 134027 gene locus_tag LOCUS_10240 132825 134027 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_10240 134081 135202 gene locus_tag LOCUS_10250 134081 135202 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256149.1 protein_id gnl|my_center|LOCUS_10250 135639 135199 gene locus_tag LOCUS_10260 135639 135199 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811741.1 protein_id gnl|my_center|LOCUS_10260 135854 136618 gene locus_tag LOCUS_10270 135854 136618 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888532.1 protein_id gnl|my_center|LOCUS_10270 136975 138450 gene locus_tag LOCUS_10280 gene trpE 136975 138450 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_10280 138634 139221 gene locus_tag LOCUS_10290 138634 139221 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_10290 139281 139568 gene locus_tag LOCUS_10300 139281 139568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 139575 140753 gene locus_tag LOCUS_10310 139575 140753 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939231.1 protein_id gnl|my_center|LOCUS_10310 140899 141768 gene locus_tag LOCUS_10320 140899 141768 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939232.1 protein_id gnl|my_center|LOCUS_10320 141799 142395 gene locus_tag LOCUS_10330 141799 142395 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_10330 142452 144596 gene locus_tag LOCUS_10340 142452 144596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 144659 145726 gene locus_tag LOCUS_10350 gene trpD 144659 145726 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943017.1 protein_id gnl|my_center|LOCUS_10350 145723 146505 gene locus_tag LOCUS_10360 gene trpC 145723 146505 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_10360 146602 146802 gene locus_tag LOCUS_10370 146602 146802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 146921 147580 gene locus_tag LOCUS_10380 146921 147580 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_10380 147932 149113 gene locus_tag LOCUS_10390 gene trpB 147932 149113 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943010.1 protein_id gnl|my_center|LOCUS_10390 149110 149910 gene locus_tag LOCUS_10400 gene trpA 149110 149910 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_10400 149982 150866 gene locus_tag LOCUS_10410 gene hslO 149982 150866 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943960.1 protein_id gnl|my_center|LOCUS_10410 151369 151028 gene locus_tag LOCUS_10420 151369 151028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 151833 152708 gene locus_tag LOCUS_10430 151833 152708 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_10430 152955 152797 gene locus_tag LOCUS_10440 152955 152797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 152887 153543 gene locus_tag LOCUS_10450 152887 153543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 153546 154610 gene locus_tag LOCUS_10460 153546 154610 CDS product DUF1786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392396.1 protein_id gnl|my_center|LOCUS_10460 154676 155521 gene locus_tag LOCUS_10470 154676 155521 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_10470 155684 156232 gene locus_tag LOCUS_10480 gene aroL 155684 156232 CDS product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208693.1 protein_id gnl|my_center|LOCUS_10480 156229 157281 gene locus_tag LOCUS_10490 gene aroC 156229 157281 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938193.1 protein_id gnl|my_center|LOCUS_10490 157278 158105 gene locus_tag LOCUS_10500 157278 158105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 158111 159388 gene locus_tag LOCUS_10510 gene serS 158111 159388 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545752.1 protein_id gnl|my_center|LOCUS_10510 160093 161829 gene locus_tag LOCUS_10520 160093 161829 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942079.1 protein_id gnl|my_center|LOCUS_10520 161826 162635 gene locus_tag LOCUS_10530 161826 162635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 162632 163102 gene locus_tag LOCUS_10540 162632 163102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 163372 163758 gene locus_tag LOCUS_10550 163372 163758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 163851 164324 gene locus_tag LOCUS_10560 163851 164324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 164396 164692 gene locus_tag LOCUS_10570 164396 164692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 165636 164857 gene locus_tag LOCUS_10580 165636 164857 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_10580 166571 165804 gene locus_tag LOCUS_10590 166571 165804 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941483.1 protein_id gnl|my_center|LOCUS_10590 166931 167146 gene locus_tag LOCUS_10600 166931 167146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 167432 167256 gene locus_tag LOCUS_10610 167432 167256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 168237 167497 gene locus_tag LOCUS_10620 168237 167497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 168740 168336 gene locus_tag LOCUS_10630 168740 168336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 169644 169003 gene locus_tag LOCUS_10640 169644 169003 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461976.1 protein_id gnl|my_center|LOCUS_10640 170135 169902 gene locus_tag LOCUS_10650 170135 169902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 170234 173950 gene locus_tag LOCUS_10660 170234 173950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 174051 174521 gene locus_tag LOCUS_10670 174051 174521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 174527 175534 gene locus_tag LOCUS_10680 174527 175534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 175793 176917 gene locus_tag LOCUS_10690 175793 176917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence06 319 1080 gene locus_tag LOCUS_10700 319 1080 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880407.1 protein_id gnl|my_center|LOCUS_10700 1313 2908 gene locus_tag LOCUS_10710 1313 2908 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942447.1 protein_id gnl|my_center|LOCUS_10710 2884 3339 gene locus_tag LOCUS_10720 2884 3339 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939197.1 protein_id gnl|my_center|LOCUS_10720 3352 3843 gene locus_tag LOCUS_10730 gene tsaE 3352 3843 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257860.1 protein_id gnl|my_center|LOCUS_10730 3853 4527 gene locus_tag LOCUS_10740 3853 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 5469 4633 gene locus_tag LOCUS_10750 5469 4633 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090280.1 protein_id gnl|my_center|LOCUS_10750 5879 5535 gene locus_tag LOCUS_10760 5879 5535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 6476 5955 gene locus_tag LOCUS_10770 6476 5955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 7670 6687 gene locus_tag LOCUS_10780 7670 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 8581 7820 gene locus_tag LOCUS_10790 8581 7820 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_10790 8976 8641 gene locus_tag LOCUS_10800 8976 8641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 9309 9503 gene locus_tag LOCUS_10810 9309 9503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 10602 9556 gene locus_tag LOCUS_10820 10602 9556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 10844 12151 gene locus_tag LOCUS_10830 10844 12151 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774548.1 protein_id gnl|my_center|LOCUS_10830 12142 13509 gene locus_tag LOCUS_10840 12142 13509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 13509 13964 gene locus_tag LOCUS_10850 13509 13964 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879145.1 protein_id gnl|my_center|LOCUS_10850 14173 14021 gene locus_tag LOCUS_10860 14173 14021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 14202 14696 gene locus_tag LOCUS_10870 14202 14696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 14719 17766 gene locus_tag LOCUS_10880 14719 17766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 17784 18218 gene locus_tag LOCUS_10890 17784 18218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 18557 18360 gene locus_tag LOCUS_10900 18557 18360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 19717 18980 gene locus_tag LOCUS_10910 19717 18980 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545759.1 protein_id gnl|my_center|LOCUS_10910 20280 19942 gene locus_tag LOCUS_10920 gene glnB 20280 19942 CDS product nitrogen regulator P-II GlnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880011.1 protein_id gnl|my_center|LOCUS_10920 20545 21045 gene locus_tag LOCUS_10930 20545 21045 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404934.1 protein_id gnl|my_center|LOCUS_10930 21136 20960 gene locus_tag LOCUS_10940 21136 20960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 22390 21377 gene locus_tag LOCUS_10950 gene amrS 22390 21377 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 protein_id gnl|my_center|LOCUS_10950 23330 22929 gene locus_tag LOCUS_10960 23330 22929 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207691809.1 protein_id gnl|my_center|LOCUS_10960 23801 23346 gene locus_tag LOCUS_10970 23801 23346 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582602.1 protein_id gnl|my_center|LOCUS_10970 24515 23955 gene locus_tag LOCUS_10980 24515 23955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 25206 24574 gene locus_tag LOCUS_10990 25206 24574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 25985 25179 gene locus_tag LOCUS_11000 gene rhlP 25985 25179 CDS product rhombotarget lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072488.1 protein_id gnl|my_center|LOCUS_11000 26389 26084 gene locus_tag LOCUS_11010 26389 26084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 27968 26436 gene locus_tag LOCUS_11020 27968 26436 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937393.1 protein_id gnl|my_center|LOCUS_11020 28303 28124 gene locus_tag LOCUS_11030 28303 28124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 30138 28447 gene locus_tag LOCUS_11040 30138 28447 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403181.1 protein_id gnl|my_center|LOCUS_11040 30654 31346 gene locus_tag LOCUS_11050 30654 31346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 32271 31351 gene locus_tag LOCUS_11060 32271 31351 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021942.1 protein_id gnl|my_center|LOCUS_11060 32979 33335 gene locus_tag LOCUS_11070 32979 33335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 33971 33411 gene locus_tag LOCUS_11080 gene efp 33971 33411 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_11080 34468 34016 gene locus_tag LOCUS_11090 34468 34016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 34689 35867 gene locus_tag LOCUS_11100 34689 35867 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257605.1 protein_id gnl|my_center|LOCUS_11100 36852 36115 gene locus_tag LOCUS_11110 36852 36115 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403241.1 protein_id gnl|my_center|LOCUS_11110 37172 36972 gene locus_tag LOCUS_11120 37172 36972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 37701 39059 gene locus_tag LOCUS_11130 gene glmM 37701 39059 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_11130 39069 39911 gene locus_tag LOCUS_11140 39069 39911 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_11140 40145 41155 gene locus_tag LOCUS_11150 40145 41155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 41330 41932 gene locus_tag LOCUS_11160 41330 41932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 42651 42950 gene locus_tag LOCUS_11170 42651 42950 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_11170 42959 43032 gene locus_tag LOCUS_t00150 42959 43032 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 43874 43452 gene locus_tag LOCUS_11180 gene nusB 43874 43452 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_11180 44351 43881 gene locus_tag LOCUS_11190 gene ribE 44351 43881 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811752.1 protein_id gnl|my_center|LOCUS_11190 45716 44514 gene locus_tag LOCUS_11200 45716 44514 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_11200 46503 45856 gene locus_tag LOCUS_11210 46503 45856 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_11210 46674 47018 gene locus_tag LOCUS_11220 46674 47018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 47029 47856 gene locus_tag LOCUS_11230 47029 47856 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228704.1 protein_id gnl|my_center|LOCUS_11230 47880 48212 gene locus_tag LOCUS_11240 47880 48212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 49252 48422 gene locus_tag LOCUS_11250 gene mazG 49252 48422 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 protein_id gnl|my_center|LOCUS_11250 49811 49257 gene locus_tag LOCUS_11260 49811 49257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 50408 49929 gene locus_tag LOCUS_11270 50408 49929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 51161 50541 gene locus_tag LOCUS_11280 51161 50541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 52655 51180 gene locus_tag LOCUS_11290 52655 51180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 53512 52814 gene locus_tag LOCUS_11300 53512 52814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 53989 53612 gene locus_tag LOCUS_11310 53989 53612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941231.1 protein_id gnl|my_center|LOCUS_11310 55388 54000 gene locus_tag LOCUS_11320 gene dnaB 55388 54000 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938258.1 protein_id gnl|my_center|LOCUS_11320 55770 56714 gene locus_tag LOCUS_11330 55770 56714 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938287.1 protein_id gnl|my_center|LOCUS_11330 56736 57107 gene locus_tag LOCUS_11340 56736 57107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 58695 57286 gene locus_tag LOCUS_11350 gene pabB 58695 57286 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393598.1 protein_id gnl|my_center|LOCUS_11350 59575 58940 gene locus_tag LOCUS_11360 59575 58940 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_11360 59785 60870 gene locus_tag LOCUS_11370 59785 60870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 61059 61757 gene locus_tag LOCUS_11380 61059 61757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 61774 62001 gene locus_tag LOCUS_11390 61774 62001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 62074 63051 gene locus_tag LOCUS_11400 gene cas6 62074 63051 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_11400 63068 64186 gene locus_tag LOCUS_11410 63068 64186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 64226 66835 gene locus_tag LOCUS_11420 gene cas10 64226 66835 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545463.1 protein_id gnl|my_center|LOCUS_11420 66840 67229 gene locus_tag LOCUS_11430 gene csm2 66840 67229 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546668.1 protein_id gnl|my_center|LOCUS_11430 67249 67959 gene locus_tag LOCUS_11440 gene csm3 67249 67959 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545508.1 protein_id gnl|my_center|LOCUS_11440 67975 69033 gene locus_tag LOCUS_11450 67975 69033 CDS product CRISPR-associated protein, Csm4 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546365.1 protein_id gnl|my_center|LOCUS_11450 69026 70474 gene locus_tag LOCUS_11460 69026 70474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 70585 70977 gene locus_tag LOCUS_11470 gene csx20 70585 70977 CDS product CRISPR-associated protein Csx20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871197.1 protein_id gnl|my_center|LOCUS_11470 70981 72276 gene locus_tag LOCUS_11480 70981 72276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 72610 72921 gene locus_tag LOCUS_11490 gene rplU 72610 72921 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392094.1 protein_id gnl|my_center|LOCUS_11490 73060 73317 gene locus_tag LOCUS_11500 gene rpmA 73060 73317 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938227.1 protein_id gnl|my_center|LOCUS_11500 73329 74357 gene locus_tag LOCUS_11510 gene cgtA 73329 74357 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957543.1 protein_id gnl|my_center|LOCUS_11510 74341 75498 gene locus_tag LOCUS_11520 gene proB 74341 75498 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_11520 75676 76932 gene locus_tag LOCUS_11530 75676 76932 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 protein_id gnl|my_center|LOCUS_11530 76942 77580 gene locus_tag LOCUS_11540 gene nadD 76942 77580 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943828.1 protein_id gnl|my_center|LOCUS_11540 77656 77976 gene locus_tag LOCUS_11550 77656 77976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 78006 79424 gene locus_tag LOCUS_11560 78006 79424 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938869.1 protein_id gnl|my_center|LOCUS_11560 79456 79815 gene locus_tag LOCUS_11570 79456 79815 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256377.1 protein_id gnl|my_center|LOCUS_11570 80018 80815 gene locus_tag LOCUS_11580 80018 80815 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943179.1 protein_id gnl|my_center|LOCUS_11580 80924 82180 gene locus_tag LOCUS_11590 80924 82180 CDS product putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009982187.1 protein_id gnl|my_center|LOCUS_11590 82317 82135 gene locus_tag LOCUS_11600 82317 82135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 82985 82422 gene locus_tag LOCUS_11610 82985 82422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 83103 83324 gene locus_tag LOCUS_11620 83103 83324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 84144 83623 gene locus_tag LOCUS_11630 gene tpx 84144 83623 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938524.1 protein_id gnl|my_center|LOCUS_11630 85001 84438 gene locus_tag LOCUS_11640 85001 84438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 86554 85565 gene locus_tag LOCUS_11650 86554 85565 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 protein_id gnl|my_center|LOCUS_11650 88466 86571 gene locus_tag LOCUS_11660 88466 86571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 90315 88522 gene locus_tag LOCUS_11670 90315 88522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 92048 90312 gene locus_tag LOCUS_11680 92048 90312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 92739 92116 gene locus_tag LOCUS_11690 92739 92116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 93726 92776 gene locus_tag LOCUS_11700 93726 92776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 95678 93786 gene locus_tag LOCUS_11710 95678 93786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 96860 95727 gene locus_tag LOCUS_11720 96860 95727 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 protein_id gnl|my_center|LOCUS_11720 97159 97866 gene locus_tag LOCUS_11730 gene tsaB 97159 97866 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403908.1 protein_id gnl|my_center|LOCUS_11730 97863 98759 gene locus_tag LOCUS_11740 97863 98759 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869388.1 protein_id gnl|my_center|LOCUS_11740 98760 99803 gene locus_tag LOCUS_11750 98760 99803 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080270.1 protein_id gnl|my_center|LOCUS_11750 99917 100639 gene locus_tag LOCUS_11760 99917 100639 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_11760 100632 101333 gene locus_tag LOCUS_11770 100632 101333 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_11770 101613 102242 gene locus_tag LOCUS_11780 101613 102242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 102405 102788 gene locus_tag LOCUS_11790 102405 102788 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081556.1 protein_id gnl|my_center|LOCUS_11790 102836 104074 gene locus_tag LOCUS_11800 gene glgC 102836 104074 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329623.1 protein_id gnl|my_center|LOCUS_11800 104074 104775 gene locus_tag LOCUS_11810 gene cobC 104074 104775 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914029.1 protein_id gnl|my_center|LOCUS_11810 104930 105295 gene locus_tag LOCUS_11820 104930 105295 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937572.1 protein_id gnl|my_center|LOCUS_11820 105393 106055 gene locus_tag LOCUS_11830 105393 106055 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053541.1 protein_id gnl|my_center|LOCUS_11830 106416 107078 gene locus_tag LOCUS_11840 106416 107078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 107258 108067 gene locus_tag LOCUS_11850 107258 108067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 109224 108127 gene locus_tag LOCUS_11860 109224 108127 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290820.1 protein_id gnl|my_center|LOCUS_11860 110745 109573 gene locus_tag LOCUS_11870 110745 109573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 111703 111002 gene locus_tag LOCUS_11880 111703 111002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937444.1 protein_id gnl|my_center|LOCUS_11880 112999 111707 gene locus_tag LOCUS_11890 112999 111707 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793113.1 protein_id gnl|my_center|LOCUS_11890 114232 113387 gene locus_tag LOCUS_11900 114232 113387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 114739 114239 gene locus_tag LOCUS_11910 114739 114239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 115421 114840 gene locus_tag LOCUS_11920 115421 114840 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289775.1 protein_id gnl|my_center|LOCUS_11920 116270 115443 gene locus_tag LOCUS_11930 116270 115443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 116545 116351 gene locus_tag LOCUS_11940 116545 116351 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869521.1 protein_id gnl|my_center|LOCUS_11940 117971 117432 gene locus_tag LOCUS_11950 117971 117432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 119107 117968 gene locus_tag LOCUS_11960 119107 117968 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124950.1 protein_id gnl|my_center|LOCUS_11960 119816 119184 gene locus_tag LOCUS_11970 119816 119184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 121008 120562 gene locus_tag LOCUS_11980 121008 120562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 121467 121096 gene locus_tag LOCUS_11990 gene queD 121467 121096 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_11990 121685 121473 gene locus_tag LOCUS_12000 121685 121473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 121929 121678 gene locus_tag LOCUS_12010 121929 121678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 122747 122115 gene locus_tag LOCUS_12020 122747 122115 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_12020 123378 122776 gene locus_tag LOCUS_12030 123378 122776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 123552 125396 gene locus_tag LOCUS_12040 123552 125396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 125407 127686 gene locus_tag LOCUS_12050 125407 127686 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_12050 128021 129421 gene locus_tag LOCUS_12060 128021 129421 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_12060 129363 130163 gene locus_tag LOCUS_12070 129363 130163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 130138 131520 gene locus_tag LOCUS_12080 130138 131520 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_12080 131524 132423 gene locus_tag LOCUS_12090 gene speB 131524 132423 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_12090 132434 133537 gene locus_tag LOCUS_12100 132434 133537 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926062.1 protein_id gnl|my_center|LOCUS_12100 133840 134349 gene locus_tag LOCUS_12110 133840 134349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 136311 134482 gene locus_tag LOCUS_12120 gene glmS 136311 134482 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_12120 137696 136323 gene locus_tag LOCUS_12130 gene glmU 137696 136323 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071041.1 protein_id gnl|my_center|LOCUS_12130 138032 138742 gene locus_tag LOCUS_12140 138032 138742 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526170.1 protein_id gnl|my_center|LOCUS_12140 138735 139331 gene locus_tag LOCUS_12150 138735 139331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 139416 141932 gene locus_tag LOCUS_12160 139416 141932 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257049.1 protein_id gnl|my_center|LOCUS_12160 141940 142587 gene locus_tag LOCUS_12170 141940 142587 CDS product DUF3786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768312.1 protein_id gnl|my_center|LOCUS_12170 143818 142853 gene locus_tag LOCUS_12180 gene meaB 143818 142853 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942224.1 protein_id gnl|my_center|LOCUS_12180 >Feature sequence07 1018 257 gene locus_tag LOCUS_12190 1018 257 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928847.1 protein_id gnl|my_center|LOCUS_12190 2016 1099 gene locus_tag LOCUS_12200 gene cobM 2016 1099 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871103.1 protein_id gnl|my_center|LOCUS_12200 2613 2155 gene locus_tag LOCUS_12210 2613 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 4257 2797 gene locus_tag LOCUS_12220 4257 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 5337 4465 gene locus_tag LOCUS_12230 gene cobA 5337 4465 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232095.1 protein_id gnl|my_center|LOCUS_12230 6985 5438 gene locus_tag LOCUS_12240 6985 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 7586 6945 gene locus_tag LOCUS_12250 7586 6945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 8452 8243 gene locus_tag LOCUS_12260 8452 8243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 8821 8477 gene locus_tag LOCUS_12270 8821 8477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12270 9498 9127 gene locus_tag LOCUS_12280 9498 9127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 9841 9644 gene locus_tag LOCUS_12290 9841 9644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 10509 10039 gene locus_tag LOCUS_12300 10509 10039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12300 11124 10621 gene locus_tag LOCUS_12310 11124 10621 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289467.1 protein_id gnl|my_center|LOCUS_12310 11921 11124 gene locus_tag LOCUS_12320 11921 11124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 12861 11923 gene locus_tag LOCUS_12330 12861 11923 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389853.1 protein_id gnl|my_center|LOCUS_12330 14554 13625 gene locus_tag LOCUS_12340 14554 13625 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_12340 15116 14517 gene locus_tag LOCUS_12350 15116 14517 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937640.1 protein_id gnl|my_center|LOCUS_12350 16423 15194 gene locus_tag LOCUS_12360 16423 15194 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942239.1 protein_id gnl|my_center|LOCUS_12360 18535 16433 gene locus_tag LOCUS_12370 gene pnp 18535 16433 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_12370 18846 18577 gene locus_tag LOCUS_12380 gene rpsO 18846 18577 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_12380 19849 18902 gene locus_tag LOCUS_12390 gene truB 19849 18902 