>Feature sequence001 304 1209 gene locus_tag LOCUS_00010 304 1209 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096951.1 protein_id gnl|my_center|LOCUS_00010 1231 1776 gene locus_tag LOCUS_00020 1231 1776 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705140.1 protein_id gnl|my_center|LOCUS_00020 3281 1824 gene locus_tag LOCUS_00030 3281 1824 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115383.1 protein_id gnl|my_center|LOCUS_00030 4595 3501 gene locus_tag LOCUS_00040 4595 3501 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816376.1 protein_id gnl|my_center|LOCUS_00040 6525 5050 gene locus_tag LOCUS_00050 gene mnmE 6525 5050 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100248.1 protein_id gnl|my_center|LOCUS_00050 8323 6629 gene locus_tag LOCUS_00060 gene yidC 8323 6629 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401421.1 protein_id gnl|my_center|LOCUS_00060 8508 8326 gene locus_tag LOCUS_00070 8508 8326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8947 8528 gene locus_tag LOCUS_00080 gene rnpA 8947 8528 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207683.1 protein_id gnl|my_center|LOCUS_00080 9078 8944 gene locus_tag LOCUS_00090 9078 8944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9563 10891 gene locus_tag LOCUS_00100 gene dnaA 9563 10891 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115442.1 protein_id gnl|my_center|LOCUS_00100 10911 12065 gene locus_tag LOCUS_00110 gene dnaN 10911 12065 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768226.1 protein_id gnl|my_center|LOCUS_00110 12079 13155 gene locus_tag LOCUS_00120 gene recF 12079 13155 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115479.1 protein_id gnl|my_center|LOCUS_00120 13259 15688 gene locus_tag LOCUS_00130 gene gyrB 13259 15688 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097268.1 protein_id gnl|my_center|LOCUS_00130 15967 17121 gene locus_tag LOCUS_00140 15967 17121 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114061.1 protein_id gnl|my_center|LOCUS_00140 17151 17591 gene locus_tag LOCUS_00150 17151 17591 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207037.1 protein_id gnl|my_center|LOCUS_00150 17607 19040 gene locus_tag LOCUS_00160 17607 19040 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190901.1 protein_id gnl|my_center|LOCUS_00160 19099 19392 gene locus_tag LOCUS_00170 19099 19392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 19539 20396 gene locus_tag LOCUS_00180 19539 20396 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809214.1 protein_id gnl|my_center|LOCUS_00180 21327 20572 gene locus_tag LOCUS_00190 21327 20572 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206915.1 protein_id gnl|my_center|LOCUS_00190 21398 21751 gene locus_tag LOCUS_00200 21398 21751 CDS product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263557.1 protein_id gnl|my_center|LOCUS_00200 >Feature sequence002 116 2260 gene locus_tag LOCUS_00210 gene rlmKL 116 2260 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206194.1 protein_id gnl|my_center|LOCUS_00210 2253 2495 gene locus_tag LOCUS_00220 2253 2495 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071966.1 protein_id gnl|my_center|LOCUS_00220 2959 3342 gene locus_tag LOCUS_00230 gene pilG 2959 3342 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084583.1 protein_id gnl|my_center|LOCUS_00230 3371 3739 gene locus_tag LOCUS_00240 3371 3739 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116220.1 protein_id gnl|my_center|LOCUS_00240 3747 4277 gene locus_tag LOCUS_00250 3747 4277 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084590.1 protein_id gnl|my_center|LOCUS_00250 4345 6465 gene locus_tag LOCUS_00260 gene pilJ 4345 6465 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_00260 6488 7351 gene locus_tag LOCUS_00270 gene pilK 6488 7351 CDS product type 4 fimbrial methyltransferase PilK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100938.1 protein_id gnl|my_center|LOCUS_00270 7413 15113 gene locus_tag LOCUS_00280 7413 15113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 15122 16141 gene locus_tag LOCUS_00290 15122 16141 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118811.1 protein_id gnl|my_center|LOCUS_00290 16153 16656 gene locus_tag LOCUS_00300 16153 16656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 17356 16697 gene locus_tag LOCUS_00310 17356 16697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207559.1 protein_id gnl|my_center|LOCUS_00310 17538 18311 gene locus_tag LOCUS_00320 17538 18311 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124872.1 protein_id gnl|my_center|LOCUS_00320 20405 18303 gene locus_tag LOCUS_00330 20405 18303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 >Feature sequence003 2741 924 gene locus_tag LOCUS_00340 2741 924 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098136.1 protein_id gnl|my_center|LOCUS_00340 4629 2827 gene locus_tag LOCUS_00350 4629 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 5545 4775 gene locus_tag LOCUS_00360 gene gloB 5545 4775 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939287.1 protein_id gnl|my_center|LOCUS_00360 5561 6388 gene locus_tag LOCUS_00370 5561 6388 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814735.1 protein_id gnl|my_center|LOCUS_00370 6396 6848 gene locus_tag LOCUS_00380 gene rnhA 6396 6848 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770770.1 protein_id gnl|my_center|LOCUS_00380 6852 7562 gene locus_tag LOCUS_00390 gene dnaQ 6852 7562 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087958.1 protein_id gnl|my_center|LOCUS_00390 7899 9590 gene locus_tag LOCUS_00400 7899 9590 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206108.1 protein_id gnl|my_center|LOCUS_00400 9590 10393 gene locus_tag LOCUS_00410 gene nudC 9590 10393 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206107.1 protein_id gnl|my_center|LOCUS_00410 10431 11468 gene locus_tag LOCUS_00420 gene sohB 10431 11468 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087997.1 protein_id gnl|my_center|LOCUS_00420 11516 12490 gene locus_tag LOCUS_00430 11516 12490 CDS product DUF2157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071957.1 protein_id gnl|my_center|LOCUS_00430 12483 13541 gene locus_tag LOCUS_00440 12483 13541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 13534 14031 gene locus_tag LOCUS_00450 13534 14031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00450 14183 15565 gene locus_tag LOCUS_00460 gene dbpA 14183 15565 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816168.1 protein_id gnl|my_center|LOCUS_00460 15682 16950 gene locus_tag LOCUS_00470 15682 16950 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119225.1 protein_id gnl|my_center|LOCUS_00470 17323 16922 gene locus_tag LOCUS_00480 17323 16922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 >Feature sequence004 1140 184 gene locus_tag LOCUS_00490 gene lipA 1140 184 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207249.1 protein_id gnl|my_center|LOCUS_00490 1345 3642 gene locus_tag LOCUS_00500 1345 3642 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_00500 4120 3716 gene locus_tag LOCUS_00510 4120 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 4355 4107 gene locus_tag LOCUS_00520 4355 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 5194 4502 gene locus_tag LOCUS_00530 gene lolD 5194 4502 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263326.1 protein_id gnl|my_center|LOCUS_00530 6418 5204 gene locus_tag LOCUS_00540 6418 5204 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963567.1 protein_id gnl|my_center|LOCUS_00540 7611 6421 gene locus_tag LOCUS_00550 7611 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 9057 7669 gene locus_tag LOCUS_00560 9057 7669 CDS product protein CyaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124349.1 protein_id gnl|my_center|LOCUS_00560 9679 10893 gene locus_tag LOCUS_00570 9679 10893 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087747.1 protein_id gnl|my_center|LOCUS_00570 10906 13080 gene locus_tag LOCUS_00580 10906 13080 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_00580 13627 13190 gene locus_tag LOCUS_00590 13627 13190 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117900.1 protein_id gnl|my_center|LOCUS_00590 13966 13891 gene locus_tag LOCUS_t00010 13966 13891 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 14067 13992 gene locus_tag LOCUS_t00020 14067 13992 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence005 <1 1589 gene locus_tag LOCUS_00600 <1 1589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003087940.1:ABC transporter ATP-binding protein 1687 2475 gene locus_tag LOCUS_00610 gene fabI 1687 2475 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368564.1 protein_id gnl|my_center|LOCUS_00610 3320 2532 gene locus_tag LOCUS_00620 3320 2532 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222468.1 protein_id gnl|my_center|LOCUS_00620 5345 3450 gene locus_tag LOCUS_00630 5345 3450 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770757.1 protein_id gnl|my_center|LOCUS_00630 5699 5424 gene locus_tag LOCUS_00640 5699 5424 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_00640 6018 6827 gene locus_tag LOCUS_00650 6018 6827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 6830 7774 gene locus_tag LOCUS_00660 6830 7774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 8255 7836 gene locus_tag LOCUS_00670 8255 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 8688 9305 gene locus_tag LOCUS_00680 8688 9305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 9639 9325 gene locus_tag LOCUS_00690 9639 9325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 10237 9695 gene locus_tag LOCUS_00700 10237 9695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 10326 10853 gene locus_tag LOCUS_00710 10326 10853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 11678 10971 gene locus_tag LOCUS_00720 gene fkpA 11678 10971 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704938.1 protein_id gnl|my_center|LOCUS_00720 12840 11797 gene locus_tag LOCUS_00730 12840 11797 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419507.1 protein_id gnl|my_center|LOCUS_00730 13847 12990 gene locus_tag LOCUS_00740 13847 12990 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087258.1 protein_id gnl|my_center|LOCUS_00740 >Feature sequence006 968 2215 gene locus_tag LOCUS_00750 968 2215 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524713.1 protein_id gnl|my_center|LOCUS_00750 2264 3664 gene locus_tag LOCUS_00760 2264 3664 CDS product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012468297.1 protein_id gnl|my_center|LOCUS_00760 3690 7442 gene locus_tag LOCUS_00770 3690 7442 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032878.1 protein_id gnl|my_center|LOCUS_00770 7442 8965 gene locus_tag LOCUS_00780 gene narH 7442 8965 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205549.1 protein_id gnl|my_center|LOCUS_00780 8958 9614 gene locus_tag LOCUS_00790 gene narJ 8958 9614 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009971854.1 protein_id gnl|my_center|LOCUS_00790 9616 10311 gene locus_tag LOCUS_00800 gene narI 9616 10311 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105305.1 protein_id gnl|my_center|LOCUS_00800 10323 10787 gene locus_tag LOCUS_00810 10323 10787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 10921 11586 gene locus_tag LOCUS_00820 gene ytfE 10921 11586 CDS product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210159.1 protein_id gnl|my_center|LOCUS_00820 11591 12151 gene locus_tag LOCUS_00830 11591 12151 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617714.1 protein_id gnl|my_center|LOCUS_00830 12301 13059 gene locus_tag LOCUS_00840 12301 13059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 13595 13107 gene locus_tag LOCUS_00850 13595 13107 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087757.1 protein_id gnl|my_center|LOCUS_00850 <14536 13774 gene locus_tag LOCUS_00860 <14536 13774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002121430.1:AraC family transcriptional regulator >Feature sequence007 811 491 gene locus_tag LOCUS_00870 gene sugE 811 491 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705814.1 protein_id gnl|my_center|LOCUS_00870 1039 824 gene locus_tag LOCUS_00880 1039 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 2064 1036 gene locus_tag LOCUS_00890 2064 1036 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227821.1 protein_id gnl|my_center|LOCUS_00890 2386 2129 gene locus_tag LOCUS_00900 2386 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 3714 2476 gene locus_tag LOCUS_00910 gene nqrF 3714 2476 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113984.1 protein_id gnl|my_center|LOCUS_00910 4346 3729 gene locus_tag LOCUS_00920 gene nqrE 4346 3729 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 protein_id gnl|my_center|LOCUS_00920 5029 4358 gene locus_tag LOCUS_00930 gene nqrD 5029 4358 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119802.1 protein_id gnl|my_center|LOCUS_00930 5816 5031 gene locus_tag LOCUS_00940 5816 5031 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105182.1 protein_id gnl|my_center|LOCUS_00940 7083 5809 gene locus_tag LOCUS_00950 7083 5809 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109478.1 protein_id gnl|my_center|LOCUS_00950 8421 7087 gene locus_tag LOCUS_00960 8421 7087 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113983.1 protein_id gnl|my_center|LOCUS_00960 10164 8698 gene locus_tag LOCUS_00970 10164 8698 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207354.1 protein_id gnl|my_center|LOCUS_00970 10581 10327 gene locus_tag LOCUS_00980 10581 10327 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091898.1 protein_id gnl|my_center|LOCUS_00980 11414 10575 gene locus_tag LOCUS_00990 11414 10575 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900432.1 protein_id gnl|my_center|LOCUS_00990 11737 13098 gene locus_tag LOCUS_01000 11737 13098 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206633.1 protein_id gnl|my_center|LOCUS_01000 >Feature sequence008 <1 1227 gene locus_tag LOCUS_01010 <1 1227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268198.1:HlyD family type I secretion periplasmic adaptor subunit 1707 1267 gene locus_tag LOCUS_01020 1707 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 2065 3849 gene locus_tag LOCUS_01030 2065 3849 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207624.1 protein_id gnl|my_center|LOCUS_01030 4126 5901 gene locus_tag LOCUS_01040 4126 5901 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116088.1 protein_id gnl|my_center|LOCUS_01040 6058 7077 gene locus_tag LOCUS_01050 6058 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 7067 8092 gene locus_tag LOCUS_01060 7067 8092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 10259 8082 gene locus_tag LOCUS_01070 10259 8082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 10554 12791 gene locus_tag LOCUS_01080 10554 12791 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444419.1 protein_id gnl|my_center|LOCUS_01080 >Feature sequence009 412 1845 gene locus_tag LOCUS_01090 gene phrB 412 1845 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209655.1 protein_id gnl|my_center|LOCUS_01090 1956 2672 gene locus_tag LOCUS_01100 1956 2672 CDS product YdiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209462.1 protein_id gnl|my_center|LOCUS_01100 3979 2717 gene locus_tag LOCUS_01110 gene icd 3979 2717 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090436.1 protein_id gnl|my_center|LOCUS_01110 4179 4751 gene locus_tag LOCUS_01120 4179 4751 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399826.1 protein_id gnl|my_center|LOCUS_01120 9520 4754 gene locus_tag LOCUS_01130 9520 4754 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104706.1 protein_id gnl|my_center|LOCUS_01130 12306 9661 gene locus_tag LOCUS_01140 gene pepN 12306 9661 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_01140 <12995 12299 gene locus_tag LOCUS_01150 <12995 12299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206650.1:DUF2797 domain-containing protein >Feature sequence010 1386 703 gene locus_tag LOCUS_01160 1386 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 2230 1481 gene locus_tag LOCUS_01170 2230 1481 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071015.1 protein_id gnl|my_center|LOCUS_01170 3201 2233 gene locus_tag LOCUS_01180 gene birA 3201 2233 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262797.1 protein_id gnl|my_center|LOCUS_01180 3463 4653 gene locus_tag LOCUS_01190 gene metK 3463 4653 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084948.1 protein_id gnl|my_center|LOCUS_01190 6646 4709 gene locus_tag LOCUS_01200 6646 4709 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044858.1 protein_id gnl|my_center|LOCUS_01200 7142 6648 gene locus_tag LOCUS_01210 7142 6648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 7607 8158 gene locus_tag LOCUS_01220 7607 8158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 9276 8281 gene locus_tag LOCUS_01230 9276 8281 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066032.1 protein_id gnl|my_center|LOCUS_01230 9630 9307 gene locus_tag LOCUS_01240 9630 9307 CDS product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266925.1 protein_id gnl|my_center|LOCUS_01240 10807 9623 gene locus_tag LOCUS_01250 gene nhaA 10807 9623 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963884.1 protein_id gnl|my_center|LOCUS_01250 11062 12384 gene locus_tag LOCUS_01260 11062 12384 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932175.1 protein_id gnl|my_center|LOCUS_01260 >Feature sequence011 732 1157 gene locus_tag LOCUS_01270 732 1157 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567255.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01270 1277 3583 gene locus_tag LOCUS_01280 gene ptsP 1277 3583 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208281.1 protein_id gnl|my_center|LOCUS_01280 3598 4254 gene locus_tag LOCUS_01290 3598 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 4703 4251 gene locus_tag LOCUS_01300 4703 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 5262 4705 gene locus_tag LOCUS_01310 5262 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 5895 5266 gene locus_tag LOCUS_01320 5895 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 6906 5899 gene locus_tag LOCUS_01330 gene gspK 6906 5899 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121457.1 protein_id gnl|my_center|LOCUS_01330 7522 6893 gene locus_tag LOCUS_01340 gene xcpW 7522 6893 CDS product GspJ family T2SS minor pseudopilin variant XcpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110067.1 protein_id gnl|my_center|LOCUS_01340 7925 7527 gene locus_tag LOCUS_01350 7925 7527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 8484 7915 gene locus_tag LOCUS_01360 8484 7915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 8897 8481 gene locus_tag LOCUS_01370 gene gspG 8897 8481 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465191.1 protein_id gnl|my_center|LOCUS_01370 10134 8914 gene locus_tag LOCUS_01380 gene gspF 10134 8914 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065941.1 protein_id gnl|my_center|LOCUS_01380 11616 10138 gene locus_tag LOCUS_01390 gene gspE 11616 10138 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208413.1 protein_id gnl|my_center|LOCUS_01390 >Feature sequence012 351 950 gene locus_tag LOCUS_01400 gene rrtA 351 950 CDS product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207737.1 protein_id gnl|my_center|LOCUS_01400 1119 1658 gene locus_tag LOCUS_01410 1119 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 1684 2376 gene locus_tag LOCUS_01420 gene mtgA 1684 2376 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206066.1 protein_id gnl|my_center|LOCUS_01420 2529 4601 gene locus_tag LOCUS_01430 gene ppk1 2529 4601 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206067.1 protein_id gnl|my_center|LOCUS_01430 4917 6035 gene locus_tag LOCUS_01440 4917 6035 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990623.1 protein_id gnl|my_center|LOCUS_01440 6052 7224 gene locus_tag LOCUS_01450 6052 7224 CDS product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930692.1 protein_id gnl|my_center|LOCUS_01450 8835 7333 gene locus_tag LOCUS_01460 gene ppx 8835 7333 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208409.1 protein_id gnl|my_center|LOCUS_01460 9119 9448 gene locus_tag LOCUS_01470 gene trxA 9119 9448 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213213.1 protein_id gnl|my_center|LOCUS_01470 9630 10892 gene locus_tag LOCUS_01480 gene rho 9630 10892 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117304.1 protein_id gnl|my_center|LOCUS_01480 11220 11029 gene locus_tag LOCUS_01490 11220 11029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 11362 11598 gene locus_tag LOCUS_01500 11362 11598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975287.1 protein_id gnl|my_center|LOCUS_01500 11595 11819 gene locus_tag LOCUS_01510 11595 11819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01510 11820 12026 gene locus_tag LOCUS_01520 11820 12026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01520 >Feature sequence013 <1 1433 gene locus_tag LOCUS_01530 <1 1433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169250172.1:tetratricopeptide repeat protein 1732 1430 gene locus_tag LOCUS_01540 1732 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 2088 3956 gene locus_tag LOCUS_01550 2088 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 4164 4571 gene locus_tag LOCUS_01560 4164 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070814.1 protein_id gnl|my_center|LOCUS_01560 4577 5233 gene locus_tag LOCUS_01570 4577 5233 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207453.1 protein_id gnl|my_center|LOCUS_01570 6021 5275 gene locus_tag LOCUS_01580 6021 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 6093 6329 gene locus_tag LOCUS_01590 6093 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 6736 6398 gene locus_tag LOCUS_01600 6736 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 6955 8055 gene locus_tag LOCUS_01610 6955 8055 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860887.1 protein_id gnl|my_center|LOCUS_01610 9834 8047 gene locus_tag LOCUS_01620 9834 8047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 10086 11159 gene locus_tag LOCUS_01630 10086 11159 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948029.1 protein_id gnl|my_center|LOCUS_01630 >Feature sequence014 4144 2963 gene locus_tag LOCUS_01640 4144 2963 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082450.1 protein_id gnl|my_center|LOCUS_01640 4434 5885 gene locus_tag LOCUS_01650 4434 5885 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087741.1 protein_id gnl|my_center|LOCUS_01650 5920 6687 gene locus_tag LOCUS_01660 5920 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 6696 7421 gene locus_tag LOCUS_01670 6696 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113561.1 protein_id gnl|my_center|LOCUS_01670 7519 10788 gene locus_tag LOCUS_01680 7519 10788 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266501.1 protein_id gnl|my_center|LOCUS_01680 >Feature sequence015 761 360 gene locus_tag LOCUS_01690 761 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 1311 763 gene locus_tag LOCUS_01700 1311 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 2087 1329 gene locus_tag LOCUS_01710 2087 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 2235 2882 gene locus_tag LOCUS_01720 2235 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 7857 2929 gene locus_tag LOCUS_01730 7857 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 8740 7976 gene locus_tag LOCUS_01740 8740 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 <10830 8742 gene locus_tag LOCUS_01750 <10830 8742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082627.1:DNA helicase RecQ >Feature sequence016 1473 943 gene locus_tag LOCUS_01760 1473 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 1903 3045 gene locus_tag LOCUS_01770 gene pdxB 1903 3045 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267266.1 protein_id gnl|my_center|LOCUS_01770 3170 4612 gene locus_tag LOCUS_01780 3170 4612 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_01780 4716 5273 gene locus_tag LOCUS_01790 4716 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 5335 6576 gene locus_tag LOCUS_01800 5335 6576 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206089.1 protein_id gnl|my_center|LOCUS_01800 8382 6661 gene locus_tag LOCUS_01810 8382 6661 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207562.1 protein_id gnl|my_center|LOCUS_01810 8502 8906 gene locus_tag LOCUS_01820 8502 8906 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086091.1 protein_id gnl|my_center|LOCUS_01820 >Feature sequence017 2238 2471 gene locus_tag LOCUS_01830 2238 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 2796 3803 gene locus_tag LOCUS_01840 gene dusA 2796 3803 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208379.1 protein_id gnl|my_center|LOCUS_01840 3832 4782 gene locus_tag LOCUS_01850 gene tal 3832 4782 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073375.1 protein_id gnl|my_center|LOCUS_01850 5360 4854 gene locus_tag LOCUS_01860 5360 4854 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104052.1 protein_id gnl|my_center|LOCUS_01860 6537 5362 gene locus_tag LOCUS_01870 6537 5362 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103855.1 protein_id gnl|my_center|LOCUS_01870 7385 6660 gene locus_tag LOCUS_01880 7385 6660 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_01880 8232 7504 gene locus_tag LOCUS_01890 8232 7504 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 protein_id gnl|my_center|LOCUS_01890 9055 8225 gene locus_tag LOCUS_01900 9055 8225 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072092.1 protein_id gnl|my_center|LOCUS_01900 9549 9130 gene locus_tag LOCUS_01910 9549 9130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 10135 9752 gene locus_tag LOCUS_01920 10135 9752 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118641.1 protein_id gnl|my_center|LOCUS_01920 >Feature sequence018 2642 1182 gene locus_tag LOCUS_01930 2642 1182 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086616.1 protein_id gnl|my_center|LOCUS_01930 3030 2710 gene locus_tag LOCUS_01940 3030 2710 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086615.1 protein_id gnl|my_center|LOCUS_01940 4208 3180 gene locus_tag LOCUS_01950 4208 3180 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114567.1 protein_id gnl|my_center|LOCUS_01950 4379 5431 gene locus_tag LOCUS_01960 gene pdhA 4379 5431 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213838.1 protein_id gnl|my_center|LOCUS_01960 5434 6414 gene locus_tag LOCUS_01970 5434 6414 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771912.1 protein_id gnl|my_center|LOCUS_01970 6411 7448 gene locus_tag LOCUS_01980 6411 7448 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947289.1 protein_id gnl|my_center|LOCUS_01980 8415 7492 gene locus_tag LOCUS_01990 8415 7492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 10104 8431 gene locus_tag LOCUS_02000 gene xcpQ 10104 8431 CDS product GspD family T2SS secretin variant XcpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113934.1 protein_id gnl|my_center|LOCUS_02000 >Feature sequence019 802 1167 gene locus_tag LOCUS_02010 gene clpS 802 1167 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121129.1 protein_id gnl|my_center|LOCUS_02010 1192 3474 gene locus_tag LOCUS_02020 gene clpA 1192 3474 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317954.1 protein_id gnl|my_center|LOCUS_02020 5171 3534 gene locus_tag LOCUS_02030 5171 3534 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065953.1 protein_id gnl|my_center|LOCUS_02030 5574 6161 gene locus_tag LOCUS_02040 5574 6161 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113996.1 protein_id gnl|my_center|LOCUS_02040 6661 6158 gene locus_tag LOCUS_02050 6661 6158 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084971.1 protein_id gnl|my_center|LOCUS_02050 9591 6772 gene locus_tag LOCUS_02060 gene rapA 9591 6772 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207322.1 protein_id gnl|my_center|LOCUS_02060 >Feature sequence020 <1 662 gene locus_tag LOCUS_02070 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005765985.1:polyprenyl diphosphate synthase 655 1467 gene locus_tag LOCUS_02080 655 1467 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206990.1 protein_id gnl|my_center|LOCUS_02080 1468 2643 gene locus_tag LOCUS_02090 gene ispC 1468 2643 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765988.1 protein_id gnl|my_center|LOCUS_02090 2654 4015 gene locus_tag LOCUS_02100 gene rseP 2654 4015 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103593.1 protein_id gnl|my_center|LOCUS_02100 4029 6338 gene locus_tag LOCUS_02110 gene bamA 4029 6338 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092382.1 protein_id gnl|my_center|LOCUS_02110 6371 6871 gene locus_tag LOCUS_02120 6371 6871 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545058.1 protein_id gnl|my_center|LOCUS_02120 6928 7962 gene locus_tag LOCUS_02130 gene lpxD 6928 7962 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 protein_id gnl|my_center|LOCUS_02130 7976 8437 gene locus_tag LOCUS_02140 gene fabZ 7976 8437 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092375.1 protein_id gnl|my_center|LOCUS_02140 8438 9214 gene locus_tag LOCUS_02150 gene lpxA 8438 9214 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092373.1 protein_id gnl|my_center|LOCUS_02150 >Feature sequence021 852 388 gene locus_tag LOCUS_02160 852 388 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068912.1 protein_id gnl|my_center|LOCUS_02160 1691 855 gene locus_tag LOCUS_02170 1691 855 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189074.1 protein_id gnl|my_center|LOCUS_02170 2050 1703 gene locus_tag LOCUS_02180 gene copC 2050 1703 CDS product copper homeostasis periplasmic binding protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185895.1 protein_id gnl|my_center|LOCUS_02180 3934 2051 gene locus_tag LOCUS_02190 3934 2051 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407259.1 protein_id gnl|my_center|LOCUS_02190 4188 5975 gene locus_tag LOCUS_02200 4188 5975 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104170.1 protein_id gnl|my_center|LOCUS_02200 >Feature sequence022 132 506 gene locus_tag LOCUS_02210 132 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 1124 612 gene locus_tag LOCUS_02220 1124 612 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403158.1 protein_id gnl|my_center|LOCUS_02220 1336 2871 gene locus_tag LOCUS_02230 gene gpmI 1336 2871 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114478.1 protein_id gnl|my_center|LOCUS_02230 3078 4550 gene locus_tag LOCUS_02240 3078 4550 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767110.1 protein_id gnl|my_center|LOCUS_02240 4547 5170 gene locus_tag LOCUS_02250 4547 5170 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400924.1 protein_id gnl|my_center|LOCUS_02250 5627 5172 gene locus_tag LOCUS_02260 5627 5172 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371299.1 protein_id gnl|my_center|LOCUS_02260 6506 5742 gene locus_tag LOCUS_02270 gene hisF 6506 5742 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002001007.1 protein_id gnl|my_center|LOCUS_02270 7377 6646 gene locus_tag LOCUS_02280 gene hisA 7377 6646 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207860.1 protein_id gnl|my_center|LOCUS_02280 8141 7509 gene locus_tag LOCUS_02290 gene hisH 8141 7509 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318304.1 protein_id gnl|my_center|LOCUS_02290 8736 8143 gene locus_tag LOCUS_02300 gene hisB 8736 8143 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_02300 >Feature sequence023 1378 518 gene locus_tag LOCUS_02310 1378 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 2343 1582 gene locus_tag LOCUS_02320 2343 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 2837 2505 gene locus_tag LOCUS_02330 2837 2505 CDS product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801427.1 protein_id gnl|my_center|LOCUS_02330 3539 3015 gene locus_tag LOCUS_02340 gene ssb1 3539 3015 CDS product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368746.1 protein_id gnl|my_center|LOCUS_02340 5141 3774 gene locus_tag LOCUS_02350 5141 3774 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207901.1 protein_id gnl|my_center|LOCUS_02350 5301 5684 gene locus_tag LOCUS_02360 5301 5684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02360 5706 8141 gene locus_tag LOCUS_02370 gene uvrA 5706 8141 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085990813.