>Feature sequence001 9 515 gene locus_tag LOCUS_00010 gene folK 9 515 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948528.1 protein_id gnl|my_center|LOCUS_00010 517 786 gene locus_tag LOCUS_00020 517 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 807 1451 gene locus_tag LOCUS_00030 gene fsa 807 1451 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943606.1 protein_id gnl|my_center|LOCUS_00030 1426 2031 gene locus_tag LOCUS_00040 gene pgsA 1426 2031 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_00040 2065 2511 gene locus_tag LOCUS_00050 2065 2511 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132355466.1 protein_id gnl|my_center|LOCUS_00050 2586 2660 gene locus_tag LOCUS_t00010 2586 2660 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2668 2742 gene locus_tag LOCUS_t00020 2668 2742 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2827 4053 gene locus_tag LOCUS_00060 gene trpB 2827 4053 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546381.1 protein_id gnl|my_center|LOCUS_00060 4046 4810 gene locus_tag LOCUS_00070 gene trpA 4046 4810 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392849.1 protein_id gnl|my_center|LOCUS_00070 4855 5679 gene locus_tag LOCUS_00080 4855 5679 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938913.1 protein_id gnl|my_center|LOCUS_00080 7344 5812 gene locus_tag LOCUS_00090 7344 5812 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940240.1 protein_id gnl|my_center|LOCUS_00090 8959 7346 gene locus_tag LOCUS_00100 gene cimA 8959 7346 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880180.1 protein_id gnl|my_center|LOCUS_00100 10185 9133 gene locus_tag LOCUS_00110 gene ilvC 10185 9133 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790693.1 protein_id gnl|my_center|LOCUS_00110 10702 10205 gene locus_tag LOCUS_00120 gene ilvN 10702 10205 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545180.1 protein_id gnl|my_center|LOCUS_00120 12552 10867 gene locus_tag LOCUS_00130 gene ilvB 12552 10867 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938671.1 protein_id gnl|my_center|LOCUS_00130 14408 12744 gene locus_tag LOCUS_00140 gene ilvD 14408 12744 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_00140 15088 16176 gene locus_tag LOCUS_00150 15088 16176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 16510 16226 gene locus_tag LOCUS_00160 16510 16226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 17029 16688 gene locus_tag LOCUS_00170 17029 16688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 17532 19028 gene locus_tag LOCUS_00180 gene trpE 17532 19028 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_00180 19035 19601 gene locus_tag LOCUS_00190 19035 19601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00190 19594 20604 gene locus_tag LOCUS_00200 gene trpD 19594 20604 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943017.1 protein_id gnl|my_center|LOCUS_00200 20604 21470 gene locus_tag LOCUS_00210 20604 21470 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938542.1 protein_id gnl|my_center|LOCUS_00210 21477 22244 gene locus_tag LOCUS_00220 21477 22244 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_00220 22241 22690 gene locus_tag LOCUS_00230 gene mlaD 22241 22690 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938540.1 protein_id gnl|my_center|LOCUS_00230 22703 23332 gene locus_tag LOCUS_00240 22703 23332 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938539.1 protein_id gnl|my_center|LOCUS_00240 23316 24104 gene locus_tag LOCUS_00250 23316 24104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 24114 25694 gene locus_tag LOCUS_00260 gene serA 24114 25694 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_00260 25719 26024 gene locus_tag LOCUS_00270 25719 26024 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937799.1 protein_id gnl|my_center|LOCUS_00270 26031 27074 gene locus_tag LOCUS_00280 26031 27074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 26987 27061 gene locus_tag LOCUS_t00030 26987 27061 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 27100 28050 gene locus_tag LOCUS_00290 27100 28050 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_00290 28125 28784 gene locus_tag LOCUS_00300 28125 28784 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_00300 28788 29375 gene locus_tag LOCUS_00310 gene pth 28788 29375 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_00310 29477 31510 gene locus_tag LOCUS_00320 29477 31510 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038412.1 protein_id gnl|my_center|LOCUS_00320 31718 32308 gene locus_tag LOCUS_00330 31718 32308 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810219.1 protein_id gnl|my_center|LOCUS_00330 32308 33294 gene locus_tag LOCUS_00340 32308 33294 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542473.1 protein_id gnl|my_center|LOCUS_00340 33664 33257 gene locus_tag LOCUS_00350 gene queF 33664 33257 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_00350 <35288 33678 gene locus_tag LOCUS_00360 <35288 33678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941506.1:ATP-binding protein >Feature sequence002 4692 829 gene locus_tag LOCUS_00370 gene hrpA 4692 829 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 protein_id gnl|my_center|LOCUS_00370 6403 4871 gene locus_tag LOCUS_00380 6403 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 6494 7945 gene locus_tag LOCUS_00390 6494 7945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 8865 8047 gene locus_tag LOCUS_00400 gene ybgF 8865 8047 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926896.1 protein_id gnl|my_center|LOCUS_00400 9534 8944 gene locus_tag LOCUS_00410 9534 8944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 10888 9563 gene locus_tag LOCUS_00420 gene tolB 10888 9563 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932320.1 protein_id gnl|my_center|LOCUS_00420 11797 10919 gene locus_tag LOCUS_00430 11797 10919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 12269 11844 gene locus_tag LOCUS_00440 gene tolR 12269 11844 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_00440 13021 12266 gene locus_tag LOCUS_00450 gene tolQ 13021 12266 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_00450 13282 13923 gene locus_tag LOCUS_00460 13282 13923 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941836.1 protein_id gnl|my_center|LOCUS_00460 13967 15880 gene locus_tag LOCUS_00470 13967 15880 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_00470 15877 16641 gene locus_tag LOCUS_00480 15877 16641 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761731.1 protein_id gnl|my_center|LOCUS_00480 16934 18004 gene locus_tag LOCUS_00490 16934 18004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 18504 18052 gene locus_tag LOCUS_00500 18504 18052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 19532 18513 gene locus_tag LOCUS_00510 19532 18513 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_00510 20210 19581 gene locus_tag LOCUS_00520 gene rpsD 20210 19581 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_00520 20621 20235 gene locus_tag LOCUS_00530 gene rpsK 20621 20235 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_00530 21029 20646 gene locus_tag LOCUS_00540 gene rpsM 21029 20646 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943462.1 protein_id gnl|my_center|LOCUS_00540 21420 21202 gene locus_tag LOCUS_00550 gene infA 21420 21202 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040194.1 protein_id gnl|my_center|LOCUS_00550 22745 21447 gene locus_tag LOCUS_00560 gene secY 22745 21447 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_00560 23202 22768 gene locus_tag LOCUS_00570 gene rplO 23202 22768 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810128.1 protein_id gnl|my_center|LOCUS_00570 23386 23189 gene locus_tag LOCUS_00580 gene rpmD 23386 23189 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201159.1 protein_id gnl|my_center|LOCUS_00580 24037 23543 gene locus_tag LOCUS_00590 gene rpsE 24037 23543 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943469.1 protein_id gnl|my_center|LOCUS_00590 24430 24062 gene locus_tag LOCUS_00600 gene rplR 24430 24062 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_00600 24994 24455 gene locus_tag LOCUS_00610 gene rplF 24994 24455 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546082.1 protein_id gnl|my_center|LOCUS_00610 25412 25014 gene locus_tag LOCUS_00620 gene rpsH 25412 25014 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943472.1 protein_id gnl|my_center|LOCUS_00620 25671 25486 gene locus_tag LOCUS_00630 25671 25486 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938611.1 protein_id gnl|my_center|LOCUS_00630 26297 25758 gene locus_tag LOCUS_00640 gene rplE 26297 25758 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_00640 26651 26322 gene locus_tag LOCUS_00650 gene rplX 26651 26322 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938609.1 protein_id gnl|my_center|LOCUS_00650 27024 26656 gene locus_tag LOCUS_00660 gene rplN 27024 26656 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943476.1 protein_id gnl|my_center|LOCUS_00660 27325 27047 gene locus_tag LOCUS_00670 gene rpsQ 27325 27047 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943477.1 protein_id gnl|my_center|LOCUS_00670 27521 27318 gene locus_tag LOCUS_00680 gene rpmC 27521 27318 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421158.1 protein_id gnl|my_center|LOCUS_00680 27934 27521 gene locus_tag LOCUS_00690 gene rplP 27934 27521 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943479.1 protein_id gnl|my_center|LOCUS_00690 28614 27976 gene locus_tag LOCUS_00700 gene rpsC 28614 27976 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_00700 28965 28627 gene locus_tag LOCUS_00710 gene rplV 28965 28627 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003027193.1 protein_id gnl|my_center|LOCUS_00710 29345 29064 gene locus_tag LOCUS_00720 gene rpsS 29345 29064 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938602.1 protein_id gnl|my_center|LOCUS_00720 30277 29447 gene locus_tag LOCUS_00730 gene rplB 30277 29447 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_00730 30658 30371 gene locus_tag LOCUS_00740 gene rplW 30658 30371 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_00740 31278 30655 gene locus_tag LOCUS_00750 gene rplD 31278 30655 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127258.1 protein_id gnl|my_center|LOCUS_00750 31981 31352 gene locus_tag LOCUS_00760 gene rplC 31981 31352 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943486.1 protein_id gnl|my_center|LOCUS_00760 32313 32002 gene locus_tag LOCUS_00770 gene rpsJ 32313 32002 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_00770 >Feature sequence003 479 6 gene locus_tag LOCUS_00780 479 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 957 466 gene locus_tag LOCUS_00790 957 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 1652 1170 gene locus_tag LOCUS_00800 1652 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 1946 3310 gene locus_tag LOCUS_00810 gene trkA 1946 3310 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 protein_id gnl|my_center|LOCUS_00810 3310 4758 gene locus_tag LOCUS_00820 3310 4758 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_00820 4863 5087 gene locus_tag LOCUS_00830 4863 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 6539 5139 gene locus_tag LOCUS_00840 gene gltA 6539 5139 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272418.1 protein_id gnl|my_center|LOCUS_00840 7405 6578 gene locus_tag LOCUS_00850 7405 6578 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_00850 7562 8896 gene locus_tag LOCUS_00860 7562 8896 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937642.1 protein_id gnl|my_center|LOCUS_00860 9480 8818 gene locus_tag LOCUS_00870 9480 8818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 10371 9490 gene locus_tag LOCUS_00880 gene rsmI 10371 9490 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941314.1 protein_id gnl|my_center|LOCUS_00880 10738 10364 gene locus_tag LOCUS_00890 10738 10364 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_00890 11400 10750 gene locus_tag LOCUS_00900 11400 10750 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_00900 11762 11415 gene locus_tag LOCUS_00910 gene rplS 11762 11415 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938136.1 protein_id gnl|my_center|LOCUS_00910 12329 11799 gene locus_tag LOCUS_00920 12329 11799 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941308.1 protein_id gnl|my_center|LOCUS_00920 13095 12310 gene locus_tag LOCUS_00930 gene trmD 13095 12310 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_00930 13630 13109 gene locus_tag LOCUS_00940 gene rimM 13630 13109 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765872.1 protein_id gnl|my_center|LOCUS_00940 13865 13635 gene locus_tag LOCUS_00950 13865 13635 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_00950 14212 13973 gene locus_tag LOCUS_00960 gene rpsP 14212 13973 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699989.1 protein_id gnl|my_center|LOCUS_00960 15593 14262 gene locus_tag LOCUS_00970 gene ffh 15593 14262 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941303.1 protein_id gnl|my_center|LOCUS_00970 16942 15773 gene locus_tag LOCUS_00980 16942 15773 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245114.1 protein_id gnl|my_center|LOCUS_00980 17328 17098 gene locus_tag LOCUS_00990 17328 17098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 19384 17489 gene locus_tag LOCUS_01000 gene recD 19384 17489 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942182.1 protein_id gnl|my_center|LOCUS_01000 20310 19390 gene locus_tag LOCUS_01010 gene porB 20310 19390 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762255.1 protein_id gnl|my_center|LOCUS_01010 21559 20315 gene locus_tag LOCUS_01020 21559 20315 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250930.1 protein_id gnl|my_center|LOCUS_01020 21913 21602 gene locus_tag LOCUS_01030 21913 21602 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762253.1 protein_id gnl|my_center|LOCUS_01030 22553 21966 gene locus_tag LOCUS_01040 22553 21966 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_01040 >Feature sequence004 1232 159 gene locus_tag LOCUS_01050 1232 159 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020431.1 protein_id gnl|my_center|LOCUS_01050 2043 1354 gene locus_tag LOCUS_01060 2043 1354 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903416.1 protein_id gnl|my_center|LOCUS_01060 3553 2057 gene locus_tag LOCUS_01070 3553 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 3854 3528 gene locus_tag LOCUS_01080 3854 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 5172 3949 gene locus_tag LOCUS_01090 5172 3949 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021679.1 protein_id gnl|my_center|LOCUS_01090 5323 5490 gene locus_tag LOCUS_01100 5323 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 7045 5849 gene locus_tag LOCUS_01110 7045 5849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 8064 7054 gene locus_tag LOCUS_01120 8064 7054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 8403 9179 gene locus_tag LOCUS_01130 8403 9179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 9213 10823 gene locus_tag LOCUS_01140 9213 10823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 10823 12262 gene locus_tag LOCUS_01150 10823 12262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 12624 13145 gene locus_tag LOCUS_01160 12624 13145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 13234 13824 gene locus_tag LOCUS_01170 13234 13824 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789731.1 protein_id gnl|my_center|LOCUS_01170 13836 14165 gene locus_tag LOCUS_01180 13836 14165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 14177 14584 gene locus_tag LOCUS_01190 14177 14584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 16022 14778 gene locus_tag LOCUS_01200 16022 14778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 16515 17471 gene locus_tag LOCUS_01210 16515 17471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 17570 18931 gene locus_tag LOCUS_01220 17570 18931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 20334 19027 gene locus_tag LOCUS_01230 20334 19027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 21489 20347 gene locus_tag LOCUS_01240 21489 20347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 >Feature sequence005 156 1487 gene locus_tag LOCUS_01250 156 1487 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933195.1 protein_id gnl|my_center|LOCUS_01250 2195 1491 gene locus_tag LOCUS_01260 2195 1491 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937704.1 protein_id gnl|my_center|LOCUS_01260 4680 2314 gene locus_tag LOCUS_01270 gene lon 4680 2314 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_01270 5153 4716 gene locus_tag LOCUS_01280 5153 4716 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083188.1 protein_id gnl|my_center|LOCUS_01280 5387 7501 gene locus_tag LOCUS_01290 5387 7501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 7680 8282 gene locus_tag LOCUS_01300 7680 8282 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384250.1 protein_id gnl|my_center|LOCUS_01300 8319 9839 gene locus_tag LOCUS_01310 gene proS 8319 9839 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921836.1 protein_id gnl|my_center|LOCUS_01310 9924 12062 gene locus_tag LOCUS_01320 9924 12062 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_01320 12284 12093 gene locus_tag LOCUS_01330 gene rpmB 12284 12093 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_01330 13591 12560 gene locus_tag LOCUS_01340 13591 12560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 13914 14633 gene locus_tag LOCUS_01350 13914 14633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 16208 14712 gene locus_tag LOCUS_01360 16208 14712 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546582.1 protein_id gnl|my_center|LOCUS_01360 18729 16231 gene locus_tag LOCUS_01370 18729 16231 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545874.1 protein_id gnl|my_center|LOCUS_01370 19143 18763 gene locus_tag LOCUS_01380 19143 18763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 20168 19164 gene locus_tag LOCUS_01390 20168 19164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 21014 20214 gene locus_tag LOCUS_01400 21014 20214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 <21876 21039 gene locus_tag LOCUS_01410 <21876 21039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942570.1:cytidylate kinase family protein >Feature sequence006 1454 558 gene locus_tag LOCUS_01420 gene rssA 1454 558 CDS product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946687.1 protein_id gnl|my_center|LOCUS_01420 1870 1556 gene locus_tag LOCUS_01430 1870 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 3322 1877 gene locus_tag LOCUS_01440 gene rfaE1 3322 1877 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942727.1 protein_id gnl|my_center|LOCUS_01440 4131 3514 gene locus_tag LOCUS_01450 gene thrH 4131 3514 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267421.1 protein_id gnl|my_center|LOCUS_01450 5462 4131 gene locus_tag LOCUS_01460 5462 4131 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_01460 6661 5495 gene locus_tag LOCUS_01470 gene alaC 6661 5495 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546347.1 protein_id gnl|my_center|LOCUS_01470 