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942236.1 protein_id gnl|my_center|LOCUS_12390 20190 19846 gene locus_tag LOCUS_12400 gene rbfA 20190 19846 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829509.1 protein_id gnl|my_center|LOCUS_12400 20573 20286 gene locus_tag LOCUS_12410 20573 20286 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937813.1 protein_id gnl|my_center|LOCUS_12410 23521 20588 gene locus_tag LOCUS_12420 23521 20588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 24903 23587 gene locus_tag LOCUS_12430 gene nusA 24903 23587 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937816.1 protein_id gnl|my_center|LOCUS_12430 25393 24932 gene locus_tag LOCUS_12440 gene rimP 25393 24932 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942230.1 protein_id gnl|my_center|LOCUS_12440 25667 25592 gene locus_tag LOCUS_t00160 25667 25592 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 26642 25728 gene locus_tag LOCUS_12450 26642 25728 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942133.1 protein_id gnl|my_center|LOCUS_12450 26589 26768 gene locus_tag LOCUS_12460 26589 26768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 26846 26932 gene locus_tag LOCUS_t00170 26846 26932 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 27307 28026 gene locus_tag LOCUS_12470 27307 28026 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932386.1 protein_id gnl|my_center|LOCUS_12470 28108 29133 gene locus_tag LOCUS_12480 28108 29133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 29334 29140 gene locus_tag LOCUS_12490 29334 29140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 29281 29490 gene locus_tag LOCUS_12500 29281 29490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12500 30377 29574 gene locus_tag LOCUS_12510 30377 29574 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056764.1 protein_id gnl|my_center|LOCUS_12510 31450 30515 gene locus_tag LOCUS_12520 31450 30515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 32616 31447 gene locus_tag LOCUS_12530 32616 31447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088279.1 protein_id gnl|my_center|LOCUS_12530 32823 33953 gene locus_tag LOCUS_12540 32823 33953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 34843 34322 gene locus_tag LOCUS_12550 34843 34322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 35837 36019 gene locus_tag LOCUS_12560 35837 36019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 36076 36459 gene locus_tag LOCUS_12570 36076 36459 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871037.1 protein_id gnl|my_center|LOCUS_12570 36612 36917 gene locus_tag LOCUS_12580 36612 36917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12580 36947 37291 gene locus_tag LOCUS_12590 36947 37291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 39987 37315 gene locus_tag LOCUS_12600 39987 37315 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141077.1 protein_id gnl|my_center|LOCUS_12600 40497 40120 gene locus_tag LOCUS_12610 40497 40120 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941813.1 protein_id gnl|my_center|LOCUS_12610 41462 40590 gene locus_tag LOCUS_12620 gene hpnK 41462 40590 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941812.1 protein_id gnl|my_center|LOCUS_12620 42546 41467 gene locus_tag LOCUS_12630 gene nirJ2 42546 41467 CDS product putative heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392759.1 protein_id gnl|my_center|LOCUS_12630 44045 42615 gene locus_tag LOCUS_12640 gene hpnJ 44045 42615 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941811.1 protein_id gnl|my_center|LOCUS_12640 45660 44161 gene locus_tag LOCUS_12650 45660 44161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 46038 45664 gene locus_tag LOCUS_12660 46038 45664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 46637 46038 gene locus_tag LOCUS_12670 46637 46038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 46831 47679 gene locus_tag LOCUS_12680 46831 47679 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_12680 47776 47952 gene locus_tag LOCUS_12690 47776 47952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 48168 47878 gene locus_tag LOCUS_12700 48168 47878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 50008 48254 gene locus_tag LOCUS_12710 50008 48254 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_12710 51272 50067 gene locus_tag LOCUS_12720 gene ftsZ 51272 50067 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939769.1 protein_id gnl|my_center|LOCUS_12720 52621 51392 gene locus_tag LOCUS_12730 gene ftsA 52621 51392 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_12730 53555 52632 gene locus_tag LOCUS_12740 53555 52632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 54991 53558 gene locus_tag LOCUS_12750 gene murC 54991 53558 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_12750 56225 55116 gene locus_tag LOCUS_12760 gene murG 56225 55116 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_12760 57391 56246 gene locus_tag LOCUS_12770 gene ftsW 57391 56246 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_12770 58739 57357 gene locus_tag LOCUS_12780 gene murD 58739 57357 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_12780 59831 58752 gene locus_tag LOCUS_12790 gene mraY 59831 58752 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_12790 61290 59899 gene locus_tag LOCUS_12800 61290 59899 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_12800 62891 61287 gene locus_tag LOCUS_12810 62891 61287 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_12810 65207 63129 gene locus_tag LOCUS_12820 65207 63129 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_12820 65572 65213 gene locus_tag LOCUS_12830 65572 65213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 66581 65661 gene locus_tag LOCUS_12840 gene rsmH 66581 65661 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_12840 67033 66599 gene locus_tag LOCUS_12850 gene mraZ 67033 66599 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625480.1 protein_id gnl|my_center|LOCUS_12850 67742 69232 gene locus_tag LOCUS_12860 67742 69232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 69210 70640 gene locus_tag LOCUS_12870 69210 70640 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_12870 70857 71252 gene locus_tag LOCUS_12880 70857 71252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 72314 71307 gene locus_tag LOCUS_12890 72314 71307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 72585 72394 gene locus_tag LOCUS_12900 72585 72394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 73300 72815 gene locus_tag LOCUS_12910 73300 72815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 73539 74900 gene locus_tag LOCUS_12920 73539 74900 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526169.1 protein_id gnl|my_center|LOCUS_12920 74998 75648 gene locus_tag LOCUS_12930 74998 75648 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_12930 75749 76372 gene locus_tag LOCUS_12940 75749 76372 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267085.1 protein_id gnl|my_center|LOCUS_12940 76880 77392 gene locus_tag LOCUS_12950 76880 77392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 77420 78592 gene locus_tag LOCUS_12960 gene nifS 77420 78592 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_12960 78957 80546 gene locus_tag LOCUS_12970 78957 80546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 81944 80679 gene locus_tag LOCUS_12980 81944 80679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 82655 81966 gene locus_tag LOCUS_12990 82655 81966 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027567.1 protein_id gnl|my_center|LOCUS_12990 83094 84092 gene locus_tag LOCUS_13000 83094 84092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 84654 84998 gene locus_tag LOCUS_13010 84654 84998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 85048 85323 gene locus_tag LOCUS_13020 85048 85323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 85320 85577 gene locus_tag LOCUS_13030 85320 85577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 85496 85687 gene locus_tag LOCUS_13040 85496 85687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 85696 85917 gene locus_tag LOCUS_13050 85696 85917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 85953 88592 gene locus_tag LOCUS_13060 gene polA 85953 88592 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_13060 88745 89035 gene locus_tag LOCUS_13070 88745 89035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 89118 89474 gene locus_tag LOCUS_13080 89118 89474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 89702 90256 gene locus_tag LOCUS_13090 89702 90256 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_13090 90293 90475 gene locus_tag LOCUS_13100 gene rpmF 90293 90475 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_13100 90487 91647 gene locus_tag LOCUS_13110 90487 91647 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_13110 91865 92653 gene locus_tag LOCUS_13120 91865 92653 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_13120 92589 92819 gene locus_tag LOCUS_13130 92589 92819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 93157 94347 gene locus_tag LOCUS_13140 93157 94347 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545166.1 protein_id gnl|my_center|LOCUS_13140 94357 95103 gene locus_tag LOCUS_13150 gene fabG 94357 95103 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_13150 95223 95459 gene locus_tag LOCUS_13160 gene acpP 95223 95459 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942249.1 protein_id gnl|my_center|LOCUS_13160 95555 96796 gene locus_tag LOCUS_13170 gene fabF 95555 96796 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942250.1 protein_id gnl|my_center|LOCUS_13170 96802 97254 gene locus_tag LOCUS_13180 gene rpiB 96802 97254 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_13180 97273 98556 gene locus_tag LOCUS_13190 97273 98556 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_13190 98575 99057 gene locus_tag LOCUS_13200 gene nrdR 98575 99057 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_13200 99198 99638 gene locus_tag LOCUS_13210 99198 99638 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143722.1 protein_id gnl|my_center|LOCUS_13210 100417 99635 gene locus_tag LOCUS_13220 gene rnc 100417 99635 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557292.1 protein_id gnl|my_center|LOCUS_13220 101290 102201 gene locus_tag LOCUS_13230 101290 102201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 102906 102544 gene locus_tag LOCUS_13240 102906 102544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 103701 102961 gene locus_tag LOCUS_13250 103701 102961 CDS product fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940521.1 protein_id gnl|my_center|LOCUS_13250 105534 103714 gene locus_tag LOCUS_13260 105534 103714 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940520.1 protein_id gnl|my_center|LOCUS_13260 106178 105534 gene locus_tag LOCUS_13270 106178 105534 CDS product fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854660.1 protein_id gnl|my_center|LOCUS_13270 107502 106960 gene locus_tag LOCUS_13280 107502 106960 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940509.1 protein_id gnl|my_center|LOCUS_13280 107957 107496 gene locus_tag LOCUS_13290 107957 107496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 108119 107982 gene locus_tag LOCUS_13300 108119 107982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 108798 108604 gene locus_tag LOCUS_13310 108798 108604 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944059.1 protein_id gnl|my_center|LOCUS_13310 109156 108839 gene locus_tag LOCUS_13320 109156 108839 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938537.1 protein_id gnl|my_center|LOCUS_13320 109695 109153 gene locus_tag LOCUS_13330 109695 109153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 109844 109716 gene locus_tag LOCUS_13340 109844 109716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 110164 109970 gene locus_tag LOCUS_13350 110164 109970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 111432 110644 gene locus_tag LOCUS_13360 111432 110644 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545667.1 protein_id gnl|my_center|LOCUS_13360 112820 111678 gene locus_tag LOCUS_13370 gene qmoC 112820 111678 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545389.1 protein_id gnl|my_center|LOCUS_13370 114970 112832 gene locus_tag LOCUS_13380 114970 112832 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545086.1 protein_id gnl|my_center|LOCUS_13380 116230 114974 gene locus_tag LOCUS_13390 116230 114974 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546111.1 protein_id gnl|my_center|LOCUS_13390 116321 116575 gene locus_tag LOCUS_13400 116321 116575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 118518 116554 gene locus_tag LOCUS_13410 gene aprA 118518 116554 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932546.1 protein_id gnl|my_center|LOCUS_13410 118981 118559 gene locus_tag LOCUS_13420 gene aprB 118981 118559 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932545.1 protein_id gnl|my_center|LOCUS_13420 119473 119150 gene locus_tag LOCUS_13430 119473 119150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 120836 119559 gene locus_tag LOCUS_13440 gene sat 120836 119559 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980653.1 protein_id gnl|my_center|LOCUS_13440 121690 123081 gene locus_tag LOCUS_13450 121690 123081 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941147.1 protein_id gnl|my_center|LOCUS_13450 123278 124639 gene locus_tag LOCUS_13460 123278 124639 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_13460 124855 125298 gene locus_tag LOCUS_13470 124855 125298 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583624.1 protein_id gnl|my_center|LOCUS_13470 125973 125362 gene locus_tag LOCUS_13480 125973 125362 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792219.1 protein_id gnl|my_center|LOCUS_13480 126943 125990 gene locus_tag LOCUS_13490 126943 125990 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_13490 127145 127221 gene locus_tag LOCUS_t00180 127145 127221 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 127679 127461 gene locus_tag LOCUS_13500 127679 127461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 130672 127853 gene locus_tag LOCUS_13510 130672 127853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 >Feature sequence08 1246 305 gene locus_tag LOCUS_13520 gene cdhD 1246 305 CDS product CO dehydrogenase/acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392712.1 protein_id gnl|my_center|LOCUS_13520 1550 1717 gene locus_tag LOCUS_13530 1550 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1946 5398 gene locus_tag LOCUS_13540 gene dnaE 1946 5398 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_13540 5616 5395 gene locus_tag LOCUS_13550 5616 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 5885 7186 gene locus_tag LOCUS_13560 5885 7186 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942382.1 protein_id gnl|my_center|LOCUS_13560 7191 7679 gene locus_tag LOCUS_13570 7191 7679 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_13570 7746 8921 gene locus_tag LOCUS_13580 7746 8921 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942379.1 protein_id gnl|my_center|LOCUS_13580 8976 9941 gene locus_tag LOCUS_13590 8976 9941 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942378.1 protein_id gnl|my_center|LOCUS_13590 9941 10897 gene locus_tag LOCUS_13600 9941 10897 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_13600 10905 11681 gene locus_tag LOCUS_13610 10905 11681 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812849.1 protein_id gnl|my_center|LOCUS_13610 11909 12481 gene locus_tag LOCUS_13620 gene pal 11909 12481 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932322.1 protein_id gnl|my_center|LOCUS_13620 12632 13579 gene locus_tag LOCUS_13630 12632 13579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 13601 15490 gene locus_tag LOCUS_13640 13601 15490 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_13640 15555 16274 gene locus_tag LOCUS_13650 15555 16274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 16481 17851 gene locus_tag LOCUS_13660 16481 17851 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939070.1 protein_id gnl|my_center|LOCUS_13660 19048 17909 gene locus_tag LOCUS_13670 19048 17909 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_13670 20370 19111 gene locus_tag LOCUS_13680 20370 19111 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942374.1 protein_id gnl|my_center|LOCUS_13680 21112 20375 gene locus_tag LOCUS_13690 21112 20375 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942375.1 protein_id gnl|my_center|LOCUS_13690 22836 21529 gene locus_tag LOCUS_13700 gene tolB 22836 21529 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_13700 24080 22851 gene locus_tag LOCUS_13710 24080 22851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 24508 24089 gene locus_tag LOCUS_13720 gene tolR 24508 24089 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_13720 25303 24512 gene locus_tag LOCUS_13730 gene tolQ 25303 24512 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_13730 26252 25368 gene locus_tag LOCUS_13740 gene metF 26252 25368 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_13740 26586 26996 gene locus_tag LOCUS_13750 26586 26996 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546098.1 protein_id gnl|my_center|LOCUS_13750 27019 27498 gene locus_tag LOCUS_13760 gene rlmH 27019 27498 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202796170.1 protein_id gnl|my_center|LOCUS_13760 29051 27531 gene locus_tag LOCUS_13770 29051 27531 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392612.1 protein_id gnl|my_center|LOCUS_13770 30208 29489 gene locus_tag LOCUS_13780 gene cobJ 30208 29489 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940428.1 protein_id gnl|my_center|LOCUS_13780 31317 30253 gene locus_tag LOCUS_13790 31317 30253 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392607.1 protein_id gnl|my_center|LOCUS_13790 32093 31314 gene locus_tag LOCUS_13800 gene cobM 32093 31314 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392606.1 protein_id gnl|my_center|LOCUS_13800 33310 32036 gene locus_tag LOCUS_13810 33310 32036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 34101 33316 gene locus_tag LOCUS_13820 34101 33316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13820 34192 34491 gene locus_tag LOCUS_13830 34192 34491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 35236 34514 gene locus_tag LOCUS_13840 gene cobI 35236 34514 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937949.1 protein_id gnl|my_center|LOCUS_13840 35865 35233 gene locus_tag LOCUS_13850 35865 35233 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943629.1 protein_id gnl|my_center|LOCUS_13850 37247 35862 gene locus_tag LOCUS_13860 37247 35862 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943636.1 protein_id gnl|my_center|LOCUS_13860 37729 37932 gene locus_tag LOCUS_13870 37729 37932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 38094 38169 gene locus_tag LOCUS_t00190 38094 38169 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 38580 38401 gene locus_tag LOCUS_13880 38580 38401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 39799 39161 gene locus_tag LOCUS_13890 39799 39161 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360256.1 protein_id gnl|my_center|LOCUS_13890 39951 40163 gene locus_tag LOCUS_13900 39951 40163 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_13900 40172 41209 gene locus_tag LOCUS_13910 gene rtcA 40172 41209 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762505.1 protein_id gnl|my_center|LOCUS_13910 44036 41244 gene locus_tag LOCUS_13920 44036 41244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 44508 45485 gene locus_tag LOCUS_13930 44508 45485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 45528 46865 gene locus_tag LOCUS_13940 gene fabF 45528 46865 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_13940 46879 47811 gene locus_tag LOCUS_13950 46879 47811 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479748.1 protein_id gnl|my_center|LOCUS_13950 49594 48362 gene locus_tag LOCUS_13960 49594 48362 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938840.1 protein_id gnl|my_center|LOCUS_13960 50101 51084 gene locus_tag LOCUS_13970 50101 51084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 52687 52268 gene locus_tag LOCUS_13980 52687 52268 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909403.1 protein_id gnl|my_center|LOCUS_13980 52885 55947 gene locus_tag LOCUS_13990 52885 55947 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942076.1 protein_id gnl|my_center|LOCUS_13990 56150 58021 gene locus_tag LOCUS_14000 56150 58021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 58064 59329 gene locus_tag LOCUS_14010 58064 59329 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_14010 59668 62121 gene locus_tag LOCUS_14020 59668 62121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 62492 62716 gene locus_tag LOCUS_14030 62492 62716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 62719 63147 gene locus_tag LOCUS_14040 62719 63147 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941003.1 protein_id gnl|my_center|LOCUS_14040 63165 63842 gene locus_tag LOCUS_14050 63165 63842 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_14050 63896 64267 gene locus_tag LOCUS_14060 63896 64267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 64376 65011 gene locus_tag LOCUS_14070 64376 65011 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938215.1 protein_id gnl|my_center|LOCUS_14070 67821 65008 gene locus_tag LOCUS_14080 gene uvrA 67821 65008 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_14080 69206 67953 gene locus_tag LOCUS_14090 69206 67953 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943295.1 protein_id gnl|my_center|LOCUS_14090 70085 69288 gene locus_tag LOCUS_14100 70085 69288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 71530 70130 gene locus_tag LOCUS_14110 71530 70130 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_14110 72395 72703 gene locus_tag LOCUS_14120 72395 72703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 73711 72854 gene locus_tag LOCUS_14130 73711 72854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 74710 74361 gene locus_tag LOCUS_tm00010 74710 74361 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 76494 74731 gene locus_tag LOCUS_14140 gene recN 76494 74731 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_14140 76878 76633 gene locus_tag LOCUS_14150 76878 76633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 79102 76913 gene locus_tag LOCUS_14160 79102 76913 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943959.1 protein_id gnl|my_center|LOCUS_14160 79667 79218 gene locus_tag LOCUS_14170 79667 79218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 80512 79688 gene locus_tag LOCUS_14180 80512 79688 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946112.1 protein_id gnl|my_center|LOCUS_14180 81814 80696 gene locus_tag LOCUS_14190 81814 80696 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_14190 82911 81811 gene locus_tag LOCUS_14200 82911 81811 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121265.1 protein_id gnl|my_center|LOCUS_14200 83938 83081 gene locus_tag LOCUS_14210 gene rsmA 83938 83081 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651548.1 protein_id gnl|my_center|LOCUS_14210 84392 83883 gene locus_tag LOCUS_14220 84392 83883 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939086.1 protein_id gnl|my_center|LOCUS_14220 85065 84466 gene locus_tag LOCUS_14230 85065 84466 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171802.1 protein_id gnl|my_center|LOCUS_14230 85699 85226 gene locus_tag LOCUS_14240 85699 85226 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279207.1 protein_id gnl|my_center|LOCUS_14240 87474 85912 gene locus_tag LOCUS_14250 87474 85912 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922119.1 protein_id gnl|my_center|LOCUS_14250 87884 87471 gene locus_tag LOCUS_14260 87884 87471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 88864 87881 gene locus_tag LOCUS_14270 88864 87881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 89898 88993 gene locus_tag LOCUS_14280 89898 88993 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404256.1 protein_id gnl|my_center|LOCUS_14280 90977 89895 gene locus_tag LOCUS_14290 90977 89895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 91354 90977 gene locus_tag LOCUS_14300 91354 90977 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404257.1 protein_id gnl|my_center|LOCUS_14300 91653 91384 gene locus_tag LOCUS_14310 91653 91384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 91980 92744 gene locus_tag LOCUS_14320 91980 92744 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938290.1 protein_id gnl|my_center|LOCUS_14320 92848 94560 gene locus_tag LOCUS_14330 92848 94560 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_14330 94573 96729 gene locus_tag LOCUS_14340 94573 96729 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_14340 96931 96719 gene locus_tag LOCUS_14350 96931 96719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 97305 97114 gene locus_tag LOCUS_14360 gene rpmB 97305 97114 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_14360 98352 97660 gene locus_tag LOCUS_14370 98352 97660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 98474 98995 gene locus_tag LOCUS_14380 gene hpt 98474 98995 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_14380 99004 99216 gene locus_tag LOCUS_14390 99004 99216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 100249 99368 gene locus_tag LOCUS_14400 100249 99368 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942022.1 protein_id gnl|my_center|LOCUS_14400 100502 100789 gene locus_tag LOCUS_14410 100502 100789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 102021 101945 gene locus_tag LOCUS_t00200 102021 101945 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 102120 102045 gene locus_tag LOCUS_t00210 102120 102045 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 104674 102206 gene locus_tag LOCUS_14420 gene lon 104674 102206 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942434.1 protein_id gnl|my_center|LOCUS_14420 105953 104700 gene locus_tag LOCUS_14430 gene clpX 105953 104700 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_14430 106809 106171 gene locus_tag LOCUS_14440 gene clpP 106809 106171 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_14440 108137 106806 gene locus_tag LOCUS_14450 gene tig 108137 106806 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938629.1 protein_id gnl|my_center|LOCUS_14450 108287 108204 gene locus_tag LOCUS_t00220 108287 108204 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 108825 109928 gene locus_tag LOCUS_14460 gene fbp 108825 109928 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393749.1 protein_id gnl|my_center|LOCUS_14460 110395 112257 gene locus_tag LOCUS_14470 110395 112257 CDS product RiPP maturation radical SAM C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084777.1 protein_id gnl|my_center|LOCUS_14470 112339 113367 gene locus_tag LOCUS_14480 112339 