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02370 8199 8972 gene locus_tag LOCUS_02380 8199 8972 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048408.1 protein_id gnl|my_center|LOCUS_02380 >Feature sequence024 558 821 gene locus_tag LOCUS_02390 558 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 808 1029 gene locus_tag LOCUS_02400 808 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 1132 1410 gene locus_tag LOCUS_02410 1132 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 1605 2243 gene locus_tag LOCUS_02420 1605 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 2865 2368 gene locus_tag LOCUS_02430 2865 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 3495 4487 gene locus_tag LOCUS_02440 3495 4487 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073578.1 protein_id gnl|my_center|LOCUS_02440 4581 4967 gene locus_tag LOCUS_02450 4581 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 5249 5046 gene locus_tag LOCUS_02460 5249 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 5328 5507 gene locus_tag LOCUS_02470 5328 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 5777 5965 gene locus_tag LOCUS_02480 5777 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 5969 6142 gene locus_tag LOCUS_02490 5969 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 6488 7363 gene locus_tag LOCUS_02500 6488 7363 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095238.1 protein_id gnl|my_center|LOCUS_02500 7863 7447 gene locus_tag LOCUS_02510 7863 7447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 8506 7856 gene locus_tag LOCUS_02520 gene parA 8506 7856 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389279.1 protein_id gnl|my_center|LOCUS_02520 8711 8938 gene locus_tag LOCUS_02530 8711 8938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 >Feature sequence025 582 5123 gene locus_tag LOCUS_02540 582 5123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 6173 5169 gene locus_tag LOCUS_02550 6173 5169 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_02550 6301 7902 gene locus_tag LOCUS_02560 6301 7902 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117581.1 protein_id gnl|my_center|LOCUS_02560 >Feature sequence026 1131 538 gene locus_tag LOCUS_02570 gene recR 1131 538 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113756.1 protein_id gnl|my_center|LOCUS_02570 1559 1230 gene locus_tag LOCUS_02580 1559 1230 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087236.1 protein_id gnl|my_center|LOCUS_02580 3421 1556 gene locus_tag LOCUS_02590 3421 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 3568 4404 gene locus_tag LOCUS_02600 3568 4404 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208385.1 protein_id gnl|my_center|LOCUS_02600 4619 5119 gene locus_tag LOCUS_02610 gene ogt 4619 5119 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211023.1 protein_id gnl|my_center|LOCUS_02610 5699 5220 gene locus_tag LOCUS_02620 gene bsaA 5699 5220 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219440.1 protein_id gnl|my_center|LOCUS_02620 6103 5699 gene locus_tag LOCUS_02630 gene msrB 6103 5699 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114184.1 protein_id gnl|my_center|LOCUS_02630 6277 7515 gene locus_tag LOCUS_02640 6277 7515 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206525.1 protein_id gnl|my_center|LOCUS_02640 7656 8585 gene locus_tag LOCUS_02650 gene htpX 7656 8585 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118851.1 protein_id gnl|my_center|LOCUS_02650 >Feature sequence027 119 1846 gene locus_tag LOCUS_02660 gene pilB 119 1846 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208227.1 protein_id gnl|my_center|LOCUS_02660 1948 3168 gene locus_tag LOCUS_02670 1948 3168 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079343.1 protein_id gnl|my_center|LOCUS_02670 3168 4025 gene locus_tag LOCUS_02680 3168 4025 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 protein_id gnl|my_center|LOCUS_02680 4030 4632 gene locus_tag LOCUS_02690 gene coaE 4030 4632 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115011.1 protein_id gnl|my_center|LOCUS_02690 4629 4823 gene locus_tag LOCUS_02700 4629 4823 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360265.1 protein_id gnl|my_center|LOCUS_02700 6414 5005 gene locus_tag LOCUS_02710 6414 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 6919 8169 gene locus_tag LOCUS_02720 6919 8169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 8794 8270 gene locus_tag LOCUS_02730 8794 8270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 >Feature sequence028 833 372 gene locus_tag LOCUS_02740 gene rimP 833 372 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 protein_id gnl|my_center|LOCUS_02740 1135 1059 gene locus_tag LOCUS_t00030 1135 1059 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1311 1227 gene locus_tag LOCUS_t00040 1311 1227 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1746 1324 gene locus_tag LOCUS_02750 gene secG 1746 1324 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115012.1 protein_id gnl|my_center|LOCUS_02750 2517 1750 gene locus_tag LOCUS_02760 gene tpiA 2517 1750 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216325.1 protein_id gnl|my_center|LOCUS_02760 3885 2554 gene locus_tag LOCUS_02770 gene glmM 3885 2554 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_02770 4732 3875 gene locus_tag LOCUS_02780 gene folP 4732 3875 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815445.1 protein_id gnl|my_center|LOCUS_02780 6627 4735 gene locus_tag LOCUS_02790 gene ftsH 6627 4735 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095200.1 protein_id gnl|my_center|LOCUS_02790 7405 6764 gene locus_tag LOCUS_02800 gene rlmE 7405 6764 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235573.1 protein_id gnl|my_center|LOCUS_02800 7540 7860 gene locus_tag LOCUS_02810 gene yhbY 7540 7860 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207458.1 protein_id gnl|my_center|LOCUS_02810 7874 8260 gene locus_tag LOCUS_02820 7874 8260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 8251 8637 gene locus_tag LOCUS_02830 8251 8637 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206717.1 protein_id gnl|my_center|LOCUS_02830 >Feature sequence029 495 1340 gene locus_tag LOCUS_02840 gene kdsA 495 1340 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092365.1 protein_id gnl|my_center|LOCUS_02840 1354 2646 gene locus_tag LOCUS_02850 gene eno 1354 2646 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121066.1 protein_id gnl|my_center|LOCUS_02850 2749 3057 gene locus_tag LOCUS_02860 2749 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 3059 3751 gene locus_tag LOCUS_02870 gene ispD 3059 3751 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262540.1 protein_id gnl|my_center|LOCUS_02870 3748 4233 gene locus_tag LOCUS_02880 gene ispF 3748 4233 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 protein_id gnl|my_center|LOCUS_02880 4243 5031 gene locus_tag LOCUS_02890 gene surE 4243 5031 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073294.1 protein_id gnl|my_center|LOCUS_02890 5042 5875 gene locus_tag LOCUS_02900 5042 5875 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115226.1 protein_id gnl|my_center|LOCUS_02900 6019 6903 gene locus_tag LOCUS_02910 gene rpoS 6019 6903 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616022.1 protein_id gnl|my_center|LOCUS_02910 7043 7576 gene locus_tag LOCUS_02920 7043 7576 CDS product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268590.1 protein_id gnl|my_center|LOCUS_02920 7599 8450 gene locus_tag LOCUS_02930 gene yghU 7599 8450 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477118.1 protein_id gnl|my_center|LOCUS_02930 >Feature sequence030 2745 916 gene locus_tag LOCUS_02940 gene glmS 2745 916 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269442.1 protein_id gnl|my_center|LOCUS_02940 3431 2763 gene locus_tag LOCUS_02950 3431 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02950 4127 3438 gene locus_tag LOCUS_02960 4127 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02960 4676 4257 gene locus_tag LOCUS_02970 4676 4257 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114076.1 protein_id gnl|my_center|LOCUS_02970 6152 4758 gene locus_tag LOCUS_02980 gene atpD 6152 4758 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114045.1 protein_id gnl|my_center|LOCUS_02980 7111 6242 gene locus_tag LOCUS_02990 gene atpG 7111 6242 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114131.1 protein_id gnl|my_center|LOCUS_02990 <8492 7173 gene locus_tag LOCUS_03000 <8492 7173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002114049.1:F0F1 ATP synthase subunit alpha >Feature sequence031 <1 1553 gene locus_tag LOCUS_03010 <1 1553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104232144.1:tetratricopeptide repeat protein 1564 2511 gene locus_tag LOCUS_03020 1564 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 2508 2837 gene locus_tag LOCUS_03030 2508 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 2865 3494 gene locus_tag LOCUS_03040 2865 3494 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_03040 3540 4052 gene locus_tag LOCUS_03050 3540 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 4049 4552 gene locus_tag LOCUS_03060 4049 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 4552 5538 gene locus_tag LOCUS_03070 4552 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 5641 5730 gene locus_tag LOCUS_t00050 5641 5730 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5927 7753 gene locus_tag LOCUS_03080 5927 7753 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115528.1 protein_id gnl|my_center|LOCUS_03080 <8468 7861 gene locus_tag LOCUS_03090 <8468 7861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704874.1:HD domain-containing protein >Feature sequence032 <1 1195 gene locus_tag LOCUS_03100 <1 1195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002116225.1:succinate dehydrogenase flavoprotein subunit 1208 1915 gene locus_tag LOCUS_03110 1208 1915 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087410.1 protein_id gnl|my_center|LOCUS_03110 2551 5385 gene locus_tag LOCUS_03120 2551 5385 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207474.1 protein_id gnl|my_center|LOCUS_03120 5404 6597 gene locus_tag LOCUS_03130 gene odhB 5404 6597 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064561.1 protein_id gnl|my_center|LOCUS_03130 6724 8160 gene locus_tag LOCUS_03140 gene lpdA 6724 8160 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116053.1 protein_id gnl|my_center|LOCUS_03140 >Feature sequence033 1524 271 gene locus_tag LOCUS_03150 1524 271 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207893.1 protein_id gnl|my_center|LOCUS_03150 1958 1662 gene locus_tag LOCUS_03160 1958 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 2463 1960 gene locus_tag LOCUS_03170 2463 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114779.1 protein_id gnl|my_center|LOCUS_03170 5172 2563 gene locus_tag LOCUS_03180 gene topA 5172 2563 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091201.1 protein_id gnl|my_center|LOCUS_03180 5900 5469 gene locus_tag LOCUS_03190 5900 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 6586 5906 gene locus_tag LOCUS_03200 6586 5906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091213.1 protein_id gnl|my_center|LOCUS_03200 7351 6674 gene locus_tag LOCUS_03210 7351 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091213.1 protein_id gnl|my_center|LOCUS_03210 8259 7447 gene locus_tag LOCUS_03220 8259 7447 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113973.1 protein_id gnl|my_center|LOCUS_03220 >Feature sequence034 491 1996 gene locus_tag LOCUS_03230 491 1996 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408473.1 protein_id gnl|my_center|LOCUS_03230 1993 2970 gene locus_tag LOCUS_03240 1993 2970 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974954.1 protein_id gnl|my_center|LOCUS_03240 3548 3108 gene locus_tag LOCUS_03250 3548 3108 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121094.1 protein_id gnl|my_center|LOCUS_03250 3787 5094 gene locus_tag LOCUS_03260 gene chrA 3787 5094 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206681.1 protein_id gnl|my_center|LOCUS_03260 5123 5851 gene locus_tag LOCUS_03270 gene ompR 5123 5851 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207855.1 protein_id gnl|my_center|LOCUS_03270 5863 7209 gene locus_tag LOCUS_03280 5863 7209 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207856.1 protein_id gnl|my_center|LOCUS_03280 7231 7875 gene locus_tag LOCUS_03290 7231 7875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03290 7897 8118 gene locus_tag LOCUS_03300 7897 8118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03300 >Feature sequence035 2119 1259 gene locus_tag LOCUS_03310 2119 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 2635 2973 gene locus_tag LOCUS_03320 2635 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 3961 3041 gene locus_tag LOCUS_03330 gene lpxC 3961 3041 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_03330 5299 4097 gene locus_tag LOCUS_03340 gene ftsZ 5299 4097 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766576.1 protein_id gnl|my_center|LOCUS_03340 6773 5529 gene locus_tag LOCUS_03350 gene ftsA 6773 5529 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094115.1 protein_id gnl|my_center|LOCUS_03350 7670 6852 gene locus_tag LOCUS_03360 7670 6852 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207933.1 protein_id gnl|my_center|LOCUS_03360 <8413 7715 gene locus_tag LOCUS_03370 <8413 7715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005066802.1:D-alanine--D-alanine ligase >Feature sequence036 1010 234 gene locus_tag LOCUS_03380 1010 234 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108916.1 protein_id gnl|my_center|LOCUS_03380 1891 1073 gene locus_tag LOCUS_03390 1891 1073 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208373.1 protein_id gnl|my_center|LOCUS_03390 3433 1952 gene locus_tag LOCUS_03400 gene pap 3433 1952 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941390.1 protein_id gnl|my_center|LOCUS_03400 3552 4211 gene locus_tag LOCUS_03410 3552 4211 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462033.1 protein_id gnl|my_center|LOCUS_03410 4789 4208 gene locus_tag LOCUS_03420 4789 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 6845 4824 gene locus_tag LOCUS_03430 gene ligA 6845 4824 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205932.1 protein_id gnl|my_center|LOCUS_03430 7849 6998 gene locus_tag LOCUS_03440 7849 6998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 <8390 7860 gene locus_tag LOCUS_03450 <8390 7860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104654.1:chromosome segregation protein SMC >Feature sequence037 1 738 gene locus_tag LOCUS_03460 1 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 808 1899 gene locus_tag LOCUS_03470 808 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 1928 2584 gene locus_tag LOCUS_03480 1928 2584 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020659.1 protein_id gnl|my_center|LOCUS_03480 2587 3063 gene locus_tag LOCUS_03490 gene elsL 2587 3063 CDS product cell wall-recycling L,D-carboxypeptidase ElsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 protein_id gnl|my_center|LOCUS_03490 3067 3723 gene locus_tag LOCUS_03500 3067 3723 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110585.1 protein_id gnl|my_center|LOCUS_03500 4349 3882 gene locus_tag LOCUS_03510 gene secB 4349 3882 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115005.1 protein_id gnl|my_center|LOCUS_03510 4620 4366 gene locus_tag LOCUS_03520 gene grxC 4620 4366 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114715.1 protein_id gnl|my_center|LOCUS_03520 5041 4628 gene locus_tag LOCUS_03530 5041 4628 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443006.1 protein_id gnl|my_center|LOCUS_03530 6135 5119 gene locus_tag LOCUS_03540 gene rsgA 6135 5119 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208364.1 protein_id gnl|my_center|LOCUS_03540 6216 6635 gene locus_tag LOCUS_03550 6216 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03550 6636 6767 gene locus_tag LOCUS_03560 6636 6767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03560 7071 7706 gene locus_tag LOCUS_03570 gene ccmA 7071 7706 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457758.1 protein_id gnl|my_center|LOCUS_03570 >Feature sequence038 <1 1416 gene locus_tag LOCUS_03580 <1 1416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257821.1:response regulator note possible pseudo, frameshifted 1471 3891 gene locus_tag LOCUS_03590 1471 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 3966 4157 gene locus_tag LOCUS_03600 3966 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 4229 5227 gene locus_tag LOCUS_03610 4229 5227 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206790.1 protein_id gnl|my_center|LOCUS_03610 5865 5353 gene locus_tag LOCUS_03620 5865 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 7801 5969 gene locus_tag LOCUS_03630 7801 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 >Feature sequence039 1914 262 gene locus_tag LOCUS_03640 1914 262 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_03640 2551 1919 gene locus_tag LOCUS_03650 2551 1919 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384710.1 protein_id gnl|my_center|LOCUS_03650 3344 2790 gene locus_tag LOCUS_03660 3344 2790 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103257.1 protein_id gnl|my_center|LOCUS_03660 3595 4923 gene locus_tag LOCUS_03670 3595 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208012.1 protein_id gnl|my_center|LOCUS_03670 4953 7757 gene locus_tag LOCUS_03680 4953 7757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 >Feature sequence040 2229 904 gene locus_tag LOCUS_03690 2229 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 4747 2357 gene locus_tag LOCUS_03700 4747 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 6066 4762 gene locus_tag LOCUS_03710 6066 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 6831 6163 gene locus_tag LOCUS_03720 6831 6163 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555418.1 protein_id gnl|my_center|LOCUS_03720 >Feature sequence041 323 652 gene locus_tag LOCUS_03730 323 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 649 1197 gene locus_tag LOCUS_03740 649 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 1669 2916 gene locus_tag LOCUS_03750 1669 2916 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_03750 3091 3378 gene locus_tag LOCUS_03760 3091 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 3380 4612 gene locus_tag LOCUS_03770 3380 4612 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_03770 4681 4944 gene locus_tag LOCUS_03780 4681 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 4965 6218 gene locus_tag LOCUS_03790 gene mksB 4965 6218 CDS product Mks condensin complex protein MksB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103378.1 protein_id gnl|my_center|LOCUS_03790 6215 6793 gene locus_tag LOCUS_03800 6215 6793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 >Feature sequence042 628 939 gene locus_tag LOCUS_03810 628 939 CDS product TRL-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862951.1 protein_id gnl|my_center|LOCUS_03810 2018 1128 gene locus_tag LOCUS_03820 2018 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 2184 3101 gene locus_tag LOCUS_03830 gene hemC 2184 3101 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349245.1 protein_id gnl|my_center|LOCUS_03830 3094 3864 gene locus_tag LOCUS_03840 3094 3864 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114032.1 protein_id gnl|my_center|LOCUS_03840 3928 4929 gene locus_tag LOCUS_03850 3928 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 4926 6143 gene locus_tag LOCUS_03860 4926 6143 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096390.1 protein_id gnl|my_center|LOCUS_03860 6153 6677 gene locus_tag LOCUS_03870 6153 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 6804 7196 gene locus_tag LOCUS_03880 6804 7196 CDS product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421593.1 protein_id gnl|my_center|LOCUS_03880 >Feature sequence043 709 77 gene locus_tag LOCUS_03890 709 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03890 1454 774 gene locus_tag LOCUS_03900 1454 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 1506 2381 gene locus_tag LOCUS_03910 1506 2381 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194150.1 protein_id gnl|my_center|LOCUS_03910 2762 2463 gene locus_tag LOCUS_03920 2762 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 2961 3542 gene locus_tag LOCUS_03930 gene ruvC 2961 3542 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121356.1 protein_id gnl|my_center|LOCUS_03930 3588 4745 gene locus_tag LOCUS_03940 3588 4745 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198074.1 protein_id gnl|my_center|LOCUS_03940 4896 7643 gene locus_tag LOCUS_03950 4896 7643 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208390.1 protein_id gnl|my_center|LOCUS_03950 >Feature sequence044 1485 496 gene locus_tag LOCUS_03960 1485 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 2083 1721 gene locus_tag LOCUS_03970 2083 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 2810 2085 gene locus_tag LOCUS_03980 2810 2085 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525286.1 protein_id gnl|my_center|LOCUS_03980 4335 3265 gene locus_tag LOCUS_03990 gene lptG 4335 3265 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406700.1 protein_id gnl|my_center|LOCUS_03990 5453 4332 gene locus_tag LOCUS_04000 gene lptF 5453 4332 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208169.1 protein_id gnl|my_center|LOCUS_04000 5599 7083 gene locus_tag LOCUS_04010 5599 7083 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266820.1 protein_id gnl|my_center|LOCUS_04010 7070 7492 gene locus_tag LOCUS_04020 7070 7492 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948332.1 protein_id gnl|my_center|LOCUS_04020 7501 7857 gene locus_tag LOCUS_04030 7501 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 >Feature sequence045 262 1260 gene locus_tag LOCUS_04040 gene adeT1 262 1260 CDS product putative multidrug efflux protein AdeT1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206789.1 protein_id gnl|my_center|LOCUS_04040 3260 1362 gene locus_tag LOCUS_04050 3260 1362 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207719.1 protein_id gnl|my_center|LOCUS_04050 3414 4760 gene locus_tag LOCUS_04060 gene miaB 3414 4760 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207720.1 protein_id gnl|my_center|LOCUS_04060 4856 5869 gene locus_tag LOCUS_04070 4856 5869 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207721.1 protein_id gnl|my_center|LOCUS_04070 5862 6356 gene locus_tag LOCUS_04080 gene ybeY 5862 6356 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210344.1 protein_id gnl|my_center|LOCUS_04080 6745 6515 gene locus_tag LOCUS_04090 6745 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 6830 7681 gene locus_tag LOCUS_04100 6830 7681 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_04100 >Feature sequence046 1676 627 gene locus_tag LOCUS_04110 1676 627 CDS product lipase secretion chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117631.1 protein_id gnl|my_center|LOCUS_04110 2831 1890 gene locus_tag LOCUS_04120 gene lipA 2831 1890 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090955.1 protein_id gnl|my_center|LOCUS_04120 3960 3019 gene locus_tag LOCUS_04130 3960 3019 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033424.1 protein_id gnl|my_center|LOCUS_04130 4873 4268 gene locus_tag LOCUS_04140 4873 4268 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207364.1 protein_id gnl|my_center|LOCUS_04140 5009 5932 gene locus_tag LOCUS_04150 5009 5932 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207401.1 protein_id gnl|my_center|LOCUS_04150 5944 6990 gene locus_tag LOCUS_04160 5944 6990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 >Feature sequence047 868 134 gene locus_tag LOCUS_04170 868 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 1078 869 gene locus_tag LOCUS_04180 1078 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 1816 1289 gene locus_tag LOCUS_04190 gene ppa 1816 1289 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121243.1 protein_id gnl|my_center|LOCUS_04190 2914 1940 gene locus_tag LOCUS_04200 gene cysK 2914 1940 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036918.1 protein_id gnl|my_center|LOCUS_04200 3020 4819 gene locus_tag LOCUS_04210 3020 4819 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065938.1 protein_id gnl|my_center|LOCUS_04210 6262 5066 gene locus_tag LOCUS_04220 6262 5066 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094617.1 protein_id gnl|my_center|LOCUS_04220 7053 6400 gene locus_tag LOCUS_04230 gene can 7053 6400 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_04230 7408 7037 gene locus_tag LOCUS_04240 7408 7037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 >Feature sequence048 2797 917 gene locus_tag LOCUS_04250 2797 917 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207874.1 protein_id gnl|my_center|LOCUS_04250 2956 3046 gene locus_tag LOCUS_t00060 2956 3046 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3871 3113 gene locus_tag LOCUS_04260 3871 3113 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_04260 4835 3891 gene locus_tag LOCUS_04270 4835 3891 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941057.1 protein_id gnl|my_center|LOCUS_04270 5227 6405 gene locus_tag LOCUS_04280 5227 6405 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498060.1 protein_id gnl|my_center|LOCUS_04280 6470 7075 gene locus_tag LOCUS_04290 6470 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 >Feature sequence049 225 2135 gene locus_tag LOCUS_04300 gene dxs 225 2135 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266507.1 protein_id gnl|my_center|LOCUS_04300 2284 3099 gene locus_tag LOCUS_04310 2284 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 3579 3148 gene locus_tag LOCUS_04320 3579 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 3873 4175 gene locus_tag LOCUS_04330 3873 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 5004 4258 gene locus_tag LOCUS_04340 5004 4258 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208038.1 protein_id gnl|my_center|LOCUS_04340 5345 6004 gene locus_tag LOCUS_04350 5345 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 >Feature sequence050 1489 605 gene locus_tag LOCUS_04360 gene tsf 1489 605 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118238.1 protein_id gnl|my_center|LOCUS_04360 2392 1682 gene locus_tag LOCUS_04370 gene rpsB 2392 1682 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118204.1 protein_id gnl|my_center|LOCUS_04370 2670 3455 gene locus_tag LOCUS_04380 gene map 2670 3455 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266973.1 protein_id gnl|my_center|LOCUS_04380 3568 6234 gene locus_tag LOCUS_04390 3568 6234 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 protein_id gnl|my_center|LOCUS_04390 6231 7427 gene locus_tag LOCUS_04400 gene dapC 6231 7427 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206527.1 protein_id gnl|my_center|LOCUS_04400 >Feature sequence051 592 80 gene locus_tag LOCUS_04410 592 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04410 754 1524 gene locus_tag LOCUS_04420 754 1524 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206522.1 protein_id gnl|my_center|LOCUS_04420 1651 2433 gene locus_tag LOCUS_04430 gene cysE 1651 2433 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206521.1 protein_id gnl|my_center|LOCUS_04430 2460 3002 gene locus_tag LOCUS_04440 2460 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 3187 3669 gene locus_tag LOCUS_04450 gene iscR 3187 3669 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092836.1 protein_id gnl|my_center|LOCUS_04450 3761 4978 gene locus_tag LOCUS_04460 3761 4978 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092832.1 protein_id gnl|my_center|LOCUS_04460 5036 5419 gene locus_tag LOCUS_04470 gene iscU 5036 5419 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092829.1 protein_id gnl|my_center|LOCUS_04470 5422 5745 gene locus_tag LOCUS_04480 gene iscA 5422 5745 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117986.1 protein_id gnl|my_center|LOCUS_04480 5894 6424 gene locus_tag LOCUS_04490 gene hscB 5894 6424 CDS product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206626.1 