6854 7897 gene locus_tag LOCUS_01480 gene purM 6854 7897 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_01480 7996 8997 gene locus_tag LOCUS_01490 gene tsaD 7996 8997 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_01490 9144 10646 gene locus_tag LOCUS_01500 9144 10646 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_01500 11010 11267 gene locus_tag LOCUS_01510 11010 11267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 11272 11568 gene locus_tag LOCUS_01520 11272 11568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 11729 12781 gene locus_tag LOCUS_01530 11729 12781 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_01530 13224 13820 gene locus_tag LOCUS_01540 13224 13820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 15987 14329 gene locus_tag LOCUS_01550 15987 14329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 18687 16063 gene locus_tag LOCUS_01560 gene mutS 18687 16063 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_01560 19349 18684 gene locus_tag LOCUS_01570 19349 18684 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583102.1 protein_id gnl|my_center|LOCUS_01570 <20110 19366 gene locus_tag LOCUS_01580 <20110 19366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583673.1:deoxyguanosinetriphosphate triphosphohydrolase >Feature sequence007 86 451 gene locus_tag LOCUS_01590 86 451 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933716.1 protein_id gnl|my_center|LOCUS_01590 504 1697 gene locus_tag LOCUS_01600 504 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 1694 3049 gene locus_tag LOCUS_01610 1694 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 3084 3515 gene locus_tag LOCUS_01620 3084 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 3852 4151 gene locus_tag LOCUS_01630 3852 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 4148 5398 gene locus_tag LOCUS_01640 4148 5398 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268088.1 protein_id gnl|my_center|LOCUS_01640 5434 6018 gene locus_tag LOCUS_01650 5434 6018 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024115.1 protein_id gnl|my_center|LOCUS_01650 6602 6012 gene locus_tag LOCUS_01660 gene thyX 6602 6012 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393959.1 protein_id gnl|my_center|LOCUS_01660 7630 6650 gene locus_tag LOCUS_01670 gene moaA 7630 6650 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_01670 8598 7624 gene locus_tag LOCUS_01680 8598 7624 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974682.1 protein_id gnl|my_center|LOCUS_01680 9748 8591 gene locus_tag LOCUS_01690 9748 8591 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257313.1 protein_id gnl|my_center|LOCUS_01690 11307 9790 gene locus_tag LOCUS_01700 gene cobA 11307 9790 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_01700 12227 11310 gene locus_tag LOCUS_01710 gene hemC 12227 11310 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_01710 13852 12476 gene locus_tag LOCUS_01720 gene glmM 13852 12476 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_01720 15233 14007 gene locus_tag LOCUS_01730 15233 14007 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926174.1 protein_id gnl|my_center|LOCUS_01730 16114 15374 gene locus_tag LOCUS_01740 gene fabG 16114 15374 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395038.1 protein_id gnl|my_center|LOCUS_01740 16570 16821 gene locus_tag LOCUS_01750 16570 16821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 16844 17620 gene locus_tag LOCUS_01760 16844 17620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 17605 19641 gene locus_tag LOCUS_01770 gene ligA 17605 19641 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_01770 >Feature sequence008 1413 259 gene locus_tag LOCUS_01780 1413 259 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040775.1 protein_id gnl|my_center|LOCUS_01780 1675 2796 gene locus_tag LOCUS_01790 1675 2796 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410070.1 protein_id gnl|my_center|LOCUS_01790 2927 4585 gene locus_tag LOCUS_01800 2927 4585 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942540.1 protein_id gnl|my_center|LOCUS_01800 4573 5691 gene locus_tag LOCUS_01810 4573 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 5755 6768 gene locus_tag LOCUS_01820 5755 6768 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071877.1 protein_id gnl|my_center|LOCUS_01820 6741 7592 gene locus_tag LOCUS_01830 6741 7592 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_01830 7737 9077 gene locus_tag LOCUS_01840 7737 9077 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943144.1 protein_id gnl|my_center|LOCUS_01840 9609 9815 gene locus_tag LOCUS_01850 9609 9815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 9830 10405 gene locus_tag LOCUS_01860 9830 10405 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_01860 11686 10652 gene locus_tag LOCUS_01870 11686 10652 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_01870 11988 12081 gene locus_tag LOCUS_t00040 11988 12081 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12127 13869 gene locus_tag LOCUS_01880 gene dnaX 12127 13869 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_01880 13881 14192 gene locus_tag LOCUS_01890 13881 14192 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391577.1 protein_id gnl|my_center|LOCUS_01890 14195 14794 gene locus_tag LOCUS_01900 gene recR 14195 14794 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391578.1 protein_id gnl|my_center|LOCUS_01900 14815 15201 gene locus_tag LOCUS_01910 14815 15201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 15214 15999 gene locus_tag LOCUS_01920 gene murI 15214 15999 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_01920 16035 16739 gene locus_tag LOCUS_01930 16035 16739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 16892 17401 gene locus_tag LOCUS_01940 16892 17401 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044348005.1 protein_id gnl|my_center|LOCUS_01940 <19253 17418 gene locus_tag LOCUS_01950 <19253 17418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583043.1:ABC transporter ATP-binding protein >Feature sequence009 2002 14 gene locus_tag LOCUS_01960 2002 14 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926958.1 protein_id gnl|my_center|LOCUS_01960 10239 2443 gene locus_tag LOCUS_01970 10239 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 12243 10330 gene locus_tag LOCUS_01980 12243 10330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 12659 13660 gene locus_tag LOCUS_01990 12659 13660 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_01990 13948 14199 gene locus_tag LOCUS_02000 13948 14199 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250181.1 protein_id gnl|my_center|LOCUS_02000 14189 14488 gene locus_tag LOCUS_02010 14189 14488 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221356.1 protein_id gnl|my_center|LOCUS_02010 17293 14711 gene locus_tag LOCUS_02020 gene clpB 17293 14711 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_02020 >Feature sequence010 385 849 gene locus_tag LOCUS_02030 385 849 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546022.1 protein_id gnl|my_center|LOCUS_02030 1897 836 gene locus_tag LOCUS_02040 1897 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 3255 2053 gene locus_tag LOCUS_02050 gene pgk 3255 2053 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942273.1 protein_id gnl|my_center|LOCUS_02050 3535 3233 gene locus_tag LOCUS_02060 3535 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 4559 3525 gene locus_tag LOCUS_02070 4559 3525 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_02070 7000 4571 gene locus_tag LOCUS_02080 gene gyrA 7000 4571 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_02080 7885 7007 gene locus_tag LOCUS_02090 7885 7007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 8343 8185 gene locus_tag LOCUS_02100 8343 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 9642 8356 gene locus_tag LOCUS_02110 9642 8356 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878693.1 protein_id gnl|my_center|LOCUS_02110 9831 11039 gene locus_tag LOCUS_02120 9831 11039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 11875 11036 gene locus_tag LOCUS_02130 11875 11036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 13495 11888 gene locus_tag LOCUS_02140 13495 11888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 14834 13572 gene locus_tag LOCUS_02150 14834 13572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 15531 14938 gene locus_tag LOCUS_02160 15531 14938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 17937 15538 gene locus_tag LOCUS_02170 17937 15538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 >Feature sequence011 692 1777 gene locus_tag LOCUS_02180 gene yedE 692 1777 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545330.1 protein_id gnl|my_center|LOCUS_02180 1789 2007 gene locus_tag LOCUS_02190 1789 2007 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546446.1 protein_id gnl|my_center|LOCUS_02190 2011 2628 gene locus_tag LOCUS_02200 2011 2628 CDS product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545577.1 protein_id gnl|my_center|LOCUS_02200 2616 3470 gene locus_tag LOCUS_02210 2616 3470 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545741.1 protein_id gnl|my_center|LOCUS_02210 3938 4333 gene locus_tag LOCUS_02220 3938 4333 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_02220 5121 4606 gene locus_tag LOCUS_02230 5121 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 5587 5315 gene locus_tag LOCUS_02240 5587 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 9150 5728 gene locus_tag LOCUS_02250 gene cobN 9150 5728 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870959.1 protein_id gnl|my_center|LOCUS_02250 10092 9298 gene locus_tag LOCUS_02260 10092 9298 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_02260 10554 10096 gene locus_tag LOCUS_02270 10554 10096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02270 11103 10558 gene locus_tag LOCUS_02280 11103 10558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02280 11972 11100 gene locus_tag LOCUS_02290 11972 11100 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812740.1 protein_id gnl|my_center|LOCUS_02290 14159 12132 gene locus_tag LOCUS_02300 14159 12132 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020921.1 protein_id gnl|my_center|LOCUS_02300 15237 14170 gene locus_tag LOCUS_02310 15237 14170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 16728 16357 gene locus_tag LOCUS_02320 16728 16357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 16973 16725 gene locus_tag LOCUS_02330 16973 16725 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_02330 18630 17455 gene locus_tag LOCUS_02340 18630 17455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 >Feature sequence012 96 1295 gene locus_tag LOCUS_02350 96 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 1305 1868 gene locus_tag LOCUS_02360 1305 1868 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_02360 2968 1877 gene locus_tag LOCUS_02370 2968 1877 CDS product DUF3524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257632.1 protein_id gnl|my_center|LOCUS_02370 3363 3076 gene locus_tag LOCUS_02380 3363 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 4145 3456 gene locus_tag LOCUS_02390 4145 3456 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_02390 4537 4148 gene locus_tag LOCUS_02400 4537 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 4803 4585 gene locus_tag LOCUS_02410 4803 4585 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941004.1 protein_id gnl|my_center|LOCUS_02410 5364 4921 gene locus_tag LOCUS_02420 gene rfaE2 5364 4921 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880070.1 protein_id gnl|my_center|LOCUS_02420 5875 5456 gene locus_tag LOCUS_02430 5875 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938912.1 protein_id gnl|my_center|LOCUS_02430 6698 5934 gene locus_tag LOCUS_02440 6698 5934 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940707.1 protein_id gnl|my_center|LOCUS_02440 7571 6729 gene locus_tag LOCUS_02450 7571 6729 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_02450 8339 7590 gene locus_tag LOCUS_02460 gene rlmB 8339 7590 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942108.1 protein_id gnl|my_center|LOCUS_02460 8952 8320 gene locus_tag LOCUS_02470 gene gmk 8952 8320 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942878.1 protein_id gnl|my_center|LOCUS_02470 9215 8949 gene locus_tag LOCUS_02480 9215 8949 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938198.1 protein_id gnl|my_center|LOCUS_02480 10126 9245 gene locus_tag LOCUS_02490 10126 9245 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_02490 10814 10284 gene locus_tag LOCUS_02500 10814 10284 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082414.1 protein_id gnl|my_center|LOCUS_02500 10998 10825 gene locus_tag LOCUS_02510 10998 10825 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545155.1 protein_id gnl|my_center|LOCUS_02510 11704 11012 gene locus_tag LOCUS_02520 11704 11012 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940040.1 protein_id gnl|my_center|LOCUS_02520 13691 11904 gene locus_tag LOCUS_02530 13691 11904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 14943 13654 gene locus_tag LOCUS_02540 14943 13654 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523086.1 protein_id gnl|my_center|LOCUS_02540 16914 14947 gene locus_tag LOCUS_02550 16914 14947 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250356.1 protein_id gnl|my_center|LOCUS_02550 17554 16967 gene locus_tag LOCUS_02560 17554 16967 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_02560 18194 17547 gene locus_tag LOCUS_02570 18194 17547 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_02570 >Feature sequence013 3178 347 gene locus_tag LOCUS_02580 gene uvrA 3178 347 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_02580 4541 3189 gene locus_tag LOCUS_02590 4541 3189 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545078.1 protein_id gnl|my_center|LOCUS_02590 6516 4786 gene locus_tag LOCUS_02600 6516 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_02600 6922 6539 gene locus_tag LOCUS_02610 6922 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 7938 7048 gene locus_tag LOCUS_02620 7938 7048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 8815 7928 gene locus_tag LOCUS_02630 gene folP 8815 7928 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_02630 10656 8812 gene locus_tag LOCUS_02640 gene ftsH 10656 8812 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_02640 12237 10762 gene locus_tag LOCUS_02650 gene tilS 12237 10762 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_02650 12906 13532 gene locus_tag LOCUS_02660 gene grpE 12906 13532 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_02660 13563 15500 gene locus_tag LOCUS_02670 gene dnaK 13563 15500 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_02670 17062 15632 gene locus_tag LOCUS_02680 17062 15632 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_02680 <18470 17059 gene locus_tag LOCUS_02690 <18470 17059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011793127.1:ATP-binding protein >Feature sequence014 192 106 gene locus_tag LOCUS_t00050 192 106 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 299 1237 gene locus_tag LOCUS_02700 299 1237 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546739.1 protein_id gnl|my_center|LOCUS_02700 1822 1238 gene locus_tag LOCUS_02710 1822 1238 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_02710 2363 1860 gene locus_tag LOCUS_02720 2363 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 2568 3656 gene locus_tag LOCUS_02730 2568 3656 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942398.1 protein_id gnl|my_center|LOCUS_02730 4123 3677 gene locus_tag LOCUS_02740 4123 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 4770 4183 gene locus_tag LOCUS_02750 4770 4183 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986919.1 protein_id gnl|my_center|LOCUS_02750 4961 6241 gene locus_tag LOCUS_02760 gene serS 4961 6241 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940715.1 protein_id gnl|my_center|LOCUS_02760 6232 7737 gene locus_tag LOCUS_02770 gene thrC 6232 7737 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791440.1 protein_id gnl|my_center|LOCUS_02770 7917 9692 gene locus_tag LOCUS_02780 7917 9692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 9736 10530 gene locus_tag LOCUS_02790 9736 10530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 11621 10593 gene locus_tag LOCUS_02800 11621 10593 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162806499.1 protein_id gnl|my_center|LOCUS_02800 12333 12145 gene locus_tag LOCUS_02810 12333 12145 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940534.1 protein_id gnl|my_center|LOCUS_02810 12702 13967 gene locus_tag LOCUS_02820 12702 13967 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053767.1 protein_id gnl|my_center|LOCUS_02820 13977 14645 gene locus_tag LOCUS_02830 13977 14645 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 protein_id gnl|my_center|LOCUS_02830 16776 14914 gene locus_tag LOCUS_02840 16776 14914 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_02840 >Feature sequence015 1910 54 gene locus_tag LOCUS_02850 1910 54 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590871.1 protein_id gnl|my_center|LOCUS_02850 3206 1968 gene locus_tag LOCUS_02860 gene fabF 3206 1968 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_02860 3485 3255 gene locus_tag LOCUS_02870 gene acpP 3485 3255 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938501.1 protein_id gnl|my_center|LOCUS_02870 4268 3501 gene locus_tag LOCUS_02880 gene fabG 4268 3501 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989818.1 protein_id gnl|my_center|LOCUS_02880 5935 4268 gene locus_tag LOCUS_02890 5935 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 6268 6089 gene locus_tag LOCUS_02900 gene rpmF 6268 6089 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_02900 6640 8058 gene locus_tag LOCUS_02910 gene gltX 6640 8058 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941876.1 protein_id gnl|my_center|LOCUS_02910 8159 9823 gene locus_tag LOCUS_02920 gene argS 8159 9823 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546374.1 protein_id gnl|my_center|LOCUS_02920 9833 10489 gene locus_tag LOCUS_02930 9833 10489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 10489 10776 gene locus_tag LOCUS_02940 gene gatC 10489 10776 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462078.1 protein_id gnl|my_center|LOCUS_02940 10793 12253 gene locus_tag LOCUS_02950 gene gatA 10793 12253 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546781.1 protein_id gnl|my_center|LOCUS_02950 12256 12435 gene locus_tag LOCUS_02960 12256 12435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 12454 14235 gene locus_tag LOCUS_02970 gene mutL 12454 14235 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942644.1 protein_id gnl|my_center|LOCUS_02970 14238 15191 gene locus_tag LOCUS_02980 14238 15191 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933107.1 protein_id gnl|my_center|LOCUS_02980 15374 16582 gene locus_tag LOCUS_02990 15374 16582 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_02990 16979 17926 gene locus_tag LOCUS_03000 16979 17926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 >Feature sequence016 120 212 gene locus_tag LOCUS_t00060 