113367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 113513 114985 gene locus_tag LOCUS_14490 113513 114985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 116782 115190 gene locus_tag LOCUS_14500 116782 115190 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382881.1 protein_id gnl|my_center|LOCUS_14500 117362 120418 gene locus_tag LOCUS_14510 gene fdnG 117362 120418 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941441.1 transl_except (pos:117926..117928,aa:Sec) note codon on position 189 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_14510 120431 121252 gene locus_tag LOCUS_14520 120431 121252 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941442.1 protein_id gnl|my_center|LOCUS_14520 121256 122419 gene locus_tag LOCUS_14530 gene hybB 121256 122419 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941443.1 protein_id gnl|my_center|LOCUS_14530 122400 123215 gene locus_tag LOCUS_14540 122400 123215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 123431 123811 gene locus_tag LOCUS_14550 123431 123811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 123832 124065 gene locus_tag LOCUS_14560 123832 124065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 124804 126012 gene locus_tag LOCUS_14570 124804 126012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 126165 127124 gene locus_tag LOCUS_14580 126165 127124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 127874 127137 gene locus_tag LOCUS_14590 127874 127137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 129736 128237 gene locus_tag LOCUS_14600 gene rmuC 129736 128237 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence09 451 1122 gene locus_tag LOCUS_14610 gene phoU 451 1122 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_14610 2496 1114 gene locus_tag LOCUS_14620 gene dnaA 2496 1114 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582428.1 protein_id gnl|my_center|LOCUS_14620 3818 4090 gene locus_tag LOCUS_14630 3818 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 6511 4286 gene locus_tag LOCUS_14640 6511 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 6856 6530 gene locus_tag LOCUS_14650 6856 6530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 7975 7091 gene locus_tag LOCUS_14660 7975 7091 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267274.1 protein_id gnl|my_center|LOCUS_14660 8243 9790 gene locus_tag LOCUS_14670 8243 9790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 10115 9768 gene locus_tag LOCUS_14680 10115 9768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 10726 11931 gene locus_tag LOCUS_14690 gene hybO 10726 11931 CDS product hydrogenase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173957.1 protein_id gnl|my_center|LOCUS_14690 11934 12899 gene locus_tag LOCUS_14700 gene hybA 11934 12899 CDS product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706349.1 protein_id gnl|my_center|LOCUS_14700 12915 14063 gene locus_tag LOCUS_14710 gene hybB 12915 14063 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941449.1 protein_id gnl|my_center|LOCUS_14710 14170 15870 gene locus_tag LOCUS_14720 gene hybC 14170 15870 CDS product hydrogenase 2 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817177.1 protein_id gnl|my_center|LOCUS_14720 16649 18688 gene locus_tag LOCUS_14730 gene fusA 16649 18688 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545225.1 protein_id gnl|my_center|LOCUS_14730 18942 19361 gene locus_tag LOCUS_14740 gene ndk 18942 19361 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958107.1 protein_id gnl|my_center|LOCUS_14740 19473 20483 gene locus_tag LOCUS_14750 gene thiL 19473 20483 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_14750 20789 20598 gene locus_tag LOCUS_14760 20789 20598 CDS product CooT family nickel-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545767.1 protein_id gnl|my_center|LOCUS_14760 21201 20782 gene locus_tag LOCUS_14770 21201 20782 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545623.1 protein_id gnl|my_center|LOCUS_14770 21896 22339 gene locus_tag LOCUS_14780 21896 22339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 24251 22353 gene locus_tag LOCUS_14790 gene mnmG 24251 22353 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546402.1 protein_id gnl|my_center|LOCUS_14790 24848 24432 gene locus_tag LOCUS_14800 24848 24432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 25471 24974 gene locus_tag LOCUS_14810 25471 24974 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193779.1 protein_id gnl|my_center|LOCUS_14810 25449 25601 gene locus_tag LOCUS_14820 25449 25601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 26780 25716 gene locus_tag LOCUS_14830 26780 25716 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163555.1 protein_id gnl|my_center|LOCUS_14830 26904 27278 gene locus_tag LOCUS_14840 26904 27278 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192320.1 protein_id gnl|my_center|LOCUS_14840 28096 27275 gene locus_tag LOCUS_14850 28096 27275 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_14850 28865 28089 gene locus_tag LOCUS_14860 28865 28089 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876244.1 protein_id gnl|my_center|LOCUS_14860 29825 28872 gene locus_tag LOCUS_14870 29825 28872 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392447.1 protein_id gnl|my_center|LOCUS_14870 30285 29854 gene locus_tag LOCUS_14880 30285 29854 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938241.1 protein_id gnl|my_center|LOCUS_14880 31893 30538 gene locus_tag LOCUS_14890 31893 30538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 32186 32836 gene locus_tag LOCUS_14900 32186 32836 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_14900 33128 33442 gene locus_tag LOCUS_14910 33128 33442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 35631 33535 gene locus_tag LOCUS_14920 35631 33535 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_14920 36908 35907 gene locus_tag LOCUS_14930 36908 35907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 37832 37017 gene locus_tag LOCUS_14940 gene mlaE 37832 37017 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707619.1 protein_id gnl|my_center|LOCUS_14940 39398 37836 gene locus_tag LOCUS_14950 39398 37836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 40713 39382 gene locus_tag LOCUS_14960 40713 39382 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226191.1 protein_id gnl|my_center|LOCUS_14960 42089 40719 gene locus_tag LOCUS_14970 42089 40719 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055995.1 protein_id gnl|my_center|LOCUS_14970 43289 42270 gene locus_tag LOCUS_14980 43289 42270 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057430.1 protein_id gnl|my_center|LOCUS_14980 44386 43289 gene locus_tag LOCUS_14990 44386 43289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 45585 44377 gene locus_tag LOCUS_15000 45585 44377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 46921 45950 gene locus_tag LOCUS_15010 46921 45950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 47489 47013 gene locus_tag LOCUS_15020 47489 47013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 47627 47551 gene locus_tag LOCUS_t00230 47627 47551 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 48095 47862 gene locus_tag LOCUS_15030 48095 47862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 48088 50157 gene locus_tag LOCUS_15040 48088 50157 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943902.1 protein_id gnl|my_center|LOCUS_15040 50329 51975 gene locus_tag LOCUS_15050 50329 51975 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869035.1 protein_id gnl|my_center|LOCUS_15050 52053 53147 gene locus_tag LOCUS_15060 52053 53147 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546094.1 protein_id gnl|my_center|LOCUS_15060 55901 53214 gene locus_tag LOCUS_15070 55901 53214 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090068.1 protein_id gnl|my_center|LOCUS_15070 57753 56107 gene locus_tag LOCUS_15080 57753 56107 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_15080 60212 58323 gene locus_tag LOCUS_15090 60212 58323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 63855 61006 gene locus_tag LOCUS_15100 gene treY 63855 61006 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393311.1 protein_id gnl|my_center|LOCUS_15100 65240 63876 gene locus_tag LOCUS_15110 65240 63876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15110 66309 65170 gene locus_tag LOCUS_15120 66309 65170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15120 68147 66303 gene locus_tag LOCUS_15130 gene treZ 68147 66303 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393309.1 protein_id gnl|my_center|LOCUS_15130 69872 68574 gene locus_tag LOCUS_15140 69872 68574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 72150 69898 gene locus_tag LOCUS_15150 gene malQ 72150 69898 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818803.1 protein_id gnl|my_center|LOCUS_15150 73810 72563 gene locus_tag LOCUS_15160 73810 72563 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764944.1 protein_id gnl|my_center|LOCUS_15160 74040 74666 gene locus_tag LOCUS_15170 gene plsY 74040 74666 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056950.1 protein_id gnl|my_center|LOCUS_15170 74866 75534 gene locus_tag LOCUS_15180 74866 75534 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940040.1 protein_id gnl|my_center|LOCUS_15180 75593 76516 gene locus_tag LOCUS_15190 75593 76516 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462061.1 protein_id gnl|my_center|LOCUS_15190 76491 76733 gene locus_tag LOCUS_15200 76491 76733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 76965 81014 gene locus_tag LOCUS_15210 76965 81014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 81358 82428 gene locus_tag LOCUS_15220 81358 82428 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_15220 82583 83392 gene locus_tag LOCUS_15230 82583 83392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 83578 84645 gene locus_tag LOCUS_15240 83578 84645 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393804.1 protein_id gnl|my_center|LOCUS_15240 84660 87890 gene locus_tag LOCUS_15250 84660 87890 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_15250 87964 88161 gene locus_tag LOCUS_15260 87964 88161 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944059.1 protein_id gnl|my_center|LOCUS_15260 88298 88549 gene locus_tag LOCUS_15270 88298 88549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 88600 89484 gene locus_tag LOCUS_15280 88600 89484 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942258.1 protein_id gnl|my_center|LOCUS_15280 89700 89554 gene locus_tag LOCUS_15290 89700 89554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 90062 89700 gene locus_tag LOCUS_15300 90062 89700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 90278 92209 gene locus_tag LOCUS_15310 90278 92209 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943084.1 protein_id gnl|my_center|LOCUS_15310 93291 92272 gene locus_tag LOCUS_15320 93291 92272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 93593 94513 gene locus_tag LOCUS_15330 gene murB 93593 94513 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142314.1 protein_id gnl|my_center|LOCUS_15330 94595 95170 gene locus_tag LOCUS_15340 94595 95170 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877617.1 protein_id gnl|my_center|LOCUS_15340 95258 96331 gene locus_tag LOCUS_15350 gene mtnA 95258 96331 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_15350 96324 97250 gene locus_tag LOCUS_15360 96324 97250 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545473.1 protein_id gnl|my_center|LOCUS_15360 98324 97380 gene locus_tag LOCUS_15370 gene fabD 98324 97380 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793967.1 protein_id gnl|my_center|LOCUS_15370 98634 99059 gene locus_tag LOCUS_15380 98634 99059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 100620 99088 gene locus_tag LOCUS_15390 gene hflX 100620 99088 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941674.1 protein_id gnl|my_center|LOCUS_15390 101033 102817 gene locus_tag LOCUS_15400 101033 102817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 102858 104129 gene locus_tag LOCUS_15410 gene ahbC 102858 104129 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022974.1 protein_id gnl|my_center|LOCUS_15410 104264 104521 gene locus_tag LOCUS_15420 104264 104521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 104597 104815 gene locus_tag LOCUS_15430 104597 104815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 105158 105286 gene locus_tag LOCUS_15440 105158 105286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 105372 106838 gene locus_tag LOCUS_15450 gene cbpB 105372 106838 CDS product peptide-modifying radical SAM enzyme CbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879693.1 protein_id gnl|my_center|LOCUS_15450 107413 106925 gene locus_tag LOCUS_15460 gene bcp 107413 106925 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704834.1 protein_id gnl|my_center|LOCUS_15460 107736 108293 gene locus_tag LOCUS_15470 107736 108293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 108443 108297 gene locus_tag LOCUS_15480 108443 108297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 109146 108409 gene locus_tag LOCUS_15490 gene pgl 109146 108409 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_15490 109761 109312 gene locus_tag LOCUS_15500 gene rplI 109761 109312 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_15500 110767 109814 gene locus_tag LOCUS_15510 110767 109814 CDS product YybS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941328.1 protein_id gnl|my_center|LOCUS_15510 111057 110800 gene locus_tag LOCUS_15520 111057 110800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 111510 111061 gene locus_tag LOCUS_15530 111510 111061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 111876 112619 gene locus_tag LOCUS_15540 111876 112619 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393069.1 protein_id gnl|my_center|LOCUS_15540 112832 114145 gene locus_tag LOCUS_15550 112832 114145 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_15550 114145 115626 gene locus_tag LOCUS_15560 114145 115626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 115636 115779 gene locus_tag LOCUS_15570 115636 115779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 115831 118971 gene locus_tag LOCUS_15580 115831 118971 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_15580 119139 119615 gene locus_tag LOCUS_15590 119139 119615 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842874.1 protein_id gnl|my_center|LOCUS_15590 121225 119930 gene locus_tag LOCUS_15600 121225 119930 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942374.1 protein_id gnl|my_center|LOCUS_15600 121991 121218 gene locus_tag LOCUS_15610 121991 121218 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525179.1 protein_id gnl|my_center|LOCUS_15610 122822 122094 gene locus_tag LOCUS_15620 122822 122094 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942375.1 protein_id gnl|my_center|LOCUS_15620 123726 122836 gene locus_tag LOCUS_15630 123726 122836 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948215.1 protein_id gnl|my_center|LOCUS_15630 124593 123730 gene locus_tag LOCUS_15640 124593 123730 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944005.1 protein_id gnl|my_center|LOCUS_15640 125230 124718 gene locus_tag LOCUS_15650 125230 124718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 125745 125257 gene locus_tag LOCUS_15660 125745 125257 CDS product DUF3124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139455833.1 protein_id gnl|my_center|LOCUS_15660 127209 125800 gene locus_tag LOCUS_15670 127209 125800 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326127.1 protein_id gnl|my_center|LOCUS_15670 127399 127788 gene locus_tag LOCUS_15680 127399 127788 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061381.1 protein_id gnl|my_center|LOCUS_15680 127893 127967 gene locus_tag LOCUS_t00240 127893 127967 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence10 153 662 gene locus_tag LOCUS_15690 153 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 830 2266 gene locus_tag LOCUS_15700 830 2266 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546372.1 protein_id gnl|my_center|LOCUS_15700 2263 3954 gene locus_tag LOCUS_15710 gene oadA 2263 3954 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105555.1 protein_id gnl|my_center|LOCUS_15710 3994 4836 gene locus_tag LOCUS_15720 gene amrB 3994 4836 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762851.1 protein_id gnl|my_center|LOCUS_15720 5441 6262 gene locus_tag LOCUS_15730 5441 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 6512 7831 gene locus_tag LOCUS_15740 6512 7831 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678843.1 protein_id gnl|my_center|LOCUS_15740 7818 8579 gene locus_tag LOCUS_15750 7818 8579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 8906 9214 gene locus_tag LOCUS_15760 8906 9214 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941530.1 protein_id gnl|my_center|LOCUS_15760 9223 9687 gene locus_tag LOCUS_15770 9223 9687 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941529.1 protein_id gnl|my_center|LOCUS_15770 9697 9999 gene locus_tag LOCUS_15780 9697 9999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 10254 11366 gene locus_tag LOCUS_15790 gene dnaJ 10254 11366 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_15790 13404 11413 gene locus_tag LOCUS_15800 gene uvrB 13404 11413 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_15800 13892 14080 gene locus_tag LOCUS_15810 13892 14080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 15327 14290 gene locus_tag LOCUS_15820 gene purM 15327 14290 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_15820 15759 15409 gene locus_tag LOCUS_15830 15759 15409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 16035 16880 gene locus_tag LOCUS_15840 16035 16880 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174269896.1 protein_id gnl|my_center|LOCUS_15840 16961 17335 gene locus_tag LOCUS_15850 16961 17335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 17364 18350 gene locus_tag LOCUS_15860 17364 18350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 19779 18541 gene locus_tag LOCUS_15870 19779 18541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 19875 20498 gene locus_tag LOCUS_15880 19875 20498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 20715 21002 gene locus_tag LOCUS_15890 20715 21002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 21358 22374 gene locus_tag LOCUS_15900 21358 22374 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_15900 22692 22408 gene locus_tag LOCUS_15910 22692 22408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 23040 23981 gene locus_tag LOCUS_15920 23040 23981 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940692.1 protein_id gnl|my_center|LOCUS_15920 24017 24748 gene locus_tag LOCUS_15930 24017 24748 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023187.1 protein_id gnl|my_center|LOCUS_15930 24888 25088 gene locus_tag LOCUS_15940 24888 25088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 25088 25534 gene locus_tag LOCUS_15950 25088 25534 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943713.1 protein_id gnl|my_center|LOCUS_15950 25571 27949 gene locus_tag LOCUS_15960 25571 27949 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542519.1 protein_id gnl|my_center|LOCUS_15960 28101 29873 gene locus_tag LOCUS_15970 gene dnaG 28101 29873 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943711.1 protein_id gnl|my_center|LOCUS_15970 29899 31608 gene locus_tag LOCUS_15980 gene rpoD 29899 31608 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_15980 31711 31786 gene locus_tag LOCUS_t00250 31711 31786 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 31890 33008 gene locus_tag LOCUS_15990 31890 33008 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392163.1 protein_id gnl|my_center|LOCUS_15990 33089 33832 gene locus_tag LOCUS_16000 33089 33832 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852139.1 protein_id gnl|my_center|LOCUS_16000 34498 35478 gene locus_tag LOCUS_16010 gene arnC 34498 35478 CDS product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099176.1 protein_id gnl|my_center|LOCUS_16010 36239 35916 gene locus_tag LOCUS_16020 36239 35916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 36192 36347 gene locus_tag LOCUS_16030 36192 36347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 36972 36694 gene locus_tag LOCUS_16040 36972 36694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 37244 37089 gene locus_tag LOCUS_16050 37244 37089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 37524 37333 gene locus_tag LOCUS_16060 37524 37333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 37784 37978 gene locus_tag LOCUS_16070 37784 37978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 38084 38875 gene locus_tag LOCUS_16080 38084 38875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815935.1 protein_id gnl|my_center|LOCUS_16080 38910 39314 gene locus_tag LOCUS_16090 38910 39314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 39432 39689 gene locus_tag LOCUS_16100 39432 39689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 39912 39836 gene locus_tag LOCUS_t00260 39912 39836 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 40622 40020 gene locus_tag LOCUS_16110 40622 40020 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939236.1 protein_id gnl|my_center|LOCUS_16110 42542 40662 gene locus_tag LOCUS_16120 gene iorA 42542 40662 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939237.1 protein_id gnl|my_center|LOCUS_16120 42823 43275 gene locus_tag LOCUS_16130 42823 43275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 43605 44921 gene locus_tag LOCUS_16140 43605 44921 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941275.1 protein_id gnl|my_center|LOCUS_16140 44924 45766 gene locus_tag LOCUS_16150 gene ccsB 44924 45766 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941276.1 protein_id gnl|my_center|LOCUS_16150 46738 46235 gene locus_tag LOCUS_16160 46738 46235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 47586 46882 gene locus_tag LOCUS_16170 47586 46882 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942574.1 protein_id gnl|my_center|LOCUS_16170 48754 47627 gene locus_tag LOCUS_16180 48754 47627 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_16180 49087 49869 gene locus_tag LOCUS_16190 gene rlmB 49087 49869 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393958.1 protein_id gnl|my_center|LOCUS_16190 50038 50403 gene locus_tag LOCUS_16200 50038 50403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 50416 52011 gene locus_tag LOCUS_16210 gene murJ 50416 52011 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946821.1 protein_id gnl|my_center|LOCUS_16210 52031 52675 gene locus_tag LOCUS_16220 gene nth 52031 52675 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013539.1 protein_id gnl|my_center|LOCUS_16220 52796 52869 gene locus_tag LOCUS_t00270 52796 52869 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 54865 53396 gene locus_tag LOCUS_16230 gene cobB 54865 53396 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272194.1 protein_id gnl|my_center|LOCUS_16230 55107 54865 gene locus_tag LOCUS_16240 55107 54865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545371.1 protein_id gnl|my_center|LOCUS_16240 56196 55123 gene locus_tag LOCUS_16250 gene dsrB 56196 55123 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810503.1 protein_id gnl|my_center|LOCUS_16250 57503 56259 gene locus_tag LOCUS_16260 gene dsrA 57503 56259 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393107.1 protein_id gnl|my_center|LOCUS_16260 59009 57687 gene locus_tag LOCUS_16270 59009 57687 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143676.1 protein_id gnl|my_center|LOCUS_16270 60394 59072 gene locus_tag LOCUS_16280 60394 59072 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074152.1 protein_id gnl|my_center|LOCUS_16280 61438 60518 gene locus_tag LOCUS_16290 61438 60518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 62170 61493 gene locus_tag LOCUS_16300 gene lepB 62170 61493 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941922.1 protein_id gnl|my_center|LOCUS_16300 63972 62173 gene locus_tag LOCUS_16310 gene lepA 63972 62173 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941921.1 protein_id gnl|my_center|LOCUS_16310 64881 64258 gene locus_tag LOCUS_16320 64881 64258 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360256.1 protein_id gnl|my_center|LOCUS_16320 65100 66233 gene locus_tag LOCUS_16330 gene carA 65100 66233 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940372.1 protein_id gnl|my_center|LOCUS_16330 67929 67666 gene locus_tag LOCUS_16340 67929 67666 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_16340 68168 67926 gene locus_tag LOCUS_16350 68168 67926 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587616.1 protein_id gnl|my_center|LOCUS_16350 68381 68271 gene locus_tag LOCUS_r00010 68381 68271 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 71470 68462 gene locus_tag LOCUS_r00020 71470 68462 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 71653 71578 gene locus_tag LOCUS_t00280 71653 71578 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 71741 71663 gene locus_tag LOCUS_t00290 71741 71663 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 73466 71909 gene locus_tag LOCUS_r00030 73466 71909 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 74039 75655 gene locus_tag LOCUS_16360 gene nadB 74039 75655 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_16360 75669 75893 gene locus_tag LOCUS_16370 75669 75893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 76911 76309 gene locus_tag LOCUS_16380 76911 76309 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228227.1 protein_id gnl|my_center|LOCUS_16380 77545 77204 gene locus_tag LOCUS_16390 77545 77204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 79602 78334 gene locus_tag LOCUS_16400 gene nifB 79602 78334 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933205.1 protein_id gnl|my_center|LOCUS_16400 81143 79743 gene locus_tag LOCUS_16410 81143 79743 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933204.1 protein_id gnl|my_center|LOCUS_16410 82528 81140 gene locus_tag LOCUS_16420 gene nifE 82528 81140 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787306.1 protein_id gnl|my_center|LOCUS_16420 83074 82772 gene locus_tag LOCUS_16430 83074 82772 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176588.1 protein_id gnl|my_center|LOCUS_16430 84612 83236 gene locus_tag LOCUS_16440 gene nifK 84612 83236 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933202.1 protein_id gnl|my_center|LOCUS_16440 86364 84712 gene locus_tag LOCUS_16450 gene nifD 86364 84712 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933201.1 protein_id gnl|my_center|LOCUS_16450 86931 86551 gene locus_tag LOCUS_16460 86931 86551 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933200.1 protein_id gnl|my_center|LOCUS_16460 87284 86928 gene locus_tag LOCUS_16470 87284 86928 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176592.1 protein_id