protein_id gnl|my_center|LOCUS_04490 >Feature sequence052 752 360 gene locus_tag LOCUS_04500 gene rpsI 752 360 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098810.1 protein_id gnl|my_center|LOCUS_04500 1191 763 gene locus_tag LOCUS_04510 gene rplM 1191 763 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377605.1 protein_id gnl|my_center|LOCUS_04510 2282 1458 gene locus_tag LOCUS_04520 2282 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 3491 2373 gene locus_tag LOCUS_04530 gene zapE 3491 2373 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117902.1 protein_id gnl|my_center|LOCUS_04530 4110 3475 gene locus_tag LOCUS_04540 gene coxH3 4110 3475 CDS product Dot/Icm type IV secretion system effector CoxH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_04540 4207 4656 gene locus_tag LOCUS_04550 4207 4656 CDS product DUF1043 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620321.1 protein_id gnl|my_center|LOCUS_04550 5912 4698 gene locus_tag LOCUS_04560 gene sat 5912 4698 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_04560 6763 6005 gene locus_tag LOCUS_04570 6763 6005 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377592.1 protein_id gnl|my_center|LOCUS_04570 >Feature sequence053 1076 168 gene locus_tag LOCUS_04580 1076 168 CDS product PA2778 family cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895637.1 protein_id gnl|my_center|LOCUS_04580 1559 1161 gene locus_tag LOCUS_04590 1559 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 1774 3660 gene locus_tag LOCUS_04600 gene mnmG 1774 3660 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207143.1 protein_id gnl|my_center|LOCUS_04600 3735 4358 gene locus_tag LOCUS_04610 gene rsmG 3735 4358 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100242.1 protein_id gnl|my_center|LOCUS_04610 4474 5253 gene locus_tag LOCUS_04620 4474 5253 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121458.1 protein_id gnl|my_center|LOCUS_04620 5250 6146 gene locus_tag LOCUS_04630 5250 6146 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_04630 6409 7038 gene locus_tag LOCUS_04640 6409 7038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 >Feature sequence054 382 1011 gene locus_tag LOCUS_04650 382 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 2624 1008 gene locus_tag LOCUS_04660 2624 1008 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704658.1 protein_id gnl|my_center|LOCUS_04660 2718 2960 gene locus_tag LOCUS_04670 2718 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 2960 4561 gene locus_tag LOCUS_04680 2960 4561 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769277.1 protein_id gnl|my_center|LOCUS_04680 4564 5967 gene locus_tag LOCUS_04690 gene pilR 4564 5967 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_04690 7040 5964 gene locus_tag LOCUS_04700 gene thiO 7040 5964 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266588.1 protein_id gnl|my_center|LOCUS_04700 >Feature sequence055 <1 1256 gene locus_tag LOCUS_04710 <1 1256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005068333.1:amidophosphoribosyltransferase 1263 2468 gene locus_tag LOCUS_04720 1263 2468 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206657.1 protein_id gnl|my_center|LOCUS_04720 2771 3688 gene locus_tag LOCUS_04730 2771 3688 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_04730 3692 4663 gene locus_tag LOCUS_04740 3692 4663 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765784.1 protein_id gnl|my_center|LOCUS_04740 4660 6684 gene locus_tag LOCUS_04750 gene tgpA 4660 6684 CDS product protein-glutamine gamma-glutamyltransferase TgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114743.1 protein_id gnl|my_center|LOCUS_04750 6732 6808 gene locus_tag LOCUS_t00070 6732 6808 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence056 1625 618 gene locus_tag LOCUS_04760 1625 618 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206062.1 protein_id gnl|my_center|LOCUS_04760 2474 1782 gene locus_tag LOCUS_04770 2474 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 2617 4392 gene locus_tag LOCUS_04780 2617 4392 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207223.1 protein_id gnl|my_center|LOCUS_04780 4712 4434 gene locus_tag LOCUS_04790 4712 4434 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089995.1 protein_id gnl|my_center|LOCUS_04790 6102 4714 gene locus_tag LOCUS_04800 gene argH 6102 4714 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121138.1 protein_id gnl|my_center|LOCUS_04800 >Feature sequence057 406 1443 gene locus_tag LOCUS_04810 gene mutY 406 1443 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073236.1 protein_id gnl|my_center|LOCUS_04810 2679 1435 gene locus_tag LOCUS_04820 2679 1435 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206666.1 protein_id gnl|my_center|LOCUS_04820 3983 2691 gene locus_tag LOCUS_04830 3983 2691 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206666.1 protein_id gnl|my_center|LOCUS_04830 5196 4012 gene locus_tag LOCUS_04840 5196 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 >Feature sequence058 171 1640 gene locus_tag LOCUS_04850 171 1640 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_04850 1798 3498 gene locus_tag LOCUS_04860 1798 3498 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 protein_id gnl|my_center|LOCUS_04860 3663 4817 gene locus_tag LOCUS_04870 gene dacC 3663 4817 CDS product D-alanyl-D-alanine carboxypeptidase PBP5/6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118558.1 protein_id gnl|my_center|LOCUS_04870 4983 5270 gene locus_tag LOCUS_04880 4983 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 5273 5887 gene locus_tag LOCUS_04890 gene lipB 5273 5887 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097593.1 protein_id gnl|my_center|LOCUS_04890 6120 6815 gene locus_tag LOCUS_04900 6120 6815 CDS product START domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932841.1 protein_id gnl|my_center|LOCUS_04900 >Feature sequence059 503 1657 gene locus_tag LOCUS_04910 gene argE 503 1657 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114054.1 protein_id gnl|my_center|LOCUS_04910 1750 3096 gene locus_tag LOCUS_04920 gene argA 1750 3096 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120768.1 protein_id gnl|my_center|LOCUS_04920 3266 4942 gene locus_tag LOCUS_04930 gene ilvD 3266 4942 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502719.1 protein_id gnl|my_center|LOCUS_04930 5001 5351 gene locus_tag LOCUS_04940 5001 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 5439 6083 gene locus_tag LOCUS_04950 gene pdxH 5439 6083 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688841.1 protein_id gnl|my_center|LOCUS_04950 6772 6155 gene locus_tag LOCUS_04960 6772 6155 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_04960 >Feature sequence060 2624 1350 gene locus_tag LOCUS_04970 2624 1350 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269137.1 protein_id gnl|my_center|LOCUS_04970 4627 2705 gene locus_tag LOCUS_04980 4627 2705 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085078.1 protein_id gnl|my_center|LOCUS_04980 5694 4858 gene locus_tag LOCUS_04990 5694 4858 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207697.1 protein_id gnl|my_center|LOCUS_04990 6091 5711 gene locus_tag LOCUS_05000 gene apaG 6091 5711 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085085.1 protein_id gnl|my_center|LOCUS_05000 6884 6084 gene locus_tag LOCUS_05010 gene rsmA 6884 6084 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 protein_id gnl|my_center|LOCUS_05010 >Feature sequence061 3290 546 gene locus_tag LOCUS_05020 3290 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 3685 6327 gene locus_tag LOCUS_05030 3685 6327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 6753 6439 gene locus_tag LOCUS_05040 6753 6439 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116171.1 protein_id gnl|my_center|LOCUS_05040 >Feature sequence062 1619 483 gene locus_tag LOCUS_05050 1619 483 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389221.1 protein_id gnl|my_center|LOCUS_05050 1750 2133 gene locus_tag LOCUS_05060 gene gloA 1750 2133 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216418.1 protein_id gnl|my_center|LOCUS_05060 5536 2873 gene locus_tag LOCUS_05070 5536 2873 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076003404.1 protein_id gnl|my_center|LOCUS_05070 6778 5822 gene locus_tag LOCUS_05080 6778 5822 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033424.1 protein_id gnl|my_center|LOCUS_05080 >Feature sequence063 1091 162 gene locus_tag LOCUS_05090 1091 162 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004705670.1 protein_id gnl|my_center|LOCUS_05090 4054 1169 gene locus_tag LOCUS_05100 gene glnE 4054 1169 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114555.1 protein_id gnl|my_center|LOCUS_05100 4657 4130 gene locus_tag LOCUS_05110 4657 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 6179 4770 gene locus_tag LOCUS_05120 gene glnA 6179 4770 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002052696.1 protein_id gnl|my_center|LOCUS_05120 >Feature sequence064 1336 3537 gene locus_tag LOCUS_05130 gene katG 1336 3537 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119918646.1 protein_id gnl|my_center|LOCUS_05130 4909 3590 gene locus_tag LOCUS_05140 4909 3590 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206666.1 protein_id gnl|my_center|LOCUS_05140 5106 6143 gene locus_tag LOCUS_05150 gene pyrC 5106 6143 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210005.1 protein_id gnl|my_center|LOCUS_05150 6140 6784 gene locus_tag LOCUS_05160 gene rnt 6140 6784 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130223.1 protein_id gnl|my_center|LOCUS_05160 >Feature sequence065 481 1059 gene locus_tag LOCUS_05170 481 1059 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_05170 1795 1115 gene locus_tag LOCUS_05180 gene lolD 1795 1115 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207403.1 protein_id gnl|my_center|LOCUS_05180 2921 1788 gene locus_tag LOCUS_05190 2921 1788 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118590.1 protein_id gnl|my_center|LOCUS_05190 3207 3806 gene locus_tag LOCUS_05200 3207 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 5557 3917 gene locus_tag LOCUS_05210 5557 3917 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044393841.1 protein_id gnl|my_center|LOCUS_05210 5808 6311 gene locus_tag LOCUS_05220 5808 6311 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122280.1 protein_id gnl|my_center|LOCUS_05220 >Feature sequence066 362 126 gene locus_tag LOCUS_05230 362 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 660 845 gene locus_tag LOCUS_05240 660 845 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_05240 858 2171 gene locus_tag LOCUS_05250 858 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05250 2226 4397 gene locus_tag LOCUS_05260 2226 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05260 4394 5776 gene locus_tag LOCUS_05270 4394 5776 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968626.1 protein_id gnl|my_center|LOCUS_05270 5773 6483 gene locus_tag LOCUS_05280 5773 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 >Feature sequence067 849 494 gene locus_tag LOCUS_tm00010 849 494 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1387 917 gene locus_tag LOCUS_05290 gene smpB 1387 917 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120348.1 protein_id gnl|my_center|LOCUS_05290 1678 2316 gene locus_tag LOCUS_05300 1678 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 2383 2871 gene locus_tag LOCUS_05310 gene coaD 2383 2871 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084466.1 protein_id gnl|my_center|LOCUS_05310 2883 3134 gene locus_tag LOCUS_05320 2883 3134 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195247.1 protein_id gnl|my_center|LOCUS_05320 3628 3278 gene locus_tag LOCUS_05330 3628 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402254.1 protein_id gnl|my_center|LOCUS_05330 4630 3809 gene locus_tag LOCUS_05340 gene mutM 4630 3809 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946302.1 protein_id gnl|my_center|LOCUS_05340 5920 4742 gene locus_tag LOCUS_05350 5920 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 6379 6128 gene locus_tag LOCUS_05360 6379 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 >Feature sequence068 147 830 gene locus_tag LOCUS_05370 147 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 1647 811 gene locus_tag LOCUS_05380 gene aroE 1647 811 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461457.1 protein_id gnl|my_center|LOCUS_05380 2549 1638 gene locus_tag LOCUS_05390 gene hemF 2549 1638 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208526.1 protein_id gnl|my_center|LOCUS_05390 3131 2562 gene locus_tag LOCUS_05400 3131 2562 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704272.1 protein_id gnl|my_center|LOCUS_05400 3491 3144 gene locus_tag LOCUS_05410 3491 3144 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140130.1 protein_id gnl|my_center|LOCUS_05410 3681 3469 gene locus_tag LOCUS_05420 3681 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 4917 3781 gene locus_tag LOCUS_05430 gene dprA 4917 3781 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208132.1 protein_id gnl|my_center|LOCUS_05430 6164 5067 gene locus_tag LOCUS_05440 6164 5067 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_05440 >Feature sequence069 2588 3193 gene locus_tag LOCUS_05450 gene nfuA 2588 3193 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117617.1 protein_id gnl|my_center|LOCUS_05450 3409 4368 gene locus_tag LOCUS_05460 3409 4368 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480839.1 protein_id gnl|my_center|LOCUS_05460 4352 5359 gene locus_tag LOCUS_05470 4352 5359 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192521.1 protein_id gnl|my_center|LOCUS_05470 5371 6288 gene locus_tag LOCUS_05480 5371 6288 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193564.1 protein_id gnl|my_center|LOCUS_05480 6288 6821 gene locus_tag LOCUS_05490 6288 6821 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193409.1 protein_id gnl|my_center|LOCUS_05490 >Feature sequence070 725 1114 gene locus_tag LOCUS_05500 725 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05500 1148 2638 gene locus_tag LOCUS_05510 gene dnaK 1148 2638 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095212.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05510 2899 4020 gene locus_tag LOCUS_05520 gene dnaJ 2899 4020 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377482.1 protein_id gnl|my_center|LOCUS_05520 4315 5130 gene locus_tag LOCUS_05530 gene dapB 4315 5130 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119175.1 protein_id gnl|my_center|LOCUS_05530 5352 6341 gene locus_tag LOCUS_05540 5352 6341 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207868.1 protein_id gnl|my_center|LOCUS_05540 >Feature sequence071 28 633 gene locus_tag LOCUS_05550 gene ubiX 28 633 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093227.1 protein_id gnl|my_center|LOCUS_05550 646 2124 gene locus_tag LOCUS_05560 gene ubiD 646 2124 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215917.1 protein_id gnl|my_center|LOCUS_05560 2288 2998 gene locus_tag LOCUS_05570 gene dnr 2288 2998 CDS product transcriptional regulator Dnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113234.1 protein_id gnl|my_center|LOCUS_05570 3085 4941 gene locus_tag LOCUS_05580 3085 4941 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826015.1 protein_id gnl|my_center|LOCUS_05580 6018 5143 gene locus_tag LOCUS_05590 6018 5143 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206645.1 protein_id gnl|my_center|LOCUS_05590 >Feature sequence072 212 1063 gene locus_tag LOCUS_05600 212 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 1139 2140 gene locus_tag LOCUS_05610 1139 2140 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770956.1 protein_id gnl|my_center|LOCUS_05610 2137 2643 gene locus_tag LOCUS_05620 2137 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 2640 3917 gene locus_tag LOCUS_05630 2640 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 4637 3912 gene locus_tag LOCUS_05640 4637 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 4841 5086 gene locus_tag LOCUS_05650 gene rpsP 4841 5086 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260334.1 protein_id gnl|my_center|LOCUS_05650 5097 5633 gene locus_tag LOCUS_05660 gene rimM 5097 5633 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116736.1 protein_id gnl|my_center|LOCUS_05660 5667 6443 gene locus_tag LOCUS_05670 gene trmD 5667 6443 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264777.1 protein_id gnl|my_center|LOCUS_05670 >Feature sequence073 <1 834 gene locus_tag LOCUS_05680 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970488.1:mechanosensitive ion channel family protein 1005 1487 gene locus_tag LOCUS_05690 1005 1487 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143723.1 protein_id gnl|my_center|LOCUS_05690 1788 1952 gene locus_tag LOCUS_05700 1788 1952 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098329.1 protein_id gnl|my_center|LOCUS_05700 2157 3311 gene locus_tag LOCUS_05710 2157 3311 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269384.1 protein_id gnl|my_center|LOCUS_05710 3378 3836 gene locus_tag LOCUS_05720 3378 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 4331 3912 gene locus_tag LOCUS_05730 4331 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 4796 5467 gene locus_tag LOCUS_05740 4796 5467 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037565.1 protein_id gnl|my_center|LOCUS_05740 >Feature sequence074 698 510 gene locus_tag LOCUS_05750 698 510 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947637.1 protein_id gnl|my_center|LOCUS_05750 1685 702 gene locus_tag LOCUS_05760 gene lpxK 1685 702 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072734.1 protein_id gnl|my_center|LOCUS_05760 3433 1682 gene locus_tag LOCUS_05770 gene msbA 3433 1682 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206591.1 protein_id gnl|my_center|LOCUS_05770 3858 3433 gene locus_tag LOCUS_05780 3858 3433 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206590.1 protein_id gnl|my_center|LOCUS_05780 4496 3861 gene locus_tag LOCUS_05790 4496 3861 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_05790 6737 4665 gene locus_tag LOCUS_05800 6737 4665 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_05800 >Feature sequence075 114 533 gene locus_tag LOCUS_05810 114 533 CDS product BLUF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055933.1 protein_id gnl|my_center|LOCUS_05810 1364 567 gene locus_tag LOCUS_05820 1364 567 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208389.1 protein_id gnl|my_center|LOCUS_05820 3162 1501 gene locus_tag LOCUS_05830 gene ettA 3162 1501 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207852.1 protein_id gnl|my_center|LOCUS_05830 3689 3228 gene locus_tag LOCUS_05840 3689 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 4415 3705 gene locus_tag LOCUS_05850 4415 3705 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_05850 5622 4420 gene locus_tag LOCUS_05860 5622 4420 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_05860 <6721 5619 gene locus_tag LOCUS_05870 <6721 5619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073326.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence076 536 1063 gene locus_tag LOCUS_05880 536 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072911.1 protein_id gnl|my_center|LOCUS_05880 1066 2253 gene locus_tag LOCUS_05890 1066 2253 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207481.1 protein_id gnl|my_center|LOCUS_05890 2343 3068 gene locus_tag LOCUS_05900 2343 3068 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617027.1 protein_id gnl|my_center|LOCUS_05900 4258 3065 gene locus_tag LOCUS_05910 4258 3065 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039906.1 protein_id gnl|my_center|LOCUS_05910 4407 4754 gene locus_tag LOCUS_05920 4407 4754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 4854 5687 gene locus_tag LOCUS_05930 4854 5687 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908986.1 protein_id gnl|my_center|LOCUS_05930 <6649 5853 gene locus_tag LOCUS_05940 <6649 5853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_116269310.1:tetratricopeptide repeat protein >Feature sequence077 <1 532 gene locus_tag LOCUS_05950 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387714.1:AAA family ATPase 535 789 gene locus_tag LOCUS_05960 535 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 1074 4607 gene locus_tag LOCUS_05970 1074 4607 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968627.1 protein_id gnl|my_center|LOCUS_05970 >Feature sequence078 599 207 gene locus_tag LOCUS_05980 599 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 974 1576 gene locus_tag LOCUS_05990 974 1576 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091628.1 protein_id gnl|my_center|LOCUS_05990 1570 1806 gene locus_tag LOCUS_06000 1570 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 2987 1866 gene locus_tag LOCUS_06010 gene pilU 2987 1866 CDS product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_06010 4035 3001 gene locus_tag LOCUS_06020 4035 3001 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070853.1 protein_id gnl|my_center|LOCUS_06020 4218 4901 gene locus_tag LOCUS_06030 4218 4901 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084549.1 protein_id gnl|my_center|LOCUS_06030 4918 5742 gene locus_tag LOCUS_06040 gene proC 4918 5742 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804294.1 protein_id gnl|my_center|LOCUS_06040 5739 6305 gene locus_tag LOCUS_06050 5739 6305 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 protein_id gnl|my_center|LOCUS_06050 >Feature sequence079 371 1651 gene locus_tag LOCUS_06060 gene ccmI 371 1651 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083145.1 protein_id gnl|my_center|LOCUS_06060 1713 2369 gene locus_tag LOCUS_06070 gene adk 1713 2369 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802919.1 protein_id gnl|my_center|LOCUS_06070 2491 3510 gene locus_tag LOCUS_06080 gene hemH 2491 3510 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065964.1 protein_id gnl|my_center|LOCUS_06080 3533 4204 gene locus_tag LOCUS_06090 3533 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 4800 4249 gene locus_tag LOCUS_06100 gene mobA 4800 4249 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706868.1 protein_id gnl|my_center|LOCUS_06100 4885 5568 gene locus_tag LOCUS_06110 gene tsaB 4885 5568 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262263.1 protein_id gnl|my_center|LOCUS_06110 5596 6423 gene locus_tag LOCUS_06120 5596 6423 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_06120 >Feature sequence080 1287 2300 gene locus_tag LOCUS_06130 gene nagZ 1287 2300 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118092.1 protein_id gnl|my_center|LOCUS_06130 4433 2454 gene locus_tag LOCUS_06140 gene dsbD 4433 2454 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958394.1 protein_id gnl|my_center|LOCUS_06140 >Feature sequence081 2916 3623 gene locus_tag LOCUS_06150 gene ubiG 2916 3623 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804826.1 protein_id gnl|my_center|LOCUS_06150 3626 4309 gene locus_tag LOCUS_06160 3626 4309 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804827.1 protein_id gnl|my_center|LOCUS_06160 4306 5067 gene locus_tag LOCUS_06170 4306 5067 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208030.1 protein_id gnl|my_center|LOCUS_06170 5528 5115 gene locus_tag LOCUS_06180 5528 5115 CDS product cytochrome c5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262871.1 protein_id gnl|my_center|LOCUS_06180 >Feature sequence082 1597 698 gene locus_tag LOCUS_06190 gene ybgF 1597 698 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104810.1 protein_id gnl|my_center|LOCUS_06190 2328 1606 gene locus_tag LOCUS_06200 2328 1606 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_06200 4850 2349 gene locus_tag LOCUS_06210 4850 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 5356 5580 gene locus_tag LOCUS_06220 5356 5580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 6159 5572 gene locus_tag LOCUS_06230 6159 5572 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132451.1 protein_id gnl|my_center|LOCUS_06230 >Feature sequence083 <1 1444 gene locus_tag LOCUS_06240 <1 1444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113971.1:FAD-binding oxidoreductase 1585 3168 gene locus_tag LOCUS_06250 1585 3168 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113972.1 protein_id gnl|my_center|LOCUS_06250 3180 4715 gene locus_tag LOCUS_06260 3180 4715 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 protein_id gnl|my_center|LOCUS_06260 4804 5640 gene locus_tag LOCUS_06270 4804 5640 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099360.1 protein_id gnl|my_center|LOCUS_06270 >Feature sequence084 735 235 gene locus_tag LOCUS_06280 735 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141199.1 protein_id gnl|my_center|LOCUS_06280 1013 732 gene locus_tag LOCUS_06290 1013 732 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693744.1 protein_id gnl|my_center|LOCUS_06290 2122 1097 gene locus_tag LOCUS_06300 gene prfA 2122 1097 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119588.1 protein_id gnl|my_center|LOCUS_06300 3341 2154 gene locus_tag LOCUS_06310 gene hemA 3341 2154 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095001.1 protein_id gnl|my_center|LOCUS_06310 3534 5249 gene locus_tag LOCUS_06320 gene lbcA 3534 5249 CDS product proteolytic complex protein LbcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004352693.1 protein_id gnl|my_center|LOCUS_06320 5253 5888 gene locus_tag LOCUS_06330 5253 5888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 >Feature sequence085 2546 1275 gene locus_tag LOCUS_06340 2546 1275 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164739889.1 protein_id gnl|my_center|LOCUS_06340 2689 3402 gene locus_tag LOCUS_06350 2689 3402 CDS product HugZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112758.1 protein_id gnl|my_center|LOCUS_06350 3407 3940 gene locus_tag LOCUS_06360 3407 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 4141 4431 gene locus_tag LOCUS_06370 4141 4431 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003650103.1 protein_id gnl|my_center|LOCUS_06370 4487 6136 gene locus_tag LOCUS_06380 gene groL 4487 6136 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120607.1 protein_id gnl|my_center|LOCUS_06380 >Feature sequence086 645 1202 gene locus_tag LOCUS_06390 645 1202 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 protein_id gnl|my_center|LOCUS_06390 1203 1862 gene locus_tag LOCUS_06400 1203 1862 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284280.1 protein_id gnl|my_center|LOCUS_06400 4060 1859 gene locus_tag LOCUS_06410 4060 1859 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095847.1 protein_id gnl|my_center|LOCUS_06410 4263 4802 gene locus_tag LOCUS_06420 4263 4802 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930554.1 protein_id gnl|my_center|LOCUS_06420 5144 4992 gene locus_tag LOCUS_06430 5144 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 5290 5141 gene locus_tag LOCUS_06440 5290 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 >Feature sequence087 471 3671 gene locus_tag LOCUS_06450 471 3671 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706767.1 protein_id gnl|my_center|LOCUS_06450 4200 3718 gene locus_tag LOCUS_06460 4200 3718 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207342.1 protein_id gnl|my_center|LOCUS_06460 5259 4312 gene locus_tag LOCUS_06470 5259 4312 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115465.1 protein_id gnl|my_center|LOCUS_06470 >Feature sequence088 <1 940 gene locus_tag LOCUS_06480 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098292.1:Fe-S protein assembly chaperone HscA 947 1288 gene locus_tag LOCUS_06490 gene fdx 947 1288 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417920.1 protein_id gnl|my_center|LOCUS_06490 1392 1592 gene locus_tag LOCUS_06500 gene iscX 1392 1592 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417922.1 protein_id gnl|my_center|LOCUS_06500 1607 2359 gene locus_tag LOCUS_06510 1607 2359 CDS product Eco47II family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166415.1 protein_id gnl|my_center|LOCUS_06510 2372 3487 gene locus_tag LOCUS_06520 gene dcm 2372 3487 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946968.1 protein_id gnl|my_center|LOCUS_06520 3557 3988 gene locus_tag LOCUS_06530 gene ndk 3557 3988 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963851.1 protein_id gnl|my_center|LOCUS_06530 4025 5260 gene locus_tag LOCUS_06540 gene rlmN 4025 5260 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115097.1 protein_id gnl|my_center|LOCUS_06540 5287 6048 gene locus_tag LOCUS_06550 gene pilW 5287 6048 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208338.1 protein_id gnl|my_center|LOCUS_06550 >Feature sequence089 1768 311 gene locus_tag LOCUS_06560 1768 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 1977 2765 gene locus_tag LOCUS_06570 1977 2765 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405915.1 protein_id gnl|my_center|LOCUS_06570 2781 3566 gene locus_tag LOCUS_06580 2781 3566 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065232.1 protein_id gnl|my_center|LOCUS_06580 4010 3549 gene locus_tag LOCUS_06590 4010 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 4913 4089 gene locus_tag LOCUS_06600 4913 4089 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113889933.1 protein_id gnl|my_center|LOCUS_06600 5577 4936 gene locus_tag LOCUS_06610 5577 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 >Feature sequence090 1228 686 gene locus_tag LOCUS_06620 1228 686 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207309.1 protein_id gnl|my_center|LOCUS_06620 2420 1233 gene locus_tag LOCUS_06630 2420 1233 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207192.1 protein_id gnl|my_center|LOCUS_06630 4928 2505 gene locus_tag LOCUS_06640 gene lon 4928 2505 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087926.1 protein_id gnl|my_center|LOCUS_06640 <6048 5141 gene locus_tag LOCUS_06650 <6048 5141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003087924.1:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence091 1237 14 gene locus_tag LOCUS_06660 gene serB 1237 14 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380690.1 protein_id gnl|my_center|LOCUS_06660 1448 2626 gene locus_tag LOCUS_06670 1448 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 2619 2978 gene locus_tag LOCUS_06680 2619 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 5353 3125 gene locus_tag LOCUS_06690 gene parC 5353 3125 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095687.