120 212 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 358 597 gene locus_tag LOCUS_03010 358 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 783 3212 gene locus_tag LOCUS_03020 783 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 3873 3238 gene locus_tag LOCUS_03030 gene queC 3873 3238 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941151.1 protein_id gnl|my_center|LOCUS_03030 4087 8394 gene locus_tag LOCUS_03040 4087 8394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 10449 8422 gene locus_tag LOCUS_03050 10449 8422 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969865.1 protein_id gnl|my_center|LOCUS_03050 12012 10459 gene locus_tag LOCUS_03060 12012 10459 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_03060 12246 14030 gene locus_tag LOCUS_03070 12246 14030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 14132 14311 gene locus_tag LOCUS_03080 14132 14311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 14397 16274 gene locus_tag LOCUS_03090 14397 16274 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_03090 16491 17357 gene locus_tag LOCUS_03100 gene sppA 16491 17357 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545082.1 protein_id gnl|my_center|LOCUS_03100 17958 17347 gene locus_tag LOCUS_03110 17958 17347 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_03110 >Feature sequence017 1580 132 gene locus_tag LOCUS_03120 1580 132 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938336.1 protein_id gnl|my_center|LOCUS_03120 2313 1858 gene locus_tag LOCUS_03130 2313 1858 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815835.1 protein_id gnl|my_center|LOCUS_03130 3745 2468 gene locus_tag LOCUS_03140 3745 2468 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_03140 4501 4352 gene locus_tag LOCUS_03150 4501 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 4787 4563 gene locus_tag LOCUS_03160 4787 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 7262 5280 gene locus_tag LOCUS_03170 7262 5280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 7616 8995 gene locus_tag LOCUS_03180 7616 8995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 8996 9691 gene locus_tag LOCUS_03190 8996 9691 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549852.1 protein_id gnl|my_center|LOCUS_03190 9960 11042 gene locus_tag LOCUS_03200 9960 11042 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_03200 11058 12242 gene locus_tag LOCUS_03210 11058 12242 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545245.1 protein_id gnl|my_center|LOCUS_03210 12261 12923 gene locus_tag LOCUS_03220 12261 12923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 12973 13128 gene locus_tag LOCUS_03230 12973 13128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 13892 13125 gene locus_tag LOCUS_03240 13892 13125 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_03240 14476 14123 gene locus_tag LOCUS_03250 14476 14123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 15311 14523 gene locus_tag LOCUS_03260 15311 14523 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065531.1 protein_id gnl|my_center|LOCUS_03260 16401 15322 gene locus_tag LOCUS_03270 gene trpD 16401 15322 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022929.1 protein_id gnl|my_center|LOCUS_03270 17473 16469 gene locus_tag LOCUS_03280 17473 16469 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_03280 >Feature sequence018 3270 2698 gene locus_tag LOCUS_03290 3270 2698 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065384.1 protein_id gnl|my_center|LOCUS_03290 4045 3425 gene locus_tag LOCUS_03300 4045 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 4878 4066 gene locus_tag LOCUS_03310 4878 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 5856 5152 gene locus_tag LOCUS_03320 gene aat 5856 5152 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546338.1 protein_id gnl|my_center|LOCUS_03320 7386 5959 gene locus_tag LOCUS_03330 7386 5959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 8144 7443 gene locus_tag LOCUS_03340 8144 7443 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_03340 10241 8151 gene locus_tag LOCUS_03350 10241 8151 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_03350 10648 12471 gene locus_tag LOCUS_03360 gene uvrC 10648 12471 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048309.1 protein_id gnl|my_center|LOCUS_03360 13404 12472 gene locus_tag LOCUS_03370 gene mdh 13404 12472 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_03370 13682 13524 gene locus_tag LOCUS_03380 13682 13524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 13940 14857 gene locus_tag LOCUS_03390 13940 14857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 14924 15538 gene locus_tag LOCUS_03400 14924 15538 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_03400 >Feature sequence019 213 1049 gene locus_tag LOCUS_03410 213 1049 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 protein_id gnl|my_center|LOCUS_03410 1046 1783 gene locus_tag LOCUS_03420 1046 1783 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211328137.1 protein_id gnl|my_center|LOCUS_03420 1791 2828 gene locus_tag LOCUS_03430 gene mnmA 1791 2828 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_03430 2833 4104 gene locus_tag LOCUS_03440 gene mtaB 2833 4104 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_03440 5097 4096 gene locus_tag LOCUS_03450 gene nagZ 5097 4096 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_03450 5246 5100 gene locus_tag LOCUS_03460 5246 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 5507 5782 gene locus_tag LOCUS_03470 5507 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 5773 5847 gene locus_tag LOCUS_t00070 5773 5847 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6479 7300 gene locus_tag LOCUS_03480 6479 7300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 8580 7297 gene locus_tag LOCUS_03490 8580 7297 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022026.1 protein_id gnl|my_center|LOCUS_03490 10786 8558 gene locus_tag LOCUS_03500 10786 8558 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200796636.1 protein_id gnl|my_center|LOCUS_03500 11017 11601 gene locus_tag LOCUS_03510 11017 11601 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_03510 11733 12548 gene locus_tag LOCUS_03520 11733 12548 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222388.1 protein_id gnl|my_center|LOCUS_03520 12970 13602 gene locus_tag LOCUS_03530 12970 13602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 >Feature sequence020 <1 1424 gene locus_tag LOCUS_03540 <1 1424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000252168.1:ABC transporter permease subunit 1450 3111 gene locus_tag LOCUS_03550 gene pstA 1450 3111 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_03550 3133 3942 gene locus_tag LOCUS_03560 gene pstB 3133 3942 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706615.1 protein_id gnl|my_center|LOCUS_03560 3966 4652 gene locus_tag LOCUS_03570 gene phoU 3966 4652 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545517.1 protein_id gnl|my_center|LOCUS_03570 4652 5344 gene locus_tag LOCUS_03580 4652 5344 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986854.1 protein_id gnl|my_center|LOCUS_03580 5341 7113 gene locus_tag LOCUS_03590 5341 7113 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_03590 7416 7114 gene locus_tag LOCUS_03600 7416 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 9700 7595 gene locus_tag LOCUS_03610 gene mrcB 9700 7595 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073474.1 protein_id gnl|my_center|LOCUS_03610 10420 10344 gene locus_tag LOCUS_t00080 10420 10344 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10768 11550 gene locus_tag LOCUS_03620 10768 11550 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545667.1 protein_id gnl|my_center|LOCUS_03620 12622 11588 gene locus_tag LOCUS_03630 gene dapA 12622 11588 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869742.1 protein_id gnl|my_center|LOCUS_03630 12817 13440 gene locus_tag LOCUS_03640 12817 13440 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940530.1 protein_id gnl|my_center|LOCUS_03640 13447 14664 gene locus_tag LOCUS_03650 13447 14664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 >Feature sequence021 311 1252 gene locus_tag LOCUS_03660 311 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 1352 1795 gene locus_tag LOCUS_03670 gene rplI 1352 1795 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545246.1 protein_id gnl|my_center|LOCUS_03670 1820 3205 gene locus_tag LOCUS_03680 gene dnaB 1820 3205 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546182.1 protein_id gnl|my_center|LOCUS_03680 3183 4388 gene locus_tag LOCUS_03690 gene coaBC 3183 4388 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967219.1 protein_id gnl|my_center|LOCUS_03690 5749 4514 gene locus_tag LOCUS_03700 5749 4514 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392000.1 protein_id gnl|my_center|LOCUS_03700 6526 5777 gene locus_tag LOCUS_03710 gene larB 6526 5777 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_03710 6692 7789 gene locus_tag LOCUS_03720 6692 7789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 7790 8149 gene locus_tag LOCUS_03730 7790 8149 CDS product CGGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870086.1 protein_id gnl|my_center|LOCUS_03730 8188 8727 gene locus_tag LOCUS_03740 8188 8727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 8724 12137 gene locus_tag LOCUS_03750 8724 12137 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943878.1 protein_id gnl|my_center|LOCUS_03750 12173 12616 gene locus_tag LOCUS_03760 12173 12616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 14193 13603 gene locus_tag LOCUS_03770 14193 13603 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_03770 15085 14525 gene locus_tag LOCUS_03780 15085 14525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 15853 15596 gene locus_tag LOCUS_03790 15853 15596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 >Feature sequence022 460 167 gene locus_tag LOCUS_03800 460 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 865 665 gene locus_tag LOCUS_03810 865 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 1144 878 gene locus_tag LOCUS_03820 1144 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 2849 1965 gene locus_tag LOCUS_03830 2849 1965 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340302.1 protein_id gnl|my_center|LOCUS_03830 4372 2846 gene locus_tag LOCUS_03840 4372 2846 CDS product alternate F1F0 ATPase, F1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022405.1 protein_id gnl|my_center|LOCUS_03840 5121 4369 gene locus_tag LOCUS_03850 5121 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 5403 5125 gene locus_tag LOCUS_03860 5403 5125 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328511.1 protein_id gnl|my_center|LOCUS_03860 6384 6088 gene locus_tag LOCUS_03870 6384 6088 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022409.1 protein_id gnl|my_center|LOCUS_03870 6700 6374 gene locus_tag LOCUS_03880 6700 6374 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120167.1 protein_id gnl|my_center|LOCUS_03880 7079 6693 gene locus_tag LOCUS_03890 7079 6693 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120166.1 protein_id gnl|my_center|LOCUS_03890 8487 7096 gene locus_tag LOCUS_03900 gene atpD 8487 7096 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065404.1 protein_id gnl|my_center|LOCUS_03900 8948 8484 gene locus_tag LOCUS_03910 8948 8484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 10274 9012 gene locus_tag LOCUS_03920 10274 9012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 10569 12173 gene locus_tag LOCUS_03930 10569 12173 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546491.1 protein_id gnl|my_center|LOCUS_03930 12790 12377 gene locus_tag LOCUS_03940 12790 12377 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774976.1 protein_id gnl|my_center|LOCUS_03940 13384 12791 gene locus_tag LOCUS_03950 13384 12791 CDS product HNH/ENDO VII family nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260285.1 protein_id gnl|my_center|LOCUS_03950 <15834 13378 gene locus_tag LOCUS_03960 <15834 13378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002263812.1:DUF87 domain-containing protein >Feature sequence023 487 1524 gene locus_tag LOCUS_03970 gene hflK 487 1524 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_03970 1514 2458 gene locus_tag LOCUS_03980 gene hflC 1514 2458 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_03980 3039 3575 gene locus_tag LOCUS_03990 3039 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 3706 3993 gene locus_tag LOCUS_04000 3706 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 4247 4534 gene locus_tag LOCUS_04010 gene groES 4247 4534 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_04010 4574 6217 gene locus_tag LOCUS_04020 gene groL 4574 6217 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_04020 6371 6703 gene locus_tag LOCUS_04030 6371 6703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 6700 8370 gene locus_tag LOCUS_04040 6700 8370 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943734.1 protein_id gnl|my_center|LOCUS_04040 8499 10640 gene locus_tag LOCUS_04050 8499 10640 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_04050 11060 10764 gene locus_tag LOCUS_04060 11060 10764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 11238 11050 gene locus_tag LOCUS_04070 11238 11050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 12209 11250 gene locus_tag LOCUS_04080 12209 11250 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206433.1 protein_id gnl|my_center|LOCUS_04080 12622 12224 gene locus_tag LOCUS_04090 12622 12224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 13035 15317 gene locus_tag LOCUS_04100 13035 15317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 >Feature sequence024 1241 1053 gene locus_tag LOCUS_04110 1241 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 2106 1672 gene locus_tag LOCUS_04120 2106 1672 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583101.1 protein_id gnl|my_center|LOCUS_04120 2265 4376 gene locus_tag LOCUS_04130 2265 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 7714 4385 gene locus_tag LOCUS_04140 gene recC 7714 4385 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942180.1 protein_id gnl|my_center|LOCUS_04140 8367 7714 gene locus_tag LOCUS_04150 gene elbB 8367 7714 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940751.1 protein_id gnl|my_center|LOCUS_04150 9618 8392 gene locus_tag LOCUS_04160 9618 8392 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941766.1 protein_id gnl|my_center|LOCUS_04160 11090 9660 gene locus_tag LOCUS_04170 11090 9660 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_04170 12371 11094 gene locus_tag LOCUS_04180 12371 11094 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_04180 13300 12365 gene locus_tag LOCUS_04190 13300 12365 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_04190 13998 13324 gene locus_tag LOCUS_04200 gene lepB 13998 13324 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941922.1 protein_id gnl|my_center|LOCUS_04200 14415 14227 gene locus_tag LOCUS_04210 14415 14227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 14953 14435 gene locus_tag LOCUS_04220 14953 14435 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546233.1 protein_id gnl|my_center|LOCUS_04220 >Feature sequence025 3163 2117 gene locus_tag LOCUS_04230 3163 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 5350 3440 gene locus_tag LOCUS_04240 gene selB 5350 3440 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937806.1 protein_id gnl|my_center|LOCUS_04240 5531 5364 gene locus_tag LOCUS_04250 5531 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 11608 5720 gene locus_tag LOCUS_04260 11608 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 11898 12176 gene locus_tag LOCUS_04270 11898 12176 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888120.1 protein_id gnl|my_center|LOCUS_04270 12173 12496 gene locus_tag LOCUS_04280 12173 12496 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244108.1 protein_id gnl|my_center|LOCUS_04280 12601 12789 gene locus_tag LOCUS_04290 12601 12789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 12849 13688 gene locus_tag LOCUS_04300 gene cas6 12849 13688 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023579.1 protein_id gnl|my_center|LOCUS_04300 13953 15086 gene locus_tag LOCUS_04310 13953 15086 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 protein_id gnl|my_center|LOCUS_04310 >Feature sequence026 1179 37 gene locus_tag LOCUS_04320 1179 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 2963 1227 gene locus_tag LOCUS_04330 2963 1227 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_04330 3567 4175 gene locus_tag LOCUS_04340 3567 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 5258 4272 gene locus_tag LOCUS_04350 gene trpS 5258 4272 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942477.1 protein_id gnl|my_center|LOCUS_04350 5993 5331 gene locus_tag LOCUS_04360 5993 5331 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545727.1 protein_id gnl|my_center|LOCUS_04360 8646 5983 gene locus_tag LOCUS_04370 8646 5983 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942226.1 protein_id gnl|my_center|LOCUS_04370 8851 9570 gene locus_tag LOCUS_04380 gene purN 8851 9570 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_04380 9781 11688 gene locus_tag LOCUS_04390 gene thrS 9781 11688 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_04390 11774 12322 gene locus_tag LOCUS_04400 11774 12322 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877617.1 protein_id gnl|my_center|LOCUS_04400 12553 13482 gene locus_tag LOCUS_04410 12553 13482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 14194 13625 gene locus_tag LOCUS_04420 14194 13625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 14487 14221 gene locus_tag LOCUS_04430 14487 14221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 14953 14738 gene locus_tag LOCUS_04440 14953 14738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 >Feature sequence027 147 335 gene locus_tag LOCUS_04450 147 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 320 673 gene locus_tag LOCUS_04460 320 673 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263487.1 protein_id gnl|my_center|LOCUS_04460 670 813 gene locus_tag LOCUS_04470 670 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 1233 907 gene locus_tag LOCUS_04480 1233 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 1895 1230 gene locus_tag LOCUS_04490 1895 1230 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792195.1 protein_id gnl|my_center|LOCUS_04490 2840 1914 gene locus_tag LOCUS_04500 gene trxB 2840 1914 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_04500 3175 2849 gene locus_tag LOCUS_04510 gene trxA 3175 2849 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939125.1 protein_id gnl|my_center|LOCUS_04510 4051 3299 gene locus_tag LOCUS_04520 4051 3299 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031778770.1 protein_id gnl|my_center|LOCUS_04520 4597 4283 gene locus_tag LOCUS_04530 4597 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 4742 4545 gene locus_tag LOCUS_04540 4742 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 5075 4857 gene locus_tag LOCUS_04550 5075 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 5619 5068 