gnl|my_center|LOCUS_16470 87539 87402 gene locus_tag LOCUS_16480 87539 87402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 88378 87554 gene locus_tag LOCUS_16490 gene nifH 88378 87554 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933198.1 protein_id gnl|my_center|LOCUS_16490 88731 88931 gene locus_tag LOCUS_16500 88731 88931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 89262 90545 gene locus_tag LOCUS_16510 89262 90545 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939886.1 protein_id gnl|my_center|LOCUS_16510 90668 90949 gene locus_tag LOCUS_16520 90668 90949 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461513.1 protein_id gnl|my_center|LOCUS_16520 92364 91459 gene locus_tag LOCUS_16530 92364 91459 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035491.1 protein_id gnl|my_center|LOCUS_16530 92564 92899 gene locus_tag LOCUS_16540 92564 92899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 94396 92969 gene locus_tag LOCUS_16550 gene adeC 94396 92969 CDS product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153304094.1 protein_id gnl|my_center|LOCUS_16550 97568 94398 gene locus_tag LOCUS_16560 97568 94398 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544956.1 protein_id gnl|my_center|LOCUS_16560 98783 97581 gene locus_tag LOCUS_16570 98783 97581 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 protein_id gnl|my_center|LOCUS_16570 99457 98780 gene locus_tag LOCUS_16580 99457 98780 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088087.1 protein_id gnl|my_center|LOCUS_16580 99853 99719 gene locus_tag LOCUS_16590 99853 99719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 100335 100913 gene locus_tag LOCUS_16600 100335 100913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 101067 102164 gene locus_tag LOCUS_16610 101067 102164 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172726.1 protein_id gnl|my_center|LOCUS_16610 102195 103199 gene locus_tag LOCUS_16620 102195 103199 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937471.1 protein_id gnl|my_center|LOCUS_16620 103405 104349 gene locus_tag LOCUS_16630 103405 104349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 104450 104833 gene locus_tag LOCUS_16640 104450 104833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 104913 107135 gene locus_tag LOCUS_16650 104913 107135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 108053 107178 gene locus_tag LOCUS_16660 108053 107178 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459951.1 protein_id gnl|my_center|LOCUS_16660 110026 108347 gene locus_tag LOCUS_16670 110026 108347 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878476.1 protein_id gnl|my_center|LOCUS_16670 113154 110551 gene locus_tag LOCUS_16680 113154 110551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 115909 113297 gene locus_tag LOCUS_16690 115909 113297 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937463.1 protein_id gnl|my_center|LOCUS_16690 116326 115919 gene locus_tag LOCUS_16700 116326 115919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 119033 116454 gene locus_tag LOCUS_16710 119033 116454 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545874.1 protein_id gnl|my_center|LOCUS_16710 119564 119121 gene locus_tag LOCUS_16720 119564 119121 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546768.1 protein_id gnl|my_center|LOCUS_16720 121779 119542 gene locus_tag LOCUS_16730 121779 119542 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924828.1 protein_id gnl|my_center|LOCUS_16730 122460 121840 gene locus_tag LOCUS_16740 122460 121840 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942088.1 protein_id gnl|my_center|LOCUS_16740 >Feature sequence11 694 122 gene locus_tag LOCUS_16750 gene gmhB 694 122 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_16750 1845 691 gene locus_tag LOCUS_16760 gene waaF 1845 691 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_16760 2950 1853 gene locus_tag LOCUS_16770 gene lpxK 2950 1853 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_16770 4755 2947 gene locus_tag LOCUS_16780 4755 2947 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938960.1 protein_id gnl|my_center|LOCUS_16780 5006 5458 gene locus_tag LOCUS_16790 5006 5458 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941344.1 protein_id gnl|my_center|LOCUS_16790 5455 7017 gene locus_tag LOCUS_16800 5455 7017 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660540.1 protein_id gnl|my_center|LOCUS_16800 7078 7728 gene locus_tag LOCUS_16810 7078 7728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 7740 9464 gene locus_tag LOCUS_16820 7740 9464 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256741.1 protein_id gnl|my_center|LOCUS_16820 9506 11350 gene locus_tag LOCUS_16830 9506 11350 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256741.1 protein_id gnl|my_center|LOCUS_16830 11465 13861 gene locus_tag LOCUS_16840 11465 13861 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015337756.1 protein_id gnl|my_center|LOCUS_16840 13876 14913 gene locus_tag LOCUS_16850 gene cheB 13876 14913 CDS product chemotaxis-specific protein-glutamate methyltransferase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257541.1 protein_id gnl|my_center|LOCUS_16850 14980 16131 gene locus_tag LOCUS_16860 14980 16131 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199382204.1 protein_id gnl|my_center|LOCUS_16860 16527 17237 gene locus_tag LOCUS_16870 16527 17237 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868126.1 protein_id gnl|my_center|LOCUS_16870 17234 18094 gene locus_tag LOCUS_16880 gene tatC 17234 18094 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942132.1 protein_id gnl|my_center|LOCUS_16880 18250 19116 gene locus_tag LOCUS_16890 18250 19116 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938660.1 protein_id gnl|my_center|LOCUS_16890 19217 19459 gene locus_tag LOCUS_16900 19217 19459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 19434 20213 gene locus_tag LOCUS_16910 19434 20213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 20470 20709 gene locus_tag LOCUS_16920 20470 20709 CDS product DUF5683 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023253.1 protein_id gnl|my_center|LOCUS_16920 20945 21343 gene locus_tag LOCUS_16930 20945 21343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 21498 23546 gene locus_tag LOCUS_16940 21498 23546 CDS product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702089.1 protein_id gnl|my_center|LOCUS_16940 23564 26941 gene locus_tag LOCUS_16950 23564 26941 CDS product tubulin-like doman-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175155.1 protein_id gnl|my_center|LOCUS_16950 26945 29089 gene locus_tag LOCUS_16960 26945 29089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 29080 32949 gene locus_tag LOCUS_16970 29080 32949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 34858 34049 gene locus_tag LOCUS_16980 34858 34049 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932314.1 protein_id gnl|my_center|LOCUS_16980 37509 34861 gene locus_tag LOCUS_16990 gene mgtA 37509 34861 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932315.1 protein_id gnl|my_center|LOCUS_16990 38614 37907 gene locus_tag LOCUS_17000 38614 37907 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262342.1 protein_id gnl|my_center|LOCUS_17000 39020 38661 gene locus_tag LOCUS_17010 39020 38661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 39055 39255 gene locus_tag LOCUS_17020 39055 39255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 39491 40165 gene locus_tag LOCUS_17030 39491 40165 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965709.1 protein_id gnl|my_center|LOCUS_17030 40146 41537 gene locus_tag LOCUS_17040 40146 41537 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939857.1 protein_id gnl|my_center|LOCUS_17040 41685 42065 gene locus_tag LOCUS_17050 41685 42065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 42216 42746 gene locus_tag LOCUS_17060 42216 42746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 42886 43125 gene locus_tag LOCUS_17070 42886 43125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 43840 43250 gene locus_tag LOCUS_17080 43840 43250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 45758 44070 gene locus_tag LOCUS_17090 45758 44070 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_17090 46104 45913 gene locus_tag LOCUS_17100 46104 45913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 46103 46948 gene locus_tag LOCUS_17110 46103 46948 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792788.1 protein_id gnl|my_center|LOCUS_17110 47221 46982 gene locus_tag LOCUS_17120 47221 46982 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938477.1 protein_id gnl|my_center|LOCUS_17120 48719 47433 gene locus_tag LOCUS_17130 48719 47433 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946051.1 protein_id gnl|my_center|LOCUS_17130 49956 49327 gene locus_tag LOCUS_17140 49956 49327 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249655.1 protein_id gnl|my_center|LOCUS_17140 51938 50046 gene locus_tag LOCUS_17150 51938 50046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 54856 51938 gene locus_tag LOCUS_17160 54856 51938 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943878.1 protein_id gnl|my_center|LOCUS_17160 54986 55990 gene locus_tag LOCUS_17170 54986 55990 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257103.1 protein_id gnl|my_center|LOCUS_17170 56559 57791 gene locus_tag LOCUS_17180 56559 57791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 59798 57870 gene locus_tag LOCUS_17190 59798 57870 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940249.1 protein_id gnl|my_center|LOCUS_17190 61107 59872 gene locus_tag LOCUS_17200 61107 59872 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542268.1 protein_id gnl|my_center|LOCUS_17200 62130 61255 gene locus_tag LOCUS_17210 62130 61255 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878808.1 protein_id gnl|my_center|LOCUS_17210 62704 62213 gene locus_tag LOCUS_17220 gene ispF 62704 62213 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_17220 63408 62683 gene locus_tag LOCUS_17230 gene ispD 63408 62683 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_17230 64319 63405 gene locus_tag LOCUS_17240 64319 63405 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869030.1 protein_id gnl|my_center|LOCUS_17240 65374 64319 gene locus_tag LOCUS_17250 65374 64319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 66394 65447 gene locus_tag LOCUS_17260 66394 65447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17260 66886 70662 gene locus_tag LOCUS_17270 66886 70662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 71756 70704 gene locus_tag LOCUS_17280 71756 70704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 72675 71857 gene locus_tag LOCUS_17290 72675 71857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 73702 72788 gene locus_tag LOCUS_17300 73702 72788 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523363.1 protein_id gnl|my_center|LOCUS_17300 74449 73727 gene locus_tag LOCUS_17310 74449 73727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 74639 74803 gene locus_tag LOCUS_17320 74639 74803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 76150 74807 gene locus_tag LOCUS_17330 76150 74807 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294683.1 protein_id gnl|my_center|LOCUS_17330 77364 76156 gene locus_tag LOCUS_17340 77364 76156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 78497 77661 gene locus_tag LOCUS_17350 gene cpaB 78497 77661 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456561.1 protein_id gnl|my_center|LOCUS_17350 79040 78681 gene locus_tag LOCUS_17360 79040 78681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 79419 79255 gene locus_tag LOCUS_17370 79419 79255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 79804 79628 gene locus_tag LOCUS_17380 79804 79628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 80150 81529 gene locus_tag LOCUS_17390 80150 81529 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258274.1 protein_id gnl|my_center|LOCUS_17390 81958 81647 gene locus_tag LOCUS_17400 81958 81647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 82287 82676 gene locus_tag LOCUS_17410 82287 82676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 82685 83749 gene locus_tag LOCUS_17420 82685 83749 CDS product TadG family pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531236.1 protein_id gnl|my_center|LOCUS_17420 84356 83832 gene locus_tag LOCUS_17430 84356 83832 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939219.1 protein_id gnl|my_center|LOCUS_17430 84835 84521 gene locus_tag LOCUS_17440 84835 84521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 86701 85046 gene locus_tag LOCUS_17450 gene pgi 86701 85046 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455828.1 protein_id gnl|my_center|LOCUS_17450 90866 86838 gene locus_tag LOCUS_17460 90866 86838 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545943.1 protein_id gnl|my_center|LOCUS_17460 90992 92026 gene locus_tag LOCUS_17470 90992 92026 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529189.1 protein_id gnl|my_center|LOCUS_17470 92023 93474 gene locus_tag LOCUS_17480 92023 93474 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090686.1 protein_id gnl|my_center|LOCUS_17480 93652 95184 gene locus_tag LOCUS_17490 93652 95184 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_17490 96117 95287 gene locus_tag LOCUS_17500 gene larE 96117 95287 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_17500 97340 96120 gene locus_tag LOCUS_17510 97340 96120 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940198.1 protein_id gnl|my_center|LOCUS_17510 98723 97410 gene locus_tag LOCUS_17520 98723 97410 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_17520 98825 99739 gene locus_tag LOCUS_17530 98825 99739 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942160.1 protein_id gnl|my_center|LOCUS_17530 100046 99723 gene locus_tag LOCUS_17540 100046 99723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943704.1 protein_id gnl|my_center|LOCUS_17540 100135 100548 gene locus_tag LOCUS_17550 100135 100548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 100589 101308 gene locus_tag LOCUS_17560 100589 101308 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_17560 101511 102695 gene locus_tag LOCUS_17570 101511 102695 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941722.1 protein_id gnl|my_center|LOCUS_17570 102715 103092 gene locus_tag LOCUS_17580 102715 103092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 103162 104478 gene locus_tag LOCUS_17590 103162 104478 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791554.1 protein_id gnl|my_center|LOCUS_17590 104778 104485 gene locus_tag LOCUS_17600 104778 104485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 105154 105588 gene locus_tag LOCUS_17610 105154 105588 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357560.1 protein_id gnl|my_center|LOCUS_17610 105806 107983 gene locus_tag LOCUS_17620 gene katG 105806 107983 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814129.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence12 489 121 gene locus_tag LOCUS_17630 489 121 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937557.1 protein_id gnl|my_center|LOCUS_17630 2603 501 gene locus_tag LOCUS_17640 2603 501 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937885.1 protein_id gnl|my_center|LOCUS_17640 4011 3058 gene locus_tag LOCUS_17650 4011 3058 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793043.1 protein_id gnl|my_center|LOCUS_17650 5618 4113 gene locus_tag LOCUS_17660 5618 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 5764 6939 gene locus_tag LOCUS_17670 5764 6939 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793041.1 protein_id gnl|my_center|LOCUS_17670 7026 7565 gene locus_tag LOCUS_17680 7026 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 7636 9735 gene locus_tag LOCUS_17690 7636 9735 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545814.1 protein_id gnl|my_center|LOCUS_17690 9754 10278 gene locus_tag LOCUS_17700 9754 10278 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545501.1 protein_id gnl|my_center|LOCUS_17700 10440 13841 gene locus_tag LOCUS_17710 10440 13841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 13982 14539 gene locus_tag LOCUS_17720 13982 14539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 15767 14547 gene locus_tag LOCUS_17730 15767 14547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 16542 15826 gene locus_tag LOCUS_17740 16542 15826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 17875 16565 gene locus_tag LOCUS_17750 17875 16565 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545411.1 protein_id gnl|my_center|LOCUS_17750 18524 18000 gene locus_tag LOCUS_17760 18524 18000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 18701 19291 gene locus_tag LOCUS_17770 gene yihA 18701 19291 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943641.1 protein_id gnl|my_center|LOCUS_17770 19344 19544 gene locus_tag LOCUS_17780 19344 19544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 20308 19556 gene locus_tag LOCUS_17790 gene larB 20308 19556 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_17790 21464 20319 gene locus_tag LOCUS_17800 gene hpnI 21464 20319 CDS product bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941358.1 protein_id gnl|my_center|LOCUS_17800 22348 21584 gene locus_tag LOCUS_17810 gene elyC 22348 21584 CDS product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816039.1 protein_id gnl|my_center|LOCUS_17810 23010 22708 gene locus_tag LOCUS_17820 23010 22708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 23611 24288 gene locus_tag LOCUS_17830 23611 24288 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108306299.1 protein_id gnl|my_center|LOCUS_17830 24285 24602 gene locus_tag LOCUS_17840 24285 24602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 24603 25346 gene locus_tag LOCUS_17850 gene cbiQ 24603 25346 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030565.1 protein_id gnl|my_center|LOCUS_17850 25357 26229 gene locus_tag LOCUS_17860 25357 26229 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392733.1 protein_id gnl|my_center|LOCUS_17860 27526 26240 gene locus_tag LOCUS_17870 27526 26240 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142660068.1 protein_id gnl|my_center|LOCUS_17870 28289 27510 gene locus_tag LOCUS_17880 28289 27510 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_17880 29214 28399 gene locus_tag LOCUS_17890 29214 28399 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948171.1 protein_id gnl|my_center|LOCUS_17890 29713 29258 gene locus_tag LOCUS_17900 29713 29258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 30858 29719 gene locus_tag LOCUS_17910 30858 29719 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 protein_id gnl|my_center|LOCUS_17910 31098 31349 gene locus_tag LOCUS_17920 31098 31349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 32175 31426 gene locus_tag LOCUS_17930 32175 31426 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875755.1 protein_id gnl|my_center|LOCUS_17930 32666 32229 gene locus_tag LOCUS_17940 32666 32229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 33770 33054 gene locus_tag LOCUS_17950 33770 33054 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942449.1 protein_id gnl|my_center|LOCUS_17950 34138 33752 gene locus_tag LOCUS_17960 34138 33752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 36584 34125 gene locus_tag LOCUS_17970 36584 34125 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_17970 37611 36577 gene locus_tag LOCUS_17980 37611 36577 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792172.1 protein_id gnl|my_center|LOCUS_17980 38045 37608 gene locus_tag LOCUS_17990 38045 37608 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404578.1 protein_id gnl|my_center|LOCUS_17990 39304 38327 gene locus_tag LOCUS_18000 39304 38327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 39688 39894 gene locus_tag LOCUS_18010 39688 39894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 39946 40947 gene locus_tag LOCUS_18020 39946 40947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876151.1 protein_id gnl|my_center|LOCUS_18020 41136 41492 gene locus_tag LOCUS_18030 41136 41492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 43327 41984 gene locus_tag LOCUS_18040 43327 41984 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_18040 44122 43442 gene locus_tag LOCUS_18050 44122 43442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 45151 44234 gene locus_tag LOCUS_18060 45151 44234 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942871.1 protein_id gnl|my_center|LOCUS_18060 46206 45160 gene locus_tag LOCUS_18070 gene holB 46206 45160 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_18070 47796 46249 gene locus_tag LOCUS_18080 gene guaA 47796 46249 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_18080 48953 47883 gene locus_tag LOCUS_18090 48953 47883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 49125 51197 gene locus_tag LOCUS_18100 49125 51197 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_18100 51493 52635 gene locus_tag LOCUS_18110 51493 52635 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545052.1 protein_id gnl|my_center|LOCUS_18110 53633 53157 gene locus_tag LOCUS_18120 53633 53157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 54035 53649 gene locus_tag LOCUS_18130 54035 53649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 55625 54939 gene locus_tag LOCUS_18140 55625 54939 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939817.1 protein_id gnl|my_center|LOCUS_18140 55894 57522 gene locus_tag LOCUS_18150 gene hcp 55894 57522 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791786.1 protein_id gnl|my_center|LOCUS_18150 57691 58392 gene locus_tag LOCUS_18160 57691 58392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 58408 59157 gene locus_tag LOCUS_18170 58408 59157 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943860.1 protein_id gnl|my_center|LOCUS_18170 59379 59945 gene locus_tag LOCUS_18180 59379 59945 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393271.1 protein_id gnl|my_center|LOCUS_18180 60174 61217 gene locus_tag LOCUS_18190 60174 61217 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582795.1 protein_id gnl|my_center|LOCUS_18190 62239 61337 gene locus_tag LOCUS_18200 62239 61337 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941524.1 protein_id gnl|my_center|LOCUS_18200 62913 62236 gene locus_tag LOCUS_18210 62913 62236 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436912.1 protein_id gnl|my_center|LOCUS_18210 64719 63508 gene locus_tag LOCUS_18220 64719 63508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150048584.1 protein_id gnl|my_center|LOCUS_18220 64959 66353 gene locus_tag LOCUS_18230 gene gltX 64959 66353 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941876.1 protein_id gnl|my_center|LOCUS_18230 66570 66761 gene locus_tag LOCUS_18240 66570 66761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 66925 67842 gene locus_tag LOCUS_18250 gene fmt 66925 67842 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392417.1 protein_id gnl|my_center|LOCUS_18250 68154 69581 gene locus_tag LOCUS_18260 gene selA 68154 69581 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943980.1 protein_id gnl|my_center|LOCUS_18260 69578 71038 gene locus_tag LOCUS_18270 gene rlmD 69578 71038 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938223.1 protein_id gnl|my_center|LOCUS_18270 71190 73127 gene locus_tag LOCUS_18280 71190 73127 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811724.1 protein_id gnl|my_center|LOCUS_18280 73443 73772 gene locus_tag LOCUS_18290 73443 73772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 74036 74686 gene locus_tag LOCUS_18300 74036 74686 CDS product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384784.1 protein_id gnl|my_center|LOCUS_18300 75060 75281 gene locus_tag LOCUS_18310 75060 75281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 75324 76259 gene locus_tag LOCUS_18320 gene hemC 75324 76259 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_18320 77198 76473 gene locus_tag LOCUS_18330 77198 76473 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_18330 77900 77214 gene locus_tag LOCUS_18340 gene rpe 77900 77214 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_18340 79168 78071 gene locus_tag LOCUS_18350 79168 78071 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937555.1 protein_id gnl|my_center|LOCUS_18350 81869 79392 gene locus_tag LOCUS_18360 81869 79392 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791698.1 protein_id gnl|my_center|LOCUS_18360 83674 81926 gene locus_tag LOCUS_18370 gene glgP 83674 81926 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869295.1 protein_id gnl|my_center|LOCUS_18370 86661 83770 gene locus_tag LOCUS_18380 86661 83770 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545920.1 protein_id gnl|my_center|LOCUS_18380 88759 86771 gene locus_tag LOCUS_18390 88759 86771 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023875.1 protein_id gnl|my_center|LOCUS_18390 90477 88879 gene locus_tag LOCUS_18400 90477 88879 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933195.1 protein_id gnl|my_center|LOCUS_18400 90620 91078 gene locus_tag LOCUS_18410 gene mscL 90620 91078 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932912.1 protein_id gnl|my_center|LOCUS_18410 91258 91545 gene locus_tag LOCUS_18420 91258 91545 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_18420 92156 93760 gene locus_tag LOCUS_18430 92156 93760 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938914.1 protein_id gnl|my_center|LOCUS_18430 93750 94607 gene locus_tag LOCUS_18440 gene kdsA 93750 94607 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_18440 94589 95134 gene locus_tag LOCUS_18450 94589 95134 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815172.1 protein_id gnl|my_center|LOCUS_18450 95213 95770 gene locus_tag LOCUS_18460 95213 95770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 95758 96429 gene locus_tag LOCUS_18470 gene lptA 95758 96429 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942534.1 protein_id gnl|my_center|LOCUS_18470 96448 97170 gene locus_tag LOCUS_18480 gene lptB 96448 97170 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942533.1 protein_id gnl|my_center|LOCUS_18480 97214 98689 gene locus_tag LOCUS_18490 gene rpoN 97214 98689 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_18490 98754 99299 gene locus_tag LOCUS_18500 gene raiA 98754 99299 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_18500 99292 99774 gene locus_tag LOCUS_18510 99292 99774 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938921.1 protein_id gnl|my_center|LOCUS_18510 99875 100765 gene locus_tag LOCUS_18520 gene rapZ 99875 100765 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942529.1 protein_id gnl|my_center|LOCUS_18520 100779 101186 gene locus_tag LOCUS_18530 100779 101186 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003505374.1 protein_id gnl|my_center|LOCUS_18530 101245 101649 gene locus_tag LOCUS_18540 gene rimI 101245 101649 