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence092 462 1259 gene locus_tag LOCUS_06700 gene rsmH 462 1259 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207838.1 protein_id gnl|my_center|LOCUS_06700 1263 1562 gene locus_tag LOCUS_06710 1263 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 1559 3364 gene locus_tag LOCUS_06720 gene ftsI 1559 3364 CDS product penicillin-binding protein PBP3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117016.1 protein_id gnl|my_center|LOCUS_06720 3364 4824 gene locus_tag LOCUS_06730 3364 4824 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112751.1 protein_id gnl|my_center|LOCUS_06730 >Feature sequence093 4607 2340 gene locus_tag LOCUS_06740 4607 2340 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118176.1 protein_id gnl|my_center|LOCUS_06740 5044 5952 gene locus_tag LOCUS_06750 5044 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 >Feature sequence094 121 405 gene locus_tag LOCUS_06760 121 405 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063142.1 protein_id gnl|my_center|LOCUS_06760 912 406 gene locus_tag LOCUS_06770 gene yjgA 912 406 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208401.1 protein_id gnl|my_center|LOCUS_06770 1328 1059 gene locus_tag LOCUS_06780 1328 1059 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984428.1 protein_id gnl|my_center|LOCUS_06780 2185 1325 gene locus_tag LOCUS_06790 gene rapZ 2185 1325 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208400.1 protein_id gnl|my_center|LOCUS_06790 2664 2365 gene locus_tag LOCUS_06800 gene hpf 2664 2365 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_06800 4295 2814 gene locus_tag LOCUS_06810 4295 2814 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340639.1 protein_id gnl|my_center|LOCUS_06810 5148 4426 gene locus_tag LOCUS_06820 gene lptB 5148 4426 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467801.1 protein_id gnl|my_center|LOCUS_06820 5693 5145 gene locus_tag LOCUS_06830 gene lptA 5693 5145 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122334.1 protein_id gnl|my_center|LOCUS_06830 >Feature sequence095 476 1171 gene locus_tag LOCUS_06840 gene pilO 476 1171 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_06840 1168 1713 gene locus_tag LOCUS_06850 1168 1713 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207830.1 protein_id gnl|my_center|LOCUS_06850 1786 3930 gene locus_tag LOCUS_06860 1786 3930 CDS product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207829.1 protein_id gnl|my_center|LOCUS_06860 3941 4459 gene locus_tag LOCUS_06870 gene aroK 3941 4459 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116987.1 protein_id gnl|my_center|LOCUS_06870 4525 5631 gene locus_tag LOCUS_06880 gene aroB 4525 5631 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207828.1 protein_id gnl|my_center|LOCUS_06880 >Feature sequence096 1010 468 gene locus_tag LOCUS_06890 1010 468 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391429.1 protein_id gnl|my_center|LOCUS_06890 1160 2560 gene locus_tag LOCUS_06900 1160 2560 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113875.1 protein_id gnl|my_center|LOCUS_06900 3722 2604 gene locus_tag LOCUS_06910 3722 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 <5821 3762 gene locus_tag LOCUS_06920 <5821 3762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113876.1:phosphoketolase >Feature sequence097 1614 103 gene locus_tag LOCUS_06930 1614 103 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_06930 2189 1611 gene locus_tag LOCUS_06940 2189 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 2514 2233 gene locus_tag LOCUS_06950 2514 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 3159 2905 gene locus_tag LOCUS_06960 3159 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 3782 3162 gene locus_tag LOCUS_06970 3782 3162 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387714.1 protein_id gnl|my_center|LOCUS_06970 4786 5598 gene locus_tag LOCUS_06980 4786 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 >Feature sequence098 696 1805 gene locus_tag LOCUS_06990 gene ispG 696 1805 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092800.1 protein_id gnl|my_center|LOCUS_06990 1950 2969 gene locus_tag LOCUS_07000 1950 2969 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462034.1 protein_id gnl|my_center|LOCUS_07000 2988 3227 gene locus_tag LOCUS_07010 2988 3227 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057724.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence099 <1 578 gene locus_tag LOCUS_07020 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002120024.1:LysR family transcriptional regulator GigC 677 2467 gene locus_tag LOCUS_07030 gene fimW 677 2467 CDS product cyclic-di-GMP receptor FimW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113922.1 protein_id gnl|my_center|LOCUS_07030 2679 4763 gene locus_tag LOCUS_07040 gene fimX 2679 4763 CDS product cyclic di-GMP-binding protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_07040 4990 5580 gene locus_tag LOCUS_07050 4990 5580 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195469.1 protein_id gnl|my_center|LOCUS_07050 5788 5603 gene locus_tag LOCUS_07060 5788 5603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 >Feature sequence100 2762 894 gene locus_tag LOCUS_07070 gene nuoL 2762 894 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405115.1 protein_id gnl|my_center|LOCUS_07070 3067 2759 gene locus_tag LOCUS_07080 gene nuoK 3067 2759 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090475.1 protein_id gnl|my_center|LOCUS_07080 3710 3213 gene locus_tag LOCUS_07090 gene nuoJ 3710 3213 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090473.1 protein_id gnl|my_center|LOCUS_07090 4284 3724 gene locus_tag LOCUS_07100 gene nuoI 4284 3724 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405112.1 protein_id gnl|my_center|LOCUS_07100 5282 4281 gene locus_tag LOCUS_07110 gene nuoH 5282 4281 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371726.1 protein_id gnl|my_center|LOCUS_07110 >Feature sequence101 226 690 gene locus_tag LOCUS_07120 226 690 CDS product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975288.1 protein_id gnl|my_center|LOCUS_07120 855 1463 gene locus_tag LOCUS_07130 855 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 1720 2991 gene locus_tag LOCUS_07140 1720 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 4625 3042 gene locus_tag LOCUS_07150 4625 3042 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403632.1 protein_id gnl|my_center|LOCUS_07150 >Feature sequence102 195 773 gene locus_tag LOCUS_07160 195 773 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103566.1 protein_id gnl|my_center|LOCUS_07160 853 1380 gene locus_tag LOCUS_07170 853 1380 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920495.1 protein_id gnl|my_center|LOCUS_07170 1508 2449 gene locus_tag LOCUS_07180 1508 2449 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_07180 3916 2657 gene locus_tag LOCUS_07190 3916 2657 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534099.1 protein_id gnl|my_center|LOCUS_07190 4726 3989 gene locus_tag LOCUS_07200 4726 3989 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_07200 >Feature sequence103 2023 1049 gene locus_tag LOCUS_07210 2023 1049 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206653.1 protein_id gnl|my_center|LOCUS_07210 2872 2306 gene locus_tag LOCUS_07220 gene dcd 2872 2306 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092017.1 protein_id gnl|my_center|LOCUS_07220 4008 2929 gene locus_tag LOCUS_07230 gene apbC 4008 2929 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104888.1 protein_id gnl|my_center|LOCUS_07230 >Feature sequence104 1126 2853 gene locus_tag LOCUS_07240 1126 2853 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079103.1 protein_id gnl|my_center|LOCUS_07240 2856 3347 gene locus_tag LOCUS_07250 gene ilvN 2856 3347 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114824.1 protein_id gnl|my_center|LOCUS_07250 3495 4511 gene locus_tag LOCUS_07260 gene ilvC 3495 4511 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095066.1 protein_id gnl|my_center|LOCUS_07260 4718 4569 gene locus_tag LOCUS_07270 4718 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 <5647 4764 gene locus_tag LOCUS_07280 <5647 4764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004537839.1:cytochrome d ubiquinol oxidase subunit II >Feature sequence105 2092 2967 gene locus_tag LOCUS_07290 2092 2967 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207755.1 protein_id gnl|my_center|LOCUS_07290 4199 3015 gene locus_tag LOCUS_07300 4199 3015 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114804.1 protein_id gnl|my_center|LOCUS_07300 4607 4912 gene locus_tag LOCUS_07310 gene hsbA 4607 4912 CDS product anti-anti sigma factor HsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_07310 >Feature sequence106 432 1796 gene locus_tag LOCUS_07320 gene hslU 432 1796 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707776.1 protein_id gnl|my_center|LOCUS_07320 1968 2225 gene locus_tag LOCUS_07330 1968 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 2278 3048 gene locus_tag LOCUS_07340 2278 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706121.1 protein_id gnl|my_center|LOCUS_07340 3193 3945 gene locus_tag LOCUS_07350 gene ubiE 3193 3945 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114829.1 protein_id gnl|my_center|LOCUS_07350 3947 4603 gene locus_tag LOCUS_07360 3947 4603 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958604.1 protein_id gnl|my_center|LOCUS_07360 >Feature sequence107 <1 2121 gene locus_tag LOCUS_07370 <1 2121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208009.1:phosphoenolpyruvate carboxylase 2257 3744 gene locus_tag LOCUS_07380 2257 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 4175 5131 gene locus_tag LOCUS_07390 4175 5131 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033424.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence108 <1 550 gene locus_tag LOCUS_07400 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003108028.1:transcription termination/antitermination protein NusG 650 1078 gene locus_tag LOCUS_07410 gene rplK 650 1078 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074682.1 protein_id gnl|my_center|LOCUS_07410 1082 1780 gene locus_tag LOCUS_07420 gene rplA 1082 1780 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065788.1 protein_id gnl|my_center|LOCUS_07420 2022 2522 gene locus_tag LOCUS_07430 gene rplJ 2022 2522 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115099.1 protein_id gnl|my_center|LOCUS_07430 2679 3047 gene locus_tag LOCUS_07440 gene rplL 2679 3047 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229360.1 protein_id gnl|my_center|LOCUS_07440 >Feature sequence109 1974 790 gene locus_tag LOCUS_07450 gene ftsW 1974 790 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079447.1 protein_id gnl|my_center|LOCUS_07450 3449 2085 gene locus_tag LOCUS_07460 gene murD 3449 2085 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208179.1 protein_id gnl|my_center|LOCUS_07460 4539 3457 gene locus_tag LOCUS_07470 gene mraY 4539 3457 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_07470 <5528 4545 gene locus_tag LOCUS_07480 <5528 4545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073904.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence110 2149 1763 gene locus_tag LOCUS_07490 gene cueR 2149 1763 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266543.1 protein_id gnl|my_center|LOCUS_07490 4287 2146 gene locus_tag LOCUS_07500 gene copA1 4287 2146 CDS product copper-translocating P-type ATPase CopA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_07500 4517 4723 gene locus_tag LOCUS_07510 4517 4723 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092153.1 protein_id gnl|my_center|LOCUS_07510 >Feature sequence111 287 1483 gene locus_tag LOCUS_07520 287 1483 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054787.1 protein_id gnl|my_center|LOCUS_07520 1566 2282 gene locus_tag LOCUS_07530 1566 2282 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566878.1 protein_id gnl|my_center|LOCUS_07530 2407 2988 gene locus_tag LOCUS_07540 2407 2988 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480360.1 protein_id gnl|my_center|LOCUS_07540 3047 4087 gene locus_tag LOCUS_07550 3047 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 4105 4743 gene locus_tag LOCUS_07560 4105 4743 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210396.1 protein_id gnl|my_center|LOCUS_07560 4751 5368 gene locus_tag LOCUS_07570 4751 5368 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228094.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence112 2337 1033 gene locus_tag LOCUS_07580 2337 1033 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222944447.1 protein_id gnl|my_center|LOCUS_07580 3277 2504 gene locus_tag LOCUS_07590 3277 2504 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208175.1 protein_id gnl|my_center|LOCUS_07590 4304 3348 gene locus_tag LOCUS_07600 gene xerD 4304 3348 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208176.1 protein_id gnl|my_center|LOCUS_07600 4892 4524 gene locus_tag LOCUS_07610 gene rplS 4892 4524 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116654.1 protein_id gnl|my_center|LOCUS_07610 5403 5008 gene locus_tag LOCUS_07620 5403 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07620 >Feature sequence113 4232 2124 gene locus_tag LOCUS_07630 gene spoT 4232 2124 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_07630 4587 4315 gene locus_tag LOCUS_07640 gene rpoZ 4587 4315 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096602.1 protein_id gnl|my_center|LOCUS_07640 5253 4639 gene locus_tag LOCUS_07650 gene gmk 5253 4639 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116973.1 protein_id gnl|my_center|LOCUS_07650 5213 5353 gene locus_tag LOCUS_07660 5213 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 >Feature sequence114 831 469 gene locus_tag LOCUS_07670 831 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 948 1766 gene locus_tag LOCUS_07680 948 1766 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206191.1 protein_id gnl|my_center|LOCUS_07680 1763 2440 gene locus_tag LOCUS_07690 1763 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 4329 2437 gene locus_tag LOCUS_07700 4329 2437 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114254.1 protein_id gnl|my_center|LOCUS_07700 5192 4320 gene locus_tag LOCUS_07710 5192 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 >Feature sequence115 1022 405 gene locus_tag LOCUS_07720 1022 405 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206595.1 protein_id gnl|my_center|LOCUS_07720 1792 1019 gene locus_tag LOCUS_07730 1792 1019 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069538.1 protein_id gnl|my_center|LOCUS_07730 2146 1802 gene locus_tag LOCUS_07740 2146 1802 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036225.1 protein_id gnl|my_center|LOCUS_07740 3164 2163 gene locus_tag LOCUS_07750 3164 2163 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206594.1 protein_id gnl|my_center|LOCUS_07750 3790 3161 gene locus_tag LOCUS_07760 gene tmk 3790 3161 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091125.1 protein_id gnl|my_center|LOCUS_07760 4949 3792 gene locus_tag LOCUS_07770 gene mltG 4949 3792 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207374.1 protein_id gnl|my_center|LOCUS_07770 >Feature sequence116 495 1286 gene locus_tag LOCUS_07780 495 1286 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096250.1 protein_id gnl|my_center|LOCUS_07780 1489 2670 gene locus_tag LOCUS_07790 1489 2670 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_07790 2742 2990 gene locus_tag LOCUS_07800 2742 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 2990 3394 gene locus_tag LOCUS_07810 2990 3394 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144326.1 protein_id gnl|my_center|LOCUS_07810 3431 4561 gene locus_tag LOCUS_07820 gene pheA 3431 4561 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049199.1 protein_id gnl|my_center|LOCUS_07820 >Feature sequence117 1058 477 gene locus_tag LOCUS_07830 1058 477 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004415847.1 protein_id gnl|my_center|LOCUS_07830 2766 1372 gene locus_tag LOCUS_07840 2766 1372 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079030.1 protein_id gnl|my_center|LOCUS_07840 3120 2779 gene locus_tag LOCUS_07850 3120 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 4265 3132 gene locus_tag LOCUS_07860 4265 3132 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208383.1 protein_id gnl|my_center|LOCUS_07860 >Feature sequence118 1583 132 gene locus_tag LOCUS_07870 gene ccoG 1583 132 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_07870 2692 1778 gene locus_tag LOCUS_07880 gene ccoP 2692 1778 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087292.1 protein_id gnl|my_center|LOCUS_07880 2874 2689 gene locus_tag LOCUS_07890 2874 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 3513 2878 gene locus_tag LOCUS_07900 gene ccoO 3513 2878 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261904.1 protein_id gnl|my_center|LOCUS_07900 4956 3529 gene locus_tag LOCUS_07910 gene ccoN 4956 3529 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072351.1 protein_id gnl|my_center|LOCUS_07910 >Feature sequence119 2067 3128 gene locus_tag LOCUS_07920 2067 3128 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_07920 3129 3770 gene locus_tag LOCUS_07930 gene pilN 3129 3770 CDS product type 4a pilus biogenesis protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_07930 3767 4480 gene locus_tag LOCUS_07940 gene pilO 3767 4480 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_07940 4477 5022 gene locus_tag LOCUS_07950 4477 5022 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207830.1 protein_id gnl|my_center|LOCUS_07950 >Feature sequence120 <1 1197 gene locus_tag LOCUS_07960 <1 1197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206210853.1:MG2 domain-containing protein 1585 3243 gene locus_tag LOCUS_07970 1585 3243 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114249.1 protein_id gnl|my_center|LOCUS_07970 >Feature sequence121 470 1168 gene locus_tag LOCUS_07980 470 1168 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207320.1 protein_id gnl|my_center|LOCUS_07980 1962 1237 gene locus_tag LOCUS_07990 gene pdxJ 1962 1237 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764769.1 protein_id gnl|my_center|LOCUS_07990 2630 1959 gene locus_tag LOCUS_08000 2630 1959 CDS product DNA repair protein RecO C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207366.1 protein_id gnl|my_center|LOCUS_08000 3583 2636 gene locus_tag LOCUS_08010 gene era 3583 2636 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207367.1 protein_id gnl|my_center|LOCUS_08010 4268 3588 gene locus_tag LOCUS_08020 gene rnc 4268 3588 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420714.1 protein_id gnl|my_center|LOCUS_08020 4651 4265 gene locus_tag LOCUS_08030 4651 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 <5300 4676 gene locus_tag LOCUS_08040 <5300 4676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207370.1:signal peptidase I >Feature sequence122 959 2818 gene locus_tag LOCUS_08050 gene thiC 959 2818 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266479.1 protein_id gnl|my_center|LOCUS_08050 2888 3493 gene locus_tag LOCUS_08060 gene nudF 2888 3493 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262653.1 protein_id gnl|my_center|LOCUS_08060 3761 4486 gene locus_tag LOCUS_08070 gene cpdA 3761 4486 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266482.1 protein_id gnl|my_center|LOCUS_08070 4523 5089 gene locus_tag LOCUS_08080 gene yqiA 4523 5089 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457154.1 protein_id gnl|my_center|LOCUS_08080 >Feature sequence123 780 49 gene locus_tag LOCUS_08090 780 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 975 1895 gene locus_tag LOCUS_08100 975 1895 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076206.1 protein_id gnl|my_center|LOCUS_08100 1941 2684 gene locus_tag LOCUS_08110 1941 2684 CDS product fimb protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688173.1 protein_id gnl|my_center|LOCUS_08110 3169 2717 gene locus_tag LOCUS_08120 3169 2717 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095815.1 protein_id gnl|my_center|LOCUS_08120 3877 3170 gene locus_tag LOCUS_08130 3877 3170 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768510.1 protein_id gnl|my_center|LOCUS_08130 4797 3874 gene locus_tag LOCUS_08140 4797 3874 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207413.1 protein_id gnl|my_center|LOCUS_08140 >Feature sequence124 3166 2648 gene locus_tag LOCUS_08150 3166 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 4224 3178 gene locus_tag LOCUS_08160 4224 3178 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215055.1 protein_id gnl|my_center|LOCUS_08160 <5226 4227 gene locus_tag LOCUS_08170 <5226 4227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968624.1:DUF1156 domain-containing protein >Feature sequence125 1506 631 gene locus_tag LOCUS_08180 1506 631 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_08180 1675 1992 gene locus_tag LOCUS_08190 1675 1992 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298602.1 protein_id gnl|my_center|LOCUS_08190 1989 2429 gene locus_tag LOCUS_08200 1989 2429 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038731.1 protein_id gnl|my_center|LOCUS_08200 2431 2844 gene locus_tag LOCUS_08210 2431 2844 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 protein_id gnl|my_center|LOCUS_08210 2970 4697 gene locus_tag LOCUS_08220 2970 4697 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_08220 >Feature sequence126 157 582 gene locus_tag LOCUS_08230 157 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 639 1349 gene locus_tag LOCUS_08240 639 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08240 1407 3014 gene locus_tag LOCUS_08250 1407 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08250 3030 3332 gene locus_tag LOCUS_08260 gene ihfA 3030 3332 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553164.1 protein_id gnl|my_center|LOCUS_08260 3313 3768 gene locus_tag LOCUS_08270 3313 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 3771 4196 gene locus_tag LOCUS_08280 3771 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 4256 4332 gene locus_tag LOCUS_t00080 4256 4332 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 <5195 4488 gene locus_tag LOCUS_08290 <5195 4488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104163.1:acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha >Feature sequence127 246 1115 gene locus_tag LOCUS_08300 gene ubiA 246 1115 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104612.1 protein_id gnl|my_center|LOCUS_08300 1467 2702 gene locus_tag LOCUS_08310 1467 2702 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226163.1 protein_id gnl|my_center|LOCUS_08310 2845 3426 gene locus_tag LOCUS_08320 2845 3426 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944023.1 protein_id gnl|my_center|LOCUS_08320 3594 4304 gene locus_tag LOCUS_08330 gene phoB 3594 4304 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650776.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence128 <1 822 gene locus_tag LOCUS_08340 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005064414.1:wax ester/triacylglycerol synthase family O-acyltransferase 2215 824 gene locus_tag LOCUS_08350 2215 824 CDS product C13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208435.1 protein_id gnl|my_center|LOCUS_08350 2932 2243 gene locus_tag LOCUS_08360 gene bioD 2932 2243 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103336.1 protein_id gnl|my_center|LOCUS_08360 3871 2942 gene locus_tag LOCUS_08370 3871 2942 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_08370 4671 3889 gene locus_tag LOCUS_08380 gene bioC 4671 3889 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460024.1 protein_id gnl|my_center|LOCUS_08380 <5178 4646 gene locus_tag LOCUS_08390 <5178 4646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703680.1:pimeloyl-ACP methyl ester esterase BioH >Feature sequence129 <1 583 gene locus_tag LOCUS_08400 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000208083.1:superoxide dismutase 1608 658 gene locus_tag LOCUS_08410 gene trxB 1608 658 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121722.1 protein_id gnl|my_center|LOCUS_08410 1736 2794 gene locus_tag LOCUS_08420 gene ald 1736 2794 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926910.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence130 946 2394 gene locus_tag LOCUS_08430 946 2394 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074089.1 protein_id gnl|my_center|LOCUS_08430 4397 2511 gene locus_tag LOCUS_08440 4397 2511 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804875.1 protein_id gnl|my_center|LOCUS_08440 4479 4551 gene locus_tag LOCUS_t00090 4479 4551 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence131 773 306 gene locus_tag LOCUS_08450 773 306 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266812.1 protein_id gnl|my_center|LOCUS_08450 1018 2400 gene locus_tag LOCUS_08460 gene hemN 1018 2400 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103794.1 protein_id gnl|my_center|LOCUS_08460 >Feature sequence132 884 702 gene locus_tag LOCUS_08470 884 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 887 2170 gene locus_tag LOCUS_08480 887 2170 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208332.1 protein_id gnl|my_center|LOCUS_08480 3080 2238 gene locus_tag LOCUS_08490 3080 2238 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208333.1 protein_id gnl|my_center|LOCUS_08490 3370 3101 gene locus_tag LOCUS_08500 3370 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 4373 3354 gene locus_tag LOCUS_08510 gene holA 4373 3354 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105191.1 protein_id gnl|my_center|LOCUS_08510 4876 4370 gene locus_tag LOCUS_08520 gene lptE 4876 4370 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947077.1 protein_id gnl|my_center|LOCUS_08520 >Feature sequence133 69 2261 gene locus_tag LOCUS_08530 69 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 3665 2355 gene locus_tag LOCUS_08540 3665 2355 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739890.1 protein_id gnl|my_center|LOCUS_08540 4072 3734 gene locus_tag LOCUS_08550 gene glnK 4072 3734 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555808.1 protein_id gnl|my_center|LOCUS_08550 4611 4159 gene locus_tag LOCUS_08560 4611 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 5123 4893 gene locus_tag LOCUS_08570 5123 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 >Feature sequence134 522 1544 gene locus_tag LOCUS_08580 522 1544 CDS product phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111200.1 protein_id gnl|my_center|LOCUS_08580 1797 2819 gene locus_tag LOCUS_08590 1797 2819 CDS product phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111200.1 protein_id gnl|my_center|LOCUS_08590 2898 4364 gene locus_tag LOCUS_08600 2898 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 4421 5002 gene locus_tag LOCUS_08610 4421 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114639.1 protein_id gnl|my_center|LOCUS_08610 >Feature sequence135 54 269 gene locus_tag LOCUS_08620 54 269 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071317.1 protein_id gnl|my_center|LOCUS_08620 323 2041 gene locus_tag LOCUS_08630 323 2041 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099684.1 protein_id gnl|my_center|LOCUS_08630 2629 2144 gene locus_tag LOCUS_08640 2629 2144 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122604.1 protein_id gnl|my_center|LOCUS_08640 3120 2632 gene locus_tag LOCUS_08650 3120 2632 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002051423.1 protein_id gnl|my_center|LOCUS_08650 3343 3987 gene locus_tag LOCUS_08660 3343 3987 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170954.1 protein_id gnl|my_center|LOCUS_08660 4469 4047 gene locus_tag LOCUS_08670 4469 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence136 <1 852 gene locus_tag LOCUS_08680 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943579.1:LTA synthase family protein 1515 937 gene locus_tag LOCUS_08690 1515 937 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 protein_id gnl|my_center|LOCUS_08690 1910 3046 gene locus_tag LOCUS_08700 gene carA 1910 3046 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706536.1 protein_id gnl|my_center|LOCUS_08700 >Feature sequence137 1765 872 gene locus_tag LOCUS_08710 1765 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 2205 1762 gene locus_tag LOCUS_08720 2205 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 2895 2215 gene locus_tag LOCUS_08730 2895 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 3045 3329 gene locus_tag LOCUS_08740 3045 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 3331 4641 gene locus_tag LOCUS_08750 3331 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 >Feature sequence138 <1 1034 gene locus_tag LOCUS_08760 <1 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877215.1:GAF domain-containing protein 1170 1556 gene locus_tag LOCUS_08770 1170 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 2802 1558 gene locus_tag LOCUS_08780 2802 1558 CDS product DUF1615 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166493634.1 protein_id gnl|my_center|LOCUS_08780 2953 3732 gene locus_tag LOCUS_08790 2953 3732 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222374.1 protein_id gnl|my_center|LOCUS_08790 4203 3778 gene locus_tag LOCUS_08800 4203 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08800 <5054 4101 gene locus_tag LOCUS_08810 <5054 4101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267702.1:methionine synthase note possible pseudo, frameshifted >Feature sequence139 422 1042 gene locus_tag LOCUS_08820 422 1042 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 protein_id gnl|my_center|LOCUS_08820 1282 2457 gene locus_tag LOCUS_08830 1282 2457 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095644.1 protein_id gnl|my_center|LOCUS_08830 2505 3827 gene locus_tag LOCUS_08840 2505 3827 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_08840 >Feature sequence140 2014 1079 gene locus_tag LOCUS_08850 2014 1079 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206196.1 protein_id gnl|my_center|LOCUS_08850 2345 3709 gene locus_tag LOCUS_08860 2345 3709 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064414.1 protein_id gnl|my_center|LOCUS_08860 4220 3837 gene locus_tag LOCUS_08870 4220 3837 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819915.1 protein_id gnl|my_center|LOCUS_08870 4504 4220 gene locus_tag LOCUS_08880 4504 4220 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063142.1 protein_id gnl|my_center|LOCUS_08880 4805 4473 gene locus_tag LOCUS_08890 4805 4473 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679319.