gene locus_tag LOCUS_04560 5619 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 6208 5675 gene locus_tag LOCUS_04570 gene cobU 6208 5675 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932625.1 protein_id gnl|my_center|LOCUS_04570 7722 6205 gene locus_tag LOCUS_04580 7722 6205 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932618.1 protein_id gnl|my_center|LOCUS_04580 8242 7712 gene locus_tag LOCUS_04590 gene cobO 8242 7712 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948638.1 protein_id gnl|my_center|LOCUS_04590 9134 8244 gene locus_tag LOCUS_04600 gene cobJ 9134 8244 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461546.1 protein_id gnl|my_center|LOCUS_04600 10129 9029 gene locus_tag LOCUS_04610 gene cbiG 10129 9029 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437735.1 protein_id gnl|my_center|LOCUS_04610 10575 10916 gene locus_tag LOCUS_04620 gene rnpA 10575 10916 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944077.1 protein_id gnl|my_center|LOCUS_04620 11364 13034 gene locus_tag LOCUS_04630 gene yidC 11364 13034 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_04630 13051 13599 gene locus_tag LOCUS_04640 13051 13599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 13779 13934 gene locus_tag LOCUS_04650 13779 13934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 >Feature sequence028 1872 64 gene locus_tag LOCUS_04660 1872 64 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839181.1 protein_id gnl|my_center|LOCUS_04660 2212 1886 gene locus_tag LOCUS_04670 2212 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 3970 2600 gene locus_tag LOCUS_04680 3970 2600 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_04680 4197 5627 gene locus_tag LOCUS_04690 4197 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 5798 6469 gene locus_tag LOCUS_04700 5798 6469 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940238.1 protein_id gnl|my_center|LOCUS_04700 6466 7236 gene locus_tag LOCUS_04710 gene pssA 6466 7236 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_04710 7379 8458 gene locus_tag LOCUS_04720 7379 8458 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_04720 8451 9473 gene locus_tag LOCUS_04730 8451 9473 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_04730 9487 9954 gene locus_tag LOCUS_04740 gene greA 9487 9954 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545525.1 protein_id gnl|my_center|LOCUS_04740 10148 10366 gene locus_tag LOCUS_04750 10148 10366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 10350 11084 gene locus_tag LOCUS_04760 10350 11084 CDS product tRNA 2-thiocytidine biosynthesis TtcA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940499.1 protein_id gnl|my_center|LOCUS_04760 11081 11851 gene locus_tag LOCUS_04770 gene folE2 11081 11851 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_04770 11883 12521 gene locus_tag LOCUS_04780 11883 12521 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262660.1 protein_id gnl|my_center|LOCUS_04780 12669 14153 gene locus_tag LOCUS_04790 gene gatB 12669 14153 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_04790 >Feature sequence029 1337 144 gene locus_tag LOCUS_04800 1337 144 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940827.1 protein_id gnl|my_center|LOCUS_04800 2218 1340 gene locus_tag LOCUS_04810 gene argB 2218 1340 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551508.1 protein_id gnl|my_center|LOCUS_04810 3629 2247 gene locus_tag LOCUS_04820 gene hslU 3629 2247 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_04820 4172 3642 gene locus_tag LOCUS_04830 gene hslV 4172 3642 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946377.1 protein_id gnl|my_center|LOCUS_04830 5094 4186 gene locus_tag LOCUS_04840 gene xerC 5094 4186 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_04840 5677 5108 gene locus_tag LOCUS_04850 5677 5108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 5955 5761 gene locus_tag LOCUS_04860 5955 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 6643 5957 gene locus_tag LOCUS_04870 6643 5957 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_04870 6781 7884 gene locus_tag LOCUS_04880 gene mtnA 6781 7884 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970692.1 protein_id gnl|my_center|LOCUS_04880 7953 8426 gene locus_tag LOCUS_04890 7953 8426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 8455 9807 gene locus_tag LOCUS_04900 8455 9807 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545411.1 protein_id gnl|my_center|LOCUS_04900 11168 10035 gene locus_tag LOCUS_04910 11168 10035 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931023.1 protein_id gnl|my_center|LOCUS_04910 12298 11282 gene locus_tag LOCUS_04920 12298 11282 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_04920 14129 12321 gene locus_tag LOCUS_04930 14129 12321 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119127.1 protein_id gnl|my_center|LOCUS_04930 >Feature sequence030 726 256 gene locus_tag LOCUS_04940 gene rpsG 726 256 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005626581.1 protein_id gnl|my_center|LOCUS_04940 1153 782 gene locus_tag LOCUS_04950 gene rpsL 1153 782 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057584.1 protein_id gnl|my_center|LOCUS_04950 5705 1314 gene locus_tag LOCUS_04960 5705 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 9930 5806 gene locus_tag LOCUS_04970 gene rpoB 9930 5806 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943493.1 protein_id gnl|my_center|LOCUS_04970 10557 10171 gene locus_tag LOCUS_04980 gene rplL 10557 10171 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943494.1 protein_id gnl|my_center|LOCUS_04980 11163 10639 gene locus_tag LOCUS_04990 gene rplJ 11163 10639 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943495.1 protein_id gnl|my_center|LOCUS_04990 12339 11635 gene locus_tag LOCUS_05000 gene rplA 12339 11635 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_05000 12788 12363 gene locus_tag LOCUS_05010 gene rplK 12788 12363 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081512.1 protein_id gnl|my_center|LOCUS_05010 13334 12804 gene locus_tag LOCUS_05020 gene nusG 13334 12804 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940183.1 protein_id gnl|my_center|LOCUS_05020 13738 13352 gene locus_tag LOCUS_05030 13738 13352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 13886 13811 gene locus_tag LOCUS_t00090 13886 13811 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence031 375 112 gene locus_tag LOCUS_05040 375 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 626 492 gene locus_tag LOCUS_05050 626 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 1846 2517 gene locus_tag LOCUS_05060 1846 2517 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256674.1 protein_id gnl|my_center|LOCUS_05060 2863 9822 gene locus_tag LOCUS_05070 2863 9822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 10190 10324 gene locus_tag LOCUS_05080 10190 10324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 11592 13661 gene locus_tag LOCUS_05090 gene fusA 11592 13661 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_05090 >Feature sequence032 168 647 gene locus_tag LOCUS_05100 gene tadA 168 647 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810985.1 protein_id gnl|my_center|LOCUS_05100 707 1999 gene locus_tag LOCUS_05110 707 1999 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048438.1 protein_id gnl|my_center|LOCUS_05110 2256 3695 gene locus_tag LOCUS_05120 2256 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 4955 3786 gene locus_tag LOCUS_05130 4955 3786 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811492.1 protein_id gnl|my_center|LOCUS_05130 5076 5891 gene locus_tag LOCUS_05140 5076 5891 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_05140 6683 6039 gene locus_tag LOCUS_05150 6683 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 8418 6904 gene locus_tag LOCUS_05160 gene eno 8418 6904 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727923.1 protein_id gnl|my_center|LOCUS_05160 9787 8411 gene locus_tag LOCUS_05170 9787 8411 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256515.1 protein_id gnl|my_center|LOCUS_05170 10342 9818 gene locus_tag LOCUS_05180 10342 9818 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942547.1 protein_id gnl|my_center|LOCUS_05180 11639 10329 gene locus_tag LOCUS_05190 11639 10329 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942548.1 protein_id gnl|my_center|LOCUS_05190 13446 11650 gene locus_tag LOCUS_05200 gene lepA 13446 11650 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957093.1 protein_id gnl|my_center|LOCUS_05200 >Feature sequence033 218 664 gene locus_tag LOCUS_05210 gene mraZ 218 664 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480800.1 protein_id gnl|my_center|LOCUS_05210 636 1607 gene locus_tag LOCUS_05220 gene rsmH 636 1607 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861627.1 protein_id gnl|my_center|LOCUS_05220 1983 3716 gene locus_tag LOCUS_05230 1983 3716 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_05230 3676 5265 gene locus_tag LOCUS_05240 3676 5265 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943699.1 protein_id gnl|my_center|LOCUS_05240 5259 6677 gene locus_tag LOCUS_05250 5259 6677 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_05250 6824 7753 gene locus_tag LOCUS_05260 gene mraY 6824 7753 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_05260 7760 9058 gene locus_tag LOCUS_05270 gene murD 7760 9058 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_05270 9092 10207 gene locus_tag LOCUS_05280 gene ftsW 9092 10207 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_05280 10211 11353 gene locus_tag LOCUS_05290 gene murG 10211 11353 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_05290 11343 12710 gene locus_tag LOCUS_05300 gene murC 11343 12710 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_05300 >Feature sequence034 482 3607 gene locus_tag LOCUS_05310 482 3607 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962208.1 protein_id gnl|my_center|LOCUS_05310 3608 4279 gene locus_tag LOCUS_05320 3608 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 4511 7312 gene locus_tag LOCUS_05330 gene ileS 4511 7312 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_05330 7309 7800 gene locus_tag LOCUS_05340 gene lspA 7309 7800 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_05340 7833 8603 gene locus_tag LOCUS_05350 gene lgt 7833 8603 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_05350 8594 10060 gene locus_tag LOCUS_05360 8594 10060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 10088 11125 gene locus_tag LOCUS_05370 gene argC 10088 11125 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_05370 11301 12212 gene locus_tag LOCUS_05380 gene folD 11301 12212 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941526.1 protein_id gnl|my_center|LOCUS_05380 12319 13248 gene locus_tag LOCUS_05390 12319 13248 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791421.1 protein_id gnl|my_center|LOCUS_05390 >Feature sequence035 <1 1472 gene locus_tag LOCUS_05400 <1 1472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942671.1:type IV pilus secretin PilQ 1557 1874 gene locus_tag LOCUS_05410 1557 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 2342 2722 gene locus_tag LOCUS_05420 2342 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 2739 5753 gene locus_tag LOCUS_05430 2739 5753 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_05430 5862 6794 gene locus_tag LOCUS_05440 5862 6794 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258713.1 protein_id gnl|my_center|LOCUS_05440 6854 7696 gene locus_tag LOCUS_05450 gene panB 6854 7696 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356105.1 protein_id gnl|my_center|LOCUS_05450 7693 8799 gene locus_tag LOCUS_05460 7693 8799 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941750.1 protein_id gnl|my_center|LOCUS_05460 9126 8926 gene locus_tag LOCUS_05470 9126 8926 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941244.1 protein_id gnl|my_center|LOCUS_05470 10097 9339 gene locus_tag LOCUS_05480 10097 9339 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_05480 10479 10117 gene locus_tag LOCUS_05490 gene dut 10479 10117 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942240.1 protein_id gnl|my_center|LOCUS_05490 12649 10580 gene locus_tag LOCUS_05500 gene pnp 12649 10580 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_05500 12977 12708 gene locus_tag LOCUS_05510 gene rpsO 12977 12708 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_05510 >Feature sequence036 <1 521 gene locus_tag LOCUS_05520 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942896.1:lipopolysaccharide heptosyltransferase II 514 1998 gene locus_tag LOCUS_05530 514 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 2018 2218 gene locus_tag LOCUS_05540 2018 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 2971 3447 gene locus_tag LOCUS_05550 2971 3447 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061729.1 protein_id gnl|my_center|LOCUS_05550 3465 4511 gene locus_tag LOCUS_05560 3465 4511 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_05560 5558 4608 gene locus_tag LOCUS_05570 5558 4608 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_05570 6322 5555 gene locus_tag LOCUS_05580 gene surE 6322 5555 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_05580 7254 6319 gene locus_tag LOCUS_05590 7254 6319 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941035.1 protein_id gnl|my_center|LOCUS_05590 7472 8512 gene locus_tag LOCUS_05600 gene mltG 7472 8512 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_05600 8615 8691 gene locus_tag LOCUS_t00100 8615 8691 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9634 8789 gene locus_tag LOCUS_05610 gene larE 9634 8789 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_05610 10501 9635 gene locus_tag LOCUS_05620 10501 9635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 12756 10501 gene locus_tag LOCUS_05630 12756 10501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 >Feature sequence037 29 1156 gene locus_tag LOCUS_05640 gene wecB 29 1156 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817161.1 protein_id gnl|my_center|LOCUS_05640 1182 2414 gene locus_tag LOCUS_05650 1182 2414 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776619.1 protein_id gnl|my_center|LOCUS_05650 2507 3478 gene locus_tag LOCUS_05660 2507 3478 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433078.1 protein_id gnl|my_center|LOCUS_05660 3482 4462 gene locus_tag LOCUS_05670 3482 4462 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816723.1 protein_id gnl|my_center|LOCUS_05670 5506 4730 gene locus_tag LOCUS_05680 5506 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 5970 8585 gene locus_tag LOCUS_05690 5970 8585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 8588 9619 gene locus_tag LOCUS_05700 8588 9619 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118763.1 protein_id gnl|my_center|LOCUS_05700 10540 9587 gene locus_tag LOCUS_05710 10540 9587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 12438 10540 gene locus_tag LOCUS_05720 gene asnB 12438 10540 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392336.1 protein_id gnl|my_center|LOCUS_05720 <12941 12335 gene locus_tag LOCUS_05730 <12941 12335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223294610.1:YkgJ family cysteine cluster protein >Feature sequence038 1741 1094 gene locus_tag LOCUS_05740 1741 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 2770 1826 gene locus_tag LOCUS_05750 2770 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 4346 2775 gene locus_tag LOCUS_05760 4346 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 5439 4660 gene locus_tag LOCUS_05770 5439 4660 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048188.1 protein_id gnl|my_center|LOCUS_05770 6294 5485 gene locus_tag LOCUS_05780 6294 5485 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943761.1 protein_id gnl|my_center|LOCUS_05780 9076 6383 gene locus_tag LOCUS_05790 gene polA 9076 6383 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_05790 9819 9118 gene locus_tag LOCUS_05800 gene tsaB 9819 9118 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942558.1 protein_id gnl|my_center|LOCUS_05800 12456 9970 gene locus_tag LOCUS_05810 gene lon 12456 9970 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545466.1 protein_id gnl|my_center|LOCUS_05810 >Feature sequence039 309 40 gene locus_tag LOCUS_05820 309 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 869 429 gene locus_tag LOCUS_05830 869 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 4119 1009 gene locus_tag LOCUS_05840 4119 1009 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_05840 5075 4326 gene locus_tag LOCUS_05850 5075 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 5422 7128 gene locus_tag LOCUS_05860 5422 7128 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_05860 7265 7666 gene locus_tag LOCUS_05870 7265 7666 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846721.1 protein_id gnl|my_center|LOCUS_05870 7663 8652 gene locus_tag LOCUS_05880 gene meaB 7663 8652 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942224.1 protein_id gnl|my_center|LOCUS_05880 >Feature sequence040 2127 274 gene locus_tag LOCUS_05890 gene typA 2127 274 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939506.1 protein_id gnl|my_center|LOCUS_05890 2336 2163 gene locus_tag LOCUS_05900 2336 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 2810 3499 gene locus_tag LOCUS_05910 2810 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 4243 3536 gene locus_tag LOCUS_05920 4243 3536 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943589.1 protein_id gnl|my_center|LOCUS_05920 4542 4261 gene locus_tag LOCUS_05930 4542 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 4884 4651 gene locus_tag LOCUS_05940 4884 4651 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065850.1 protein_id gnl|my_center|LOCUS_05940 6011 4941 gene locus_tag LOCUS_05950 6011 4941 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331459.1 protein_id gnl|my_center|LOCUS_05950 6467 6123 gene locus_tag LOCUS_05960 6467 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 7393 6563 gene locus_tag LOCUS_05970 7393 6563 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439262.1 protein_id gnl|my_center|LOCUS_05970 7539 7784 gene locus_tag LOCUS_05980 7539 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 8211 7696 gene locus_tag LOCUS_05990 8211 7696 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807613.1 protein_id gnl|my_center|LOCUS_05990 8479 8198 gene locus_tag LOCUS_06000 8479 8198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 9271 8843 gene locus_tag LOCUS_06010 9271 8843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 9501 9268 gene locus_tag LOCUS_06020 9501 9268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 10295 9729 gene locus_tag LOCUS_06030 10295 9729 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546058.1 protein_id gnl|my_center|LOCUS_06030 11133 10279 gene locus_tag LOCUS_06040 gene prfB 11133 10279 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205591.1 protein_id gnl|my_center|LOCUS_06040 <12456 11362 gene locus_tag LOCUS_06050 <12456 11362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939146.1:apolipoprotein N-acyltransferase >Feature sequence041 1511 363 gene locus_tag LOCUS_06060 