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_18540 102015 102233 gene locus_tag LOCUS_18550 102015 102233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 102330 102256 gene locus_tag LOCUS_t00300 102330 102256 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 102868 102413 gene locus_tag LOCUS_18560 102868 102413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 103432 102965 gene locus_tag LOCUS_18570 103432 102965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 103706 103563 gene locus_tag LOCUS_18580 103706 103563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 104415 103894 gene locus_tag LOCUS_18590 104415 103894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 104840 104412 gene locus_tag LOCUS_18600 104840 104412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 105489 104929 gene locus_tag LOCUS_18610 105489 104929 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941436.1 protein_id gnl|my_center|LOCUS_18610 106445 105873 gene locus_tag LOCUS_18620 106445 105873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 107645 106620 gene locus_tag LOCUS_18630 107645 106620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 108236 107718 gene locus_tag LOCUS_18640 108236 107718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence13 65 346 gene locus_tag LOCUS_18650 65 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 965 1123 gene locus_tag LOCUS_18660 965 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 1291 1773 gene locus_tag LOCUS_18670 1291 1773 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943176.1 protein_id gnl|my_center|LOCUS_18670 1849 2286 gene locus_tag LOCUS_18680 gene speD 1849 2286 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014510642.1 protein_id gnl|my_center|LOCUS_18680 2288 3160 gene locus_tag LOCUS_18690 2288 3160 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942919.1 protein_id gnl|my_center|LOCUS_18690 4539 3133 gene locus_tag LOCUS_18700 4539 3133 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943456.1 protein_id gnl|my_center|LOCUS_18700 5429 4614 gene locus_tag LOCUS_18710 5429 4614 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142916.1 protein_id gnl|my_center|LOCUS_18710 5834 5433 gene locus_tag LOCUS_18720 5834 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 6049 8127 gene locus_tag LOCUS_18730 gene fusA 6049 8127 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_18730 8172 8660 gene locus_tag LOCUS_18740 8172 8660 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393623.1 protein_id gnl|my_center|LOCUS_18740 8629 9117 gene locus_tag LOCUS_18750 8629 9117 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_18750 9279 10577 gene locus_tag LOCUS_18760 9279 10577 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_18760 10593 11357 gene locus_tag LOCUS_18770 10593 11357 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546761.1 protein_id gnl|my_center|LOCUS_18770 11529 11864 gene locus_tag LOCUS_18780 11529 11864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 11905 13380 gene locus_tag LOCUS_18790 11905 13380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 13377 13751 gene locus_tag LOCUS_18800 13377 13751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 13864 15117 gene locus_tag LOCUS_18810 13864 15117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 15934 15209 gene locus_tag LOCUS_18820 15934 15209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 18424 16010 gene locus_tag LOCUS_18830 18424 16010 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545339.1 protein_id gnl|my_center|LOCUS_18830 19384 18476 gene locus_tag LOCUS_18840 19384 18476 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510026.1 protein_id gnl|my_center|LOCUS_18840 19863 19384 gene locus_tag LOCUS_18850 gene greA 19863 19384 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529568.1 protein_id gnl|my_center|LOCUS_18850 20083 20865 gene locus_tag LOCUS_18860 20083 20865 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061316.1 protein_id gnl|my_center|LOCUS_18860 21013 22443 gene locus_tag LOCUS_18870 gene gatB 21013 22443 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_18870 22924 22505 gene locus_tag LOCUS_18880 22924 22505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942792.1 protein_id gnl|my_center|LOCUS_18880 23225 23001 gene locus_tag LOCUS_18890 23225 23001 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791779.1 protein_id gnl|my_center|LOCUS_18890 24076 23345 gene locus_tag LOCUS_18900 24076 23345 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897510.1 protein_id gnl|my_center|LOCUS_18900 25203 24160 gene locus_tag LOCUS_18910 gene pdxA 25203 24160 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_18910 25528 25187 gene locus_tag LOCUS_18920 25528 25187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 26114 25566 gene locus_tag LOCUS_18930 26114 25566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 26415 27200 gene locus_tag LOCUS_18940 26415 27200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 29643 27244 gene locus_tag LOCUS_18950 29643 27244 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942301.1 protein_id gnl|my_center|LOCUS_18950 29960 29640 gene locus_tag LOCUS_18960 29960 29640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 31059 29995 gene locus_tag LOCUS_18970 gene dnaJ 31059 29995 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_18970 31292 31501 gene locus_tag LOCUS_18980 31292 31501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 33000 31594 gene locus_tag LOCUS_18990 33000 31594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 34010 33024 gene locus_tag LOCUS_19000 34010 33024 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942544.1 protein_id gnl|my_center|LOCUS_19000 34823 34014 gene locus_tag LOCUS_19010 34823 34014 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942652.1 protein_id gnl|my_center|LOCUS_19010 35737 34943 gene locus_tag LOCUS_19020 35737 34943 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085709.1 protein_id gnl|my_center|LOCUS_19020 36672 35707 gene locus_tag LOCUS_19030 36672 35707 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546311.1 protein_id gnl|my_center|LOCUS_19030 37604 36735 gene locus_tag LOCUS_19040 37604 36735 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172393.1 protein_id gnl|my_center|LOCUS_19040 38923 37748 gene locus_tag LOCUS_19050 38923 37748 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266503.1 protein_id gnl|my_center|LOCUS_19050 39360 40613 gene locus_tag LOCUS_19060 gene murA 39360 40613 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_19060 41434 40727 gene locus_tag LOCUS_19070 gene yrfG 41434 40727 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942337.1 protein_id gnl|my_center|LOCUS_19070 42513 41620 gene locus_tag LOCUS_19080 42513 41620 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929456.1 protein_id gnl|my_center|LOCUS_19080 44099 42627 gene locus_tag LOCUS_19090 gene cysS 44099 42627 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_19090 44700 44215 gene locus_tag LOCUS_19100 44700 44215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 45279 46661 gene locus_tag LOCUS_19110 45279 46661 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726975.1 protein_id gnl|my_center|LOCUS_19110 51350 46929 gene locus_tag LOCUS_19120 51350 46929 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392708.1 protein_id gnl|my_center|LOCUS_19120 52255 51404 gene locus_tag LOCUS_19130 52255 51404 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_19130 52852 52265 gene locus_tag LOCUS_19140 52852 52265 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392710.1 protein_id gnl|my_center|LOCUS_19140 53521 53336 gene locus_tag LOCUS_19150 53521 53336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 53655 53882 gene locus_tag LOCUS_19160 53655 53882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 53886 54122 gene locus_tag LOCUS_19170 53886 54122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 55743 54289 gene locus_tag LOCUS_19180 55743 54289 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_19180 57278 55740 gene locus_tag LOCUS_19190 57278 55740 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_19190 59204 57303 gene locus_tag LOCUS_19200 gene nuoL 59204 57303 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_19200 59520 59215 gene locus_tag LOCUS_19210 gene nuoK 59520 59215 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_19210 60046 59549 gene locus_tag LOCUS_19220 60046 59549 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_19220 60472 60068 gene locus_tag LOCUS_19230 gene nuoI 60472 60068 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258756.1 protein_id gnl|my_center|LOCUS_19230 61508 60477 gene locus_tag LOCUS_19240 gene nuoH 61508 60477 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944046.1 protein_id gnl|my_center|LOCUS_19240 64161 61513 gene locus_tag LOCUS_19250 gene fdhF 64161 61513 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_19250 65398 64208 gene locus_tag LOCUS_19260 gene nuoD 65398 64208 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_19260 65869 65411 gene locus_tag LOCUS_19270 65869 65411 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396799.1 protein_id gnl|my_center|LOCUS_19270 66380 65853 gene locus_tag LOCUS_19280 66380 65853 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416420.1 protein_id gnl|my_center|LOCUS_19280 66792 66436 gene locus_tag LOCUS_19290 66792 66436 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_19290 68708 66876 gene locus_tag LOCUS_19300 gene nuoF 68708 66876 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_19300 69183 69917 gene locus_tag LOCUS_19310 69183 69917 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938321.1 protein_id gnl|my_center|LOCUS_19310 69896 71116 gene locus_tag LOCUS_19320 69896 71116 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024286.1 protein_id gnl|my_center|LOCUS_19320 71120 71293 gene locus_tag LOCUS_19330 71120 71293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 71316 71768 gene locus_tag LOCUS_19340 71316 71768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 71816 72295 gene locus_tag LOCUS_19350 gene mobB 71816 72295 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460721.1 protein_id gnl|my_center|LOCUS_19350 72334 72897 gene locus_tag LOCUS_19360 72334 72897 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_19360 73858 73079 gene locus_tag LOCUS_19370 73858 73079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 75128 73899 gene locus_tag LOCUS_19380 75128 73899 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392245.1 protein_id gnl|my_center|LOCUS_19380 76231 75257 gene locus_tag LOCUS_19390 76231 75257 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_19390 77892 76480 gene locus_tag LOCUS_19400 gene tilS 77892 76480 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942455.1 protein_id gnl|my_center|LOCUS_19400 78291 77905 gene locus_tag LOCUS_19410 78291 77905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 80183 78387 gene locus_tag LOCUS_19420 80183 78387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 80493 81137 gene locus_tag LOCUS_19430 80493 81137 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389783.1 protein_id gnl|my_center|LOCUS_19430 81302 82396 gene locus_tag LOCUS_19440 81302 82396 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941437.1 protein_id gnl|my_center|LOCUS_19440 82777 82550 gene locus_tag LOCUS_19450 82777 82550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 83441 82842 gene locus_tag LOCUS_19460 83441 82842 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930880.1 protein_id gnl|my_center|LOCUS_19460 84863 83445 gene locus_tag LOCUS_19470 84863 83445 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942656.1 protein_id gnl|my_center|LOCUS_19470 86388 85087 gene locus_tag LOCUS_19480 gene ahcY 86388 85087 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_19480 87600 86434 gene locus_tag LOCUS_19490 gene metK 87600 86434 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_19490 88160 87783 gene locus_tag LOCUS_19500 88160 87783 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723010.1 protein_id gnl|my_center|LOCUS_19500 89011 88163 gene locus_tag LOCUS_19510 gene panC 89011 88163 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942350.1 protein_id gnl|my_center|LOCUS_19510 89452 89931 gene locus_tag LOCUS_19520 89452 89931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 89944 90834 gene locus_tag LOCUS_19530 89944 90834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 92387 91431 gene locus_tag LOCUS_19540 92387 91431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19540 92995 92519 gene locus_tag LOCUS_19550 92995 92519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 93668 93796 gene locus_tag LOCUS_19560 93668 93796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 94262 94453 gene locus_tag LOCUS_19570 94262 94453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 95874 94780 gene locus_tag LOCUS_19580 95874 94780 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272228.1 protein_id gnl|my_center|LOCUS_19580 99525 96124 gene locus_tag LOCUS_19590 99525 96124 CDS product TerB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072770867.1 protein_id gnl|my_center|LOCUS_19590 >Feature sequence14 688 161 gene locus_tag LOCUS_19600 688 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 1350 685 gene locus_tag LOCUS_19610 1350 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19610 2509 2691 gene locus_tag LOCUS_19620 2509 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 3806 2817 gene locus_tag LOCUS_19630 3806 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 5258 4170 gene locus_tag LOCUS_19640 gene wecB 5258 4170 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_19640 6416 5298 gene locus_tag LOCUS_19650 6416 5298 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947153.1 protein_id gnl|my_center|LOCUS_19650 7752 6448 gene locus_tag LOCUS_19660 gene wbpA 7752 6448 CDS product UDP-N-acetyl-D-glucosamine 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113429.1 protein_id gnl|my_center|LOCUS_19660 8787 7771 gene locus_tag LOCUS_19670 8787 7771 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_19670 10605 8866 gene locus_tag LOCUS_19680 10605 8866 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946701.1 protein_id gnl|my_center|LOCUS_19680 12337 10826 gene locus_tag LOCUS_19690 12337 10826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 12998 12324 gene locus_tag LOCUS_19700 12998 12324 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918895.1 protein_id gnl|my_center|LOCUS_19700 14090 13008 gene locus_tag LOCUS_19710 14090 13008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 15861 14785 gene locus_tag LOCUS_19720 15861 14785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 16979 15858 gene locus_tag LOCUS_19730 gene vioA 16979 15858 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase VioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998544.1 protein_id gnl|my_center|LOCUS_19730 17626 16976 gene locus_tag LOCUS_19740 17626 16976 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582959.1 protein_id gnl|my_center|LOCUS_19740 18830 17697 gene locus_tag LOCUS_19750 18830 17697 CDS product XrtA-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044863.1 protein_id gnl|my_center|LOCUS_19750 19737 18838 gene locus_tag LOCUS_19760 19737 18838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 21541 19799 gene locus_tag LOCUS_19770 21541 19799 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942628.1 protein_id gnl|my_center|LOCUS_19770 22752 21577 gene locus_tag LOCUS_19780 22752 21577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 23427 22813 gene locus_tag LOCUS_19790 23427 22813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 24873 23896 gene locus_tag LOCUS_19800 24873 23896 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943294.1 protein_id gnl|my_center|LOCUS_19800 25966 24866 gene locus_tag LOCUS_19810 gene pdhA 25966 24866 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943293.1 protein_id gnl|my_center|LOCUS_19810 26301 26035 gene locus_tag LOCUS_19820 26301 26035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 28254 27736 gene locus_tag LOCUS_19830 28254 27736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 28905 29768 gene locus_tag LOCUS_19840 28905 29768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 30604 29819 gene locus_tag LOCUS_19850 30604 29819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 30866 31714 gene locus_tag LOCUS_19860 30866 31714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 32631 31795 gene locus_tag LOCUS_19870 32631 31795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 33363 34829 gene locus_tag LOCUS_19880 33363 34829 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_19880 34887 35633 gene locus_tag LOCUS_19890 34887 35633 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921533.1 protein_id gnl|my_center|LOCUS_19890 35852 37621 gene locus_tag LOCUS_19900 35852 37621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 37672 38541 gene locus_tag LOCUS_19910 37672 38541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 38631 40196 gene locus_tag LOCUS_19920 38631 40196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 40193 40918 gene locus_tag LOCUS_19930 40193 40918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 40956 42008 gene locus_tag LOCUS_19940 gene gmd 40956 42008 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546080.1 protein_id gnl|my_center|LOCUS_19940 42016 42948 gene locus_tag LOCUS_19950 42016 42948 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_19950 42995 44110 gene locus_tag LOCUS_19960 gene wecB 42995 44110 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767232.1 protein_id gnl|my_center|LOCUS_19960 45129 45608 gene locus_tag LOCUS_19970 45129 45608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 45807 47021 gene locus_tag LOCUS_19980 45807 47021 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974188.1 protein_id gnl|my_center|LOCUS_19980 47018 48133 gene locus_tag LOCUS_19990 47018 48133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 48130 49548 gene locus_tag LOCUS_20000 48130 49548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 49592 50464 gene locus_tag LOCUS_20010 49592 50464 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942887.1 protein_id gnl|my_center|LOCUS_20010 50451 51512 gene locus_tag LOCUS_20020 50451 51512 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390551.1 protein_id gnl|my_center|LOCUS_20020 51509 52615 gene locus_tag LOCUS_20030 gene wecB 51509 52615 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390550.1 protein_id gnl|my_center|LOCUS_20030 52639 53799 gene locus_tag LOCUS_20040 52639 53799 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213498758.1 protein_id gnl|my_center|LOCUS_20040 53803 54993 gene locus_tag LOCUS_20050 53803 54993 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974187.1 protein_id gnl|my_center|LOCUS_20050 54996 55748 gene locus_tag LOCUS_20060 54996 55748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 55745 56419 gene locus_tag LOCUS_20070 55745 56419 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403388.1 protein_id gnl|my_center|LOCUS_20070 56426 57268 gene locus_tag LOCUS_20080 56426 57268 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_20080 57310 57882 gene locus_tag LOCUS_20090 gene wcaF 57310 57882 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153597.1 protein_id gnl|my_center|LOCUS_20090 57967 58563 gene locus_tag LOCUS_20100 57967 58563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 58627 59991 gene locus_tag LOCUS_20110 58627 59991 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937988.1 protein_id gnl|my_center|LOCUS_20110 59988 61409 gene locus_tag LOCUS_20120 59988 61409 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 protein_id gnl|my_center|LOCUS_20120 62495 61662 gene locus_tag LOCUS_20130 62495 61662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 62900 62505 gene locus_tag LOCUS_20140 62900 62505 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885432.1 protein_id gnl|my_center|LOCUS_20140 63571 62897 gene locus_tag LOCUS_20150 63571 62897 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069550.1 protein_id gnl|my_center|LOCUS_20150 64000 63803 gene locus_tag LOCUS_20160 64000 63803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 65079 64249 gene locus_tag LOCUS_20170 65079 64249 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066716.1 protein_id gnl|my_center|LOCUS_20170 66086 65076 gene locus_tag LOCUS_20180 66086 65076 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703279.1 protein_id gnl|my_center|LOCUS_20180 66925 66083 gene locus_tag LOCUS_20190 66925 66083 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192829.1 protein_id gnl|my_center|LOCUS_20190 67400 67597 gene locus_tag LOCUS_20200 67400 67597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 69998 67983 gene locus_tag LOCUS_20210 69998 67983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 70895 70053 gene locus_tag LOCUS_20220 70895 70053 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168485.1 protein_id gnl|my_center|LOCUS_20220 71263 71877 gene locus_tag LOCUS_20230 71263 71877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 74038 71963 gene locus_tag LOCUS_20240 gene btuB 74038 71963 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_20240 74599 74342 gene locus_tag LOCUS_20250 74599 74342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 75575 75069 gene locus_tag LOCUS_20260 75575 75069 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545623.1 protein_id gnl|my_center|LOCUS_20260 76776 76021 gene locus_tag LOCUS_20270 76776 76021 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206826.1 protein_id gnl|my_center|LOCUS_20270 77780 76773 gene locus_tag LOCUS_20280 77780 76773 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206827.1 protein_id gnl|my_center|LOCUS_20280 78794 77784 gene locus_tag LOCUS_20290 78794 77784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 80933 78858 gene locus_tag LOCUS_20300 80933 78858 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545674.1 protein_id gnl|my_center|LOCUS_20300 81710 81546 gene locus_tag LOCUS_20310 81710 81546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 82309 82148 gene locus_tag LOCUS_20320 82309 82148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 84347 82440 gene locus_tag LOCUS_20330 gene dnaK 84347 82440 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_20330 84990 84409 gene locus_tag LOCUS_20340 gene grpE 84990 84409 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101637.1 protein_id gnl|my_center|LOCUS_20340 86241 85204 gene locus_tag LOCUS_20350 gene hrcA 86241 85204 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_20350 86666 87454 gene locus_tag LOCUS_20360 86666 87454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 87506 88978 gene locus_tag LOCUS_20370 gene glgA 87506 88978 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_20370 89082 89282 gene locus_tag LOCUS_20380 89082 89282 CDS product DUF6485 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584058.1 protein_id gnl|my_center|LOCUS_20380 >Feature sequence15 682 533 gene locus_tag LOCUS_20390 682 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 1347 3935 gene locus_tag LOCUS_20400 1347 3935 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 protein_id gnl|my_center|LOCUS_20400 4050 4235 gene locus_tag LOCUS_20410 4050 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 4923 8123 gene locus_tag LOCUS_20420 gene carB 4923 8123 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_20420 8339 9712 gene locus_tag LOCUS_20430 gene purF 8339 9712 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869508.1 protein_id gnl|my_center|LOCUS_20430 9736 10767 gene locus_tag LOCUS_20440 gene holA 9736 10767 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392113.1 protein_id gnl|my_center|LOCUS_20440 10993 10742 gene locus_tag LOCUS_20450 gene rpsT 10993 10742 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939182.1 protein_id gnl|my_center|LOCUS_20450 13026 11242 gene locus_tag LOCUS_20460 13026 11242 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546634.1 protein_id gnl|my_center|LOCUS_20460 13897 15786 gene locus_tag LOCUS_20470 gene cooS 13897 15786 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939375.1 protein_id gnl|my_center|LOCUS_20470 16085 17377 gene locus_tag LOCUS_20480 16085 17377 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939254.1 protein_id gnl|my_center|LOCUS_20480 17359 18057 gene locus_tag LOCUS_20490 17359 18057 CDS product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939255.1 protein_id gnl|my_center|LOCUS_20490 18226 18474 gene locus_tag LOCUS_20500 18226 18474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 18506 19381 gene locus_tag LOCUS_20510 gene nadC 18506 19381 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_20510 20171 19335 gene locus_tag LOCUS_20520 gene proC 20171 19335 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392379.1 protein_id gnl|my_center|LOCUS_20520 20435 21253 gene locus_tag LOCUS_20530 20435 21253 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403290.1 protein_id gnl|my_center|LOCUS_20530 21196 21609 gene locus_tag LOCUS_20540 21196 21609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 22932 22234 gene locus_tag LOCUS_20550 22932 22234 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249791.1 protein_id gnl|my_center|LOCUS_20550 23284 24105 gene locus_tag LOCUS_20560 23284 24105 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176580.1 protein_id gnl|my_center|LOCUS_20560 24102 24770 gene locus_tag LOCUS_20570 24102 24770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 24777 25418 gene locus_tag LOCUS_20580 24777 25418 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545638.1 protein_id gnl|my_center|LOCUS_20580 25429 26115 gene locus_tag LOCUS_20590 gene queC 25429 26115 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932219.1 protein_id gnl|my_center|LOCUS_20590 26237 26977 gene locus_tag LOCUS_20600 26237 26977 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930779.1 protein_id gnl|my_center|LOCUS_20600 28342 26978 gene locus_tag LOCUS_20610 28342 26978 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_20610 29752 28373 gene locus_tag LOCUS_20620 29752 28373 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258545.1 protein_id gnl|my_center|LOCUS_20620 31190 29853 gene locus_tag LOCUS_20630 31190 29853 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_20630 33030 31603 gene locus_tag LOCUS_20640 33030 31603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 33422 35377 gene locus_tag LOCUS_20650 gene shc 33422 35377 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_20650 35370 36368 gene locus_tag LOCUS_20660 35370 36368 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_20660 36471 37469 gene locus_tag LOCUS_20670 gene hpnH 36471 37469 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941345.1 protein_id gnl|my_center|LOCUS_20670 37491 38753 gene locus_tag LOCUS_20680 37491 38753 