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence141 2847 2356 gene locus_tag LOCUS_08900 2847 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 4478 2946 gene locus_tag LOCUS_08910 4478 2946 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099581.1 protein_id gnl|my_center|LOCUS_08910 <5023 4475 gene locus_tag LOCUS_08920 <5023 4475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269137.1:YeaH/YhbH family protein >Feature sequence142 369 1835 gene locus_tag LOCUS_08930 gene guaB 369 1835 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121951.1 protein_id gnl|my_center|LOCUS_08930 1947 3509 gene locus_tag LOCUS_08940 gene guaA 1947 3509 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771001.1 protein_id gnl|my_center|LOCUS_08940 3563 3925 gene locus_tag LOCUS_08950 3563 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 3909 4406 gene locus_tag LOCUS_08960 gene tadA 3909 4406 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121378.1 protein_id gnl|my_center|LOCUS_08960 >Feature sequence143 1296 169 gene locus_tag LOCUS_08970 1296 169 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038953.1 protein_id gnl|my_center|LOCUS_08970 2353 1307 gene locus_tag LOCUS_08980 2353 1307 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204243849.1 protein_id gnl|my_center|LOCUS_08980 2505 3170 gene locus_tag LOCUS_08990 gene fabR 2505 3170 CDS product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038955.1 protein_id gnl|my_center|LOCUS_08990 3629 3171 gene locus_tag LOCUS_09000 gene moaE 3629 3171 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490611.1 protein_id gnl|my_center|LOCUS_09000 3932 3678 gene locus_tag LOCUS_09010 gene moaD 3932 3678 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764130.1 protein_id gnl|my_center|LOCUS_09010 4396 3929 gene locus_tag LOCUS_09020 gene moaC 4396 3929 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341741.1 protein_id gnl|my_center|LOCUS_09020 >Feature sequence144 <1 1257 gene locus_tag LOCUS_09030 <1 1257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113930.1:GTPase HflX 1289 2380 gene locus_tag LOCUS_09040 gene hflK 1289 2380 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266497.1 protein_id gnl|my_center|LOCUS_09040 2383 3249 gene locus_tag LOCUS_09050 gene hflC 2383 3249 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366315.1 protein_id gnl|my_center|LOCUS_09050 >Feature sequence145 982 317 gene locus_tag LOCUS_09060 982 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 1205 2371 gene locus_tag LOCUS_09070 gene liuA 1205 2371 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100385.1 protein_id gnl|my_center|LOCUS_09070 2595 4205 gene locus_tag LOCUS_09080 2595 4205 CDS product propionyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267706.1 protein_id gnl|my_center|LOCUS_09080 >Feature sequence146 <1 603 gene locus_tag LOCUS_09090 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092047.1:electron transport complex subunit RsxG 600 1313 gene locus_tag LOCUS_09100 600 1313 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112914.1 protein_id gnl|my_center|LOCUS_09100 1314 1949 gene locus_tag LOCUS_09110 gene nth 1314 1949 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057741.1 protein_id gnl|my_center|LOCUS_09110 2389 1958 gene locus_tag LOCUS_09120 2389 1958 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132355466.1 protein_id gnl|my_center|LOCUS_09120 2740 2465 gene locus_tag LOCUS_09130 2740 2465 CDS product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118245.1 protein_id gnl|my_center|LOCUS_09130 3631 2741 gene locus_tag LOCUS_09140 3631 2741 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118179.1 protein_id gnl|my_center|LOCUS_09140 4732 3653 gene locus_tag LOCUS_09150 4732 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 >Feature sequence147 109 1944 gene locus_tag LOCUS_09160 109 1944 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208177.1 protein_id gnl|my_center|LOCUS_09160 1941 2204 gene locus_tag LOCUS_09170 1941 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 2285 4723 gene locus_tag LOCUS_09180 2285 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence148 295 720 gene locus_tag LOCUS_09190 gene rbfA 295 720 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268880.1 protein_id gnl|my_center|LOCUS_09190 721 1656 gene locus_tag LOCUS_09200 gene truB 721 1656 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100522.1 protein_id gnl|my_center|LOCUS_09200 1858 2127 gene locus_tag LOCUS_09210 gene rpsO 1858 2127 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114951.1 protein_id gnl|my_center|LOCUS_09210 2329 4416 gene locus_tag LOCUS_09220 gene pnp 2329 4416 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208247.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence149 <1 1770 gene locus_tag LOCUS_09230 <1 1770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072959.1:DNA topoisomerase III 1850 3301 gene locus_tag LOCUS_09240 1850 3301 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114563.1 protein_id gnl|my_center|LOCUS_09240 3312 4025 gene locus_tag LOCUS_09250 3312 4025 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090711.1 protein_id gnl|my_center|LOCUS_09250 >Feature sequence150 <1 1144 gene locus_tag LOCUS_09260 <1 1144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001218900.1:tyrosine-type recombinase/integrase 1570 1289 gene locus_tag LOCUS_09270 1570 1289 CDS product PA4642 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121755.1 protein_id gnl|my_center|LOCUS_09270 1938 1666 gene locus_tag LOCUS_09280 gene minE 1938 1666 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007648439.1 protein_id gnl|my_center|LOCUS_09280 2751 1942 gene locus_tag LOCUS_09290 gene minD 2751 1942 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382726.1 protein_id gnl|my_center|LOCUS_09290 3670 2975 gene locus_tag LOCUS_09300 gene minC 3670 2975 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104763.1 protein_id gnl|my_center|LOCUS_09300 4816 3812 gene locus_tag LOCUS_09310 4816 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838772.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence151 1408 2136 gene locus_tag LOCUS_09320 1408 2136 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206820.1 protein_id gnl|my_center|LOCUS_09320 2171 2428 gene locus_tag LOCUS_09330 2171 2428 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886812.1 protein_id gnl|my_center|LOCUS_09330 4086 2620 gene locus_tag LOCUS_09340 gene nuoN 4086 2620 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090482.1 protein_id gnl|my_center|LOCUS_09340 <4891 4094 gene locus_tag LOCUS_09350 <4891 4094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002210269.1:NADH-quinone oxidoreductase subunit M >Feature sequence152 <1 1726 gene locus_tag LOCUS_09360 <1 1726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112602.1:alanine--tRNA ligase 1781 3007 gene locus_tag LOCUS_09370 1781 3007 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369901.1 protein_id gnl|my_center|LOCUS_09370 3304 3510 gene locus_tag LOCUS_09380 gene csrA 3304 3510 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906487.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence153 623 1516 gene locus_tag LOCUS_09390 gene cysM 623 1516 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208391.1 protein_id gnl|my_center|LOCUS_09390 2837 1599 gene locus_tag LOCUS_09400 2837 1599 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_09400 3543 2827 gene locus_tag LOCUS_09410 3543 2827 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108766.1 protein_id gnl|my_center|LOCUS_09410 4302 3586 gene locus_tag LOCUS_09420 gene aat 4302 3586 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205972.1 protein_id gnl|my_center|LOCUS_09420 4511 4843 gene locus_tag LOCUS_09430 4511 4843 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001335188.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence154 1716 1279 gene locus_tag LOCUS_09440 gene nsrR 1716 1279 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 protein_id gnl|my_center|LOCUS_09440 2074 4332 gene locus_tag LOCUS_09450 2074 4332 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691589.1 protein_id gnl|my_center|LOCUS_09450 >Feature sequence155 247 172 gene locus_tag LOCUS_t00100 247 172 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1621 455 gene locus_tag LOCUS_09460 1621 455 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118408.1 protein_id gnl|my_center|LOCUS_09460 1804 3828 gene locus_tag LOCUS_09470 gene uvrB 1804 3828 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118463.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence156 <1 3161 gene locus_tag LOCUS_09480 <1 3161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206207.1:ATP-dependent RNA helicase HrpA 3275 4396 gene locus_tag LOCUS_09490 3275 4396 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265715.1 protein_id gnl|my_center|LOCUS_09490 >Feature sequence157 85 1797 gene locus_tag LOCUS_09500 85 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 1859 2146 gene locus_tag LOCUS_09510 1859 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 2139 2387 gene locus_tag LOCUS_09520 2139 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 2407 3999 gene locus_tag LOCUS_09530 2407 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 >Feature sequence158 <1 685 gene locus_tag LOCUS_09540 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002118606.1:translation elongation factor 4 685 1467 gene locus_tag LOCUS_09550 gene lepB 685 1467 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207370.1 protein_id gnl|my_center|LOCUS_09550 1492 1878 gene locus_tag LOCUS_09560 1492 1878 CDS product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246809.1 protein_id gnl|my_center|LOCUS_09560 1875 2555 gene locus_tag LOCUS_09570 gene rnc 1875 2555 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420714.1 protein_id gnl|my_center|LOCUS_09570 2560 3507 gene locus_tag LOCUS_09580 gene era 2560 3507 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207367.1 protein_id gnl|my_center|LOCUS_09580 3513 4217 gene locus_tag LOCUS_09590 gene recO 3513 4217 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101972.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence159 273 746 gene locus_tag LOCUS_09600 273 746 CDS product DUF3015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003650547.1 protein_id gnl|my_center|LOCUS_09600 830 2734 gene locus_tag LOCUS_09610 830 2734 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207273.1 protein_id gnl|my_center|LOCUS_09610 <4762 2731 gene locus_tag LOCUS_09620 <4762 2731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003086042.1:GTP diphosphokinase >Feature sequence160 1979 657 gene locus_tag LOCUS_09630 1979 657 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207856.1 protein_id gnl|my_center|LOCUS_09630 2725 1991 gene locus_tag LOCUS_09640 gene ompR 2725 1991 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207855.1 protein_id gnl|my_center|LOCUS_09640 4110 2797 gene locus_tag LOCUS_09650 gene chrA 4110 2797 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206681.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence161 157 492 gene locus_tag LOCUS_09660 157 492 CDS product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116083.1 protein_id gnl|my_center|LOCUS_09660 1260 583 gene locus_tag LOCUS_09670 1260 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 2636 1359 gene locus_tag LOCUS_09680 2636 1359 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071339.1 protein_id gnl|my_center|LOCUS_09680 4048 2744 gene locus_tag LOCUS_09690 4048 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 <4714 4059 gene locus_tag LOCUS_09700 <4714 4059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003399812.1:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence162 3345 523 gene locus_tag LOCUS_09710 gene ileS 3345 523 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208022.1 protein_id gnl|my_center|LOCUS_09710 4319 3384 gene locus_tag LOCUS_09720 gene ribF 4319 3384 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704352.1 protein_id gnl|my_center|LOCUS_09720 4711 4385 gene locus_tag LOCUS_09730 4711 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 >Feature sequence163 1038 148 gene locus_tag LOCUS_09740 1038 148 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104396.1 protein_id gnl|my_center|LOCUS_09740 1641 1135 gene locus_tag LOCUS_09750 1641 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09750 2415 1696 gene locus_tag LOCUS_09760 2415 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09760 3163 3501 gene locus_tag LOCUS_09770 3163 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 3498 3863 gene locus_tag LOCUS_09780 gene sdhD 3498 3863 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833672.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence164 <1 856 gene locus_tag LOCUS_09790 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005068220.1:rod shape-determining protein RodA note possible pseudo, internal stop codon 857 991 gene locus_tag LOCUS_09800 857 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09800 995 1990 gene locus_tag LOCUS_09810 gene mltB 995 1990 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_09810 2340 3215 gene locus_tag LOCUS_09820 2340 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence165 1705 758 gene locus_tag LOCUS_09830 gene prmB 1705 758 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113580.1 protein_id gnl|my_center|LOCUS_09830 1816 2487 gene locus_tag LOCUS_09840 1816 2487 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207268.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence166 104 841 gene locus_tag LOCUS_09850 104 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 895 1863 gene locus_tag LOCUS_09860 895 1863 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205925.1 protein_id gnl|my_center|LOCUS_09860 2058 2477 gene locus_tag LOCUS_09870 2058 2477 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554011.1 protein_id gnl|my_center|LOCUS_09870 2487 3158 gene locus_tag LOCUS_09880 2487 3158 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554012.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence167 845 180 gene locus_tag LOCUS_09890 845 180 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704158.1 protein_id gnl|my_center|LOCUS_09890 1145 2224 gene locus_tag LOCUS_09900 1145 2224 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206644.1 protein_id gnl|my_center|LOCUS_09900 3543 2473 gene locus_tag LOCUS_09910 3543 2473 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190236313.1 protein_id gnl|my_center|LOCUS_09910 >Feature sequence168 <1 887 gene locus_tag LOCUS_09920 <1 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002222142.1:tRNA 5-hydroxyuridine modification protein YegQ 1253 1894 gene locus_tag LOCUS_09930 1253 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 2319 2243 gene locus_tag LOCUS_t00110 2319 2243 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2711 2355 gene locus_tag LOCUS_09940 2711 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence169 1130 564 gene locus_tag LOCUS_09950 1130 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1689 1123 gene locus_tag LOCUS_09960 1689 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 2135 1710 gene locus_tag LOCUS_09970 2135 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 3538 2282 gene locus_tag LOCUS_09980 3538 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 4318 4064 gene locus_tag LOCUS_09990 4318 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 >Feature sequence170 <1 1389 gene locus_tag LOCUS_10000 <1 1389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000367525.1:L-aspartate oxidase 1850 1437 gene locus_tag LOCUS_10010 1850 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 2085 1819 gene locus_tag LOCUS_10020 2085 1819 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207740.1 protein_id gnl|my_center|LOCUS_10020 2179 3102 gene locus_tag LOCUS_10030 2179 3102 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114180.1 protein_id gnl|my_center|LOCUS_10030 <4559 3307 gene locus_tag LOCUS_10040 <4559 3307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546063.1:potassium channel protein >Feature sequence171 <1 1624 gene locus_tag LOCUS_10050 <1 1624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403487.1:ATP-dependent helicase 1788 2519 gene locus_tag LOCUS_10060 gene cmk 1788 2519 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616463.1 protein_id gnl|my_center|LOCUS_10060 2641 4377 gene locus_tag LOCUS_10070 gene rpsA 2641 4377 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121348.1 protein_id gnl|my_center|LOCUS_10070 >Feature sequence172 <1 889 gene locus_tag LOCUS_10080 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016356903.1:tryptophan--tRNA ligase 896 1735 gene locus_tag LOCUS_10090 896 1735 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404131.1 protein_id gnl|my_center|LOCUS_10090 1732 2304 gene locus_tag LOCUS_10100 1732 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 2395 3270 gene locus_tag LOCUS_10110 2395 3270 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120431.1 protein_id gnl|my_center|LOCUS_10110 3359 3784 gene locus_tag LOCUS_10120 3359 3784 CDS product limonene-1,2-epoxide hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877467.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence173 169 17 gene locus_tag LOCUS_10130 169 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 727 170 gene locus_tag LOCUS_10140 727 170 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207618.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10140 1051 731 gene locus_tag LOCUS_10150 1051 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1272 1967 gene locus_tag LOCUS_10160 1272 1967 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245388.1 protein_id gnl|my_center|LOCUS_10160 2058 2783 gene locus_tag LOCUS_10170 gene ung 2058 2783 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206598.1 protein_id gnl|my_center|LOCUS_10170 2780 3883 gene locus_tag LOCUS_10180 2780 3883 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114169.1 protein_id gnl|my_center|LOCUS_10180 >Feature sequence174 <1 2729 gene locus_tag LOCUS_10190 <1 2729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206955.1:insulinase family protein 2940 3974 gene locus_tag LOCUS_10200 2940 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 3987 4460 gene locus_tag LOCUS_10210 3987 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 >Feature sequence175 2312 189 gene locus_tag LOCUS_10220 2312 189 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205127109.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence176 <1 1137 gene locus_tag LOCUS_10230 <1 1137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208443.1:bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ 1296 1946 gene locus_tag LOCUS_10240 1296 1946 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_10240 1959 2909 gene locus_tag LOCUS_10250 1959 2909 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112754.1 protein_id gnl|my_center|LOCUS_10250 3263 2898 gene locus_tag LOCUS_10260 gene pilH 3263 2898 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266432.1 protein_id gnl|my_center|LOCUS_10260 <4499 3298 gene locus_tag LOCUS_10270 <4499 3298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207388.1:deoxyguanosinetriphosphate triphosphohydrolase >Feature sequence177 1261 989 gene locus_tag LOCUS_10280 gene yoeB 1261 989 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_10280 1509 1258 gene locus_tag LOCUS_10290 gene yefM 1509 1258 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259256.1 protein_id gnl|my_center|LOCUS_10290 1749 2495 gene locus_tag LOCUS_10300 gene rlmB 1749 2495 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704663.1 protein_id gnl|my_center|LOCUS_10300 2499 3386 gene locus_tag LOCUS_10310 2499 3386 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208224.1 protein_id gnl|my_center|LOCUS_10310 4122 3388 gene locus_tag LOCUS_10320 4122 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence178 1622 219 gene locus_tag LOCUS_10330 gene dnaB 1622 219 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112283.1 protein_id gnl|my_center|LOCUS_10330 2525 2079 gene locus_tag LOCUS_10340 gene rplI 2525 2079 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382591.1 protein_id gnl|my_center|LOCUS_10340 2763 2536 gene locus_tag LOCUS_10350 gene rpsR 2763 2536 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090661.1 protein_id gnl|my_center|LOCUS_10350 3164 2781 gene locus_tag LOCUS_10360 gene rpsF 3164 2781 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119610.1 protein_id gnl|my_center|LOCUS_10360 3992 3318 gene locus_tag LOCUS_10370 gene radC 3992 3318 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114357.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence179 >Feature sequence180 1535 1284 gene locus_tag LOCUS_10380 gene ibaG 1535 1284 CDS product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115399.1 protein_id gnl|my_center|LOCUS_10380 1852 1544 gene locus_tag LOCUS_10390 1852 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 2573 1944 gene locus_tag LOCUS_10400 2573 1944 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207761.1 protein_id gnl|my_center|LOCUS_10400 3105 2584 gene locus_tag LOCUS_10410 gene mlaD 3105 2584 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094339.1 protein_id gnl|my_center|LOCUS_10410 3887 3105 gene locus_tag LOCUS_10420 gene mlaE 3887 3105 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094341.1 protein_id gnl|my_center|LOCUS_10420 <4459 3887 gene locus_tag LOCUS_10430 <4459 3887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005620333.1:ATP-binding cassette domain-containing protein >Feature sequence181 982 2031 gene locus_tag LOCUS_10440 gene adeT1 982 2031 CDS product putative multidrug efflux protein AdeT1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206789.1 protein_id gnl|my_center|LOCUS_10440 2197 3330 gene locus_tag LOCUS_10450 gene adeT1 2197 3330 CDS product putative multidrug efflux protein AdeT1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206789.1 protein_id gnl|my_center|LOCUS_10450 >Feature sequence182 67 750 gene locus_tag LOCUS_10460 67 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 >Feature sequence183 544 1572 gene locus_tag LOCUS_10470 544 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 1582 2811 gene locus_tag LOCUS_10480 1582 2811 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226779.1 protein_id gnl|my_center|LOCUS_10480 2925 3497 gene locus_tag LOCUS_10490 gene terD 2925 3497 CDS product tellurium resistance membrane protein TerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116680.1 protein_id gnl|my_center|LOCUS_10490 4130 3609 gene locus_tag LOCUS_10500 4130 3609 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770558.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence184 1302 3059 gene locus_tag LOCUS_10510 1302 3059 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004343881.1 protein_id gnl|my_center|LOCUS_10510 >Feature sequence185 1049 507 gene locus_tag LOCUS_10520 gene moaB 1049 507 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091240.1 protein_id gnl|my_center|LOCUS_10520 1973 1086 gene locus_tag LOCUS_10530 gene moaA 1973 1086 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059643243.1 protein_id gnl|my_center|LOCUS_10530 3072 2278 gene locus_tag LOCUS_10540 gene mazG 3072 2278 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971631.1 protein_id gnl|my_center|LOCUS_10540 3210 3992 gene locus_tag LOCUS_10550 3210 3992 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence186 1505 885 gene locus_tag LOCUS_10560 gene msrQ 1505 885 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036769.1 protein_id gnl|my_center|LOCUS_10560 2510 1506 gene locus_tag LOCUS_10570 gene msrP 2510 1506 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770490.1 protein_id gnl|my_center|LOCUS_10570 3340 2537 gene locus_tag LOCUS_10580 gene pssA 3340 2537 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119541.1 protein_id gnl|my_center|LOCUS_10580 <4430 3544 gene locus_tag LOCUS_10590 <4430 3544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706758.1:multidrug efflux RND transporter permease subunit >Feature sequence187 310 666 gene locus_tag LOCUS_10600 310 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 733 2079 gene locus_tag LOCUS_10610 733 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 2150 2599 gene locus_tag LOCUS_10620 2150 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 3588 2557 gene locus_tag LOCUS_10630 3588 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 4191 3670 gene locus_tag LOCUS_10640 4191 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 >Feature sequence188 577 56 gene locus_tag LOCUS_10650 577 56 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930802.1 protein_id gnl|my_center|LOCUS_10650 665 1276 gene locus_tag LOCUS_10660 665 1276 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117499.1 protein_id gnl|my_center|LOCUS_10660 1802 2911 gene locus_tag LOCUS_10670 1802 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 3040 4296 gene locus_tag LOCUS_10680 3040 4296 CDS product IS4-like element ISRba2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118068.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence189 343 2160 gene locus_tag LOCUS_10690 343 2160 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116803.1 protein_id gnl|my_center|LOCUS_10690 2264 2548 gene locus_tag LOCUS_10700 2264 2548 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530250.1 protein_id gnl|my_center|LOCUS_10700 2559 2927 gene locus_tag LOCUS_10710 2559 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 3579 3172 gene locus_tag LOCUS_10720 3579 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 4339 3644 gene locus_tag LOCUS_10730 gene yihA 4339 3644 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116788.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence190 <1 900 gene locus_tag LOCUS_10740 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206074.1:lysine--tRNA ligase 1047 1205 gene locus_tag LOCUS_10750 1047 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1750 1283 gene locus_tag LOCUS_10760 1750 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 1977 1852 gene locus_tag LOCUS_10770 1977 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 3577 2060 gene locus_tag LOCUS_10780 3577 2060 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704452.1 protein_id gnl|my_center|LOCUS_10780 <4374 3744 gene locus_tag LOCUS_10790 <4374 3744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003314166.1:inositol-phosphate phosphatase >Feature sequence191 35 1165 gene locus_tag LOCUS_10800 gene dapE 35 1165 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116563.1 protein_id gnl|my_center|LOCUS_10800 1252 2799 gene locus_tag LOCUS_10810 1252 2799 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464264.1 protein_id gnl|my_center|LOCUS_10810 3113 4363 gene locus_tag LOCUS_10820 3113 4363 CDS product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528855.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence192 468 2141 gene locus_tag LOCUS_10830 gene recN 468 2141 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113905.1 protein_id gnl|my_center|LOCUS_10830 2202 2411 gene locus_tag LOCUS_10840 2202 2411 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_10840 3608 2550 gene locus_tag LOCUS_10850 3608 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 4105 3626 gene locus_tag LOCUS_10860 4105 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence193 3382 341 gene locus_tag LOCUS_10870 3382 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 3561 4175 gene locus_tag LOCUS_10880 3561 4175 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904941.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence194 405 148 gene locus_tag LOCUS_10890 405 148 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_10890 616 422 gene locus_tag LOCUS_10900 616 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 2014 695 gene locus_tag LOCUS_10910 2014 695 CDS product integrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001407714.1 protein_id gnl|my_center|LOCUS_10910 2958 2281 gene locus_tag LOCUS_10920 gene baeR 2958 2281 CDS product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815798.1 protein_id gnl|my_center|LOCUS_10920 <4346 2955 gene locus_tag LOCUS_10930 <4346 2955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545118.1:ATP-binding protein >Feature sequence195 498 755 gene locus_tag LOCUS_10940 498 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 996 2282 gene locus_tag LOCUS_10950 996 2282 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124441.1 protein_id gnl|my_center|LOCUS_10950 2293 3240 gene locus_tag LOCUS_10960 2293 3240 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090981.1 protein_id gnl|my_center|LOCUS_10960 3630 3319 gene locus_tag LOCUS_10970 3630 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence196 273 911 gene locus_tag LOCUS_10980 gene coq7 273 911 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119684.1 protein_id gnl|my_center|LOCUS_10980 904 1365 gene locus_tag LOCUS_10990 904 1365 CDS product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099189.1 protein_id gnl|my_center|LOCUS_10990 1853 1431 gene locus_tag LOCUS_11000 1853 1431 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206189.1 protein_id gnl|my_center|LOCUS_11000 2074 2709 gene locus_tag LOCUS_11010 gene crp 2074 2709 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085214.1 protein_id gnl|my_center|LOCUS_11010 3593 2790 gene locus_tag LOCUS_11020 gene trpC 3593 2790 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437196.1 protein_id gnl|my_center|LOCUS_11020 4316 3732 gene locus_tag LOCUS_11030 4316 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence197 1851 1318 gene locus_tag LOCUS_11040 1851 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1983 2324 gene locus_tag LOCUS_11050 1983 2324 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104394.1 protein_id gnl|my_center|LOCUS_11050 2478 2987 gene locus_tag LOCUS_11060 gene purE 2478 2987 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115451.1 protein_id gnl|my_center|LOCUS_11060 2984 4099 gene locus_tag LOCUS_11070 2984 4099 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207670.