1511 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 2425 1622 gene locus_tag LOCUS_06070 gene cbiR 2425 1622 CDS product cobamide remodeling phosphodiesterase CbiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932624.1 protein_id gnl|my_center|LOCUS_06070 3405 2452 gene locus_tag LOCUS_06080 gene cbiB 3405 2452 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816688.1 protein_id gnl|my_center|LOCUS_06080 4490 3408 gene locus_tag LOCUS_06090 4490 3408 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861966.1 protein_id gnl|my_center|LOCUS_06090 6239 4563 gene locus_tag LOCUS_06100 gene msbA 6239 4563 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_06100 7116 6490 gene locus_tag LOCUS_06110 7116 6490 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392265.1 protein_id gnl|my_center|LOCUS_06110 8443 7286 gene locus_tag LOCUS_06120 gene lpxB 8443 7286 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_06120 9395 8436 gene locus_tag LOCUS_06130 9395 8436 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_06130 10198 9392 gene locus_tag LOCUS_06140 gene lpxI 10198 9392 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_06140 10968 10198 gene locus_tag LOCUS_06150 gene lpxA 10968 10198 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_06150 11411 10965 gene locus_tag LOCUS_06160 gene fabZ 11411 10965 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942905.1 protein_id gnl|my_center|LOCUS_06160 >Feature sequence042 <1 1038 gene locus_tag LOCUS_06170 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545879.1:peptide chain release factor 1 1019 1906 gene locus_tag LOCUS_06180 gene prmC 1019 1906 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_06180 2129 3007 gene locus_tag LOCUS_06190 gene rpsB 2129 3007 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942566.1 protein_id gnl|my_center|LOCUS_06190 3053 3649 gene locus_tag LOCUS_06200 gene tsf 3053 3649 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392547.1 protein_id gnl|my_center|LOCUS_06200 3710 4378 gene locus_tag LOCUS_06210 gene pyrH 3710 4378 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_06210 4513 5070 gene locus_tag LOCUS_06220 gene frr 4513 5070 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_06220 5060 5830 gene locus_tag LOCUS_06230 5060 5830 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_06230 5841 6656 gene locus_tag LOCUS_06240 5841 6656 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_06240 6663 7817 gene locus_tag LOCUS_06250 6663 7817 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_06250 7814 8887 gene locus_tag LOCUS_06260 gene rseP 7814 8887 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942559.1 protein_id gnl|my_center|LOCUS_06260 >Feature sequence043 478 293 gene locus_tag LOCUS_06270 478 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 849 2474 gene locus_tag LOCUS_06280 849 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 2519 3322 gene locus_tag LOCUS_06290 2519 3322 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101477.1 protein_id gnl|my_center|LOCUS_06290 3531 4643 gene locus_tag LOCUS_06300 3531 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 4824 6038 gene locus_tag LOCUS_06310 4824 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 6413 6156 gene locus_tag LOCUS_06320 6413 6156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 6627 7100 gene locus_tag LOCUS_06330 6627 7100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 7228 8052 gene locus_tag LOCUS_06340 7228 8052 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932352.1 protein_id gnl|my_center|LOCUS_06340 8091 8930 gene locus_tag LOCUS_06350 gene modA 8091 8930 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932353.1 protein_id gnl|my_center|LOCUS_06350 8995 10182 gene locus_tag LOCUS_06360 8995 10182 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455027.1 protein_id gnl|my_center|LOCUS_06360 10204 10827 gene locus_tag LOCUS_06370 10204 10827 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_06370 >Feature sequence044 <1 2804 gene locus_tag LOCUS_06380 <1 2804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942050.1:DNA polymerase III subunit alpha 2797 4164 gene locus_tag LOCUS_06390 2797 4164 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278239.1 protein_id gnl|my_center|LOCUS_06390 4174 5322 gene locus_tag LOCUS_06400 4174 5322 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_06400 6082 5312 gene locus_tag LOCUS_06410 6082 5312 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351753.1 protein_id gnl|my_center|LOCUS_06410 6267 6854 gene locus_tag LOCUS_06420 gene hisB 6267 6854 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_06420 6968 7657 gene locus_tag LOCUS_06430 6968 7657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 7654 8385 gene locus_tag LOCUS_06440 gene hisA 7654 8385 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943717.1 protein_id gnl|my_center|LOCUS_06440 8495 10327 gene locus_tag LOCUS_06450 8495 10327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 10586 11482 gene locus_tag LOCUS_06460 10586 11482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 >Feature sequence045 952 428 gene locus_tag LOCUS_06470 952 428 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546650.1 protein_id gnl|my_center|LOCUS_06470 3249 958 gene locus_tag LOCUS_06480 gene lptD 3249 958 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792614.1 protein_id gnl|my_center|LOCUS_06480 3347 3793 gene locus_tag LOCUS_06490 3347 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 4421 3795 gene locus_tag LOCUS_06500 4421 3795 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_06500 4845 4411 gene locus_tag LOCUS_06510 gene nusB 4845 4411 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_06510 5321 4848 gene locus_tag LOCUS_06520 gene ribE 5321 4848 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942334.1 protein_id gnl|my_center|LOCUS_06520 6550 5333 gene locus_tag LOCUS_06530 6550 5333 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_06530 7267 6608 gene locus_tag LOCUS_06540 7267 6608 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459819.1 protein_id gnl|my_center|LOCUS_06540 8355 7252 gene locus_tag LOCUS_06550 gene ribD 8355 7252 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_06550 8831 8370 gene locus_tag LOCUS_06560 gene nrdR 8831 8370 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_06560 9335 8850 gene locus_tag LOCUS_06570 9335 8850 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_06570 10572 9328 gene locus_tag LOCUS_06580 10572 9328 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_06580 11074 10628 gene locus_tag LOCUS_06590 gene rpiB 11074 10628 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_06590 >Feature sequence046 2456 585 gene locus_tag LOCUS_06600 gene mrdA 2456 585 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_06600 3981 3130 gene locus_tag LOCUS_06610 gene mreC 3981 3130 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_06610 5028 3985 gene locus_tag LOCUS_06620 5028 3985 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_06620 6222 5131 gene locus_tag LOCUS_06630 6222 5131 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927203.1 protein_id gnl|my_center|LOCUS_06630 7130 6219 gene locus_tag LOCUS_06640 7130 6219 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_06640 8087 7146 gene locus_tag LOCUS_06650 8087 7146 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192895.1 protein_id gnl|my_center|LOCUS_06650 8570 8115 gene locus_tag LOCUS_06660 8570 8115 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671223.1 protein_id gnl|my_center|LOCUS_06660 9143 8823 gene locus_tag LOCUS_06670 9143 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 9334 9131 gene locus_tag LOCUS_06680 9334 9131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 9720 10580 gene locus_tag LOCUS_06690 9720 10580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 10577 10918 gene locus_tag LOCUS_06700 10577 10918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 >Feature sequence047 1051 1188 gene locus_tag LOCUS_06710 1051 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 1181 1357 gene locus_tag LOCUS_06720 1181 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 2036 1815 gene locus_tag LOCUS_06730 2036 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 2589 2819 gene locus_tag LOCUS_06740 2589 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 2820 3254 gene locus_tag LOCUS_06750 2820 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 3431 3817 gene locus_tag LOCUS_06760 3431 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06760 4064 4705 gene locus_tag LOCUS_06770 4064 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06770 4778 4954 gene locus_tag LOCUS_06780 4778 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 4893 5189 gene locus_tag LOCUS_06790 4893 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 6372 5464 gene locus_tag LOCUS_06800 6372 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 6630 6385 gene locus_tag LOCUS_06810 6630 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 7866 6802 gene locus_tag LOCUS_06820 7866 6802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 8271 7954 gene locus_tag LOCUS_06830 8271 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 8855 9448 gene locus_tag LOCUS_06840 8855 9448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 9644 10762 gene locus_tag LOCUS_06850 9644 10762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 >Feature sequence048 329 1489 gene locus_tag LOCUS_06860 329 1489 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932105.1 protein_id gnl|my_center|LOCUS_06860 1632 1868 gene locus_tag LOCUS_06870 1632 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 1855 2229 gene locus_tag LOCUS_06880 1855 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 2223 3887 gene locus_tag LOCUS_06890 2223 3887 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932106.1 protein_id gnl|my_center|LOCUS_06890 4032 4805 gene locus_tag LOCUS_06900 4032 4805 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029797603.1 protein_id gnl|my_center|LOCUS_06900 4802 6256 gene locus_tag LOCUS_06910 4802 6256 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 protein_id gnl|my_center|LOCUS_06910 6281 6892 gene locus_tag LOCUS_06920 6281 6892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 6892 7308 gene locus_tag LOCUS_06930 6892 7308 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_06930 7308 7979 gene locus_tag LOCUS_06940 7308 7979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 7986 9308 gene locus_tag LOCUS_06950 7986 9308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 9400 9828 gene locus_tag LOCUS_06960 9400 9828 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404578.1 protein_id gnl|my_center|LOCUS_06960 >Feature sequence049 <1 1446 gene locus_tag LOCUS_06970 <1 1446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787920.1:VWA domain-containing protein 1836 2642 gene locus_tag LOCUS_06980 1836 2642 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393323.1 protein_id gnl|my_center|LOCUS_06980 2626 3756 gene locus_tag LOCUS_06990 2626 3756 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311608.1 protein_id gnl|my_center|LOCUS_06990 3854 4288 gene locus_tag LOCUS_07000 gene rplM 3854 4288 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943505.1 protein_id gnl|my_center|LOCUS_07000 4374 4769 gene locus_tag LOCUS_07010 gene rpsI 4374 4769 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943504.1 protein_id gnl|my_center|LOCUS_07010 5667 4855 gene locus_tag LOCUS_07020 5667 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 5751 6404 gene locus_tag LOCUS_07030 5751 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 7677 6397 gene locus_tag LOCUS_07040 7677 6397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 8729 7692 gene locus_tag LOCUS_07050 8729 7692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 10424 8745 gene locus_tag LOCUS_07060 10424 8745 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963794.1 protein_id gnl|my_center|LOCUS_07060 >Feature sequence050 1893 925 gene locus_tag LOCUS_07070 gene fmt 1893 925 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_07070 2434 1910 gene locus_tag LOCUS_07080 gene def 2434 1910 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528469.1 protein_id gnl|my_center|LOCUS_07080 3980 2454 gene locus_tag LOCUS_07090 3980 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 4105 4992 gene locus_tag LOCUS_07100 gene map 4105 4992 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 protein_id gnl|my_center|LOCUS_07100 5535 5191 gene locus_tag LOCUS_07110 5535 5191 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829891.1 protein_id gnl|my_center|LOCUS_07110 5773 5525 gene locus_tag LOCUS_07120 5773 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 5960 6871 gene locus_tag LOCUS_07130 5960 6871 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941197.1 protein_id gnl|my_center|LOCUS_07130 8351 6819 gene locus_tag LOCUS_07140 8351 6819 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852245.1 protein_id gnl|my_center|LOCUS_07140 9494 9273 gene locus_tag LOCUS_07150 9494 9273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 10052 9558 gene locus_tag LOCUS_07160 10052 9558 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545398.1 protein_id gnl|my_center|LOCUS_07160 10619 10104 gene locus_tag LOCUS_07170 gene tpx 10619 10104 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941020.1 protein_id gnl|my_center|LOCUS_07170 >Feature sequence051 1426 272 gene locus_tag LOCUS_07180 1426 272 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_07180 3819 1426 gene locus_tag LOCUS_07190 3819 1426 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 protein_id gnl|my_center|LOCUS_07190 4098 5153 gene locus_tag LOCUS_07200 4098 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 5159 6526 gene locus_tag LOCUS_07210 gene prsR 5159 6526 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942585.1 protein_id gnl|my_center|LOCUS_07210 7013 8275 gene locus_tag LOCUS_07220 7013 8275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545304.1 protein_id gnl|my_center|LOCUS_07220 8329 8589 gene locus_tag LOCUS_07230 8329 8589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 9016 10341 gene locus_tag LOCUS_07240 9016 10341 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937573.1 protein_id gnl|my_center|LOCUS_07240 >Feature sequence052 153 818 gene locus_tag LOCUS_07250 153 818 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629591.1 protein_id gnl|my_center|LOCUS_07250 897 1436 gene locus_tag LOCUS_07260 897 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 1604 4054 gene locus_tag LOCUS_07270 1604 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 3999 4223 gene locus_tag LOCUS_07280 3999 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 4231 4371 gene locus_tag LOCUS_07290 4231 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 4709 5071 gene locus_tag LOCUS_07300 4709 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938073.1 protein_id gnl|my_center|LOCUS_07300 5104 7251 gene locus_tag LOCUS_07310 5104 7251 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_07310 7373 7286 gene locus_tag LOCUS_t00110 7373 7286 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8100 7435 gene locus_tag LOCUS_07320 8100 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878811.1 protein_id gnl|my_center|LOCUS_07320 8158 8757 gene locus_tag LOCUS_07330 8158 8757 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_07330 8754 9455 gene locus_tag LOCUS_07340 8754 9455 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546351.1 protein_id gnl|my_center|LOCUS_07340 9524 9982 gene locus_tag LOCUS_07350 9524 9982 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_07350 10372 10013 gene locus_tag LOCUS_07360 10372 10013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 >Feature sequence053 1420 1944 gene locus_tag LOCUS_07370 1420 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 1962 2810 gene locus_tag LOCUS_07380 1962 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 2829 3704 gene locus_tag LOCUS_07390 2829 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 3723 4517 gene locus_tag LOCUS_07400 3723 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 4908 5432 gene locus_tag LOCUS_07410 4908 5432 CDS product RsbRD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810499.1 protein_id gnl|my_center|LOCUS_07410 5595 6626 gene locus_tag LOCUS_07420 gene dsrM 5595 6626 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810497.1 protein_id gnl|my_center|LOCUS_07420 6623 8251 gene locus_tag LOCUS_07430 6623 8251 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_07430 8244 8639 gene locus_tag LOCUS_07440 gene dsrJ 8244 8639 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393111.1 protein_id gnl|my_center|LOCUS_07440 8639 9427 gene locus_tag LOCUS_07450 8639 9427 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938583.1 protein_id gnl|my_center|LOCUS_07450 >Feature sequence054 1135 131 gene locus_tag LOCUS_07460 1135 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 1410 2858 gene locus_tag LOCUS_07470 gene xseA 1410 2858 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_07470 2839 3060 gene locus_tag LOCUS_07480 2839 3060 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942410.1 protein_id gnl|my_center|LOCUS_07480 3070 3975 gene locus_tag LOCUS_07490 3070 3975 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_07490 4164 6044 gene locus_tag LOCUS_07500 gene dxs 4164 6044 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_07500 6037 6807 gene locus_tag LOCUS_07510 6037 6807 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544951.1 protein_id gnl|my_center|LOCUS_07510 6823 7461 gene locus_tag LOCUS_07520 6823 7461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 7458 8339 gene locus_tag LOCUS_07530 7458 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 8344 9567 gene locus_tag LOCUS_07540 8344 9567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 >Feature sequence055 1624 437 gene locus_tag LOCUS_07550 gene argJ 1624 437 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942692.1 protein_id gnl|my_center|LOCUS_07550 2271 1711 gene locus_tag LOCUS_07560 gene efp 2271 1711 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942396.1 protein_id gnl|my_center|LOCUS_07560 2418 3947 gene locus_tag LOCUS_07570 gene guaA 2418 3947 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_07570 3960 4769 gene locus_tag LOCUS_07580 3960 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 5034 4831 gene locus_tag LOCUS_07590 5034 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 7575 5326 gene locus_tag LOCUS_07600 7575 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 8806 7583 gene locus_tag LOCUS_07610 8806 7583 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868912.1 protein_id gnl|my_center|LOCUS_07610 9190 8873 gene locus_tag LOCUS_07620 9190 8873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 9140 9943 gene locus_tag LOCUS_07630 9140 9943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07630 >Feature sequence056 221 1102 gene locus_tag LOCUS_07640 221 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 1149 2024 gene locus_tag LOCUS_07650 1149 2024 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425211.1 protein_id gnl|my_center|LOCUS_07650 2038 2838 gene locus_tag LOCUS_07660 2038 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 2879 3289 gene locus_tag LOCUS_07670 2879 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 3305 3979 gene locus_tag LOCUS_07680 3305 3979 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888112.1 protein_id gnl|my_center|LOCUS_07680 4059 4349 gene locus_tag LOCUS_07690 4059 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 5142 4354 gene locus_tag LOCUS_07700 5142 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 5889 5152 gene locus_tag LOCUS_07710 5889 5152 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943860.1 protein_id gnl|my_center|LOCUS_07710 6638 5901 gene locus_tag LOCUS_07720 6638 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 8152 8961 gene locus_tag LOCUS_07730 8152 8961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 9065 9889 gene locus_tag LOCUS_07740 9065 9889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07740 >Feature sequence057 225 1550 gene locus_tag LOCUS_07750 225 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 2786 3886 gene locus_tag LOCUS_07760 2786 3886 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039963.1 protein_id gnl|my_center|LOCUS_07760 3888 4871 gene locus_tag LOCUS_07770 3888 4871 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963967.1 protein_id gnl|my_center|LOCUS_07770 5208 6083 gene locus_tag LOCUS_07780 5208 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 6384 7628 gene locus_tag LOCUS_07790 6384 7628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 8186 9028 gene locus_tag LOCUS_07800 8186 9028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 9168 9704 gene locus_tag LOCUS_07810 gene wcaB 9168 9704 CDS product colanic acid biosynthesis acetyltransferase WcaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097879.