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941036.1 protein_id gnl|my_center|LOCUS_20680 38753 40486 gene locus_tag LOCUS_20690 38753 40486 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193449.1 protein_id gnl|my_center|LOCUS_20690 40557 41213 gene locus_tag LOCUS_20700 40557 41213 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258849.1 protein_id gnl|my_center|LOCUS_20700 45077 41544 gene locus_tag LOCUS_20710 45077 41544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 46132 45848 gene locus_tag LOCUS_20720 46132 45848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 48010 46238 gene locus_tag LOCUS_20730 48010 46238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 48539 48913 gene locus_tag LOCUS_20740 gene crcB 48539 48913 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405171.1 protein_id gnl|my_center|LOCUS_20740 49068 50411 gene locus_tag LOCUS_20750 49068 50411 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258332.1 protein_id gnl|my_center|LOCUS_20750 50427 51608 gene locus_tag LOCUS_20760 50427 51608 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546088.1 protein_id gnl|my_center|LOCUS_20760 51786 52208 gene locus_tag LOCUS_20770 51786 52208 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228279.1 protein_id gnl|my_center|LOCUS_20770 52235 53443 gene locus_tag LOCUS_20780 52235 53443 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545988.1 protein_id gnl|my_center|LOCUS_20780 53549 54826 gene locus_tag LOCUS_20790 gene eno 53549 54826 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869074.1 protein_id gnl|my_center|LOCUS_20790 54946 56040 gene locus_tag LOCUS_20800 gene cobD 54946 56040 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392618.1 protein_id gnl|my_center|LOCUS_20800 56030 56980 gene locus_tag LOCUS_20810 gene cbiB 56030 56980 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816688.1 protein_id gnl|my_center|LOCUS_20810 57024 57578 gene locus_tag LOCUS_20820 57024 57578 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082414.1 protein_id gnl|my_center|LOCUS_20820 57770 58651 gene locus_tag LOCUS_20830 57770 58651 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_20830 58718 58999 gene locus_tag LOCUS_20840 58718 58999 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082206.1 protein_id gnl|my_center|LOCUS_20840 59000 59599 gene locus_tag LOCUS_20850 gene gmk 59000 59599 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942878.1 protein_id gnl|my_center|LOCUS_20850 59770 61071 gene locus_tag LOCUS_20860 59770 61071 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940001.1 protein_id gnl|my_center|LOCUS_20860 61589 61053 gene locus_tag LOCUS_20870 61589 61053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 61703 62269 gene locus_tag LOCUS_20880 61703 62269 CDS product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933919.1 protein_id gnl|my_center|LOCUS_20880 62462 63580 gene locus_tag LOCUS_20890 gene ribD 62462 63580 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_20890 63811 65073 gene locus_tag LOCUS_20900 gene hisS 63811 65073 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942303.1 protein_id gnl|my_center|LOCUS_20900 65075 66856 gene locus_tag LOCUS_20910 gene aspS 65075 66856 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_20910 66990 68819 gene locus_tag LOCUS_20920 66990 68819 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937705.1 protein_id gnl|my_center|LOCUS_20920 69040 70056 gene locus_tag LOCUS_20930 69040 70056 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096844.1 protein_id gnl|my_center|LOCUS_20930 70112 71407 gene locus_tag LOCUS_20940 70112 71407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 72218 71502 gene locus_tag LOCUS_20950 72218 71502 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942088.1 protein_id gnl|my_center|LOCUS_20950 72371 73339 gene locus_tag LOCUS_20960 72371 73339 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941713.1 protein_id gnl|my_center|LOCUS_20960 74171 73305 gene locus_tag LOCUS_20970 74171 73305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 74299 75021 gene locus_tag LOCUS_20980 74299 75021 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939585.1 protein_id gnl|my_center|LOCUS_20980 76042 75197 gene locus_tag LOCUS_20990 76042 75197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 76213 76288 gene locus_tag LOCUS_t00310 76213 76288 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 76517 76332 gene locus_tag LOCUS_21000 76517 76332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence16 175 489 gene locus_tag LOCUS_21010 175 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 1456 626 gene locus_tag LOCUS_21020 1456 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 1882 2691 gene locus_tag LOCUS_21030 1882 2691 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881009.1 protein_id gnl|my_center|LOCUS_21030 2693 3685 gene locus_tag LOCUS_21040 2693 3685 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881255.1 protein_id gnl|my_center|LOCUS_21040 4208 4453 gene locus_tag LOCUS_21050 4208 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 4686 5771 gene locus_tag LOCUS_21060 gene pheA 4686 5771 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_21060 5768 6472 gene locus_tag LOCUS_21070 gene aroD 5768 6472 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024466.1 protein_id gnl|my_center|LOCUS_21070 6679 6449 gene locus_tag LOCUS_21080 6679 6449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 6609 7448 gene locus_tag LOCUS_21090 6609 7448 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249220.1 protein_id gnl|my_center|LOCUS_21090 7562 8833 gene locus_tag LOCUS_21100 gene aroA 7562 8833 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031206.1 protein_id gnl|my_center|LOCUS_21100 9619 8981 gene locus_tag LOCUS_21110 9619 8981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 10909 9743 gene locus_tag LOCUS_21120 10909 9743 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941825.1 protein_id gnl|my_center|LOCUS_21120 11446 10940 gene locus_tag LOCUS_21130 11446 10940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 13603 11543 gene locus_tag LOCUS_21140 13603 11543 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980092.1 protein_id gnl|my_center|LOCUS_21140 13723 16404 gene locus_tag LOCUS_21150 13723 16404 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880620.1 protein_id gnl|my_center|LOCUS_21150 16408 17112 gene locus_tag LOCUS_21160 gene nfi 16408 17112 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258210.1 protein_id gnl|my_center|LOCUS_21160 17330 17121 gene locus_tag LOCUS_21170 17330 17121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 17765 18322 gene locus_tag LOCUS_21180 17765 18322 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250928.1 protein_id gnl|my_center|LOCUS_21180 18319 18612 gene locus_tag LOCUS_21190 gene porD 18319 18612 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082458.1 protein_id gnl|my_center|LOCUS_21190 18612 19787 gene locus_tag LOCUS_21200 gene porA 18612 19787 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496445.1 protein_id gnl|my_center|LOCUS_21200 19787 20794 gene locus_tag LOCUS_21210 gene porB 19787 20794 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496444.1 protein_id gnl|my_center|LOCUS_21210 20776 21228 gene locus_tag LOCUS_21220 20776 21228 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941010.1 protein_id gnl|my_center|LOCUS_21220 21327 23180 gene locus_tag LOCUS_21230 gene nuoF 21327 23180 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_21230 23291 24007 gene locus_tag LOCUS_21240 23291 24007 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869224.1 protein_id gnl|my_center|LOCUS_21240 24438 24274 gene locus_tag LOCUS_21250 24438 24274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 25575 24793 gene locus_tag LOCUS_21260 25575 24793 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_21260 25754 25569 gene locus_tag LOCUS_21270 25754 25569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 26467 25874 gene locus_tag LOCUS_21280 26467 25874 CDS product DUF4881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937459.1 protein_id gnl|my_center|LOCUS_21280 27557 26496 gene locus_tag LOCUS_21290 27557 26496 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937460.1 protein_id gnl|my_center|LOCUS_21290 27872 27576 gene locus_tag LOCUS_21300 27872 27576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937461.1 protein_id gnl|my_center|LOCUS_21300 28301 27891 gene locus_tag LOCUS_21310 28301 27891 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207464.1 protein_id gnl|my_center|LOCUS_21310 28393 28605 gene locus_tag LOCUS_21320 28393 28605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 28818 31475 gene locus_tag LOCUS_21330 28818 31475 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937463.1 protein_id gnl|my_center|LOCUS_21330 31651 33306 gene locus_tag LOCUS_21340 31651 33306 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940474.1 protein_id gnl|my_center|LOCUS_21340 33370 33771 gene locus_tag LOCUS_21350 33370 33771 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940473.1 protein_id gnl|my_center|LOCUS_21350 33798 34748 gene locus_tag LOCUS_21360 33798 34748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 34751 35146 gene locus_tag LOCUS_21370 34751 35146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 35239 35436 gene locus_tag LOCUS_21380 35239 35436 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405863.1 protein_id gnl|my_center|LOCUS_21380 38071 35471 gene locus_tag LOCUS_21390 38071 35471 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940472.1 protein_id gnl|my_center|LOCUS_21390 39416 38634 gene locus_tag LOCUS_21400 39416 38634 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546093.1 protein_id gnl|my_center|LOCUS_21400 40430 39456 gene locus_tag LOCUS_21410 40430 39456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 41157 40399 gene locus_tag LOCUS_21420 41157 40399 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938355.1 protein_id gnl|my_center|LOCUS_21420 41935 41165 gene locus_tag LOCUS_21430 gene cbiQ 41935 41165 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938356.1 protein_id gnl|my_center|LOCUS_21430 42585 41932 gene locus_tag LOCUS_21440 42585 41932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 43551 42946 gene locus_tag LOCUS_21450 gene cbiM 43551 42946 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938357.1 protein_id gnl|my_center|LOCUS_21450 43931 43743 gene locus_tag LOCUS_21460 43931 43743 CDS product CooT family nickel-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545767.1 protein_id gnl|my_center|LOCUS_21460 44227 44133 gene locus_tag LOCUS_t00320 44227 44133 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 44765 46099 gene locus_tag LOCUS_21470 44765 46099 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_21470 46133 47467 gene locus_tag LOCUS_21480 46133 47467 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_21480 47647 49053 gene locus_tag LOCUS_21490 gene der 47647 49053 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_21490 49343 49074 gene locus_tag LOCUS_21500 49343 49074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 50233 49493 gene locus_tag LOCUS_21510 50233 49493 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942367.1 protein_id gnl|my_center|LOCUS_21510 50632 50393 gene locus_tag LOCUS_21520 50632 50393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 50957 50619 gene locus_tag LOCUS_21530 50957 50619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 51460 52434 gene locus_tag LOCUS_21540 gene selD 51460 52434 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_21540 52552 53643 gene locus_tag LOCUS_21550 gene yedE 52552 53643 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545330.1 protein_id gnl|my_center|LOCUS_21550 53664 53882 gene locus_tag LOCUS_21560 53664 53882 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546446.1 protein_id gnl|my_center|LOCUS_21560 53885 54445 gene locus_tag LOCUS_21570 53885 54445 CDS product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545577.1 protein_id gnl|my_center|LOCUS_21570 54433 55308 gene locus_tag LOCUS_21580 54433 55308 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545741.1 protein_id gnl|my_center|LOCUS_21580 55346 55558 gene locus_tag LOCUS_21590 55346 55558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 55555 56100 gene locus_tag LOCUS_21600 55555 56100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 56233 56355 gene locus_tag LOCUS_21610 56233 56355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 56494 56652 gene locus_tag LOCUS_21620 56494 56652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21620 56835 57746 gene locus_tag LOCUS_21630 56835 57746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21630 57868 58668 gene locus_tag LOCUS_21640 57868 58668 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546386.1 protein_id gnl|my_center|LOCUS_21640 59019 59267 gene locus_tag LOCUS_21650 59019 59267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 59251 59691 gene locus_tag LOCUS_21660 59251 59691 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392707.1 protein_id gnl|my_center|LOCUS_21660 59746 61044 gene locus_tag LOCUS_21670 59746 61044 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939741.1 protein_id gnl|my_center|LOCUS_21670 61405 61851 gene locus_tag LOCUS_21680 61405 61851 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_21680 61924 62394 gene locus_tag LOCUS_21690 61924 62394 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392649.1 protein_id gnl|my_center|LOCUS_21690 62515 62742 gene locus_tag LOCUS_21700 62515 62742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 63558 62623 gene locus_tag LOCUS_21710 gene mdh 63558 62623 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence17 604 47 gene locus_tag LOCUS_21720 604 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 1843 818 gene locus_tag LOCUS_21730 1843 818 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902730.1 protein_id gnl|my_center|LOCUS_21730 2563 1844 gene locus_tag LOCUS_21740 2563 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 2907 4283 gene locus_tag LOCUS_21750 2907 4283 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922250.1 protein_id gnl|my_center|LOCUS_21750 4323 6443 gene locus_tag LOCUS_21760 4323 6443 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122387.1 protein_id gnl|my_center|LOCUS_21760 6632 8044 gene locus_tag LOCUS_21770 6632 8044 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393375.1 protein_id gnl|my_center|LOCUS_21770 8613 8257 gene locus_tag LOCUS_21780 8613 8257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 9450 9365 gene locus_tag LOCUS_t00330 9450 9365 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9928 9683 gene locus_tag LOCUS_21790 9928 9683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 11836 9929 gene locus_tag LOCUS_21800 gene glgB 11836 9929 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_21800 12460 12074 gene locus_tag LOCUS_21810 12460 12074 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924922.1 protein_id gnl|my_center|LOCUS_21810 13833 12523 gene locus_tag LOCUS_21820 13833 12523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 14211 15233 gene locus_tag LOCUS_21830 gene yhaM 14211 15233 CDS product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245698.1 protein_id gnl|my_center|LOCUS_21830 15440 15916 gene locus_tag LOCUS_21840 15440 15916 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258548.1 protein_id gnl|my_center|LOCUS_21840 16844 16023 gene locus_tag LOCUS_21850 gene lpxI 16844 16023 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_21850 17619 16804 gene locus_tag LOCUS_21860 gene lpxA 17619 16804 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_21860 18079 17612 gene locus_tag LOCUS_21870 gene fabZ 18079 17612 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939641.1 protein_id gnl|my_center|LOCUS_21870 19125 18076 gene locus_tag LOCUS_21880 gene lpxD 19125 18076 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_21880 19633 19127 gene locus_tag LOCUS_21890 19633 19127 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705101.1 protein_id gnl|my_center|LOCUS_21890 22375 19742 gene locus_tag LOCUS_21900 gene bamA 22375 19742 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_21900 23105 22386 gene locus_tag LOCUS_21910 23105 22386 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_21910 24553 23324 gene locus_tag LOCUS_21920 24553 23324 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_21920 26040 24559 gene locus_tag LOCUS_21930 gene lysS 26040 24559 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791906.1 protein_id gnl|my_center|LOCUS_21930 27785 26634 gene locus_tag LOCUS_21940 27785 26634 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941824.1 protein_id gnl|my_center|LOCUS_21940 28495 27788 gene locus_tag LOCUS_21950 28495 27788 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_21950 29732 28497 gene locus_tag LOCUS_21960 29732 28497 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941822.1 protein_id gnl|my_center|LOCUS_21960 29880 30362 gene locus_tag LOCUS_21970 29880 30362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 30910 30557 gene locus_tag LOCUS_21980 30910 30557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048124573.1 protein_id gnl|my_center|LOCUS_21980 31775 31317 gene locus_tag LOCUS_21990 31775 31317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 34440 32026 gene locus_tag LOCUS_22000 gene gyrB 34440 32026 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356688.1 protein_id gnl|my_center|LOCUS_22000 35751 34612 gene locus_tag LOCUS_22010 gene dnaN 35751 34612 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_22010 37672 36011 gene locus_tag LOCUS_22020 gene ilvD 37672 36011 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_22020 39209 37662 gene locus_tag LOCUS_22030 39209 37662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 39658 40050 gene locus_tag LOCUS_22040 39658 40050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 40115 40588 gene locus_tag LOCUS_22050 40115 40588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 40873 41250 gene locus_tag LOCUS_22060 40873 41250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 41243 42280 gene locus_tag LOCUS_22070 gene dnaJ 41243 42280 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309945.1 protein_id gnl|my_center|LOCUS_22070 42286 42801 gene locus_tag LOCUS_22080 gene moaC 42286 42801 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393624.1 protein_id gnl|my_center|LOCUS_22080 42826 43188 gene locus_tag LOCUS_22090 gene dksA 42826 43188 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 protein_id gnl|my_center|LOCUS_22090 43277 44305 gene locus_tag LOCUS_22100 gene rlmN 43277 44305 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_22100 44695 44309 gene locus_tag LOCUS_22110 44695 44309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 45310 44816 gene locus_tag LOCUS_22120 45310 44816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 46014 45421 gene locus_tag LOCUS_22130 gene pth 46014 45421 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226727.1 protein_id gnl|my_center|LOCUS_22130 47235 46303 gene locus_tag LOCUS_22140 47235 46303 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_22140 48116 47280 gene locus_tag LOCUS_22150 gene ispE 48116 47280 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941321.1 protein_id gnl|my_center|LOCUS_22150 48562 48116 gene locus_tag LOCUS_22160 48562 48116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 50299 48719 gene locus_tag LOCUS_22170 gene serA 50299 48719 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_22170 51448 50303 gene locus_tag LOCUS_22180 51448 50303 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545576.1 protein_id gnl|my_center|LOCUS_22180 52602 51724 gene locus_tag LOCUS_22190 52602 51724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 53315 52599 gene locus_tag LOCUS_22200 53315 52599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 54455 53334 gene locus_tag LOCUS_22210 54455 53334 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112563.1 protein_id gnl|my_center|LOCUS_22210 55494 54448 gene locus_tag LOCUS_22220 55494 54448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 59234 55563 gene locus_tag LOCUS_22230 59234 55563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 60629 59433 gene locus_tag LOCUS_22240 gene megL 60629 59433 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017138.1 protein_id gnl|my_center|LOCUS_22240 61030 62673 gene locus_tag LOCUS_22250 gene pgm 61030 62673 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971701.1 protein_id gnl|my_center|LOCUS_22250 62959 62750 gene locus_tag LOCUS_22260 62959 62750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 63099 63686 gene locus_tag LOCUS_22270 63099 63686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 64087 63773 gene locus_tag LOCUS_22280 64087 63773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence18 283 897 gene locus_tag LOCUS_22290 283 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 1893 1024 gene locus_tag LOCUS_22300 gene cas6 1893 1024 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256458.1 protein_id gnl|my_center|LOCUS_22300 4145 1896 gene locus_tag LOCUS_22310 4145 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 4945 4115 gene locus_tag LOCUS_22320 4945 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 5771 4950 gene locus_tag LOCUS_22330 5771 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 7855 5810 gene locus_tag LOCUS_22340 7855 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 9141 7852 gene locus_tag LOCUS_22350 9141 7852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 9585 9145 gene locus_tag LOCUS_22360 9585 9145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 10544 9582 gene locus_tag LOCUS_22370 gene cmr4 10544 9582 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880200.1 protein_id gnl|my_center|LOCUS_22370 11737 10562 gene locus_tag LOCUS_22380 11737 10562 CDS product type III-B CRISPR module-associated protein Cmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229143.1 protein_id gnl|my_center|LOCUS_22380 14634 11740 gene locus_tag LOCUS_22390 14634 11740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 14760 14969 gene locus_tag LOCUS_22400 14760 14969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 18155 15837 gene locus_tag LOCUS_22410 18155 15837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 18662 18980 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaagcactggaggaattcccgttagggattggaaac 19014 19151 gene locus_tag LOCUS_22420 19014 19151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 19213 19467 gene locus_tag LOCUS_22430 19213 19467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 20185 20415 gene locus_tag LOCUS_22440 20185 20415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 20639 21142 gene locus_tag LOCUS_22450 20639 21142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 21142 21963 gene locus_tag LOCUS_22460 21142 21963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 22086 22286 gene locus_tag LOCUS_22470 22086 22286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 22309 22458 gene locus_tag LOCUS_22480 22309 22458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 22626 22769 gene locus_tag LOCUS_22490 22626 22769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 23162 23524 gene locus_tag LOCUS_22500 23162 23524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 23574 23900 gene locus_tag LOCUS_22510 23574 23900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 24821 24117 gene locus_tag LOCUS_22520 24821 24117 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391936.1 protein_id gnl|my_center|LOCUS_22520 25814 24987 gene locus_tag LOCUS_22530 25814 24987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 26960 26052 gene locus_tag LOCUS_22540 gene ubiA 26960 26052 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_22540 28407 26944 gene locus_tag LOCUS_22550 28407 26944 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545977.1 protein_id gnl|my_center|LOCUS_22550 29417 28596 gene locus_tag LOCUS_22560 29417 28596 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940024.1 protein_id gnl|my_center|LOCUS_22560 30681 29407 gene locus_tag LOCUS_22570 30681 29407 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942352.1 protein_id gnl|my_center|LOCUS_22570 31571 30687 gene locus_tag LOCUS_22580 gene mtnP 31571 30687 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868192.1 protein_id gnl|my_center|LOCUS_22580 32839 31763 gene locus_tag LOCUS_22590 gene mqnC 32839 31763 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393344.1 protein_id gnl|my_center|LOCUS_22590 34016 32916 gene locus_tag LOCUS_22600 gene mqnE 34016 32916 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393346.1 protein_id gnl|my_center|LOCUS_22600 34865 34215 gene locus_tag LOCUS_22610 34865 34215 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401268.1 protein_id gnl|my_center|LOCUS_22610 35248 37902 gene locus_tag LOCUS_22620 35248 37902 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_22620 38279 40120 gene locus_tag LOCUS_22630 38279 40120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 40327 40542 gene locus_tag LOCUS_22640 40327 40542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 42420 40780 gene locus_tag LOCUS_22650 gene groL 42420 40780 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_22650 42784 42494 gene locus_tag LOCUS_22660 gene groES 42784 42494 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939263.1 protein_id gnl|my_center|LOCUS_22660 44329 43595 gene locus_tag LOCUS_22670 44329 43595 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211328137.1 protein_id gnl|my_center|LOCUS_22670 45256 44366 gene locus_tag LOCUS_22680 45256 44366 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 protein_id gnl|my_center|LOCUS_22680 45772 46155 gene locus_tag LOCUS_22690 45772 46155 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943583.1 protein_id gnl|my_center|LOCUS_22690 46229 46651 gene locus_tag LOCUS_22700 46229 46651 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943584.1 protein_id gnl|my_center|LOCUS_22700 47537 46734 gene locus_tag LOCUS_22710 gene murI 47537 46734 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202028.1 protein_id gnl|my_center|LOCUS_22710 48419 47625 gene locus_tag LOCUS_22720 48419 47625 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095630.1 protein_id gnl|my_center|LOCUS_22720 49341 48403 gene locus_tag LOCUS_22730 49341 48403 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878797.1 protein_id gnl|my_center|LOCUS_22730 49505 50533 gene locus_tag LOCUS_22740 gene ruvB 49505 50533 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_22740 50811 50569 gene locus_tag LOCUS_22750 50811 50569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 50810 51913 gene locus_tag LOCUS_22760 50810 51913 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763625.1 protein_id gnl|my_center|LOCUS_22760 52021 52605 gene locus_tag