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence198 308 691 gene locus_tag LOCUS_11080 308 691 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693271.1 protein_id gnl|my_center|LOCUS_11080 1757 774 gene locus_tag LOCUS_11090 1757 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 2263 1757 gene locus_tag LOCUS_11100 2263 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 3002 2304 gene locus_tag LOCUS_11110 3002 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 3992 3916 gene locus_tag LOCUS_t00120 3992 3916 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence199 986 651 gene locus_tag LOCUS_11120 986 651 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767383.1 protein_id gnl|my_center|LOCUS_11120 1239 961 gene locus_tag LOCUS_11130 1239 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 1595 1239 gene locus_tag LOCUS_11140 gene tusC 1595 1239 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817321.1 protein_id gnl|my_center|LOCUS_11140 1986 1600 gene locus_tag LOCUS_11150 gene tusD 1986 1600 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458288.1 protein_id gnl|my_center|LOCUS_11150 2132 3622 gene locus_tag LOCUS_11160 gene glpK 2132 3622 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113887.1 protein_id gnl|my_center|LOCUS_11160 3926 3798 gene locus_tag LOCUS_11170 3926 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 >Feature sequence200 635 36 gene locus_tag LOCUS_11180 635 36 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393403.1 protein_id gnl|my_center|LOCUS_11180 788 1300 gene locus_tag LOCUS_11190 788 1300 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369637.1 protein_id gnl|my_center|LOCUS_11190 1401 2654 gene locus_tag LOCUS_11200 1401 2654 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207236.1 protein_id gnl|my_center|LOCUS_11200 2690 2809 gene locus_tag LOCUS_11210 2690 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 2812 3279 gene locus_tag LOCUS_11220 gene nrdR 2812 3279 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317051.1 protein_id gnl|my_center|LOCUS_11220 >Feature sequence201 1502 1032 gene locus_tag LOCUS_11230 1502 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 >Feature sequence202 <1 2339 gene locus_tag LOCUS_11240 <1 2339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003163304.1:motility hub landmark protein FimV 2454 3245 gene locus_tag LOCUS_11250 gene truA 2454 3245 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208287.1 protein_id gnl|my_center|LOCUS_11250 <4257 3261 gene locus_tag LOCUS_11260 <4257 3261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003102870.1:GMC family oxidoreductase >Feature sequence203 1470 820 gene locus_tag LOCUS_11270 1470 820 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555418.1 protein_id gnl|my_center|LOCUS_11270 1768 2832 gene locus_tag LOCUS_11280 1768 2832 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208031.1 protein_id gnl|my_center|LOCUS_11280 2992 4155 gene locus_tag LOCUS_11290 2992 4155 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118415.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence204 165 241 gene locus_tag LOCUS_t00130 165 241 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1510 383 gene locus_tag LOCUS_11300 gene proB 1510 383 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381304.1 protein_id gnl|my_center|LOCUS_11300 2736 1528 gene locus_tag LOCUS_11310 gene cgtA 2736 1528 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118576.1 protein_id gnl|my_center|LOCUS_11310 3065 2805 gene locus_tag LOCUS_11320 gene rpmA 3065 2805 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551972.1 protein_id gnl|my_center|LOCUS_11320 3392 3081 gene locus_tag LOCUS_11330 gene rplU 3392 3081 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271409.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence205 693 953 gene locus_tag LOCUS_11340 693 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 1024 2079 gene locus_tag LOCUS_11350 1024 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 2207 2680 gene locus_tag LOCUS_11360 2207 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 2723 3277 gene locus_tag LOCUS_11370 2723 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 3801 3301 gene locus_tag LOCUS_11380 3801 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 >Feature sequence206 <1 529 gene locus_tag LOCUS_11390 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002118814.1:RNA polymerase sigma factor 529 897 gene locus_tag LOCUS_11400 529 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 981 1472 gene locus_tag LOCUS_11410 981 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1577 2782 gene locus_tag LOCUS_11420 1577 2782 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228752.1 protein_id gnl|my_center|LOCUS_11420 <4156 2835 gene locus_tag LOCUS_11430 <4156 2835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_022771536.1:DUF1566 domain-containing protein >Feature sequence207 630 1091 gene locus_tag LOCUS_11440 630 1091 CDS product mobile mystery protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942039.1 protein_id gnl|my_center|LOCUS_11440 1085 1672 gene locus_tag LOCUS_11450 1085 1672 CDS product mobile mystery protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942040.1 protein_id gnl|my_center|LOCUS_11450 1988 2419 gene locus_tag LOCUS_11460 1988 2419 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132355466.1 protein_id gnl|my_center|LOCUS_11460 2799 3146 gene locus_tag LOCUS_11470 2799 3146 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211161.1 protein_id gnl|my_center|LOCUS_11470 3295 3687 gene locus_tag LOCUS_11480 3295 3687 CDS product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216048.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence208 1453 1088 gene locus_tag LOCUS_11490 1453 1088 CDS product DUF5522 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963580.1 protein_id gnl|my_center|LOCUS_11490 2930 1506 gene locus_tag LOCUS_11500 2930 1506 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207825.1 protein_id gnl|my_center|LOCUS_11500 <4130 3003 gene locus_tag LOCUS_11510 <4130 3003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266380.1:glutamate synthase large subunit >Feature sequence209 614 907 gene locus_tag LOCUS_11520 614 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 907 1068 gene locus_tag LOCUS_11530 907 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1710 1111 gene locus_tag LOCUS_11540 1710 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 2489 1725 gene locus_tag LOCUS_11550 2489 1725 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_11550 3297 2500 gene locus_tag LOCUS_11560 3297 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 3818 3447 gene locus_tag LOCUS_11570 3818 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence210 100 963 gene locus_tag LOCUS_11580 100 963 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066312.1 protein_id gnl|my_center|LOCUS_11580 1145 1756 gene locus_tag LOCUS_11590 1145 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1771 3363 gene locus_tag LOCUS_11600 1771 3363 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071171.1 protein_id gnl|my_center|LOCUS_11600 <4082 3422 gene locus_tag LOCUS_11610 <4082 3422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003104390.1:START domain-containing protein >Feature sequence211 <1 2360 gene locus_tag LOCUS_11620 <1 2360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113014.1:PAS domain S-box protein 2572 3303 gene locus_tag LOCUS_11630 gene pyrH 2572 3303 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092391.1 protein_id gnl|my_center|LOCUS_11630 3316 3870 gene locus_tag LOCUS_11640 gene frr 3316 3870 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115638.1 protein_id gnl|my_center|LOCUS_11640 >Feature sequence212 406 80 gene locus_tag LOCUS_11650 406 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 3602 411 gene locus_tag LOCUS_11660 3602 411 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207561.1 protein_id gnl|my_center|LOCUS_11660 4023 3604 gene locus_tag LOCUS_11670 4023 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 >Feature sequence213 71 517 gene locus_tag LOCUS_11680 71 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 640 1899 gene locus_tag LOCUS_11690 640 1899 CDS product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208246.1 protein_id gnl|my_center|LOCUS_11690 2045 3205 gene locus_tag LOCUS_11700 2045 3205 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116208.1 protein_id gnl|my_center|LOCUS_11700 <4023 3351 gene locus_tag LOCUS_11710 <4023 3351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004790086.1:alpha/beta hydrolase >Feature sequence214 2259 418 gene locus_tag LOCUS_11720 gene ftsH 2259 418 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095200.1 protein_id gnl|my_center|LOCUS_11720 3264 2623 gene locus_tag LOCUS_11730 gene rlmE 3264 2623 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235573.1 protein_id gnl|my_center|LOCUS_11730 3367 3684 gene locus_tag LOCUS_11740 gene yhbY 3367 3684 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207458.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence215 1596 2099 gene locus_tag LOCUS_11750 1596 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 2096 2788 gene locus_tag LOCUS_11760 2096 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 2989 3591 gene locus_tag LOCUS_11770 2989 3591 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092073.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence216 1162 62 gene locus_tag LOCUS_11780 gene adeF 1162 62 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AdeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207233.1 protein_id gnl|my_center|LOCUS_11780 1938 1156 gene locus_tag LOCUS_11790 1938 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 2570 2103 gene locus_tag LOCUS_11800 2570 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 3134 2574 gene locus_tag LOCUS_11810 3134 2574 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_11810 <3977 3165 gene locus_tag LOCUS_11820 <3977 3165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011017159.1:PDDEXK nuclease domain-containing protein >Feature sequence217 <1 1050 gene locus_tag LOCUS_11830 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946476.1:alanine racemase 3159 1138 gene locus_tag LOCUS_11840 3159 1138 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence218 2584 1631 gene locus_tag LOCUS_11850 2584 1631 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115207.1 protein_id gnl|my_center|LOCUS_11850 2690 3346 gene locus_tag LOCUS_11860 2690 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207867.1 protein_id gnl|my_center|LOCUS_11860 3749 3423 gene locus_tag LOCUS_11870 3749 3423 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104586.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence219 415 1068 gene locus_tag LOCUS_11880 415 1068 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074453.1 protein_id gnl|my_center|LOCUS_11880 1637 1305 gene locus_tag LOCUS_11890 1637 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1920 1594 gene locus_tag LOCUS_11900 1920 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 2573 2184 gene locus_tag LOCUS_11910 2573 2184 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044768.1 protein_id gnl|my_center|LOCUS_11910 2797 2573 gene locus_tag LOCUS_11920 gene vapB 2797 2573 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261288.1 protein_id gnl|my_center|LOCUS_11920 3832 3077 gene locus_tag LOCUS_11930 3832 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence220 911 171 gene locus_tag LOCUS_11940 gene fabG 911 171 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318510.1 protein_id gnl|my_center|LOCUS_11940 1842 913 gene locus_tag LOCUS_11950 gene fabD 1842 913 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245842.1 protein_id gnl|my_center|LOCUS_11950 2322 1858 gene locus_tag LOCUS_11960 2322 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 3342 2341 gene locus_tag LOCUS_11970 gene plsX 3342 2341 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947122.1 protein_id gnl|my_center|LOCUS_11970 3536 3351 gene locus_tag LOCUS_11980 gene rpmF 3536 3351 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290730.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence221 1513 851 gene locus_tag LOCUS_11990 1513 851 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208197.1 protein_id gnl|my_center|LOCUS_11990 2310 1627 gene locus_tag LOCUS_12000 gene rpe 2310 1627 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043044.1 protein_id gnl|my_center|LOCUS_12000 3012 2326 gene locus_tag LOCUS_12010 3012 2326 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121402.1 protein_id gnl|my_center|LOCUS_12010 <3940 3016 gene locus_tag LOCUS_12020 <3940 3016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444878.1:phosphotransferase >Feature sequence222 2436 775 gene locus_tag LOCUS_12030 gene pgi 2436 775 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208058.1 protein_id gnl|my_center|LOCUS_12030 3324 2455 gene locus_tag LOCUS_12040 gene galU 3324 2455 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225519.1 protein_id gnl|my_center|LOCUS_12040 >Feature sequence223 1568 429 gene locus_tag LOCUS_12050 1568 429 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_12050 2221 1547 gene locus_tag LOCUS_12060 2221 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 3373 2234 gene locus_tag LOCUS_12070 3373 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence224 865 407 gene locus_tag LOCUS_12080 865 407 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093901.1 protein_id gnl|my_center|LOCUS_12080 2382 955 gene locus_tag LOCUS_12090 2382 955 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721097.1 protein_id gnl|my_center|LOCUS_12090 2786 2448 gene locus_tag LOCUS_12100 gene glnK 2786 2448 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_12100 3560 2847 gene locus_tag LOCUS_12110 3560 2847 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930529.1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence225 825 3131 gene locus_tag LOCUS_12120 825 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12120 >Feature sequence226 1490 153 gene locus_tag LOCUS_12130 1490 153 CDS product DUF3426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269007.1 protein_id gnl|my_center|LOCUS_12130 2617 1724 gene locus_tag LOCUS_12140 gene prmA 2617 1724 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703628.1 protein_id gnl|my_center|LOCUS_12140 <3891 2621 gene locus_tag LOCUS_12150 <3891 2621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002115704.1:acetyl-CoA carboxylase biotin carboxylase subunit >Feature sequence227 1306 497 gene locus_tag LOCUS_12160 1306 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1574 1849 gene locus_tag LOCUS_12170 1574 1849 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_12170 1928 3817 gene locus_tag LOCUS_12180 1928 3817 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098131.1 protein_id gnl|my_center|LOCUS_12180 >Feature sequence228 <1 780 gene locus_tag LOCUS_12190 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014205954.1:outer membrane protein assembly factor BamD 794 1012 gene locus_tag LOCUS_12200 794 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1094 1237 gene locus_tag LOCUS_12210 1094 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 2208 1240 gene locus_tag LOCUS_12220 2208 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 2310 2615 gene locus_tag LOCUS_12230 2310 2615 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_12230 3721 2774 gene locus_tag LOCUS_12240 3721 2774 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090981.1 protein_id gnl|my_center|LOCUS_12240 >Feature sequence229 1981 1097 gene locus_tag LOCUS_12250 gene tsf 1981 1097 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118238.1 protein_id gnl|my_center|LOCUS_12250 2874 2119 gene locus_tag LOCUS_12260 gene rpsB 2874 2119 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118204.1 protein_id gnl|my_center|LOCUS_12260 >Feature sequence230 234 158 gene locus_tag LOCUS_t00140 234 158 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 420 329 gene locus_tag LOCUS_t00150 420 329 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 788 2053 gene locus_tag LOCUS_12270 788 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 2072 2707 gene locus_tag LOCUS_12280 gene vpsN 2072 2707 CDS product exopolysaccharide export protein VpsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978825.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence231 <1 1846 gene locus_tag LOCUS_12290 <1 1846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266502.1:circularly permuted type 2 ATP-grasp protein 1846 2742 gene locus_tag LOCUS_12300 1846 2742 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407851.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence232 <1 720 gene locus_tag LOCUS_12310 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002115045.1:fumarate hydratase 831 1367 gene locus_tag LOCUS_12320 831 1367 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120393.1 protein_id gnl|my_center|LOCUS_12320 1409 1594 gene locus_tag LOCUS_12330 gene rpmF 1409 1594 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290730.1 protein_id gnl|my_center|LOCUS_12330 1603 2598 gene locus_tag LOCUS_12340 gene plsX 1603 2598 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947122.1 protein_id gnl|my_center|LOCUS_12340 2669 3139 gene locus_tag LOCUS_12350 2669 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 >Feature sequence233 572 123 gene locus_tag LOCUS_12360 572 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 1353 565 gene locus_tag LOCUS_12370 1353 565 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208387.1 protein_id gnl|my_center|LOCUS_12370 1797 1390 gene locus_tag LOCUS_12380 1797 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 2084 1800 gene locus_tag LOCUS_12390 2084 1800 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530736.1 protein_id gnl|my_center|LOCUS_12390 2415 2341 gene locus_tag LOCUS_t00160 2415 2341 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2613 2849 gene locus_tag LOCUS_12400 2613 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence234 1501 359 gene locus_tag LOCUS_12410 1501 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 <3816 1498 gene locus_tag LOCUS_12420 <3816 1498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082341.1:type III-B CRISPR-associated protein Cas10/Cmr2 >Feature sequence235 811 185 gene locus_tag LOCUS_12430 811 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 2427 811 gene locus_tag LOCUS_12440 2427 811 CDS product fatty acid CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_12440 3539 2424 gene locus_tag LOCUS_12450 3539 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence236 170 1489 gene locus_tag LOCUS_12460 gene pepP 170 1489 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_12460 1493 2692 gene locus_tag LOCUS_12470 1493 2692 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115267.1 protein_id gnl|my_center|LOCUS_12470 2855 3169 gene locus_tag LOCUS_12480 2855 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 <3795 3237 gene locus_tag LOCUS_12490 <3795 3237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207217.1:glycosyl transferase family protein >Feature sequence237 1119 1817 gene locus_tag LOCUS_12500 1119 1817 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005125138.1 protein_id gnl|my_center|LOCUS_12500 1825 3018 gene locus_tag LOCUS_12510 1825 3018 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092150.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence238 2268 1030 gene locus_tag LOCUS_12520 2268 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 2375 3046 gene locus_tag LOCUS_12530 2375 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 <3781 3038 gene locus_tag LOCUS_12540 <3781 3038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001108817.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence239 <1 538 gene locus_tag LOCUS_12550 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003090000.1:LysR family transcriptional regulator 2261 528 gene locus_tag LOCUS_12560 2261 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 3205 2504 gene locus_tag LOCUS_12570 3205 2504 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364547.1 protein_id gnl|my_center|LOCUS_12570 <3773 3177 gene locus_tag LOCUS_12580 <3773 3177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005455500.1:zinc ABC transporter permease subunit ZnuB >Feature sequence240 3509 132 gene locus_tag LOCUS_12590 3509 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 >Feature sequence241 2647 1271 gene locus_tag LOCUS_12600 gene mltF 2647 1271 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266923.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence242 519 181 gene locus_tag LOCUS_12610 519 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12610 695 2929 gene locus_tag LOCUS_12620 gene glgB 695 2929 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_12620 <3728 3050 gene locus_tag LOCUS_12630 <3728 3050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143971.1:alpha-D-glucose phosphate-specific phosphoglucomutase >Feature sequence243 73 2559 gene locus_tag LOCUS_12640 gene rnr 73 2559 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112282.1 protein_id gnl|my_center|LOCUS_12640 2566 2832 gene locus_tag LOCUS_12650 2566 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence244 <1 593 gene locus_tag LOCUS_12660 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002114718.1:2-isopropylmalate synthase 671 1753 gene locus_tag LOCUS_12670 671 1753 CDS product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038553.1 protein_id gnl|my_center|LOCUS_12670 2989 1856 gene locus_tag LOCUS_12680 2989 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 3378 2992 gene locus_tag LOCUS_12690 3378 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence245 <1 1056 gene locus_tag LOCUS_12700 <1 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005768357.1:ABC transporter permease subunit 1067 2722 gene locus_tag LOCUS_12710 gene pstA 1067 2722 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_12710 2782 3633 gene locus_tag LOCUS_12720 gene pstB 2782 3633 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096663.1 protein_id gnl|my_center|LOCUS_12720 >Feature sequence246 1369 983 gene locus_tag LOCUS_12730 1369 983 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212659.1 protein_id gnl|my_center|LOCUS_12730 1608 1366 gene locus_tag LOCUS_12740 1608 1366 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_12740 2310 1834 gene locus_tag LOCUS_12750 gene greA 2310 1834 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148001.1 protein_id gnl|my_center|LOCUS_12750 <3722 2310 gene locus_tag LOCUS_12760 <3722 2310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005067595.1:carbamoyl-phosphate synthase large subunit >Feature sequence247 1847 510 gene locus_tag LOCUS_12770 1847 510 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086850841.1 protein_id gnl|my_center|LOCUS_12770 1969 2166 gene locus_tag LOCUS_12780 1969 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 2168 3118 gene locus_tag LOCUS_12790 2168 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence248 923 24 gene locus_tag LOCUS_12800 923 24 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085811.1 protein_id gnl|my_center|LOCUS_12800 1158 1535 gene locus_tag LOCUS_12810 1158 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1529 1849 gene locus_tag LOCUS_12820 1529 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1846 2067 gene locus_tag LOCUS_12830 1846 2067 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268333.1 protein_id gnl|my_center|LOCUS_12830 2842 2051 gene locus_tag LOCUS_12840 2842 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence249 609 121 gene locus_tag LOCUS_12850 609 121 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247038.1 protein_id gnl|my_center|LOCUS_12850 687 1532 gene locus_tag LOCUS_12860 gene znuA 687 1532 CDS product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707443.1 protein_id gnl|my_center|LOCUS_12860 2694 1600 gene locus_tag LOCUS_12870 2694 1600 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101151.1 protein_id gnl|my_center|LOCUS_12870 3627 2779 gene locus_tag LOCUS_12880 3627 2779 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457108.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence250 809 189 gene locus_tag LOCUS_12890 809 189 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118764.1 protein_id gnl|my_center|LOCUS_12890 808 1653 gene locus_tag LOCUS_12900 gene rlmJ 808 1653 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207716.1 protein_id gnl|my_center|LOCUS_12900 2242 1733 gene locus_tag LOCUS_12910 2242 1733 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095076.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence251 960 1253 gene locus_tag LOCUS_12920 gene scyA 960 1253 CDS product monoheme cytochrome c5 ScyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070638.1 protein_id gnl|my_center|LOCUS_12920 1270 1920 gene locus_tag LOCUS_12930 1270 1920 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102831.1 protein_id gnl|my_center|LOCUS_12930 2063 2683 gene locus_tag LOCUS_12940 2063 2683 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804825.1 protein_id gnl|my_center|LOCUS_12940 2780 3400 gene locus_tag LOCUS_12950 2780 3400 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813020.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence252 26 364 gene locus_tag LOCUS_12960 26 364 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103458.1 protein_id gnl|my_center|LOCUS_12960 386 634 gene locus_tag LOCUS_12970 gene tatA 386 634 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199902.1 protein_id gnl|my_center|LOCUS_12970 634 1038 gene locus_tag LOCUS_12980 634 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1035 1799 gene locus_tag LOCUS_12990 gene tatC 1035 1799 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114673.1 protein_id gnl|my_center|LOCUS_12990 2248 1928 gene locus_tag LOCUS_13000 2248 1928 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103139.1 protein_id gnl|my_center|LOCUS_13000 2556 2260 gene locus_tag LOCUS_13010 2556 2260 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737444.1 protein_id gnl|my_center|LOCUS_13010 3601 2651 gene locus_tag LOCUS_13020 gene pip 3601 2651 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095918.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence253 2229 1234 gene locus_tag LOCUS_13030 2229 1234 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706122.1 protein_id gnl|my_center|LOCUS_13030 2794 2246 gene locus_tag LOCUS_13040 2794 2246 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106283.1 protein_id gnl|my_center|LOCUS_13040 <3641 2787 gene locus_tag LOCUS_13050 <3641 2787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338425.1:glycosyltransferase >Feature sequence254 914 246 gene locus_tag LOCUS_13060 914 246 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925860.1 protein_id gnl|my_center|LOCUS_13060 1377 916 gene locus_tag LOCUS_13070 1377 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 2383 1382 gene locus_tag LOCUS_13080 gene adeT1 2383 1382 CDS product putative multidrug efflux protein AdeT1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206789.1 protein_id gnl|my_center|LOCUS_13080 3509 2496 gene locus_tag LOCUS_13090 3509 2496 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208461.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence255 <1 596 gene locus_tag LOCUS_13100 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964080.1:tetracycline resistance MFS efflux pump 655 2352 gene locus_tag LOCUS_13110 655 2352 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 protein_id gnl|my_center|LOCUS_13110 2443 3597 gene locus_tag LOCUS_13120 gene dacC 2443 3597 CDS product D-alanyl-D-alanine carboxypeptidase PBP5/6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118558.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence256 408 175 gene locus_tag LOCUS_13130 408 175 CDS product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344490.1 protein_id gnl|my_center|LOCUS_13130 702 992 gene locus_tag LOCUS_13140 702 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 1809 1036 gene locus_tag LOCUS_13150 1809 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 3394 2117 gene locus_tag LOCUS_13160 3394 2117 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003146627.