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence058 3179 1188 gene locus_tag LOCUS_07820 gene oadA 3179 1188 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_07820 3580 3371 gene locus_tag LOCUS_07830 3580 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 5207 3654 gene locus_tag LOCUS_07840 5207 3654 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392670.1 protein_id gnl|my_center|LOCUS_07840 6205 5228 gene locus_tag LOCUS_07850 gene meaB 6205 5228 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390231.1 protein_id gnl|my_center|LOCUS_07850 8331 6202 gene locus_tag LOCUS_07860 gene scpA 8331 6202 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064244.1 protein_id gnl|my_center|LOCUS_07860 8928 8524 gene locus_tag LOCUS_07870 gene mce 8928 8524 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_07870 9433 8966 gene locus_tag LOCUS_07880 9433 8966 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073919.1 protein_id gnl|my_center|LOCUS_07880 <10160 9569 gene locus_tag LOCUS_07890 <10160 9569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941722.1:pyridoxal phosphate-dependent aminotransferase >Feature sequence059 188 979 gene locus_tag LOCUS_07900 188 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 1184 2092 gene locus_tag LOCUS_07910 1184 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 2097 2282 gene locus_tag LOCUS_07920 2097 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 2384 3112 gene locus_tag LOCUS_07930 2384 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 3236 5095 gene locus_tag LOCUS_07940 gene asnB 3236 5095 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703387.1 protein_id gnl|my_center|LOCUS_07940 5120 6109 gene locus_tag LOCUS_07950 5120 6109 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_07950 6102 7055 gene locus_tag LOCUS_07960 6102 7055 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125825.1 protein_id gnl|my_center|LOCUS_07960 8519 9088 gene locus_tag LOCUS_07970 8519 9088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 >Feature sequence060 <1 605 gene locus_tag LOCUS_07980 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681379.1:restriction endonuclease subunit S 704 1117 gene locus_tag LOCUS_07990 704 1117 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_07990 1114 4257 gene locus_tag LOCUS_08000 1114 4257 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041594898.1 protein_id gnl|my_center|LOCUS_08000 4260 4976 gene locus_tag LOCUS_08010 4260 4976 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_08010 5096 5524 gene locus_tag LOCUS_08020 5096 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 5618 6220 gene locus_tag LOCUS_08030 5618 6220 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065173.1 protein_id gnl|my_center|LOCUS_08030 6326 7279 gene locus_tag LOCUS_08040 6326 7279 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_08040 7377 7547 gene locus_tag LOCUS_08050 7377 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 7914 8285 gene locus_tag LOCUS_08060 7914 8285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 8361 8822 gene locus_tag LOCUS_08070 gene sixA 8361 8822 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878502.1 protein_id gnl|my_center|LOCUS_08070 8936 9229 gene locus_tag LOCUS_08080 8936 9229 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938514.1 protein_id gnl|my_center|LOCUS_08080 >Feature sequence061 <1 747 gene locus_tag LOCUS_08090 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065180.1:plasma-membrane proton-efflux P-type ATPase 826 2091 gene locus_tag LOCUS_08100 826 2091 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037226281.1 protein_id gnl|my_center|LOCUS_08100 2322 2684 gene locus_tag LOCUS_08110 2322 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 5653 3266 gene locus_tag LOCUS_08120 5653 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 6096 6515 gene locus_tag LOCUS_08130 6096 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 8413 7328 gene locus_tag LOCUS_08140 8413 7328 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107236.1 protein_id gnl|my_center|LOCUS_08140 9323 8505 gene locus_tag LOCUS_08150 9323 8505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 >Feature sequence062 1964 648 gene locus_tag LOCUS_08160 1964 648 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_08160 2469 3914 gene locus_tag LOCUS_08170 2469 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 5058 4063 gene locus_tag LOCUS_08180 5058 4063 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_08180 6005 5043 gene locus_tag LOCUS_08190 6005 5043 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_08190 7622 6009 gene locus_tag LOCUS_08200 7622 6009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 8716 7673 gene locus_tag LOCUS_08210 8716 7673 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759810.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence063 317 1063 gene locus_tag LOCUS_08220 317 1063 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948648.1 protein_id gnl|my_center|LOCUS_08220 1211 1525 gene locus_tag LOCUS_08230 gene rplU 1211 1525 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048023.1 protein_id gnl|my_center|LOCUS_08230 1530 1784 gene locus_tag LOCUS_08240 gene rpmA 1530 1784 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140826.1 protein_id gnl|my_center|LOCUS_08240 1781 2785 gene locus_tag LOCUS_08250 gene obgE 1781 2785 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943831.1 protein_id gnl|my_center|LOCUS_08250 2775 3596 gene locus_tag LOCUS_08260 2775 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 3583 3909 gene locus_tag LOCUS_08270 3583 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 3934 4284 gene locus_tag LOCUS_08280 3934 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 4879 4376 gene locus_tag LOCUS_08290 4879 4376 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926900.1 protein_id gnl|my_center|LOCUS_08290 6174 4879 gene locus_tag LOCUS_08300 6174 4879 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941850.1 protein_id gnl|my_center|LOCUS_08300 6461 7381 gene locus_tag LOCUS_08310 6461 7381 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246830.1 protein_id gnl|my_center|LOCUS_08310 7717 7442 gene locus_tag LOCUS_08320 7717 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 >Feature sequence064 1035 835 gene locus_tag LOCUS_08330 1035 835 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_08330 1448 1373 gene locus_tag LOCUS_t00120 1448 1373 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1642 3141 gene locus_tag LOCUS_08340 gene lysS 1642 3141 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_08340 3173 4423 gene locus_tag LOCUS_08350 3173 4423 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_08350 4416 5147 gene locus_tag LOCUS_08360 4416 5147 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_08360 5158 7821 gene locus_tag LOCUS_08370 gene bamA 5158 7821 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_08370 7844 8386 gene locus_tag LOCUS_08380 7844 8386 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946255.1 protein_id gnl|my_center|LOCUS_08380 >Feature sequence065 1680 40 gene locus_tag LOCUS_08390 1680 40 CDS product propionyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257900.1 protein_id gnl|my_center|LOCUS_08390 2020 3504 gene locus_tag LOCUS_08400 2020 3504 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064509.1 protein_id gnl|my_center|LOCUS_08400 3620 3943 gene locus_tag LOCUS_08410 3620 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 4263 5561 gene locus_tag LOCUS_08420 4263 5561 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791554.1 protein_id gnl|my_center|LOCUS_08420 5576 6862 gene locus_tag LOCUS_08430 gene thiC 5576 6862 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392914.1 protein_id gnl|my_center|LOCUS_08430 7069 8673 gene locus_tag LOCUS_08440 gene fumB 7069 8673 CDS product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066639.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence066 387 887 gene locus_tag LOCUS_08450 387 887 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941529.1 protein_id gnl|my_center|LOCUS_08450 1882 914 gene locus_tag LOCUS_08460 gene dusB 1882 914 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941670.1 protein_id gnl|my_center|LOCUS_08460 2790 1879 gene locus_tag LOCUS_08470 2790 1879 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108052.1 protein_id gnl|my_center|LOCUS_08470 3145 2816 gene locus_tag LOCUS_08480 3145 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 3468 4475 gene locus_tag LOCUS_08490 gene bioB 3468 4475 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_08490 4475 5836 gene locus_tag LOCUS_08500 gene bioA 4475 5836 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048655595.1 protein_id gnl|my_center|LOCUS_08500 5847 7037 gene locus_tag LOCUS_08510 gene bioF 5847 7037 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_08510 7042 7755 gene locus_tag LOCUS_08520 gene bioD 7042 7755 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545503.1 protein_id gnl|my_center|LOCUS_08520 8127 8894 gene locus_tag LOCUS_08530 8127 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 >Feature sequence067 44 811 gene locus_tag LOCUS_08540 44 811 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896585.1 protein_id gnl|my_center|LOCUS_08540 911 2077 gene locus_tag LOCUS_08550 911 2077 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878787.1 protein_id gnl|my_center|LOCUS_08550 2081 2482 gene locus_tag LOCUS_08560 2081 2482 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878788.1 protein_id gnl|my_center|LOCUS_08560 3762 2566 gene locus_tag LOCUS_08570 3762 2566 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748737.1 protein_id gnl|my_center|LOCUS_08570 5021 3759 gene locus_tag LOCUS_08580 5021 3759 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941550.1 protein_id gnl|my_center|LOCUS_08580 5378 5088 gene locus_tag LOCUS_08590 5378 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 6995 5403 gene locus_tag LOCUS_08600 6995 5403 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015951.1 protein_id gnl|my_center|LOCUS_08600 8692 7094 gene locus_tag LOCUS_08610 gene murJ 8692 7094 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_08610 >Feature sequence068 2967 718 gene locus_tag LOCUS_08620 2967 718 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939521.1 protein_id gnl|my_center|LOCUS_08620 4187 2964 gene locus_tag LOCUS_08630 4187 2964 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964994.1 protein_id gnl|my_center|LOCUS_08630 4260 6065 gene locus_tag LOCUS_08640 4260 6065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 6099 7274 gene locus_tag LOCUS_08650 gene ahbC 6099 7274 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022974.1 protein_id gnl|my_center|LOCUS_08650 7445 8368 gene locus_tag LOCUS_08660 gene hemB 7445 8368 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940811.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence069 570 2822 gene locus_tag LOCUS_08670 570 2822 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_08670 2850 4019 gene locus_tag LOCUS_08680 2850 4019 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_08680 4039 4596 gene locus_tag LOCUS_08690 gene rsmD 4039 4596 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986836.1 protein_id gnl|my_center|LOCUS_08690 4615 5106 gene locus_tag LOCUS_08700 gene coaD 4615 5106 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938824.1 protein_id gnl|my_center|LOCUS_08700 5865 5224 gene locus_tag LOCUS_08710 5865 5224 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942171.1 protein_id gnl|my_center|LOCUS_08710 5965 6966 gene locus_tag LOCUS_08720 5965 6966 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_08720 <8853 7068 gene locus_tag LOCUS_08730 <8853 7068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048053741.1:NAD(P)-binding protein >Feature sequence070 856 931 gene locus_tag LOCUS_t00130 856 931 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1148 1969 gene locus_tag LOCUS_08740 gene ccsB 1148 1969 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_08740 1979 3271 gene locus_tag LOCUS_08750 gene hemA 1979 3271 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_08750 3311 4249 gene locus_tag LOCUS_08760 gene fabD 3311 4249 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048428.1 protein_id gnl|my_center|LOCUS_08760 4409 7708 gene locus_tag LOCUS_08770 4409 7708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 8516 7767 gene locus_tag LOCUS_08780 8516 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence071 218 2479 gene locus_tag LOCUS_08790 gene clpA 218 2479 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546336.1 protein_id gnl|my_center|LOCUS_08790 2559 2810 gene locus_tag LOCUS_08800 2559 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 2814 3080 gene locus_tag LOCUS_08810 2814 3080 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_08810 3093 6056 gene locus_tag LOCUS_08820 3093 6056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 >Feature sequence072 336 40 gene locus_tag LOCUS_08830 336 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 551 339 gene locus_tag LOCUS_08840 551 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 1720 647 gene locus_tag LOCUS_08850 1720 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 4409 1734 gene locus_tag LOCUS_08860 4409 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 5021 4536 gene locus_tag LOCUS_08870 5021 4536 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549852.1 protein_id gnl|my_center|LOCUS_08870 5783 5292 gene locus_tag LOCUS_08880 5783 5292 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037422212.1 protein_id gnl|my_center|LOCUS_08880 6242 8122 gene locus_tag LOCUS_08890 6242 8122 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence073 1926 739 gene locus_tag LOCUS_08900 1926 739 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016322.1 protein_id gnl|my_center|LOCUS_08900 3671 1929 gene locus_tag LOCUS_08910 3671 1929 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_08910 4425 5831 gene locus_tag LOCUS_08920 4425 5831 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941275.1 protein_id gnl|my_center|LOCUS_08920 5828 6682 gene locus_tag LOCUS_08930 gene ccsB 5828 6682 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941276.1 protein_id gnl|my_center|LOCUS_08930 6811 7533 gene locus_tag LOCUS_08940 6811 7533 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940677.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence074 345 70 gene locus_tag LOCUS_08950 345 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08950 2879 435 gene locus_tag LOCUS_08960 gene pheT 2879 435 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_08960 3888 2881 gene locus_tag LOCUS_08970 gene pheS 3888 2881 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_08970 4281 3931 gene locus_tag LOCUS_08980 gene rplT 4281 3931 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942165.1 protein_id gnl|my_center|LOCUS_08980 4506 4309 gene locus_tag LOCUS_08990 gene rpmI 4506 4309 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942164.1 protein_id gnl|my_center|LOCUS_08990 5100 4678 gene locus_tag LOCUS_09000 gene infC 5100 4678 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942163.1 protein_id gnl|my_center|LOCUS_09000 5832 5323 gene locus_tag LOCUS_09010 5832 5323 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041466983.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence075 856 1194 gene locus_tag LOCUS_09020 856 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 1231 3165 gene locus_tag LOCUS_09030 1231 3165 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 protein_id gnl|my_center|LOCUS_09030 3241 4974 gene locus_tag LOCUS_09040 3241 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 4974 6866 gene locus_tag LOCUS_09050 4974 6866 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112594.1 protein_id gnl|my_center|LOCUS_09050 7997 7092 gene locus_tag LOCUS_09060 7997 7092 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761539.