LOCUS_22770 52021 52605 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774866.1 protein_id gnl|my_center|LOCUS_22770 52607 53134 gene locus_tag LOCUS_22780 52607 53134 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947935.1 protein_id gnl|my_center|LOCUS_22780 53787 53569 gene locus_tag LOCUS_22790 53787 53569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 53671 53967 gene locus_tag LOCUS_22800 53671 53967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 54446 54522 gene locus_tag LOCUS_t00340 54446 54522 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence19 189 1166 gene locus_tag LOCUS_22810 189 1166 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_22810 1546 2316 gene locus_tag LOCUS_22820 1546 2316 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_22820 2319 3779 gene locus_tag LOCUS_22830 2319 3779 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_22830 3776 5191 gene locus_tag LOCUS_22840 3776 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 5716 5345 gene locus_tag LOCUS_22850 5716 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 5777 6034 gene locus_tag LOCUS_22860 5777 6034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 6670 5942 gene locus_tag LOCUS_22870 6670 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 7777 6845 gene locus_tag LOCUS_22880 7777 6845 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392705.1 protein_id gnl|my_center|LOCUS_22880 8539 7841 gene locus_tag LOCUS_22890 8539 7841 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392706.1 protein_id gnl|my_center|LOCUS_22890 8911 8558 gene locus_tag LOCUS_22900 8911 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22900 13452 9001 gene locus_tag LOCUS_22910 13452 9001 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392708.1 protein_id gnl|my_center|LOCUS_22910 14412 13915 gene locus_tag LOCUS_22920 14412 13915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 14671 14453 gene locus_tag LOCUS_22930 14671 14453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 15130 14690 gene locus_tag LOCUS_22940 15130 14690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 15439 16140 gene locus_tag LOCUS_22950 15439 16140 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210775.1 protein_id gnl|my_center|LOCUS_22950 16574 16383 gene locus_tag LOCUS_22960 16574 16383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 18203 16788 gene locus_tag LOCUS_22970 gene gltA 18203 16788 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393026.1 protein_id gnl|my_center|LOCUS_22970 19099 18245 gene locus_tag LOCUS_22980 19099 18245 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939745.1 protein_id gnl|my_center|LOCUS_22980 19622 19359 gene locus_tag LOCUS_22990 19622 19359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 20061 20690 gene locus_tag LOCUS_23000 20061 20690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 22088 20901 gene locus_tag LOCUS_23010 22088 20901 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010147499.1 protein_id gnl|my_center|LOCUS_23010 22632 22258 gene locus_tag LOCUS_23020 22632 22258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 24577 23282 gene locus_tag LOCUS_23030 24577 23282 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_23030 24745 25014 gene locus_tag LOCUS_23040 24745 25014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 25916 25065 gene locus_tag LOCUS_23050 25916 25065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 27320 25977 gene locus_tag LOCUS_23060 27320 25977 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942128.1 protein_id gnl|my_center|LOCUS_23060 27737 28426 gene locus_tag LOCUS_23070 27737 28426 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_23070 28428 28934 gene locus_tag LOCUS_23080 28428 28934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 28927 30348 gene locus_tag LOCUS_23090 28927 30348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 30464 31051 gene locus_tag LOCUS_23100 30464 31051 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942740.1 protein_id gnl|my_center|LOCUS_23100 31254 31048 gene locus_tag LOCUS_23110 31254 31048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 31190 32191 gene locus_tag LOCUS_23120 31190 32191 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793101.1 protein_id gnl|my_center|LOCUS_23120 32191 32499 gene locus_tag LOCUS_23130 32191 32499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 32701 32516 gene locus_tag LOCUS_23140 32701 32516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 32919 32993 gene locus_tag LOCUS_t00350 32919 32993 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 34116 33334 gene locus_tag LOCUS_23150 34116 33334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 34742 34817 gene locus_tag LOCUS_t00360 34742 34817 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 35909 35061 gene locus_tag LOCUS_23160 gene htpX 35909 35061 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360263.1 protein_id gnl|my_center|LOCUS_23160 37754 36045 gene locus_tag LOCUS_23170 37754 36045 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228698.1 protein_id gnl|my_center|LOCUS_23170 38513 37869 gene locus_tag LOCUS_23180 38513 37869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 38985 38761 gene locus_tag LOCUS_23190 38985 38761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 40295 38982 gene locus_tag LOCUS_23200 40295 38982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 40496 41824 gene locus_tag LOCUS_23210 gene fabF 40496 41824 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_23210 41821 43275 gene locus_tag LOCUS_23220 41821 43275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 43263 44270 gene locus_tag LOCUS_23230 43263 44270 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 protein_id gnl|my_center|LOCUS_23230 44263 45222 gene locus_tag LOCUS_23240 44263 45222 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_23240 46814 45336 gene locus_tag LOCUS_23250 gene purF 46814 45336 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937472.1 protein_id gnl|my_center|LOCUS_23250 47312 46935 gene locus_tag LOCUS_23260 47312 46935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 48371 47319 gene locus_tag LOCUS_23270 48371 47319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 51633 48397 gene locus_tag LOCUS_23280 gene carB 51633 48397 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937473.1 protein_id gnl|my_center|LOCUS_23280 52300 51707 gene locus_tag LOCUS_23290 52300 51707 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599821.1 protein_id gnl|my_center|LOCUS_23290 52579 52310 gene locus_tag LOCUS_23300 52579 52310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 53299 52610 gene locus_tag LOCUS_23310 53299 52610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 >Feature sequence20 341 568 gene locus_tag LOCUS_23320 341 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 1772 525 gene locus_tag LOCUS_23330 1772 525 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_23330 2304 1903 gene locus_tag LOCUS_23340 2304 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 2841 2548 gene locus_tag LOCUS_23350 2841 2548 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582790.1 protein_id gnl|my_center|LOCUS_23350 3149 2946 gene locus_tag LOCUS_23360 3149 2946 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106983.1 protein_id gnl|my_center|LOCUS_23360 3646 5949 gene locus_tag LOCUS_23370 3646 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 6066 9167 gene locus_tag LOCUS_23380 6066 9167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 9495 10931 gene locus_tag LOCUS_23390 gene gndA 9495 10931 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056424.1 protein_id gnl|my_center|LOCUS_23390 10988 12559 gene locus_tag LOCUS_23400 gene zwf 10988 12559 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_23400 13986 12733 gene locus_tag LOCUS_23410 13986 12733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 16889 14250 gene locus_tag LOCUS_23420 gene alaS 16889 14250 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_23420 17938 16886 gene locus_tag LOCUS_23430 gene recA 17938 16886 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_23430 18621 18046 gene locus_tag LOCUS_23440 gene thpR 18621 18046 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876222.1 protein_id gnl|my_center|LOCUS_23440 19922 18639 gene locus_tag LOCUS_23450 19922 18639 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940819.1 protein_id gnl|my_center|LOCUS_23450 20347 19907 gene locus_tag LOCUS_23460 20347 19907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 20695 20516 gene locus_tag LOCUS_23470 20695 20516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 21001 22056 gene locus_tag LOCUS_23480 gene queA 21001 22056 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583955.1 protein_id gnl|my_center|LOCUS_23480 22774 22061 gene locus_tag LOCUS_23490 22774 22061 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965197.1 protein_id gnl|my_center|LOCUS_23490 23448 24998 gene locus_tag LOCUS_23500 23448 24998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 25062 26381 gene locus_tag LOCUS_23510 25062 26381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 26425 27399 gene locus_tag LOCUS_23520 26425 27399 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894961.1 protein_id gnl|my_center|LOCUS_23520 28540 27533 gene locus_tag LOCUS_23530 28540 27533 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258144.1 protein_id gnl|my_center|LOCUS_23530 29875 28661 gene locus_tag LOCUS_23540 29875 28661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 30186 29914 gene locus_tag LOCUS_23550 30186 29914 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125708.1 protein_id gnl|my_center|LOCUS_23550 31683 30220 gene locus_tag LOCUS_23560 gene guaB 31683 30220 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_23560 32065 32334 gene locus_tag LOCUS_23570 32065 32334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 33102 32344 gene locus_tag LOCUS_23580 33102 32344 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027371.1 protein_id gnl|my_center|LOCUS_23580 34181 33144 gene locus_tag LOCUS_23590 gene hypE 34181 33144 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388058.1 protein_id gnl|my_center|LOCUS_23590 34321 35118 gene locus_tag LOCUS_23600 34321 35118 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545667.1 protein_id gnl|my_center|LOCUS_23600 35195 35479 gene locus_tag LOCUS_23610 35195 35479 CDS product PxxKW family cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942657.1 protein_id gnl|my_center|LOCUS_23610 36733 35540 gene locus_tag LOCUS_23620 36733 35540 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_23620 36831 37664 gene locus_tag LOCUS_23630 36831 37664 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_23630 37911 38762 gene locus_tag LOCUS_23640 gene fdhD 37911 38762 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037498.1 protein_id gnl|my_center|LOCUS_23640 38920 39936 gene locus_tag LOCUS_23650 38920 39936 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546361.1 protein_id gnl|my_center|LOCUS_23650 40252 41946 gene locus_tag LOCUS_23660 40252 41946 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259854.1 protein_id gnl|my_center|LOCUS_23660 42244 43509 gene locus_tag LOCUS_23670 42244 43509 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_23670 43549 44403 gene locus_tag LOCUS_23680 43549 44403 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_23680 44400 45368 gene locus_tag LOCUS_23690 44400 45368 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546311.1 protein_id gnl|my_center|LOCUS_23690 45365 46126 gene locus_tag LOCUS_23700 45365 46126 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085709.1 protein_id gnl|my_center|LOCUS_23700 46183 46893 gene locus_tag LOCUS_23710 46183 46893 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763250.1 protein_id gnl|my_center|LOCUS_23710 47118 47543 gene locus_tag LOCUS_23720 gene rplM 47118 47543 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583377.1 protein_id gnl|my_center|LOCUS_23720 47568 47963 gene locus_tag LOCUS_23730 gene rpsI 47568 47963 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943504.1 protein_id gnl|my_center|LOCUS_23730 48219 49256 gene locus_tag LOCUS_23740 gene argC 48219 49256 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_23740 49660 50475 gene locus_tag LOCUS_23750 gene truA 49660 50475 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_23750 51709 50507 gene locus_tag LOCUS_23760 gene waaC 51709 50507 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_23760 >Feature sequence21 295 219 gene locus_tag LOCUS_t00370 295 219 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 385 309 gene locus_tag LOCUS_t00380 385 309 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 484 400 gene locus_tag LOCUS_t00390 484 400 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 596 522 gene locus_tag LOCUS_t00400 596 522 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 916 1983 gene locus_tag LOCUS_23770 gene prfB 916 1983 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_23770 1998 2480 gene locus_tag LOCUS_23780 1998 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 2948 2493 gene locus_tag LOCUS_23790 2948 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 3112 3390 gene locus_tag LOCUS_23800 3112 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 4055 3435 gene locus_tag LOCUS_23810 gene thiE 4055 3435 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022682.1 protein_id gnl|my_center|LOCUS_23810 4861 4052 gene locus_tag LOCUS_23820 gene thiM 4861 4052 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022683.1 protein_id gnl|my_center|LOCUS_23820 6555 4858 gene locus_tag LOCUS_23830 6555 4858 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_23830 6683 8416 gene locus_tag LOCUS_23840 gene polX 6683 8416 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_23840 8536 10323 gene locus_tag LOCUS_23850 8536 10323 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_23850 10636 11253 gene locus_tag LOCUS_23860 10636 11253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 11899 11450 gene locus_tag LOCUS_23870 11899 11450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 12173 13009 gene locus_tag LOCUS_23880 gene rpsB 12173 13009 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942566.1 protein_id gnl|my_center|LOCUS_23880 13124 13720 gene locus_tag LOCUS_23890 gene tsf 13124 13720 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583563.1 protein_id gnl|my_center|LOCUS_23890 13795 14520 gene locus_tag LOCUS_23900 gene pyrH 13795 14520 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_23900 14510 15067 gene locus_tag LOCUS_23910 gene frr 14510 15067 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545660.1 protein_id gnl|my_center|LOCUS_23910 15151 15906 gene locus_tag LOCUS_23920 15151 15906 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964194.1 protein_id gnl|my_center|LOCUS_23920 16166 16918 gene locus_tag LOCUS_23930 16166 16918 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346925.1 protein_id gnl|my_center|LOCUS_23930 16921 17721 gene locus_tag LOCUS_23940 16921 17721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 18917 17829 gene locus_tag LOCUS_23950 gene hypD 18917 17829 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940977.1 protein_id gnl|my_center|LOCUS_23950 19125 18904 gene locus_tag LOCUS_23960 19125 18904 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878866.1 protein_id gnl|my_center|LOCUS_23960 21631 19301 gene locus_tag LOCUS_23970 gene hypF 21631 19301 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258631.1 protein_id gnl|my_center|LOCUS_23970 22115 22492 gene locus_tag LOCUS_23980 22115 22492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 22965 22615 gene locus_tag LOCUS_23990 22965 22615 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938183.1 protein_id gnl|my_center|LOCUS_23990 23212 22946 gene locus_tag LOCUS_24000 23212 22946 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938182.1 protein_id gnl|my_center|LOCUS_24000 24282 23221 gene locus_tag LOCUS_24010 24282 23221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 25635 24436 gene locus_tag LOCUS_24020 gene argJ 25635 24436 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942692.1 protein_id gnl|my_center|LOCUS_24020 26499 25762 gene locus_tag LOCUS_24030 gene sfsA 26499 25762 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057534.1 protein_id gnl|my_center|LOCUS_24030 27895 26699 gene locus_tag LOCUS_24040 gene larC 27895 26699 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393989.1 protein_id gnl|my_center|LOCUS_24040 29120 27867 gene locus_tag LOCUS_24050 29120 27867 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_24050 30376 29117 gene locus_tag LOCUS_24060 30376 29117 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_24060 32985 30532 gene locus_tag LOCUS_24070 gene lon 32985 30532 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943811.1 protein_id gnl|my_center|LOCUS_24070 33185 34225 gene locus_tag LOCUS_24080 33185 34225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24080 34231 34806 gene locus_tag LOCUS_24090 34231 34806 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880963.1 protein_id gnl|my_center|LOCUS_24090 34810 35349 gene locus_tag LOCUS_24100 34810 35349 CDS product C-GCAxxG-C-C family (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813157.1 protein_id gnl|my_center|LOCUS_24100 35524 36507 gene locus_tag LOCUS_24110 gene trpS 35524 36507 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942477.1 protein_id gnl|my_center|LOCUS_24110 36571 37341 gene locus_tag LOCUS_24120 36571 37341 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_24120 37399 38343 gene locus_tag LOCUS_24130 37399 38343 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_24130 40446 38683 gene locus_tag LOCUS_24140 gene mutL 40446 38683 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139982.1 protein_id gnl|my_center|LOCUS_24140 40637 40810 gene locus_tag LOCUS_24150 40637 40810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 40816 41565 gene locus_tag LOCUS_24160 gene rph 40816 41565 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392056.1 protein_id gnl|my_center|LOCUS_24160 41544 42218 gene locus_tag LOCUS_24170 41544 42218 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_24170 42195 42272 gene locus_tag LOCUS_t00410 42195 42272 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 42586 43356 gene locus_tag LOCUS_24180 42586 43356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 43359 45059 gene locus_tag LOCUS_24190 43359 45059 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943734.1 protein_id gnl|my_center|LOCUS_24190 45205 45281 gene locus_tag LOCUS_t00420 45205 45281 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 46032 45718 gene locus_tag LOCUS_24200 46032 45718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 46832 46491 gene locus_tag LOCUS_24210 46832 46491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 47029 47295 gene locus_tag LOCUS_24220 47029 47295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24220 47265 47492 gene locus_tag LOCUS_24230 47265 47492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24230 >Feature sequence22 420 190 gene locus_tag LOCUS_24240 420 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 787 452 gene locus_tag LOCUS_24250 787 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 1221 3212 gene locus_tag LOCUS_24260 1221 3212 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056499.1 protein_id gnl|my_center|LOCUS_24260 3479 3817 gene locus_tag LOCUS_24270 3479 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 4072 3863 gene locus_tag LOCUS_24280 4072 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 3959 4939 gene locus_tag LOCUS_24290 gene moaA 3959 4939 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_24290 5125 6048 gene locus_tag LOCUS_24300 5125 6048 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943320.1 protein_id gnl|my_center|LOCUS_24300 6117 7757 gene locus_tag LOCUS_24310 6117 7757 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943319.1 protein_id gnl|my_center|LOCUS_24310 7838 8302 gene locus_tag LOCUS_24320 7838 8302 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392135.1 protein_id gnl|my_center|LOCUS_24320 9419 8265 gene locus_tag LOCUS_24330 9419 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 10111 9473 gene locus_tag LOCUS_24340 10111 9473 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184839.1 protein_id gnl|my_center|LOCUS_24340 11826 10108 gene locus_tag LOCUS_24350 11826 10108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 14152 12191 gene locus_tag LOCUS_24360 14152 12191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 14479 14255 gene locus_tag LOCUS_24370 14479 14255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 16181 14628 gene locus_tag LOCUS_24380 16181 14628 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_24380 17092 18669 gene locus_tag LOCUS_24390 17092 18669 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582712.1 protein_id gnl|my_center|LOCUS_24390 19597 18806 gene locus_tag LOCUS_24400 19597 18806 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545867.1 protein_id gnl|my_center|LOCUS_24400 20570 19614 gene locus_tag LOCUS_24410 20570 19614 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941035.1 protein_id gnl|my_center|LOCUS_24410 21346 20567 gene locus_tag LOCUS_24420 21346 20567 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_24420 22244 21354 gene locus_tag LOCUS_24430 gene prmA 22244 21354 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941115.1 protein_id gnl|my_center|LOCUS_24430 23223 22618 gene locus_tag LOCUS_24440 23223 22618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 23447 24598 gene locus_tag LOCUS_24450 23447 24598 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208869.1 protein_id gnl|my_center|LOCUS_24450 25199 24744 gene locus_tag LOCUS_24460 25199 24744 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_24460 25704 25306 gene locus_tag LOCUS_24470 25704 25306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 26711 25701 gene locus_tag LOCUS_24480 26711 25701 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_24480 27454 26828 gene locus_tag LOCUS_24490 gene rpsD 27454 26828 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_24490 27970 27575 gene locus_tag LOCUS_24500 gene rpsK 27970 27575 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_24500 28354 27980 gene locus_tag LOCUS_24510 gene rpsM 28354 27980 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943462.1 protein_id gnl|my_center|LOCUS_24510 28737 28519 gene locus_tag LOCUS_24520 gene infA 28737 28519 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040194.1 protein_id gnl|my_center|LOCUS_24520 29587 28841 gene locus_tag LOCUS_24530 gene map 29587 28841 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393915.1 protein_id gnl|my_center|LOCUS_24530 30293 29646 gene locus_tag LOCUS_24540 30293 29646 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_24540 31707 30394 gene locus_tag LOCUS_24550 gene secY 31707 30394 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_24550 31987 31709 gene locus_tag LOCUS_24560 31987 31709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 32356 32162 gene locus_tag LOCUS_24570 gene rpmD 32356 32162 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156497.1 protein_id gnl|my_center|LOCUS_24570 32878 32381 gene locus_tag LOCUS_24580 gene rpsE 32878 32381 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943469.1 protein_id gnl|my_center|LOCUS_24580 33296 32928 gene locus_tag LOCUS_24590 gene rplR 33296 32928 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943470.1 protein_id gnl|my_center|LOCUS_24590 33910 33371 gene locus_tag LOCUS_24600 gene rplF 33910 33371 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943471.1 protein_id gnl|my_center|LOCUS_24600 34359 33961 gene locus_tag LOCUS_24610 gene rpsH 34359 33961 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545222.1 protein_id gnl|my_center|LOCUS_24610 34703 34518 gene locus_tag LOCUS_24620 34703 34518 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938611.1 protein_id gnl|my_center|LOCUS_24620 35256 34717 gene locus_tag LOCUS_24630 gene rplE 35256 34717 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_24630 35614 35264 gene locus_tag LOCUS_24640 gene rplX 35614 35264 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938609.1 protein_id gnl|my_center|LOCUS_24640 35991 35623 gene locus_tag LOCUS_24650 gene rplN 35991 35623 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938608.1 protein_id gnl|my_center|LOCUS_24650 36330 36070 gene locus_tag LOCUS_24660 gene rpsQ 36330 36070 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943477.1 protein_id gnl|my_center|LOCUS_24660 36568 36365 gene locus_tag LOCUS_24670 gene rpmC 36568 36365 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288664.1 protein_id gnl|my_center|LOCUS_24670 36933 36565 gene locus_tag LOCUS_24680 gene rplP 36933 36565 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_24680 37668 37018 gene locus_tag LOCUS_24690 gene rpsC 37668 37018 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_24690 38125 37790 gene locus_tag LOCUS_24700 gene rplV 38125 37790 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943481.1 protein_id gnl|my_center|LOCUS_24700 38445 38161 gene locus_tag LOCUS_24710 gene rpsS 38445 38161 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_24710 39337 38516 gene locus_tag LOCUS_24720 gene rplB 39337 38516 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_24720 39679 39389 gene locus_tag LOCUS_24730 gene rplW 39679 39389 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_24730 40299 39676 gene locus_tag LOCUS_24740 gene rplD 40299 39676 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_24740 40927 40319 gene locus_tag LOCUS_24750 gene rplC 40927 40319 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943486.1 protein_id gnl|my_center|LOCUS_24750 41310 41002 gene locus_tag LOCUS_24760 gene rpsJ 41310 41002 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_24760 41455 41324 gene locus_tag LOCUS_24770 41455 41324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 >Feature sequence23 317 1225 gene locus_tag LOCUS_24780 317 1225 CDS product IS1595-like element ISRsp21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076611897.1 protein_id gnl|my_center|LOCUS_24780 2335 1385 gene locus_tag LOCUS_24790 2335 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 3727 2738 gene locus_tag LOCUS_24800 3727 2738 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_24800 4101 5447 gene locus_tag LOCUS_24810 4101 5447 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669361.1 protein_id gnl|my_center|LOCUS_24810 5440 6063 gene locus_tag LOCUS_24820 5440 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 6060 7832 gene locus_tag LOCUS_24830 6060 7832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 7832 8287 gene locus_tag LOCUS_24840 7832 8287 CDS product ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871651.1 protein_id gnl|my_center|LOCUS_24840 