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence257 <1 851 gene locus_tag LOCUS_13170 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074140.1:ligand-gated channel protein 1844 1047 gene locus_tag LOCUS_13180 1844 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 2665 1847 gene locus_tag LOCUS_13190 2665 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 3003 2665 gene locus_tag LOCUS_13200 3003 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence258 <1 801 gene locus_tag LOCUS_13210 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002118491.1:Tol-Pal system beta propeller repeat protein TolB 832 1470 gene locus_tag LOCUS_13220 gene pal 832 1470 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118513.1 protein_id gnl|my_center|LOCUS_13220 1475 3433 gene locus_tag LOCUS_13230 gene mrdA 1475 3433 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802923.1 protein_id gnl|my_center|LOCUS_13230 >Feature sequence259 2238 1003 gene locus_tag LOCUS_13240 2238 1003 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005007934.1 protein_id gnl|my_center|LOCUS_13240 2632 2252 gene locus_tag LOCUS_13250 2632 2252 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681559.1 protein_id gnl|my_center|LOCUS_13250 2901 2635 gene locus_tag LOCUS_13260 2901 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 <3569 2969 gene locus_tag LOCUS_13270 <3569 2969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005071099.1:ribonucleoside-diphosphate reductase subunit alpha >Feature sequence260 1874 1023 gene locus_tag LOCUS_13280 1874 1023 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_13280 2087 3151 gene locus_tag LOCUS_13290 2087 3151 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114567.1 protein_id gnl|my_center|LOCUS_13290 >Feature sequence261 1118 93 gene locus_tag LOCUS_13300 1118 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 2056 1223 gene locus_tag LOCUS_13310 2056 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 2960 2325 gene locus_tag LOCUS_13320 2960 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 3420 2953 gene locus_tag LOCUS_13330 3420 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence262 80 1675 gene locus_tag LOCUS_13340 80 1675 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102870.1 protein_id gnl|my_center|LOCUS_13340 1728 2393 gene locus_tag LOCUS_13350 1728 2393 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958089.1 protein_id gnl|my_center|LOCUS_13350 >Feature sequence263 175 1062 gene locus_tag LOCUS_13360 175 1062 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064553.1 protein_id gnl|my_center|LOCUS_13360 1638 1099 gene locus_tag LOCUS_13370 1638 1099 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116105.1 protein_id gnl|my_center|LOCUS_13370 2992 1712 gene locus_tag LOCUS_13380 2992 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 >Feature sequence264 <1 674 gene locus_tag LOCUS_13390 <1 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003087446.1:molecular chaperone HtpG 900 1925 gene locus_tag LOCUS_13400 900 1925 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207203.1 protein_id gnl|my_center|LOCUS_13400 1933 2394 gene locus_tag LOCUS_13410 gene sixA 1933 2394 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114250.1 protein_id gnl|my_center|LOCUS_13410 2762 2463 gene locus_tag LOCUS_13420 2762 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 3514 2738 gene locus_tag LOCUS_13430 3514 2738 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202847.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence265 1448 270 gene locus_tag LOCUS_13440 1448 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence266 111 530 gene locus_tag LOCUS_13450 111 530 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207701.1 protein_id gnl|my_center|LOCUS_13450 1312 731 gene locus_tag LOCUS_13460 1312 731 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117601.1 protein_id gnl|my_center|LOCUS_13460 1695 1321 gene locus_tag LOCUS_13470 1695 1321 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024665649.1 protein_id gnl|my_center|LOCUS_13470 2707 1634 gene locus_tag LOCUS_13480 2707 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence267 <1 1007 gene locus_tag LOCUS_13490 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261142.1:alanine--glyoxylate aminotransferase family protein 1042 1527 gene locus_tag LOCUS_13500 1042 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 2317 1538 gene locus_tag LOCUS_13510 2317 1538 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175245.1 protein_id gnl|my_center|LOCUS_13510 2934 2335 gene locus_tag LOCUS_13520 gene plsY 2934 2335 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188027.1 protein_id gnl|my_center|LOCUS_13520 3015 3389 gene locus_tag LOCUS_13530 gene folB 3015 3389 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038896.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence268 80 1606 gene locus_tag LOCUS_13540 80 1606 CDS product DUF3336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073515.1 protein_id gnl|my_center|LOCUS_13540 1745 3079 gene locus_tag LOCUS_13550 1745 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 3318 3154 gene locus_tag LOCUS_13560 3318 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 >Feature sequence269 <1 1299 gene locus_tag LOCUS_13570 <1 1299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_044233703.1:SDR family oxidoreductase 1549 2235 gene locus_tag LOCUS_13580 1549 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 <3514 2302 gene locus_tag LOCUS_13590 <3514 2302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003104132.1:beta-ketoacyl-ACP synthase II >Feature sequence270 598 1704 gene locus_tag LOCUS_13600 gene asd 598 1704 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111187.1 protein_id gnl|my_center|LOCUS_13600 1810 2811 gene locus_tag LOCUS_13610 1810 2811 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644533.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence271 410 1765 gene locus_tag LOCUS_13620 gene murD 410 1765 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103104.1 protein_id gnl|my_center|LOCUS_13620 1955 2698 gene locus_tag LOCUS_13630 1955 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13630 2777 3148 gene locus_tag LOCUS_13640 2777 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13640 >Feature sequence272 1159 236 gene locus_tag LOCUS_13650 gene miaA 1159 236 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693854.1 protein_id gnl|my_center|LOCUS_13650 1418 2440 gene locus_tag LOCUS_13660 1418 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207738.1 protein_id gnl|my_center|LOCUS_13660 2463 3497 gene locus_tag LOCUS_13670 2463 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 >Feature sequence273 >Feature sequence274 788 612 gene locus_tag LOCUS_13680 788 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 1763 867 gene locus_tag LOCUS_13690 gene gluQRS 1763 867 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937432.1 protein_id gnl|my_center|LOCUS_13690 2233 1787 gene locus_tag LOCUS_13700 gene dksA 2233 1787 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121205.1 protein_id gnl|my_center|LOCUS_13700 2812 2492 gene locus_tag LOCUS_13710 2812 2492 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895682.1 protein_id gnl|my_center|LOCUS_13710 <3482 2819 gene locus_tag LOCUS_13720 <3482 2819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206956.1:adenosine kinase >Feature sequence275 502 3021 gene locus_tag LOCUS_13730 gene ladS 502 3021 CDS product hybrid sensor histidine kinase/response regulator LadS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence276 1517 2287 gene locus_tag LOCUS_13740 1517 2287 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190784.1 protein_id gnl|my_center|LOCUS_13740 2370 3182 gene locus_tag LOCUS_13750 2370 3182 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence277 2275 809 gene locus_tag LOCUS_13760 2275 809 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532746.1 protein_id gnl|my_center|LOCUS_13760 2413 3072 gene locus_tag LOCUS_13770 2413 3072 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224580.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence278 >Feature sequence279 262 1032 gene locus_tag LOCUS_13780 262 1032 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_13780 1938 1300 gene locus_tag LOCUS_13790 1938 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 2082 2840 gene locus_tag LOCUS_13800 2082 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 2858 3409 gene locus_tag LOCUS_13810 2858 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 >Feature sequence280 634 2 gene locus_tag LOCUS_13820 634 2 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_13820 3056 789 gene locus_tag LOCUS_13830 3056 789 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence281 1281 910 gene locus_tag LOCUS_13840 1281 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 2234 1464 gene locus_tag LOCUS_13850 gene rph 2234 1464 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120794.1 protein_id gnl|my_center|LOCUS_13850 2326 3192 gene locus_tag LOCUS_13860 2326 3192 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640567.1 protein_id gnl|my_center|LOCUS_13860 >Feature sequence282 1889 966 gene locus_tag LOCUS_13870 1889 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 <3421 2195 gene locus_tag LOCUS_13880 <3421 2195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002116088.1:acyl-CoA dehydrogenase C-terminal domain-containing protein >Feature sequence283 248 1318 gene locus_tag LOCUS_13890 248 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 1412 1876 gene locus_tag LOCUS_13900 1412 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 1948 2796 gene locus_tag LOCUS_13910 1948 2796 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181015.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence284 2449 665 gene locus_tag LOCUS_13920 2449 665 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478597.1 protein_id gnl|my_center|LOCUS_13920 2541 3347 gene locus_tag LOCUS_13930 2541 3347 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence285 1404 382 gene locus_tag LOCUS_13940 gene rsxD 1404 382 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061001934.1 protein_id gnl|my_center|LOCUS_13940 3087 1405 gene locus_tag LOCUS_13950 3087 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 >Feature sequence286 <1 2148 gene locus_tag LOCUS_13960 <1 2148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201418856.1:ABC transporter permease subunit >Feature sequence287 209 1111 gene locus_tag LOCUS_13970 209 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence288 729 1604 gene locus_tag LOCUS_13980 729 1604 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113146.1 protein_id gnl|my_center|LOCUS_13980 1601 3355 gene locus_tag LOCUS_13990 1601 3355 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551438.1 protein_id gnl|my_center|LOCUS_13990 >Feature sequence289 488 1657 gene locus_tag LOCUS_14000 gene lpxB 488 1657 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206649.1 protein_id gnl|my_center|LOCUS_14000 1662 2270 gene locus_tag LOCUS_14010 gene rnhB 1662 2270 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368153.1 protein_id gnl|my_center|LOCUS_14010 2663 2322 gene locus_tag LOCUS_14020 2663 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence290 3119 1653 gene locus_tag LOCUS_14030 gene rng 3119 1653 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116044.1 protein_id gnl|my_center|LOCUS_14030 >Feature sequence291 898 449 gene locus_tag LOCUS_14040 gene fur 898 449 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121758.1 protein_id gnl|my_center|LOCUS_14040 1038 1430 gene locus_tag LOCUS_14050 1038 1430 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121740.1 protein_id gnl|my_center|LOCUS_14050 1759 1373 gene locus_tag LOCUS_14060 1759 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 2778 1732 gene locus_tag LOCUS_14070 2778 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113997598.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence292 136 537 gene locus_tag LOCUS_14080 136 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 781 1149 gene locus_tag LOCUS_14090 781 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 2590 1199 gene locus_tag LOCUS_14100 gene nhaD 2590 1199 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482814.1 protein_id gnl|my_center|LOCUS_14100 <3375 2723 gene locus_tag LOCUS_14110 <3375 2723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208270.1:radical SAM family heme chaperone HemW >Feature sequence293 401 1432 gene locus_tag LOCUS_14120 gene ruvB 401 1432 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002052424.1 protein_id gnl|my_center|LOCUS_14120 1429 1830 gene locus_tag LOCUS_14130 gene ybgC 1429 1830 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004699892.1 protein_id gnl|my_center|LOCUS_14130 1823 2485 gene locus_tag LOCUS_14140 gene tolQ 1823 2485 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086125.1 protein_id gnl|my_center|LOCUS_14140 2490 2927 gene locus_tag LOCUS_14150 gene tolR 2490 2927 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067772.1 protein_id gnl|my_center|LOCUS_14150 >Feature sequence294 1160 939 gene locus_tag LOCUS_14160 1160 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1199 2638 gene locus_tag LOCUS_14170 1199 2638 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409438.1 protein_id gnl|my_center|LOCUS_14170 <3346 2792 gene locus_tag LOCUS_14180 <3346 2792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114306.1:molybdopterin molybdotransferase MoeA >Feature sequence295 1013 2062 gene locus_tag LOCUS_14190 gene adeT1 1013 2062 CDS product putative multidrug efflux protein AdeT1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206789.1 protein_id gnl|my_center|LOCUS_14190 2474 3274 gene locus_tag LOCUS_14200 2474 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence296 1371 859 gene locus_tag LOCUS_14210 gene fabA 1371 859 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706133.1 protein_id gnl|my_center|LOCUS_14210 1710 2459 gene locus_tag LOCUS_14220 1710 2459 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091107.1 protein_id gnl|my_center|LOCUS_14220 >Feature sequence297 <1 1840 gene locus_tag LOCUS_14230 <1 1840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063831.1:TM0106 family RecB-like putative nuclease 1897 2718 gene locus_tag LOCUS_14240 1897 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 3246 2752 gene locus_tag LOCUS_14250 3246 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence298 <1 977 gene locus_tag LOCUS_14260 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005073053.1:DNA repair protein RadA 1053 3083 gene locus_tag LOCUS_14270 1053 3083 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070868.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence299 2432 1170 gene locus_tag LOCUS_14280 2432 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 <3318 2429 gene locus_tag LOCUS_14290 <3318 2429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004550314.1:TolC family protein >Feature sequence300 751 3042 gene locus_tag LOCUS_14300 gene ppsA 751 3042 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803576.1 protein_id gnl|my_center|LOCUS_14300 >Feature sequence301 210 43 gene locus_tag LOCUS_14310 210 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1073 603 gene locus_tag LOCUS_14320 1073 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1353 1066 gene locus_tag LOCUS_14330 1353 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 2306 1482 gene locus_tag LOCUS_14340 2306 1482 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980286.1 protein_id gnl|my_center|LOCUS_14340 2520 2317 gene locus_tag LOCUS_14350 2520 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 2645 3256 gene locus_tag LOCUS_14360 2645 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 >Feature sequence302 1474 755 gene locus_tag LOCUS_14370 gene bfmR 1474 755 CDS product response regulator transcription factor BfmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence303 508 771 gene locus_tag LOCUS_14380 gene rpsT 508 771 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117906.1 protein_id gnl|my_center|LOCUS_14380 890 1084 gene locus_tag LOCUS_14390 890 1084 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002000629.1 protein_id gnl|my_center|LOCUS_14390 1226 1690 gene locus_tag LOCUS_14400 gene bfrB 1226 1690 CDS product bacterioferritin BfrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092078.1 protein_id gnl|my_center|LOCUS_14400 <3295 2000 gene locus_tag LOCUS_14410 <3295 2000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014205896.1:sensor histidine kinase BfmS >Feature sequence304 914 330 gene locus_tag LOCUS_14420 gene pth 914 330 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103428.1 protein_id gnl|my_center|LOCUS_14420 1539 961 gene locus_tag LOCUS_14430 1539 961 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099279.1 protein_id gnl|my_center|LOCUS_14430 2574 1624 gene locus_tag LOCUS_14440 2574 1624 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120445.1 protein_id gnl|my_center|LOCUS_14440 2732 2658 gene locus_tag LOCUS_t00170 2732 2658 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 <3292 2755 gene locus_tag LOCUS_14450 <3292 2755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266731.1:4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase >Feature sequence305 535 1614 gene locus_tag LOCUS_14460 gene serC 535 1614 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207406.1 protein_id gnl|my_center|LOCUS_14460 1759 2562 gene locus_tag LOCUS_14470 1759 2562 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947138.1 protein_id gnl|my_center|LOCUS_14470 >Feature sequence306 753 364 gene locus_tag LOCUS_14480 gene gcvH 753 364 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071083.1 protein_id gnl|my_center|LOCUS_14480 1956 871 gene locus_tag LOCUS_14490 gene gcvT 1956 871 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114049.1 protein_id gnl|my_center|LOCUS_14490 2245 3084 gene locus_tag LOCUS_14500 2245 3084 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206171.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence307 <1 795 gene locus_tag LOCUS_14510 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338425.1:glycosyltransferase 788 1420 gene locus_tag LOCUS_14520 788 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1493 1891 gene locus_tag LOCUS_14530 1493 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 2359 1943 gene locus_tag LOCUS_14540 2359 1943 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404325.1 protein_id gnl|my_center|LOCUS_14540 2598 2356 gene locus_tag LOCUS_14550 2598 2356 CDS product DUF6364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404326.1 protein_id gnl|my_center|LOCUS_14550 2672 3211 gene locus_tag LOCUS_14560 2672 3211 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207956.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence308 100 1089 gene locus_tag LOCUS_14570 gene cas1 100 1089 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546247.1 protein_id gnl|my_center|LOCUS_14570 1082 1855 gene locus_tag LOCUS_14580 1082 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1937 2473 gene locus_tag LOCUS_14590 1937 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 2470 2778 gene locus_tag LOCUS_14600 gene cas2 2470 2778 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546007.1 protein_id gnl|my_center|LOCUS_14600 3059 >3279 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttgaatcgttccctgattactaagggattaagac >Feature sequence309 316 861 gene locus_tag LOCUS_14610 316 861 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 protein_id gnl|my_center|LOCUS_14610 1190 1114 gene locus_tag LOCUS_t00180 1190 1114 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1283 1208 gene locus_tag LOCUS_t00190 1283 1208 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2422 1517 gene locus_tag LOCUS_14620 gene estB 2422 1517 CDS product esterase EstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206070.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence310 815 1195 gene locus_tag LOCUS_14630 gene crcB 815 1195 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094051.1 protein_id gnl|my_center|LOCUS_14630 1810 1238 gene locus_tag LOCUS_14640 1810 1238 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189913.1 protein_id gnl|my_center|LOCUS_14640 2301 2122 gene locus_tag LOCUS_14650 2301 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 >Feature sequence311 2820 2179 gene locus_tag LOCUS_14660 2820 2179 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688682.1 protein_id gnl|my_center|LOCUS_14660 >Feature sequence312 670 1521 gene locus_tag LOCUS_14670 670 1521 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_14670 2077 1532 gene locus_tag LOCUS_14680 2077 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 2551 2961 gene locus_tag LOCUS_14690 2551 2961 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975642.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence313 356 853 gene locus_tag LOCUS_14700 gene lspA 356 853 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387467.1 protein_id gnl|my_center|LOCUS_14700 914 1387 gene locus_tag LOCUS_14710 914 1387 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208021.1 protein_id gnl|my_center|LOCUS_14710 1396 2346 gene locus_tag LOCUS_14720 gene ispH 1396 2346 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116992.1 protein_id gnl|my_center|LOCUS_14720 2557 3081 gene locus_tag LOCUS_14730 2557 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 >Feature sequence314 2536 2450 gene locus_tag LOCUS_t00200 2536 2450 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence315 <1 640 gene locus_tag LOCUS_14740 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267308.1:NADPH-dependent 7-cyano-7-deazaguanine reductase QueF 773 1447 gene locus_tag LOCUS_14750 773 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118229.1 protein_id gnl|my_center|LOCUS_14750 1454 2125 gene locus_tag LOCUS_14760 1454 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 2122 2844 gene locus_tag LOCUS_14770 2122 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 >Feature sequence316 <1 2345 gene locus_tag LOCUS_14780 <1 2345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113915.1:two-component system sensor histidine kinase CbrA >Feature sequence317 466 377 gene locus_tag LOCUS_t00210 466 377 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 803 570 gene locus_tag LOCUS_14790 803 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 1632 919 gene locus_tag LOCUS_14800 1632 919 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119240.1 protein_id gnl|my_center|LOCUS_14800 2261 1656 gene locus_tag LOCUS_14810 2261 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 3135 2263 gene locus_tag LOCUS_14820 gene dapA 3135 2263 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300412.1 protein_id gnl|my_center|LOCUS_14820 >Feature sequence318 <1 905 gene locus_tag LOCUS_14830 <1 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003405115.1:NADH-quinone oxidoreductase subunit L note possible pseudo, internal stop codon 915 1340 gene locus_tag LOCUS_14840 915 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14840 1348 2907 gene locus_tag LOCUS_14850 gene nuoM 1348 2907 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210269.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence319 469 167 gene locus_tag LOCUS_14860 469 167 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100122.1 protein_id gnl|my_center|LOCUS_14860 1751 579 gene locus_tag LOCUS_14870 1751 579 CDS product HRDC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206658.1 protein_id gnl|my_center|LOCUS_14870 2896 1751 gene locus_tag LOCUS_14880 2896 1751 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103930.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence320 1355 129 gene locus_tag LOCUS_14890 1355 129 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102844.1 protein_id gnl|my_center|LOCUS_14890 1691 1536 gene locus_tag LOCUS_14900 1691 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1987 2664 gene locus_tag LOCUS_14910 1987 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence321 3018 706 gene locus_tag LOCUS_14920 3018 706 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763462.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence322 655 116 gene locus_tag LOCUS_14930 655 116 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396551.1 protein_id gnl|my_center|LOCUS_14930 755 1603 gene locus_tag LOCUS_14940 755 1603 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356902.1 protein_id gnl|my_center|LOCUS_14940 1600 2220 gene locus_tag LOCUS_14950 1600 2220 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351379.1 protein_id gnl|my_center|LOCUS_14950 >Feature sequence323 1864 578 gene locus_tag LOCUS_14960 1864 578 CDS product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208246.1 protein_id gnl|my_center|LOCUS_14960 1964 2980 gene locus_tag LOCUS_14970 1964 2980 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192764.1 protein_id gnl|my_center|LOCUS_14970 >Feature sequence324 1198 23 gene locus_tag LOCUS_14980 gene rhlB 1198 23 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119269.1 protein_id gnl|my_center|LOCUS_14980 2076 1195 gene locus_tag LOCUS_14990 2076 1195 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_14990 2883 2275 gene locus_tag LOCUS_15000 2883 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence325 <1 694 gene locus_tag LOCUS_15010 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051618874.1:amidase 758 1750 gene locus_tag LOCUS_15020 758 1750 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528524.1 protein_id gnl|my_center|LOCUS_15020 1747 2622 gene locus_tag LOCUS_15030 gene glpG 1747 2622 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704134.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence326 2106 2951 gene locus_tag LOCUS_15040 2106 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 3148 3039 gene locus_tag LOCUS_r00010 3148 3039 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence327 >Feature sequence328 <1 528 gene locus_tag LOCUS_15050 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208174.1:response regulator 525 2345 gene locus_tag LOCUS_15060 gene uvrC 525 2345 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208216.1 protein_id gnl|my_center|LOCUS_15060 2371 2934 gene locus_tag LOCUS_15070 gene pgsA 2371 2934 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114808.1 protein_id gnl|my_center|LOCUS_15070 3072 3147 gene locus_tag LOCUS_t00220 3072 3147 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence329 2848 320 gene locus_tag LOCUS_15080 gene nirB 2848 320 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207014.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence330 2235 1132 gene locus_tag LOCUS_15090 2235 1132 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117107.1 protein_id gnl|my_center|LOCUS_15090 <3152 2288 gene locus_tag LOCUS_15100 <3152 2288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704155.1:glycine--tRNA ligase subunit beta >Feature sequence331 355 2700 gene locus_tag LOCUS_15110 355 2700 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268725.1 protein_id gnl|my_center|LOCUS_15110 3048 2737 gene locus_tag LOCUS_15120 3048 2737 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115102.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence332 <1 1564 gene locus_tag LOCUS_15130 <1 1564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057122.1:PAS domain S-box protein 1774 2589 gene locus_tag LOCUS_15140 1774 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence333 41 1216 gene locus_tag LOCUS_15150 41 1216 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207741.1 protein_id gnl|my_center|LOCUS_15150 1599 1285 gene locus_tag LOCUS_15160 1599 1285 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101229.1 protein_id gnl|my_center|LOCUS_15160 2538 1699 gene locus_tag LOCUS_15170 gene metF 2538 1699 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207253.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence334 <1 669 gene locus_tag LOCUS_15180 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002555720.1:nitrogen regulation protein NR(II) 656 2089 gene locus_tag LOCUS_15190 gene ntrC 656 2089 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413458.1 protein_id gnl|my_center|LOCUS_15190 <3095 2242 gene locus_tag LOCUS_15200 <3095 2242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207454.1:bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD >Feature sequence335 247 438 gene locus_tag LOCUS_15210 247 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15210 546 1076 gene locus_tag LOCUS_15220 546 1076 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114474.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence336 894 259 gene locus_tag LOCUS_15230 894 259 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688682.1 protein_id gnl|my_center|LOCUS_15230 2853 910 gene locus_tag LOCUS_15240 2853 910 CDS product type IV pili methyl-accepting chemotaxis transducer N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550179.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence337 296 1135 gene locus_tag LOCUS_15250 296 1135 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090571.1 protein_id gnl|my_center|LOCUS_15250 1191 2219 gene locus_tag LOCUS_15260 1191 2219 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406732.1 protein_id gnl|my_center|LOCUS_15260 2279 2809 gene locus_tag LOCUS_15270 2279 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence338 779 132 gene locus_tag LOCUS_15280 779 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1811 795 gene locus_tag LOCUS_15290 gene hemH 1811 795 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065964.1 protein_id gnl|my_center|LOCUS_15290 2811 2155 gene locus_tag LOCUS_15300 gene adk 2811 2155 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092485.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence339 22 1416 gene locus_tag LOCUS_15310 gene atpD 22 1416 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114045.1 protein_id gnl|my_center|LOCUS_15310 1489 1902 gene locus_tag LOCUS_15320 1489 1902 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114076.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence340 75 1 gene locus_tag LOCUS_t00230 75 1 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 251 167 gene locus_tag LOCUS_t00240 251 167 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 652 263 gene locus_tag LOCUS_15330 gene secG 652 263 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115012.1 protein_id gnl|my_center|LOCUS_15330 1424 657 gene locus_tag LOCUS_15340 gene tpiA 1424 657 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037661.1 protein_id gnl|my_center|LOCUS_15340 2881 1544 gene locus_tag LOCUS_15350 gene glmM 2881 1544 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence341 844 413 gene locus_tag LOCUS_15360 844 413 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132355466.1 protein_id gnl|my_center|LOCUS_15360 1190 846 gene locus_tag LOCUS_15370 1190 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 1574 2632 gene locus_tag LOCUS_15380 1574 2632 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703864.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence342 <1 732 gene locus_tag LOCUS_15390 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338709.1:DUF1365 domain-containing protein 729 1934 gene locus_tag LOCUS_15400 729 1934 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640238.1 protein_id gnl|my_center|LOCUS_15400 1937 2461 gene locus_tag LOCUS_15410 1937 2461 CDS product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073243.