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence076 65 1723 gene locus_tag LOCUS_09070 65 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 1760 3079 gene locus_tag LOCUS_09080 1760 3079 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939741.1 transl_except (pos:2489..2491,aa:Sec) note codon on position 244 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_09080 3511 5175 gene locus_tag LOCUS_09090 gene hcp 3511 5175 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939296.1 protein_id gnl|my_center|LOCUS_09090 <8128 5229 gene locus_tag LOCUS_09100 <8128 5229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041670058.1:RecQ family ATP-dependent DNA helicase >Feature sequence077 1625 948 gene locus_tag LOCUS_09110 1625 948 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_09110 2007 1639 gene locus_tag LOCUS_09120 2007 1639 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192320.1 protein_id gnl|my_center|LOCUS_09120 3572 2073 gene locus_tag LOCUS_09130 3572 2073 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640376.1 protein_id gnl|my_center|LOCUS_09130 4426 3587 gene locus_tag LOCUS_09140 4426 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 6196 4472 gene locus_tag LOCUS_09150 6196 4472 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760864.1 protein_id gnl|my_center|LOCUS_09150 6809 6207 gene locus_tag LOCUS_09160 6809 6207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 7198 6968 gene locus_tag LOCUS_09170 7198 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 7904 7248 gene locus_tag LOCUS_09180 7904 7248 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357824.1 protein_id gnl|my_center|LOCUS_09180 >Feature sequence078 <1 2334 gene locus_tag LOCUS_09190 <1 2334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943854.1:TIGR03960 family B12-binding radical SAM protein 4061 2346 gene locus_tag LOCUS_09200 4061 2346 CDS product bifunctional sulfate adenylyltransferase/adenylylsulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 protein_id gnl|my_center|LOCUS_09200 5100 4180 gene locus_tag LOCUS_09210 5100 4180 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_09210 6198 5113 gene locus_tag LOCUS_09220 gene gmd 6198 5113 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868774.1 protein_id gnl|my_center|LOCUS_09220 6308 6769 gene locus_tag LOCUS_09230 6308 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 6787 7650 gene locus_tag LOCUS_09240 gene rsmA 6787 7650 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986025.1 protein_id gnl|my_center|LOCUS_09240 >Feature sequence079 1995 217 gene locus_tag LOCUS_09250 1995 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09250 2640 2011 gene locus_tag LOCUS_09260 2640 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09260 4237 2645 gene locus_tag LOCUS_09270 4237 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 7669 4253 gene locus_tag LOCUS_09280 7669 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence080 984 1298 gene locus_tag LOCUS_09290 984 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1320 2084 gene locus_tag LOCUS_09300 1320 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 2096 3826 gene locus_tag LOCUS_09310 gene dnaK 2096 3826 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582444.1 protein_id gnl|my_center|LOCUS_09310 5473 4292 gene locus_tag LOCUS_09320 gene hemW 5473 4292 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_09320 6566 5451 gene locus_tag LOCUS_09330 gene tgt 6566 5451 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_09330 7526 6570 gene locus_tag LOCUS_09340 gene queA 7526 6570 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583955.1 protein_id gnl|my_center|LOCUS_09340 >Feature sequence081 287 1150 gene locus_tag LOCUS_09350 gene metF 287 1150 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174022.1 protein_id gnl|my_center|LOCUS_09350 1376 1300 gene locus_tag LOCUS_t00140 1376 1300 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1631 2479 gene locus_tag LOCUS_09360 gene nifU 1631 2479 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_09360 2457 3632 gene locus_tag LOCUS_09370 gene nifS 2457 3632 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942654.1 protein_id gnl|my_center|LOCUS_09370 5101 3842 gene locus_tag LOCUS_09380 5101 3842 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_09380 6039 5173 gene locus_tag LOCUS_09390 6039 5173 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927154.1 protein_id gnl|my_center|LOCUS_09390 6832 6032 gene locus_tag LOCUS_09400 6832 6032 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876244.1 protein_id gnl|my_center|LOCUS_09400 7802 6825 gene locus_tag LOCUS_09410 7802 6825 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_09410 >Feature sequence082 949 488 gene locus_tag LOCUS_09420 949 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 1341 946 gene locus_tag LOCUS_09430 1341 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 2401 1550 gene locus_tag LOCUS_09440 gene cobM 2401 1550 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871103.1 protein_id gnl|my_center|LOCUS_09440 3368 2562 gene locus_tag LOCUS_09450 3368 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 5709 3403 gene locus_tag LOCUS_09460 5709 3403 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933207.1 protein_id gnl|my_center|LOCUS_09460 6457 6209 gene locus_tag LOCUS_09470 6457 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 6686 6498 gene locus_tag LOCUS_09480 6686 6498 CDS product CooT family nickel-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545767.1 protein_id gnl|my_center|LOCUS_09480 7654 6704 gene locus_tag LOCUS_09490 7654 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 >Feature sequence083 486 1646 gene locus_tag LOCUS_09500 486 1646 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039902.1 protein_id gnl|my_center|LOCUS_09500 1830 2447 gene locus_tag LOCUS_09510 1830 2447 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870595.1 protein_id gnl|my_center|LOCUS_09510 2487 2873 gene locus_tag LOCUS_09520 2487 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 2877 4004 gene locus_tag LOCUS_09530 2877 4004 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789543.1 protein_id gnl|my_center|LOCUS_09530 4010 4414 gene locus_tag LOCUS_09540 4010 4414 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944306.1 protein_id gnl|my_center|LOCUS_09540 4422 4877 gene locus_tag LOCUS_09550 4422 4877 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_09550 5024 5764 gene locus_tag LOCUS_09560 gene fabG 5024 5764 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927192.1 protein_id gnl|my_center|LOCUS_09560 5769 7553 gene locus_tag LOCUS_09570 5769 7553 CDS product 3-oxoacid CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414123.1 protein_id gnl|my_center|LOCUS_09570 7553 7885 gene locus_tag LOCUS_09580 7553 7885 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763032.1 protein_id gnl|my_center|LOCUS_09580 >Feature sequence084 1816 1091 gene locus_tag LOCUS_09590 gene cobI 1816 1091 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937949.1 protein_id gnl|my_center|LOCUS_09590 2441 1824 gene locus_tag LOCUS_09600 2441 1824 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943629.1 protein_id gnl|my_center|LOCUS_09600 3762 2446 gene locus_tag LOCUS_09610 3762 2446 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943636.1 protein_id gnl|my_center|LOCUS_09610 4813 3824 gene locus_tag LOCUS_09620 4813 3824 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868809.1 protein_id gnl|my_center|LOCUS_09620 5588 4815 gene locus_tag LOCUS_09630 gene fecE 5588 4815 CDS product Fe(3+) dicitrate ABC transporter ATP-binding protein FecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477430.1 protein_id gnl|my_center|LOCUS_09630 6675 5590 gene locus_tag LOCUS_09640 6675 5590 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460055.1 protein_id gnl|my_center|LOCUS_09640 7283 7023 gene locus_tag LOCUS_09650 7283 7023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence085 <1 618 gene locus_tag LOCUS_09660 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024225.1:SO_0444 family Cu/Zn efflux transporter 1116 1784 gene locus_tag LOCUS_09670 1116 1784 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064948.1 protein_id gnl|my_center|LOCUS_09670 1814 2275 gene locus_tag LOCUS_09680 1814 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 2548 3171 gene locus_tag LOCUS_09690 2548 3171 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185803.1 protein_id gnl|my_center|LOCUS_09690 3671 3258 gene locus_tag LOCUS_09700 3671 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 3859 4698 gene locus_tag LOCUS_09710 3859 4698 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434782.1 protein_id gnl|my_center|LOCUS_09710 4950 6293 gene locus_tag LOCUS_09720 4950 6293 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_09720 7134 6358 gene locus_tag LOCUS_09730 7134 6358 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815002.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence086 223 298 gene locus_tag LOCUS_t00150 223 298 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 669 1961 gene locus_tag LOCUS_09740 gene nusA 669 1961 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942231.1 protein_id gnl|my_center|LOCUS_09740 1982 4657 gene locus_tag LOCUS_09750 gene infB 1982 4657 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942233.1 protein_id gnl|my_center|LOCUS_09750 4658 4945 gene locus_tag LOCUS_09760 4658 4945 CDS product DUF503 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964058.1 protein_id gnl|my_center|LOCUS_09760 4942 5313 gene locus_tag LOCUS_09770 4942 5313 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942234.1 protein_id gnl|my_center|LOCUS_09770 5288 6256 gene locus_tag LOCUS_09780 5288 6256 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_09780 6279 7199 gene locus_tag LOCUS_09790 gene truB 6279 7199 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942236.1 protein_id gnl|my_center|LOCUS_09790 7417 7686 gene locus_tag LOCUS_09800 gene rpsO 7417 7686 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894036.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence087 3593 4714 gene locus_tag LOCUS_09810 3593 4714 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249414.1 protein_id gnl|my_center|LOCUS_09810 4983 5657 gene locus_tag LOCUS_09820 4983 5657 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939218.1 protein_id gnl|my_center|LOCUS_09820 <7596 5819 gene locus_tag LOCUS_09830 <7596 5819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392144.1:pyruvate, phosphate dikinase >Feature sequence088 1126 2754 gene locus_tag LOCUS_09840 1126 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 2823 3749 gene locus_tag LOCUS_09850 gene pfkB 2823 3749 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640859.1 protein_id gnl|my_center|LOCUS_09850 4663 3827 gene locus_tag LOCUS_09860 4663 3827 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339817.1 protein_id gnl|my_center|LOCUS_09860 6071 4653 gene locus_tag LOCUS_09870 6071 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427771.1 protein_id gnl|my_center|LOCUS_09870 6411 6623 gene locus_tag LOCUS_09880 6411 6623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 >Feature sequence089 1806 1021 gene locus_tag LOCUS_09890 1806 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 2324 1803 gene locus_tag LOCUS_09900 2324 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 4326 2596 gene locus_tag LOCUS_09910 4326 2596 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942079.1 protein_id gnl|my_center|LOCUS_09910 5322 4387 gene locus_tag LOCUS_09920 5322 4387 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938875.1 protein_id gnl|my_center|LOCUS_09920 5478 5554 gene locus_tag LOCUS_t00160 5478 5554 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6568 6140 gene locus_tag LOCUS_09930 6568 6140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 7391 6798 gene locus_tag LOCUS_09940 7391 6798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence090 694 296 gene locus_tag LOCUS_09950 694 296 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971327.1 protein_id gnl|my_center|LOCUS_09950 885 691 gene locus_tag LOCUS_09960 885 691 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545607.1 protein_id gnl|my_center|LOCUS_09960 1056 1259 gene locus_tag LOCUS_09970 1056 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 1256 1663 gene locus_tag LOCUS_09980 1256 1663 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142893.1 protein_id gnl|my_center|LOCUS_09980 2521 1769 gene locus_tag LOCUS_09990 2521 1769 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291176.1 protein_id gnl|my_center|LOCUS_09990 4117 2579 gene locus_tag LOCUS_10000 4117 2579 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990685.1 protein_id gnl|my_center|LOCUS_10000 4892 4149 gene locus_tag LOCUS_10010 4892 4149 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990902.1 protein_id gnl|my_center|LOCUS_10010 7204 4910 gene locus_tag LOCUS_10020 7204 4910 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545674.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence091 1878 2507 gene locus_tag LOCUS_10030 gene hisH 1878 2507 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937594.1 protein_id gnl|my_center|LOCUS_10030 2501 3277 gene locus_tag LOCUS_10040 gene hisF 2501 3277 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937595.1 protein_id gnl|my_center|LOCUS_10040 3982 6030 gene locus_tag LOCUS_10050 3982 6030 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880310.1 protein_id gnl|my_center|LOCUS_10050 6247 7275 gene locus_tag LOCUS_10060 gene cas6 6247 7275 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_10060 >Feature sequence092 1140 364 gene locus_tag LOCUS_10070 gene fdhD 1140 364 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414705.1 protein_id gnl|my_center|LOCUS_10070 2324 1155 gene locus_tag LOCUS_10080 2324 1155 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940198.1 protein_id gnl|my_center|LOCUS_10080 3696 2347 gene locus_tag LOCUS_10090 3696 2347 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939137.1 protein_id gnl|my_center|LOCUS_10090 4045 4866 gene locus_tag LOCUS_10100 gene kdsA 4045 4866 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_10100 4949 5491 gene locus_tag LOCUS_10110 4949 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 5644 6039 gene locus_tag LOCUS_10120 5644 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 6020 6580 gene locus_tag LOCUS_10130 6020 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 6589 7311 gene locus_tag LOCUS_10140 gene lptB 6589 7311 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073698.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence093 444 2000 gene locus_tag LOCUS_10150 444 2000 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107406.1 protein_id gnl|my_center|LOCUS_10150 2084 2926 gene locus_tag LOCUS_10160 2084 2926 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057642364.1 protein_id gnl|my_center|LOCUS_10160 3162 4205 gene locus_tag LOCUS_10170 gene recA 3162 4205 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390446.1 protein_id gnl|my_center|LOCUS_10170 4226 6853 gene locus_tag LOCUS_10180 gene alaS 4226 6853 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_10180 >Feature sequence094 830 156 gene locus_tag LOCUS_10190 830 156 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943893.1 protein_id gnl|my_center|LOCUS_10190 1681 827 gene locus_tag LOCUS_10200 1681 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 3991 1820 gene locus_tag LOCUS_10210 3991 1820 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_10210 4211 4573 gene locus_tag LOCUS_10220 gene dksA 4211 4573 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 protein_id gnl|my_center|LOCUS_10220 4551 5441 gene locus_tag LOCUS_10230 4551 5441 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_10230 5449 6156 gene locus_tag LOCUS_10240 gene rnc 5449 6156 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557292.1 protein_id gnl|my_center|LOCUS_10240 6178 7218 gene locus_tag LOCUS_10250 6178 7218 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438208.1 protein_id gnl|my_center|LOCUS_10250 >Feature sequence095 375 1448 gene locus_tag LOCUS_10260 375 1448 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495700.1 protein_id gnl|my_center|LOCUS_10260 1636 2574 gene locus_tag LOCUS_10270 1636 2574 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941566.1 protein_id gnl|my_center|LOCUS_10270 2599 4806 gene locus_tag LOCUS_10280 2599 4806 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943374.1 protein_id gnl|my_center|LOCUS_10280 4917 5663 gene locus_tag LOCUS_10290 4917 5663 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525145.1 protein_id gnl|my_center|LOCUS_10290 5708 6091 gene locus_tag LOCUS_10300 5708 6091 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430159.1 protein_id gnl|my_center|LOCUS_10300 7031 6153 gene locus_tag LOCUS_10310 7031 6153 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971490.1 protein_id gnl|my_center|LOCUS_10310 >Feature sequence096 <1 603 gene locus_tag LOCUS_10320 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003568424.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE 690 1367 gene locus_tag LOCUS_10330 690 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940532.1 protein_id gnl|my_center|LOCUS_10330 1360 1707 gene locus_tag LOCUS_10340 1360 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940531.1 protein_id gnl|my_center|LOCUS_10340 2224 2009 gene locus_tag LOCUS_10350 2224 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 3199 2519 gene locus_tag LOCUS_10360 3199 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 5551 3491 gene locus_tag LOCUS_10370 gene fusA 5551 3491 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682356.1 protein_id gnl|my_center|LOCUS_10370 5755 6903 gene locus_tag LOCUS_10380 gene carA 5755 6903 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence097 347 99 gene locus_tag LOCUS_10390 347 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 431 1225 gene locus_tag LOCUS_10400 431 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 1203 1916 gene locus_tag LOCUS_10410 1203 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 2102 2797 gene locus_tag LOCUS_10420 gene minC 2102 2797 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816782.1 protein_id gnl|my_center|LOCUS_10420 2847 3644 gene locus_tag LOCUS_10430 gene minD 2847 3644 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392079.1 protein_id gnl|my_center|LOCUS_10430 3658 3930 gene locus_tag LOCUS_10440 gene minE 3658 3930 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141992.1 protein_id gnl|my_center|LOCUS_10440 4095 4781 gene locus_tag LOCUS_10450 4095 4781 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941121.1 protein_id gnl|my_center|LOCUS_10450 4879 6132 gene locus_tag LOCUS_10460 4879 6132 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070644.1 protein_id gnl|my_center|LOCUS_10460 7305 6613 gene locus_tag LOCUS_10470 7305 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 >Feature sequence098 <1 700 gene locus_tag LOCUS_10480 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108603.1:virulence RhuM family protein 864 3971 gene locus_tag LOCUS_10490 864 3971 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870273.1 protein_id gnl|my_center|LOCUS_10490 5578 4085 gene locus_tag LOCUS_10500 5578 4085 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_10500 7015 5672 gene locus_tag LOCUS_10510 7015 5672 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_10510 >Feature sequence099 1023 115 gene locus_tag LOCUS_10520 1023 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1261 2973 gene locus_tag LOCUS_10530 1261 2973 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940470.1 protein_id gnl|my_center|LOCUS_10530 3048 4457 gene locus_tag LOCUS_10540 3048 4457 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881416.1 protein_id gnl|my_center|LOCUS_10540 5051 4554 gene locus_tag LOCUS_10550 5051 4554 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259432.1 protein_id gnl|my_center|LOCUS_10550 5611 5826 gene locus_tag LOCUS_10560 5611 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 6879 5911 gene locus_tag LOCUS_10570 6879 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence100 1113 877 gene locus_tag LOCUS_10580 1113 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1598 2200 gene locus_tag LOCUS_10590 1598 2200 CDS product poly-gamma-glutamate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829580.1 protein_id gnl|my_center|LOCUS_10590 3141 2536 gene locus_tag LOCUS_10600 gene