8292 8966 gene locus_tag LOCUS_24850 8292 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 8978 9655 gene locus_tag LOCUS_24860 8978 9655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 9630 11447 gene locus_tag LOCUS_24870 9630 11447 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669362.1 protein_id gnl|my_center|LOCUS_24870 11559 13184 gene locus_tag LOCUS_24880 11559 13184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 13699 13259 gene locus_tag LOCUS_24890 13699 13259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 14338 13721 gene locus_tag LOCUS_24900 14338 13721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 16634 14547 gene locus_tag LOCUS_24910 16634 14547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24910 16995 16663 gene locus_tag LOCUS_24920 16995 16663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24920 18030 17017 gene locus_tag LOCUS_24930 18030 17017 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788929.1 protein_id gnl|my_center|LOCUS_24930 18227 18430 gene locus_tag LOCUS_24940 18227 18430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 18616 19407 gene locus_tag LOCUS_24950 18616 19407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 19600 20169 gene locus_tag LOCUS_24960 19600 20169 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393334.1 protein_id gnl|my_center|LOCUS_24960 20195 21403 gene locus_tag LOCUS_24970 gene tyrS 20195 21403 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941800.1 protein_id gnl|my_center|LOCUS_24970 21616 22659 gene locus_tag LOCUS_24980 21616 22659 CDS product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941752.1 protein_id gnl|my_center|LOCUS_24980 23511 22804 gene locus_tag LOCUS_24990 23511 22804 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939178.1 protein_id gnl|my_center|LOCUS_24990 24031 23516 gene locus_tag LOCUS_25000 24031 23516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 23930 24193 gene locus_tag LOCUS_25010 23930 24193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 24267 24446 gene locus_tag LOCUS_25020 24267 24446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 24927 25910 gene locus_tag LOCUS_25030 24927 25910 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939260.1 protein_id gnl|my_center|LOCUS_25030 25927 26778 gene locus_tag LOCUS_25040 25927 26778 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939259.1 protein_id gnl|my_center|LOCUS_25040 27826 26909 gene locus_tag LOCUS_25050 27826 26909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25050 28595 27792 gene locus_tag LOCUS_25060 gene cdaA 28595 27792 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_25060 29471 28626 gene locus_tag LOCUS_25070 gene folP 29471 28626 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_25070 31407 29533 gene locus_tag LOCUS_25080 gene ftsH 31407 29533 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_25080 31777 31559 gene locus_tag LOCUS_25090 31777 31559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 31857 32534 gene locus_tag LOCUS_25100 31857 32534 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083101.1 protein_id gnl|my_center|LOCUS_25100 32798 32589 gene locus_tag LOCUS_25110 32798 32589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 33374 33547 gene locus_tag LOCUS_25120 33374 33547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 33711 33935 gene locus_tag LOCUS_25130 33711 33935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 34073 34543 gene locus_tag LOCUS_25140 34073 34543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 34760 36325 gene locus_tag LOCUS_25150 gene terL 34760 36325 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323343.1 protein_id gnl|my_center|LOCUS_25150 36344 36925 gene locus_tag LOCUS_25160 36344 36925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 36922 38133 gene locus_tag LOCUS_25170 36922 38133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 38130 39209 gene locus_tag LOCUS_25180 38130 39209 CDS product phage protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939978.1 protein_id gnl|my_center|LOCUS_25180 39212 39610 gene locus_tag LOCUS_25190 39212 39610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 39625 40521 gene locus_tag LOCUS_25200 39625 40521 CDS product Mu-like prophage major head subunit gpT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142982.1 protein_id gnl|my_center|LOCUS_25200 40659 40862 gene locus_tag LOCUS_25210 40659 40862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 >Feature sequence24 3 2024 gene locus_tag LOCUS_25220 gene cooS 3 2024 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_25220 2677 3030 gene locus_tag LOCUS_25230 2677 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 3190 3020 gene locus_tag LOCUS_25240 3190 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 3214 4266 gene locus_tag LOCUS_25250 gene mnmA 3214 4266 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256566.1 protein_id gnl|my_center|LOCUS_25250 4263 5597 gene locus_tag LOCUS_25260 gene mtaB 4263 5597 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_25260 6677 5754 gene locus_tag LOCUS_25270 gene lpxC 6677 5754 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073895.1 protein_id gnl|my_center|LOCUS_25270 6996 7796 gene locus_tag LOCUS_25280 6996 7796 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545667.1 protein_id gnl|my_center|LOCUS_25280 7793 8206 gene locus_tag LOCUS_25290 7793 8206 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_25290 8301 9137 gene locus_tag LOCUS_25300 8301 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 9169 9957 gene locus_tag LOCUS_25310 gene udp 9169 9957 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250430.1 protein_id gnl|my_center|LOCUS_25310 10033 10956 gene locus_tag LOCUS_25320 10033 10956 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258713.1 protein_id gnl|my_center|LOCUS_25320 12518 11250 gene locus_tag LOCUS_25330 gene rho 12518 11250 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_25330 13530 12919 gene locus_tag LOCUS_25340 gene coaE 13530 12919 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579584.1 protein_id gnl|my_center|LOCUS_25340 14483 13524 gene locus_tag LOCUS_25350 14483 13524 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_25350 15517 14492 gene locus_tag LOCUS_25360 15517 14492 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919677.1 protein_id gnl|my_center|LOCUS_25360 16075 15581 gene locus_tag LOCUS_25370 16075 15581 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_25370 16360 17727 gene locus_tag LOCUS_25380 gene xseA 16360 17727 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_25380 17720 17968 gene locus_tag LOCUS_25390 17720 17968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 17998 18888 gene locus_tag LOCUS_25400 17998 18888 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_25400 18969 20870 gene locus_tag LOCUS_25410 gene dxs 18969 20870 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_25410 21194 21400 gene locus_tag LOCUS_25420 21194 21400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 23268 21397 gene locus_tag LOCUS_25430 23268 21397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 23842 23525 gene locus_tag LOCUS_25440 23842 23525 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940042.1 protein_id gnl|my_center|LOCUS_25440 25441 24029 gene locus_tag LOCUS_25450 25441 24029 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_25450 26346 25552 gene locus_tag LOCUS_25460 26346 25552 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351753.1 protein_id gnl|my_center|LOCUS_25460 26887 26402 gene locus_tag LOCUS_25470 26887 26402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 28660 26888 gene locus_tag LOCUS_25480 28660 26888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 29119 28829 gene locus_tag LOCUS_25490 29119 28829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 29407 29150 gene locus_tag LOCUS_25500 29407 29150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 29645 30121 gene locus_tag LOCUS_25510 29645 30121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 30733 30170 gene locus_tag LOCUS_25520 30733 30170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 31975 30782 gene locus_tag LOCUS_25530 31975 30782 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459196.1 protein_id gnl|my_center|LOCUS_25530 32553 31996 gene locus_tag LOCUS_25540 32553 31996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 >Feature sequence25 530 1498 gene locus_tag LOCUS_25550 530 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 2824 1712 gene locus_tag LOCUS_25560 2824 1712 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941750.1 protein_id gnl|my_center|LOCUS_25560 3861 2878 gene locus_tag LOCUS_25570 3861 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 4121 3858 gene locus_tag LOCUS_25580 4121 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 5449 4175 gene locus_tag LOCUS_25590 5449 4175 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_25590 6395 5433 gene locus_tag LOCUS_25600 6395 5433 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_25600 6740 7186 gene locus_tag LOCUS_25610 6740 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 9812 7386 gene locus_tag LOCUS_25620 9812 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 10422 9832 gene locus_tag LOCUS_25630 10422 9832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 10635 11978 gene locus_tag LOCUS_25640 10635 11978 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545535.1 protein_id gnl|my_center|LOCUS_25640 12053 12295 gene locus_tag LOCUS_25650 12053 12295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 12346 12669 gene locus_tag LOCUS_25660 12346 12669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 12736 13122 gene locus_tag LOCUS_25670 12736 13122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 13115 13624 gene locus_tag LOCUS_25680 gene tadA 13115 13624 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940742.1 protein_id gnl|my_center|LOCUS_25680 13645 13738 gene locus_tag LOCUS_t00430 13645 13738 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13810 13902 gene locus_tag LOCUS_t00440 13810 13902 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 14577 13942 gene locus_tag LOCUS_25690 14577 13942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 15860 14574 gene locus_tag LOCUS_25700 15860 14574 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100874.1 protein_id gnl|my_center|LOCUS_25700 16392 16183 gene locus_tag LOCUS_25710 16392 16183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25710 18839 16533 gene locus_tag LOCUS_25720 18839 16533 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_25720 19630 19001 gene locus_tag LOCUS_25730 19630 19001 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222251.1 protein_id gnl|my_center|LOCUS_25730 20711 19764 gene locus_tag LOCUS_25740 20711 19764 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_25740 20889 22121 gene locus_tag LOCUS_25750 20889 22121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 23463 22372 gene locus_tag LOCUS_25760 23463 22372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 23948 23529 gene locus_tag LOCUS_25770 23948 23529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 24767 24096 gene locus_tag LOCUS_25780 24767 24096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 25803 24847 gene locus_tag LOCUS_25790 25803 24847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 26470 25793 gene locus_tag LOCUS_25800 26470 25793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878811.1 protein_id gnl|my_center|LOCUS_25800 27300 26476 gene locus_tag LOCUS_25810 27300 26476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 27377 28168 gene locus_tag LOCUS_25820 27377 28168 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391597.1 protein_id gnl|my_center|LOCUS_25820 29426 28260 gene locus_tag LOCUS_25830 29426 28260 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_25830 30691 29441 gene locus_tag LOCUS_25840 30691 29441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 32251 30800 gene locus_tag LOCUS_25850 32251 30800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 >Feature sequence26 173 1240 gene locus_tag LOCUS_25860 173 1240 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986837.1 protein_id gnl|my_center|LOCUS_25860 1227 4997 gene locus_tag LOCUS_25870 gene cobN 1227 4997 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932109.1 protein_id gnl|my_center|LOCUS_25870 5494 7824 gene locus_tag LOCUS_25880 5494 7824 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545674.1 protein_id gnl|my_center|LOCUS_25880 7925 8962 gene locus_tag LOCUS_25890 7925 8962 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022139.1 protein_id gnl|my_center|LOCUS_25890 8949 10019 gene locus_tag LOCUS_25900 8949 10019 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_25900 10016 10888 gene locus_tag LOCUS_25910 10016 10888 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_25910 11395 11646 gene locus_tag LOCUS_25920 11395 11646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 11586 11933 gene locus_tag LOCUS_25930 11586 11933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 12312 14624 gene locus_tag LOCUS_25940 12312 14624 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545674.1 protein_id gnl|my_center|LOCUS_25940 14637 15584 gene locus_tag LOCUS_25950 14637 15584 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924841.1 protein_id gnl|my_center|LOCUS_25950 15581 16579 gene locus_tag LOCUS_25960 15581 16579 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545600.1 protein_id gnl|my_center|LOCUS_25960 16576 17343 gene locus_tag LOCUS_25970 16576 17343 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546427.1 protein_id gnl|my_center|LOCUS_25970 17613 21527 gene locus_tag LOCUS_25980 gene cobN 17613 21527 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020916.1 protein_id gnl|my_center|LOCUS_25980 >Feature sequence27 849 322 gene locus_tag LOCUS_25990 849 322 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938827.1 protein_id gnl|my_center|LOCUS_25990 1376 846 gene locus_tag LOCUS_26000 1376 846 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938826.1 protein_id gnl|my_center|LOCUS_26000 2018 1410 gene locus_tag LOCUS_26010 gene prxU 2018 1410 CDS product selenocysteine-containing peroxiredoxin PrxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q9L3Q5 protein_id gnl|my_center|LOCUS_26010 2763 2065 gene locus_tag LOCUS_26020 2763 2065 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057804.1 protein_id gnl|my_center|LOCUS_26020 3095 5524 gene locus_tag LOCUS_26030 3095 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 7325 5613 gene locus_tag LOCUS_26040 7325 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 7625 7700 gene locus_tag LOCUS_t00450 7625 7700 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 8383 12069 gene locus_tag LOCUS_26050 8383 12069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 12053 14053 gene locus_tag LOCUS_26060 12053 14053 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013008044.1 protein_id gnl|my_center|LOCUS_26060 14308 14511 gene locus_tag LOCUS_26070 14308 14511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 15335 14589 gene locus_tag LOCUS_26080 gene gpmA 15335 14589 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942257.1 protein_id gnl|my_center|LOCUS_26080 15568 16521 gene locus_tag LOCUS_26090 15568 16521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 16990 16676 gene locus_tag LOCUS_26100 16990 16676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 16871 18355 gene locus_tag LOCUS_26110 16871 18355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 18465 19355 gene locus_tag LOCUS_26120 18465 19355 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_26120 19533 19991 gene locus_tag LOCUS_26130 19533 19991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 20043 20792 gene locus_tag LOCUS_26140 20043 20792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 21024 21749 gene locus_tag LOCUS_26150 21024 21749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 >Feature sequence28 1471 518 gene locus_tag LOCUS_26160 1471 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 5201 1509 gene locus_tag LOCUS_26170 5201 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 7222 5222 gene locus_tag LOCUS_26180 7222 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258039.1 protein_id gnl|my_center|LOCUS_26180 10026 7219 gene locus_tag LOCUS_26190 10026 7219 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258038.1 protein_id gnl|my_center|LOCUS_26190 12731 10023 gene locus_tag LOCUS_26200 12731 10023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 13092 12736 gene locus_tag LOCUS_26210 13092 12736 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258036.1 protein_id gnl|my_center|LOCUS_26210 13423 13100 gene locus_tag LOCUS_26220 13423 13100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258035.1 protein_id gnl|my_center|LOCUS_26220 13976 13458 gene locus_tag LOCUS_26230 13976 13458 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258034.1 protein_id gnl|my_center|LOCUS_26230 15106 13976 gene locus_tag LOCUS_26240 15106 13976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258033.1 protein_id gnl|my_center|LOCUS_26240 15458 15099 gene locus_tag LOCUS_26250 15458 15099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258032.1 protein_id gnl|my_center|LOCUS_26250 16114 15455 gene locus_tag LOCUS_26260 16114 15455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258031.1 protein_id gnl|my_center|LOCUS_26260 >Feature sequence29 2265 187 gene locus_tag LOCUS_26270 gene fusA 2265 187 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_26270 2767 2297 gene locus_tag LOCUS_26280 gene rpsG 2767 2297 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938594.1 protein_id gnl|my_center|LOCUS_26280 3172 2801 gene locus_tag LOCUS_26290 gene rpsL 3172 2801 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943491.1 protein_id gnl|my_center|LOCUS_26290 7624 3257 gene locus_tag LOCUS_26300 gene rpoC 7624 3257 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316440.1 protein_id gnl|my_center|LOCUS_26300 11777 7617 gene locus_tag LOCUS_26310 gene rpoB 11777 7617 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943493.1 protein_id gnl|my_center|LOCUS_26310 12244 11858 gene locus_tag LOCUS_26320 gene rplL 12244 11858 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940187.1 protein_id gnl|my_center|LOCUS_26320 12842 12309 gene locus_tag LOCUS_26330 gene rplJ 12842 12309 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943495.1 protein_id gnl|my_center|LOCUS_26330 13584 12871 gene locus_tag LOCUS_26340 gene rplA 13584 12871 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_26340 14037 13615 gene locus_tag LOCUS_26350 gene rplK 14037 13615 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940184.1 protein_id gnl|my_center|LOCUS_26350 14635 14102 gene locus_tag LOCUS_26360 gene nusG 14635 14102 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_26360 15036 14650 gene locus_tag LOCUS_26370 15036 14650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 15336 15260 gene locus_tag LOCUS_t00460 15336 15260 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 15694 15563 gene locus_tag LOCUS_26380 15694 15563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 >Feature sequence30 1189 2613 gene locus_tag LOCUS_26390 1189 2613 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546582.1 protein_id gnl|my_center|LOCUS_26390 2610 3962 gene locus_tag LOCUS_26400 2610 3962 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_26400 6039 4021 gene locus_tag LOCUS_26410 gene lon 6039 4021 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545787.1 protein_id gnl|my_center|LOCUS_26410 6252 6064 gene locus_tag LOCUS_26420 6252 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 6463 7290 gene locus_tag LOCUS_26430 6463 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 7336 8421 gene locus_tag LOCUS_26440 7336 8421 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940556.1 protein_id gnl|my_center|LOCUS_26440 8408 9268 gene locus_tag LOCUS_26450 8408 9268 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545088.1 protein_id gnl|my_center|LOCUS_26450 9392 11941 gene locus_tag LOCUS_26460 9392 11941 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937463.1 protein_id gnl|my_center|LOCUS_26460 12437 12144 gene locus_tag LOCUS_26470 12437 12144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 >Feature sequence31 835 1227 gene locus_tag LOCUS_26480 835 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26480 1321 1812 gene locus_tag LOCUS_26490 1321 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26490 1823 4954 gene locus_tag LOCUS_26500 1823 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 4984 5523 gene locus_tag LOCUS_26510 4984 5523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 5543 6574 gene locus_tag LOCUS_26520 5543 6574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 6578 8095 gene locus_tag LOCUS_26530 6578 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 8092 9114 gene locus_tag LOCUS_26540 8092 9114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 9117 10055 gene locus_tag LOCUS_26550 9117 10055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 10059 11063 gene locus_tag LOCUS_26560 gene cas1 10059 11063 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256457.1 protein_id gnl|my_center|LOCUS_26560 11332 11481 gene locus_tag LOCUS_26570 11332 11481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 11602 11877 gene locus_tag LOCUS_26580 gene cas2 11602 11877 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626042.1 protein_id gnl|my_center|LOCUS_26580 >Feature sequence32 194 355 gene locus_tag LOCUS_26590 194 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26590 410 643 gene locus_tag LOCUS_26600 410 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26600 647 793 gene locus_tag LOCUS_26610 647 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 1094 2701 gene locus_tag LOCUS_26620 1094 2701 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940504.1 protein_id gnl|my_center|LOCUS_26620 2971 4161 gene locus_tag LOCUS_26630 2971 4161 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940505.1 protein_id gnl|my_center|LOCUS_26630 4217 7336 gene locus_tag LOCUS_26640 4217 7336 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940506.1 protein_id gnl|my_center|LOCUS_26640 9647 7464 gene locus_tag LOCUS_26650 9647 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 10048 9749 gene locus_tag LOCUS_26660 10048 9749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 >Feature sequence33 327 1259 gene locus_tag LOCUS_26670 327 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 1267 1920 gene locus_tag LOCUS_26680 1267 1920 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_26680 2132 3127 gene locus_tag LOCUS_26690 2132 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 3171 4700 gene locus_tag LOCUS_26700 3171 4700 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546144.1 protein_id gnl|my_center|LOCUS_26700 4920 6683 gene locus_tag LOCUS_26710 4920 6683 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546477.1 protein_id gnl|my_center|LOCUS_26710 7030 8787 gene locus_tag LOCUS_26720 7030 8787 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546477.1 protein_id gnl|my_center|LOCUS_26720 9437 8928 gene locus_tag LOCUS_26730 9437 8928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 >Feature sequence34 352 89 gene locus_tag LOCUS_26740 352 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 667 371 gene locus_tag LOCUS_26750 667 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 744 2159 gene locus_tag LOCUS_26760 744 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 2822 2448 gene locus_tag LOCUS_26770 2822 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 4075 2936 gene locus_tag LOCUS_26780 gene qmoC 4075 2936 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545389.1 protein_id gnl|my_center|LOCUS_26780 4468 4136 gene locus_tag LOCUS_26790 4468 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 6411 4480 gene locus_tag LOCUS_26800 6411 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 7752 6433 gene locus_tag LOCUS_26810 7752 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 8152 7808 gene locus_tag LOCUS_26820 8152 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 8612 8175 gene locus_tag LOCUS_26830 8612 8175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 8879 8625 gene locus_tag LOCUS_26840 8879 8625 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256473.1 protein_id gnl|my_center|LOCUS_26840 >Feature sequence35 2746 248 gene locus_tag LOCUS_26850 gene leuS 2746 248 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942849.1 protein_id gnl|my_center|LOCUS_26850 3481 2963 gene locus_tag LOCUS_26860 3481 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939305.1 protein_id gnl|my_center|LOCUS_26860 3756 3481 gene locus_tag LOCUS_26870 3756 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 3688 3909 gene locus_tag LOCUS_26880 3688 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 4517 3906 gene locus_tag LOCUS_26890 4517 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26890 6661 4622 gene locus_tag LOCUS_26900 6661 4622 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_26900 6973 7365 gene locus_tag LOCUS_26910 6973 7365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 8586 7585 gene locus_tag LOCUS_26920 8586 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 >Feature sequence36 604 380 gene locus_tag LOCUS_26930 604 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 1261 716 gene locus_tag LOCUS_26940 1261 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26940 2035 1331 gene locus_tag LOCUS_26950 2035 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26950 5207 2202 gene locus_tag LOCUS_26960 5207 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 5608 6495 gene locus_tag LOCUS_26970 5608 6495 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140590772.1 protein_id gnl|my_center|LOCUS_26970 6488 6682 gene locus_tag LOCUS_26980 6488 6682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 >Feature sequence37 3008 3262 gene locus_tag LOCUS_26990 3008 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 3649 4482 gene locus_tag LOCUS_27000 3649 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 5474 4569 gene locus_tag LOCUS_27010 5474 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 7175 5766 gene locus_tag LOCUS_27020 7175 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 >Feature sequence38 1876 1052 gene locus_tag LOCUS_27030 1876 1052 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_27030 3831 3097 gene locus_tag LOCUS_27040 3831 3097 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211328137.1 protein_id gnl|my_center|LOCUS_27040 4667 3831 gene locus_tag LOCUS_27050 4667 3831 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 protein_id gnl|my_center|LOCUS_27050 5713 4664 gene locus_tag LOCUS_27060 5713 4664 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932112.1 protein_id gnl|my_center|LOCUS_27060