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence343 <1 2132 gene locus_tag LOCUS_15420 <1 2132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266649.1:DUF1631 domain-containing protein 2134 2688 gene locus_tag LOCUS_15430 gene ampD 2134 2688 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923703.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence344 <1 1547 gene locus_tag LOCUS_15440 <1 1547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087773.1:HsdR family type I site-specific deoxyribonuclease 1607 2239 gene locus_tag LOCUS_15450 1607 2239 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087772.1 protein_id gnl|my_center|LOCUS_15450 2368 3003 gene locus_tag LOCUS_15460 2368 3003 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556051.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence345 >Feature sequence346 <1 619 gene locus_tag LOCUS_15470 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208394.1:SDR family oxidoreductase 720 1793 gene locus_tag LOCUS_15480 720 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029784.1 protein_id gnl|my_center|LOCUS_15480 2013 2159 gene locus_tag LOCUS_15490 2013 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 2225 2725 gene locus_tag LOCUS_15500 2225 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 >Feature sequence347 770 2515 gene locus_tag LOCUS_15510 770 2515 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994007.1 protein_id gnl|my_center|LOCUS_15510 2598 2921 gene locus_tag LOCUS_15520 2598 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 >Feature sequence348 184 1245 gene locus_tag LOCUS_15530 184 1245 CDS product HaeII family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686885.1 protein_id gnl|my_center|LOCUS_15530 1233 1889 gene locus_tag LOCUS_15540 gene nadD 1233 1889 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210330.1 protein_id gnl|my_center|LOCUS_15540 1879 2244 gene locus_tag LOCUS_15550 gene rsfS 1879 2244 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100305.1 protein_id gnl|my_center|LOCUS_15550 2245 2712 gene locus_tag LOCUS_15560 gene rlmH 2245 2712 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313894.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence349 2556 1882 gene locus_tag LOCUS_15570 2556 1882 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103923.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence350 2038 107 gene locus_tag LOCUS_15580 2038 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 <2961 2166 gene locus_tag LOCUS_15590 <2961 2166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003146627.1:DSD1 family PLP-dependent enzyme >Feature sequence351 441 1466 gene locus_tag LOCUS_15600 441 1466 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206186.1 protein_id gnl|my_center|LOCUS_15600 1513 2679 gene locus_tag LOCUS_15610 1513 2679 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084960.1 protein_id gnl|my_center|LOCUS_15610 >Feature sequence352 380 541 gene locus_tag LOCUS_15620 380 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1240 545 gene locus_tag LOCUS_15630 1240 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1915 1373 gene locus_tag LOCUS_15640 1915 1373 CDS product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223531.1 protein_id gnl|my_center|LOCUS_15640 2385 1930 gene locus_tag LOCUS_15650 2385 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 <2956 2382 gene locus_tag LOCUS_15660 <2956 2382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038543.1:nicotinate phosphoribosyltransferase >Feature sequence353 200 877 gene locus_tag LOCUS_15670 200 877 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086682.1 protein_id gnl|my_center|LOCUS_15670 877 1899 gene locus_tag LOCUS_15680 877 1899 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence354 1100 126 gene locus_tag LOCUS_15690 1100 126 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407374.1 protein_id gnl|my_center|LOCUS_15690 1940 1865 gene locus_tag LOCUS_t00250 1940 1865 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 <2955 2104 gene locus_tag LOCUS_15700 <2955 2104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002118408.1:pyridoxal phosphate-dependent aminotransferase >Feature sequence355 <1 732 gene locus_tag LOCUS_15710 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207641.1:ELM1/GtrOC1 family putative glycosyltransferase 711 1751 gene locus_tag LOCUS_15720 711 1751 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207636.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence356 1560 352 gene locus_tag LOCUS_15730 gene tyrS 1560 352 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115433.1 protein_id gnl|my_center|LOCUS_15730 1624 2739 gene locus_tag LOCUS_15740 1624 2739 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770633.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence357 439 155 gene locus_tag LOCUS_15750 439 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1052 621 gene locus_tag LOCUS_15760 1052 621 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102139.1 protein_id gnl|my_center|LOCUS_15760 <2947 1176 gene locus_tag LOCUS_15770 <2947 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114386.1:molybdopterin oxidoreductase family protein >Feature sequence358 351 1463 gene locus_tag LOCUS_15780 gene tgt 351 1463 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207645.1 protein_id gnl|my_center|LOCUS_15780 1479 1847 gene locus_tag LOCUS_15790 gene yajC 1479 1847 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116168.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence359 681 256 gene locus_tag LOCUS_15800 gene trxC 681 256 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_15800 1559 684 gene locus_tag LOCUS_15810 1559 684 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406126.1 protein_id gnl|my_center|LOCUS_15810 1997 1563 gene locus_tag LOCUS_15820 1997 1563 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114206.1 protein_id gnl|my_center|LOCUS_15820 2438 2001 gene locus_tag LOCUS_15830 2438 2001 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454539.1 protein_id gnl|my_center|LOCUS_15830 <2942 2443 gene locus_tag LOCUS_15840 <2942 2443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973309.1:SPFH domain-containing protein >Feature sequence360 917 150 gene locus_tag LOCUS_15850 917 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 1256 1720 gene locus_tag LOCUS_15860 1256 1720 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978225.1 protein_id gnl|my_center|LOCUS_15860 <2942 1725 gene locus_tag LOCUS_15870 <2942 1725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002121907.1:phosphate regulon sensor histidine kinase PhoR >Feature sequence361 1100 1633 gene locus_tag LOCUS_15880 1100 1633 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986783.1 protein_id gnl|my_center|LOCUS_15880 2687 1701 gene locus_tag LOCUS_15890 gene rluD 2687 1701 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094686.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence362 2817 694 gene locus_tag LOCUS_15900 2817 694 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073633.1 protein_id gnl|my_center|LOCUS_15900 >Feature sequence363 1741 2802 gene locus_tag LOCUS_15910 1741 2802 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence364 1603 2565 gene locus_tag LOCUS_15920 gene rluC 1603 2565 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072718.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence365 >Feature sequence366 <2900 1698 gene locus_tag LOCUS_15930 <2900 1698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004530942.1:nitrite reductase large subunit NirB >Feature sequence367 1351 278 gene locus_tag LOCUS_15940 1351 278 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118385.1 protein_id gnl|my_center|LOCUS_15940 2233 1361 gene locus_tag LOCUS_15950 2233 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence368 768 184 gene locus_tag LOCUS_15960 gene pth 768 184 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120328.1 protein_id gnl|my_center|LOCUS_15960 1363 779 gene locus_tag LOCUS_15970 1363 779 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099279.1 protein_id gnl|my_center|LOCUS_15970 2452 1502 gene locus_tag LOCUS_15980 2452 1502 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120445.1 protein_id gnl|my_center|LOCUS_15980 2610 2536 gene locus_tag LOCUS_t00260 2610 2536 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence369 1344 739 gene locus_tag LOCUS_15990 gene clpP 1344 739 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418252.1 protein_id gnl|my_center|LOCUS_15990 <2892 1629 gene locus_tag LOCUS_16000 <2892 1629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003087920.1:trigger factor >Feature sequence370 1917 904 gene locus_tag LOCUS_16010 gene tsaD 1917 904 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369630.1 protein_id gnl|my_center|LOCUS_16010 2127 2342 gene locus_tag LOCUS_16020 gene rpsU 2127 2342 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136722.1 protein_id gnl|my_center|LOCUS_16020 2442 2885 gene locus_tag LOCUS_16030 2442 2885 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453780.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence371 <1 920 gene locus_tag LOCUS_16040 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090710.1:ABC transporter permease 923 2128 gene locus_tag LOCUS_16050 923 2128 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_16050 2840 2145 gene locus_tag LOCUS_16060 2840 2145 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120391.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence372 1504 1202 gene locus_tag LOCUS_16070 1504 1202 CDS product cytochrome c5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919100.1 protein_id gnl|my_center|LOCUS_16070 1724 2299 gene locus_tag LOCUS_16080 1724 2299 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_16080 2421 2296 gene locus_tag LOCUS_16090 2421 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence373 355 1551 gene locus_tag LOCUS_16100 355 1551 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093119.1 protein_id gnl|my_center|LOCUS_16100 2787 1771 gene locus_tag LOCUS_16110 2787 1771 CDS product bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038544.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence374 <1 1348 gene locus_tag LOCUS_16120 <1 1348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002116195.1:preprotein translocase subunit SecA 1377 2597 gene locus_tag LOCUS_16130 gene argJ 1377 2597 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208443.1 protein_id gnl|my_center|LOCUS_16130 >Feature sequence375 1120 329 gene locus_tag LOCUS_16140 1120 329 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208339.1 protein_id gnl|my_center|LOCUS_16140 1855 1133 gene locus_tag LOCUS_16150 gene pilF 1855 1133 CDS product type 4a pilus biogenesis protein PilF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113801.1 protein_id gnl|my_center|LOCUS_16150 <2867 1958 gene locus_tag LOCUS_16160 <2867 1958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002115097.1:23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN >Feature sequence376 515 1363 gene locus_tag LOCUS_16170 515 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206816.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence377 610 1164 gene locus_tag LOCUS_16180 610 1164 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399826.1 protein_id gnl|my_center|LOCUS_16180 <2854 1211 gene locus_tag LOCUS_16190 <2854 1211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103491.1:NAD-glutamate dehydrogenase GdhB >Feature sequence378 932 1786 gene locus_tag LOCUS_16200 gene hslO 932 1786 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096245.1 protein_id gnl|my_center|LOCUS_16200 1986 2765 gene locus_tag LOCUS_16210 1986 2765 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992443.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence379 649 206 gene locus_tag LOCUS_16220 649 206 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090019.1 protein_id gnl|my_center|LOCUS_16220 1480 758 gene locus_tag LOCUS_16230 1480 758 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208387.1 protein_id gnl|my_center|LOCUS_16230 >Feature sequence380 <1 1225 gene locus_tag LOCUS_16240 <1 1225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091283.1:exopolysaccharide Pel transporter PelG 1241 1621 gene locus_tag LOCUS_16250 1241 1621 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116996.1 protein_id gnl|my_center|LOCUS_16250 2166 1618 gene locus_tag LOCUS_16260 gene rfbC 2166 1618 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973711.1 protein_id gnl|my_center|LOCUS_16260 <2831 2176 gene locus_tag LOCUS_16270 <2831 2176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000857508.1:glucose-1-phosphate thymidylyltransferase RfbA >Feature sequence381 1465 572 gene locus_tag LOCUS_16280 1465 572 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026838.1 protein_id gnl|my_center|LOCUS_16280 1648 2487 gene locus_tag LOCUS_16290 1648 2487 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113156.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence382 272 1672 gene locus_tag LOCUS_16300 272 1672 CDS product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012468297.1 protein_id gnl|my_center|LOCUS_16300 >Feature sequence383 1027 221 gene locus_tag LOCUS_16310 1027 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 1584 1033 gene locus_tag LOCUS_16320 gene ampD 1584 1033 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923703.1 protein_id gnl|my_center|LOCUS_16320 2635 1586 gene locus_tag LOCUS_16330 2635 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16330 2803 2663 gene locus_tag LOCUS_16340 2803 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16340 >Feature sequence384 198 875 gene locus_tag LOCUS_16350 198 875 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112849.1 protein_id gnl|my_center|LOCUS_16350 875 1570 gene locus_tag LOCUS_16360 875 1570 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037742.1 protein_id gnl|my_center|LOCUS_16360 1586 2284 gene locus_tag LOCUS_16370 1586 2284 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525409.1 protein_id gnl|my_center|LOCUS_16370 2286 2699 gene locus_tag LOCUS_16380 2286 2699 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200660.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence385 1093 1521 gene locus_tag LOCUS_16390 1093 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16390 >Feature sequence386 213 1571 gene locus_tag LOCUS_16400 213 1571 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066720.1 protein_id gnl|my_center|LOCUS_16400 1581 2420 gene locus_tag LOCUS_16410 1581 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 >Feature sequence387 396 833 gene locus_tag LOCUS_16420 396 833 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454539.1 protein_id gnl|my_center|LOCUS_16420 851 1285 gene locus_tag LOCUS_16430 851 1285 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114206.1 protein_id gnl|my_center|LOCUS_16430 1385 2158 gene locus_tag LOCUS_16440 1385 2158 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406126.1 protein_id gnl|my_center|LOCUS_16440 2155 2580 gene locus_tag LOCUS_16450 gene trxC 2155 2580 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence388 182 1153 gene locus_tag LOCUS_16460 182 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 1396 1322 gene locus_tag LOCUS_t00270 1396 1322 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 <2758 1416 gene locus_tag LOCUS_16470 <2758 1416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207840.1:glutamate--tRNA ligase >Feature sequence389 <2757 38 gene locus_tag LOCUS_16480 <2757 38 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261335.1:exodeoxyribonuclease V subunit beta >Feature sequence390 854 648 gene locus_tag LOCUS_16490 854 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 1604 1002 gene locus_tag LOCUS_16500 1604 1002 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704791.1 protein_id gnl|my_center|LOCUS_16500 1743 2696 gene locus_tag LOCUS_16510 1743 2696 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065230.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence391 267 635 gene locus_tag LOCUS_16520 267 635 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115263.1 protein_id gnl|my_center|LOCUS_16520 639 839 gene locus_tag LOCUS_16530 gene thiS 639 839 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379876.1 protein_id gnl|my_center|LOCUS_16530 949 1728 gene locus_tag LOCUS_16540 949 1728 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084517.1 protein_id gnl|my_center|LOCUS_16540 1729 2430 gene locus_tag LOCUS_16550 gene trmB 1729 2430 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173629.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence392 1027 257 gene locus_tag LOCUS_16560 1027 257 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547056.1 protein_id gnl|my_center|LOCUS_16560 1502 1065 gene locus_tag LOCUS_16570 1502 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1653 2285 gene locus_tag LOCUS_16580 1653 2285 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084765.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence393 64 261 gene locus_tag LOCUS_16590 64 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 248 490 gene locus_tag LOCUS_16600 248 490 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106997.1 protein_id gnl|my_center|LOCUS_16600 487 864 gene locus_tag LOCUS_16610 487 864 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106996.1 protein_id gnl|my_center|LOCUS_16610 1284 883 gene locus_tag LOCUS_16620 gene vapC 1284 883 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651560.1 protein_id gnl|my_center|LOCUS_16620 1512 1285 gene locus_tag LOCUS_16630 gene vapB 1512 1285 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170066.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence394 1589 699 gene locus_tag LOCUS_16640 1589 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 2406 1594 gene locus_tag LOCUS_16650 2406 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 >Feature sequence395 2 1825 gene locus_tag LOCUS_16660 gene mutL 2 1825 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105240.1 protein_id gnl|my_center|LOCUS_16660 1831 2175 gene locus_tag LOCUS_16670 1831 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 >Feature sequence396 >Feature sequence397 491 1186 gene locus_tag LOCUS_16680 gene narI 491 1186 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105305.1 protein_id gnl|my_center|LOCUS_16680 1198 1662 gene locus_tag LOCUS_16690 1198 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 1678 2343 gene locus_tag LOCUS_16700 gene ytfE 1678 2343 CDS product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210159.1 protein_id gnl|my_center|LOCUS_16700 >Feature sequence398 200 511 gene locus_tag LOCUS_16710 200 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 594 1775 gene locus_tag LOCUS_16720 594 1775 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268088.1 protein_id gnl|my_center|LOCUS_16720 1793 1930 gene locus_tag LOCUS_16730 1793 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence399 357 824 gene locus_tag LOCUS_16740 357 824 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208021.1 protein_id gnl|my_center|LOCUS_16740 836 1786 gene locus_tag LOCUS_16750 gene ispH 836 1786 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116992.1 protein_id gnl|my_center|LOCUS_16750 1955 2506 gene locus_tag LOCUS_16760 1955 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 >Feature sequence400 <1 761 gene locus_tag LOCUS_16770 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005078668.1:undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase 767 2203 gene locus_tag LOCUS_16780 gene murC 767 2203 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122011.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence401 962 378 gene locus_tag LOCUS_16790 962 378 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 protein_id gnl|my_center|LOCUS_16790 1447 2373 gene locus_tag LOCUS_16800 gene lipA 1447 2373 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090955.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence402 <1 1007 gene locus_tag LOCUS_16810 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046236117.1:glutamate--cysteine ligase 1147 1638 gene locus_tag LOCUS_16820 1147 1638 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207954.1 protein_id gnl|my_center|LOCUS_16820 <2657 1702 gene locus_tag LOCUS_16830 <2657 1702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207691.1:DUF6091 family protein >Feature sequence403 <1 638 gene locus_tag LOCUS_16840 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001150037.1:ADP-ribose diphosphatase 821 1633 gene locus_tag LOCUS_16850 gene cpdA 821 1633 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080946587.1 protein_id gnl|my_center|LOCUS_16850 1744 2247 gene locus_tag LOCUS_16860 gene yqiA 1744 2247 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262650.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence404 <1 986 gene locus_tag LOCUS_16870 <1 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003405080.1:DNA translocase FtsK 1169 1783 gene locus_tag LOCUS_16880 gene lolA 1169 1783 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090414.1 protein_id gnl|my_center|LOCUS_16880 >Feature sequence405 >Feature sequence406 285 680 gene locus_tag LOCUS_16890 285 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 1416 778 gene locus_tag LOCUS_16900 1416 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 <2632 1649 gene locus_tag LOCUS_16910 <2632 1649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208253.1:apolipoprotein N-acyltransferase >Feature sequence407 <1 1323 gene locus_tag LOCUS_16920 <1 1323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207488.1:siroheme synthase CysG 1546 2319 gene locus_tag LOCUS_16930 1546 2319 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191307.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence408 >Feature sequence409 1466 432 gene locus_tag LOCUS_16940 gene vexG 1466 432 CDS product vibriobactin export RND transporter periplasmic adaptor subunit VexG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039257.1 protein_id gnl|my_center|LOCUS_16940 2158 1781 gene locus_tag LOCUS_16950 gene rplQ 2158 1781 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049717.1 protein_id gnl|my_center|LOCUS_16950 >Feature sequence410 1592 915 gene locus_tag LOCUS_16960 gene pyrE 1592 915 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096586.1 protein_id gnl|my_center|LOCUS_16960 1668 2447 gene locus_tag LOCUS_16970 1668 2447 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122009.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence411 1206 2576 gene locus_tag LOCUS_16980 gene purB 1206 2576 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118712.1 protein_id gnl|my_center|LOCUS_16980 >Feature sequence412 1816 512 gene locus_tag LOCUS_16990 1816 512 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208265.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence413 444 2267 gene locus_tag LOCUS_17000 444 2267 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928981.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence414 <1 2494 gene locus_tag LOCUS_17010 <1 2494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113940.1:aminopeptidase N >Feature sequence415 477 980 gene locus_tag LOCUS_17020 477 980 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113053.1 protein_id gnl|my_center|LOCUS_17020 1022 1612 gene locus_tag LOCUS_17030 1022 1612 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093301.1 protein_id gnl|my_center|LOCUS_17030 1721 2305 gene locus_tag LOCUS_17040 gene ribA 1721 2305 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110510.1 protein_id gnl|my_center|LOCUS_17040 >Feature sequence416 1360 599 gene locus_tag LOCUS_17050 1360 599 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114696.1 protein_id gnl|my_center|LOCUS_17050 2171 1350 gene locus_tag LOCUS_17060 gene prmC 2171 1350 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211235.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence417 2328 1375 gene locus_tag LOCUS_17070 gene pstS 2328 1375 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_17070 >Feature sequence418 484 593 gene locus_tag LOCUS_r00020 484 593 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1635 847 gene locus_tag LOCUS_17080 gene fabI 1635 847 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368564.1 protein_id gnl|my_center|LOCUS_17080 2358 1648 gene locus_tag LOCUS_17090 2358 1648 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739343.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence419 205 1833 gene locus_tag LOCUS_17100 205 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 2016 2234 gene locus_tag LOCUS_17110 2016 2234 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669263.1 protein_id gnl|my_center|LOCUS_17110 2218 2562 gene locus_tag LOCUS_17120 2218 2562 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669261.1 protein_id gnl|my_center|LOCUS_17120 >Feature sequence420 2 1918 gene locus_tag LOCUS_17130 2 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 1998 2429 gene locus_tag LOCUS_17140 1998 2429 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132355466.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence421 78 680 gene locus_tag LOCUS_17150 78 680 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207364.1 protein_id gnl|my_center|LOCUS_17150 1057 1998 gene locus_tag LOCUS_17160 gene lipA 1057 1998 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090955.1 protein_id gnl|my_center|LOCUS_17160 >Feature sequence422 575 6 gene locus_tag LOCUS_17170 575 6 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112737.1 protein_id gnl|my_center|LOCUS_17170 1076 591 gene locus_tag LOCUS_17180 gene mreD 1076 591 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308115.1 protein_id gnl|my_center|LOCUS_17180 1972 1073 gene locus_tag LOCUS_17190 gene mreC 1972 1073 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116449.1 protein_id gnl|my_center|LOCUS_17190 2557 1991 gene locus_tag LOCUS_17200 2557 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence423 1077 1535 gene locus_tag LOCUS_17210 1077 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 2019 1597 gene locus_tag LOCUS_17220 gene rimI 2019 1597 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095025.1 protein_id gnl|my_center|LOCUS_17220 >Feature sequence424 2061 2333 gene locus_tag LOCUS_17230 2061 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence425 860 1606 gene locus_tag LOCUS_17240 860 1606 CDS product DUF2846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208323.1 protein_id gnl|my_center|LOCUS_17240 1600 1911 gene locus_tag LOCUS_17250 1600 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence426 <1 1112 gene locus_tag LOCUS_17260 <1 1112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005073697.1:AAA family ATPase 1154 1516 gene locus_tag LOCUS_17270 1154 1516 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640659.1 protein_id gnl|my_center|LOCUS_17270 1610 2278 gene locus_tag LOCUS_17280 1610 2278 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063534.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence427 683 24 gene locus_tag LOCUS_17290 683 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804634.1 protein_id gnl|my_center|LOCUS_17290 1688 1365 gene locus_tag LOCUS_17300 1688 1365 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092272.1 protein_id gnl|my_center|LOCUS_17300 <2533 1812 gene locus_tag LOCUS_17310 <2533 1812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073287.1:DNA mismatch repair protein MutS >Feature sequence428 >Feature sequence429 80 5 gene locus_tag LOCUS_t00280 80 5 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1577 192 gene locus_tag LOCUS_17320 gene cysS 1577 192 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206254.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence430 1509 364 gene locus_tag LOCUS_17330 1509 364 CDS product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930692.1 protein_id gnl|my_center|LOCUS_17330 2312 1590 gene locus_tag LOCUS_17340 2312 1590 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195885.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence431 299 850 gene locus_tag LOCUS_17350 299 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence432 887 429 gene locus_tag LOCUS_17360 887 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 902 1726 gene locus_tag LOCUS_17370 902 1726 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483526.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence433 647 1894 gene locus_tag LOCUS_17380 647 1894 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107018.1 protein_id gnl|my_center|LOCUS_17380 >Feature sequence434 <1 547 gene locus_tag LOCUS_17390 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015706179.1:bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC 1136 537 gene locus_tag LOCUS_17400 1136 537 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107293.1 protein_id gnl|my_center|LOCUS_17400 1308 2348 gene locus_tag LOCUS_17410 1308 2348 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098754.1 protein_id gnl|my_center|LOCUS_17410 >Feature sequence435 <1 870 gene locus_tag LOCUS_17420 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207024.1:MFS transporter 949 2082 gene locus_tag LOCUS_17430 949 2082 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208032.1 protein_id gnl|my_center|LOCUS_17430 >Feature sequence436 1448 156 gene locus_tag LOCUS_17440 gene eno 1448 156 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121066.1 protein_id gnl|my_center|LOCUS_17440 2374 1529 gene locus_tag LOCUS_17450 gene kdsA 2374 1529 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092365.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence437 >Feature sequence438 71 400 gene locus_tag LOCUS_17460 71 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 462 698 gene locus_tag LOCUS_17470 462 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 745 1629 gene locus_tag LOCUS_17480 745 1629 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724803.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence439 >Feature sequence440 201 1238 gene locus_tag LOCUS_17490 201 1238 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052727998.1 protein_id gnl|my_center|LOCUS_17490