yedF 3141 2536 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938959.1 protein_id gnl|my_center|LOCUS_10600 4172 3222 gene locus_tag LOCUS_10610 gene selD 4172 3222 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_10610 5356 4442 gene locus_tag LOCUS_10620 5356 4442 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_10620 6061 5360 gene locus_tag LOCUS_10630 6061 5360 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158923.1 protein_id gnl|my_center|LOCUS_10630 6240 7175 gene locus_tag LOCUS_10640 6240 7175 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence101 1564 1094 gene locus_tag LOCUS_10650 1564 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1946 1566 gene locus_tag LOCUS_10660 1946 1566 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941071.1 protein_id gnl|my_center|LOCUS_10660 2832 1981 gene locus_tag LOCUS_10670 2832 1981 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_10670 3347 2829 gene locus_tag LOCUS_10680 3347 2829 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868668.1 protein_id gnl|my_center|LOCUS_10680 4288 3470 gene locus_tag LOCUS_10690 4288 3470 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537801.1 protein_id gnl|my_center|LOCUS_10690 6880 4298 gene locus_tag LOCUS_10700 6880 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence102 554 477 gene locus_tag LOCUS_t00170 554 477 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 649 574 gene locus_tag LOCUS_t00180 649 574 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 877 2808 gene locus_tag LOCUS_10710 gene htpG 877 2808 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943026.1 protein_id gnl|my_center|LOCUS_10710 4243 2861 gene locus_tag LOCUS_10720 4243 2861 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_10720 5626 4286 gene locus_tag LOCUS_10730 gene dnaA 5626 4286 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_10730 6420 6145 gene locus_tag LOCUS_10740 6420 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence103 1110 73 gene locus_tag LOCUS_10750 1110 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 4380 1117 gene locus_tag LOCUS_10760 4380 1117 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880674.1 protein_id gnl|my_center|LOCUS_10760 5553 4450 gene locus_tag LOCUS_10770 5553 4450 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_10770 7001 5550 gene locus_tag LOCUS_10780 7001 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 >Feature sequence104 90 707 gene locus_tag LOCUS_10790 90 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 811 1722 gene locus_tag LOCUS_10800 gene gnd 811 1722 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256404.1 protein_id gnl|my_center|LOCUS_10800 1762 3327 gene locus_tag LOCUS_10810 gene zwf 1762 3327 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_10810 3324 4061 gene locus_tag LOCUS_10820 gene pgl 3324 4061 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939587.1 protein_id gnl|my_center|LOCUS_10820 4569 5357 gene locus_tag LOCUS_10830 4569 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 5610 5344 gene locus_tag LOCUS_10840 gene grxC 5610 5344 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096057.1 protein_id gnl|my_center|LOCUS_10840 6303 5623 gene locus_tag LOCUS_10850 6303 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 7091 6333 gene locus_tag LOCUS_10860 7091 6333 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence105 755 114 gene locus_tag LOCUS_10870 755 114 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545579.1 protein_id gnl|my_center|LOCUS_10870 1340 837 gene locus_tag LOCUS_10880 1340 837 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880135.1 protein_id gnl|my_center|LOCUS_10880 2373 1330 gene locus_tag LOCUS_10890 2373 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10890 2704 2477 gene locus_tag LOCUS_10900 2704 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10900 3118 2873 gene locus_tag LOCUS_10910 3118 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 3358 5064 gene locus_tag LOCUS_10920 gene recJ 3358 5064 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_10920 5196 5615 gene locus_tag LOCUS_10930 5196 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 5618 6622 gene locus_tag LOCUS_10940 5618 6622 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941710.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence106 139 762 gene locus_tag LOCUS_10950 139 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 999 2705 gene locus_tag LOCUS_10960 999 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 2935 2759 gene locus_tag LOCUS_10970 2935 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 2998 3570 gene locus_tag LOCUS_10980 2998 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 3669 4535 gene locus_tag LOCUS_10990 3669 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 4763 5818 gene locus_tag LOCUS_11000 4763 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 5867 6847 gene locus_tag LOCUS_11010 5867 6847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 >Feature sequence107 1010 1783 gene locus_tag LOCUS_11020 1010 1783 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546093.1 protein_id gnl|my_center|LOCUS_11020 1811 2428 gene locus_tag LOCUS_11030 gene cbiM 1811 2428 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938357.1 protein_id gnl|my_center|LOCUS_11030 2418 3068 gene locus_tag LOCUS_11040 2418 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545984.1 protein_id gnl|my_center|LOCUS_11040 3061 3807 gene locus_tag LOCUS_11050 gene cbiQ 3061 3807 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545677.1 protein_id gnl|my_center|LOCUS_11050 3798 4529 gene locus_tag LOCUS_11060 3798 4529 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546570.1 protein_id gnl|my_center|LOCUS_11060 4844 4686 gene locus_tag LOCUS_11070 4844 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 6082 4862 gene locus_tag LOCUS_11080 6082 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 6880 6224 gene locus_tag LOCUS_11090 6880 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence108 207 947 gene locus_tag LOCUS_11100 207 947 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816105.1 protein_id gnl|my_center|LOCUS_11100 2259 973 gene locus_tag LOCUS_11110 2259 973 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942128.1 protein_id gnl|my_center|LOCUS_11110 2599 2252 gene locus_tag LOCUS_11120 2599 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11120 5534 2610 gene locus_tag LOCUS_11130 5534 2610 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933702.1 protein_id gnl|my_center|LOCUS_11130 6606 5524 gene locus_tag LOCUS_11140 6606 5524 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275358.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence109 2708 1812 gene locus_tag LOCUS_11150 gene xerD 2708 1812 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439987.1 protein_id gnl|my_center|LOCUS_11150 3906 2803 gene locus_tag LOCUS_11160 3906 2803 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256149.1 protein_id gnl|my_center|LOCUS_11160 4475 3915 gene locus_tag LOCUS_11170 4475 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 4681 4472 gene locus_tag LOCUS_11180 4681 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 5537 4695 gene locus_tag LOCUS_11190 5537 4695 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545002.1 protein_id gnl|my_center|LOCUS_11190 5860 6534 gene locus_tag LOCUS_11200 5860 6534 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435816.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence110 <1 1275 gene locus_tag LOCUS_11210 <1 1275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545662.1:PBP1A family penicillin-binding protein 2719 1370 gene locus_tag LOCUS_11220 gene gdhA 2719 1370 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_11220 5963 2916 gene locus_tag LOCUS_11230 5963 2916 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761136.1 protein_id gnl|my_center|LOCUS_11230 6499 6197 gene locus_tag LOCUS_11240 6499 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 6740 6477 gene locus_tag LOCUS_11250 6740 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 >Feature sequence111 832 2268 gene locus_tag LOCUS_11260 832 2268 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787371.1 protein_id gnl|my_center|LOCUS_11260 2911 3420 gene locus_tag LOCUS_11270 2911 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 3516 3953 gene locus_tag LOCUS_11280 3516 3953 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937835.1 protein_id gnl|my_center|LOCUS_11280 4365 4547 gene locus_tag LOCUS_11290 4365 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 4955 6415 gene locus_tag LOCUS_11300 4955 6415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence112 1669 1223 gene locus_tag LOCUS_11310 1669 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 2595 1690 gene locus_tag LOCUS_11320 2595 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 3165 2599 gene locus_tag LOCUS_11330 3165 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 3447 4001 gene locus_tag LOCUS_11340 3447 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 4063 5214 gene locus_tag LOCUS_11350 4063 5214 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851140.1 protein_id gnl|my_center|LOCUS_11350 5211 5978 gene locus_tag LOCUS_11360 5211 5978 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937914.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence113 2386 671 gene locus_tag LOCUS_11370 2386 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 2676 5426 gene locus_tag LOCUS_11380 2676 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 >Feature sequence114 806 24 gene locus_tag LOCUS_11390 806 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 2261 1059 gene locus_tag LOCUS_11400 gene lpxK 2261 1059 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_11400 3430 2243 gene locus_tag LOCUS_11410 3430 2243 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_11410 3757 4038 gene locus_tag LOCUS_11420 3757 4038 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422895.1 protein_id gnl|my_center|LOCUS_11420 4046 5806 gene locus_tag LOCUS_11430 gene ptsP 4046 5806 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092157593.1 protein_id gnl|my_center|LOCUS_11430 5781 6275 gene locus_tag LOCUS_11440 gene smpB 5781 6275 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391819.1 protein_id gnl|my_center|LOCUS_11440 6346 6695 gene locus_tag LOCUS_tm00010 6346 6695 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence115 <1 3469 gene locus_tag LOCUS_11450 <1 3469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940695.1:transcription-repair coupling factor 3500 4204 gene locus_tag LOCUS_11460 3500 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 4216 5205 gene locus_tag LOCUS_11470 4216 5205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 5212 6042 gene locus_tag LOCUS_11480 5212 6042 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812890.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence116 279 596 gene locus_tag LOCUS_11490 279 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1772 600 gene locus_tag LOCUS_11500 1772 600 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913616.1 protein_id gnl|my_center|LOCUS_11500 3112 1769 gene locus_tag LOCUS_11510 3112 1769 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526169.1 protein_id gnl|my_center|LOCUS_11510 3705 3109 gene locus_tag LOCUS_11520 3705 3109 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880618.1 protein_id gnl|my_center|LOCUS_11520 4396 3800 gene locus_tag LOCUS_11530 4396 3800 CDS product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006450537.1 protein_id gnl|my_center|LOCUS_11530 4981 4628 gene locus_tag LOCUS_11540 4981 4628 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250020.1 protein_id gnl|my_center|LOCUS_11540 5190 4978 gene locus_tag LOCUS_11550 5190 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 6010 5276 gene locus_tag LOCUS_11560 6010 5276 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064452.1 protein_id gnl|my_center|LOCUS_11560 6357 6010 gene locus_tag LOCUS_11570 6357 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence117 1130 336 gene locus_tag LOCUS_11580 1130 336 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267926.1 protein_id gnl|my_center|LOCUS_11580 1295 3031 gene locus_tag LOCUS_11590 1295 3031 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_11590 3237 3617 gene locus_tag LOCUS_11600 3237 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 3677 4960 gene locus_tag LOCUS_11610 gene rsxC 3677 4960 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583453.1 protein_id gnl|my_center|LOCUS_11610 4961 5923 gene locus_tag LOCUS_11620 4961 5923 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940059.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence118 658 95 gene locus_tag LOCUS_11630 658 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 2087 732 gene locus_tag LOCUS_11640 2087 732 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875981.1 protein_id gnl|my_center|LOCUS_11640 3366 2158 gene locus_tag LOCUS_11650 3366 2158 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491176.1 protein_id gnl|my_center|LOCUS_11650 4563 3433 gene locus_tag LOCUS_11660 4563 3433 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240438.1 protein_id gnl|my_center|LOCUS_11660 5712 4567 gene locus_tag LOCUS_11670 5712 4567 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021207.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence119 217 732 gene locus_tag LOCUS_11680 217 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881242.1 protein_id gnl|my_center|LOCUS_11680 2772 745 gene locus_tag LOCUS_11690 gene gspD 2772 745 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533584.1 protein_id gnl|my_center|LOCUS_11690 3430 2816 gene locus_tag LOCUS_11700 3430 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 4011 3430 gene locus_tag LOCUS_11710 4011 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 5414 4008 gene locus_tag LOCUS_11720 5414 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 <6355 5416 gene locus_tag LOCUS_11730 <6355 5416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921874.1:type II secretion system protein GspK >Feature sequence120 1488 757 gene locus_tag LOCUS_11740 1488 757 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020313.1 protein_id gnl|my_center|LOCUS_11740 2726 1527 gene locus_tag LOCUS_11750 2726 1527 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003157243.1 protein_id gnl|my_center|LOCUS_11750 3640 2738 gene locus_tag LOCUS_11760 3640 2738 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546059.1 protein_id gnl|my_center|LOCUS_11760 4438 3647 gene locus_tag LOCUS_11770 4438 3647 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 protein_id gnl|my_center|LOCUS_11770 6207 4435 gene locus_tag LOCUS_11780 6207 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence121 2543 375 gene locus_tag LOCUS_11790 2543 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 4147 2897 gene locus_tag LOCUS_11800 gene murA 4147 2897 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_11800 5510 4161 gene locus_tag LOCUS_11810 gene glrR 5510 4161 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625590.1 protein_id gnl|my_center|LOCUS_11810 6133 5507 gene locus_tag LOCUS_11820 6133 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 >Feature sequence122 515 907 gene locus_tag LOCUS_11830 515 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 918 2210 gene locus_tag LOCUS_11840 918 2210 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037226281.1 protein_id gnl|my_center|LOCUS_11840 2260 3582 gene locus_tag LOCUS_11850 2260 3582 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656298.1 protein_id gnl|my_center|LOCUS_11850 4331 3579 gene locus_tag LOCUS_11860 4331 3579 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940003.1 protein_id gnl|my_center|LOCUS_11860 4764 4339 gene locus_tag LOCUS_11870 gene ndk 4764 4339 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545240.1 protein_id gnl|my_center|LOCUS_11870 4907 5407 gene locus_tag LOCUS_11880 4907 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 >Feature sequence123 450 1298 gene locus_tag LOCUS_11890 450 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1301 2749 gene locus_tag LOCUS_11900 1301 2749 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181791.1 protein_id gnl|my_center|LOCUS_11900 2825 3568 gene locus_tag LOCUS_11910 2825 3568 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939585.1 protein_id gnl|my_center|LOCUS_11910 5179 3743 gene locus_tag LOCUS_11920 5179 3743 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_11920 5313 5221 gene locus_tag LOCUS_t00190 5313 5221 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence124 <1 836 gene locus_tag LOCUS_11930 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943710.1:RNA polymerase sigma factor RpoD 931 1003 gene locus_tag LOCUS_t00200 931 1003 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1090 2214 gene locus_tag LOCUS_11940 1090 2214 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943706.1 protein_id gnl|my_center|LOCUS_11940 2227 2952 gene locus_tag LOCUS_11950 2227 2952 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_11950 3403 4710 gene locus_tag LOCUS_11960 3403 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 4721 5437 gene locus_tag LOCUS_11970 gene ispD 4721 5437 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_11970 5536 5724 gene locus_tag LOCUS_11980 5536 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 5721 6014 gene locus_tag LOCUS_11990 5721 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 >Feature sequence125 1197 538 gene locus_tag LOCUS_12000 1197 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 2240 1323 gene locus_tag LOCUS_12010 2240 1323 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966228.1 protein_id gnl|my_center|LOCUS_12010 3567 2257 gene locus_tag LOCUS_12020 gene gabT 3567 2257 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464684.1 protein_id gnl|my_center|LOCUS_12020 3947 3756 gene locus_tag LOCUS_12030 3947 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 4224 4072 gene locus_tag LOCUS_12040 4224 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 5564 4491 gene locus_tag LOCUS_12050 5564 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12050 5770 5600 gene locus_tag LOCUS_12060 5770 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12060 >Feature sequence126 82 675 gene locus_tag LOCUS_12070 82 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 744 1760 gene locus_tag LOCUS_12080 744 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1854 2168 gene locus_tag LOCUS_12090 1854 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 2193 2786 gene locus_tag LOCUS_12100 2193 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 3098 3376 gene locus_tag LOCUS_12110 3098 3376 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213585.1 protein_id gnl|my_center|LOCUS_12110 3351 3626 gene locus_tag LOCUS_12120 3351 3626 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225230.1 protein_id gnl|my_center|LOCUS_12120 4077 3733 gene locus_tag LOCUS_12130 4077 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 4407 4679 gene locus_tag LOCUS_12140 4407 4679 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131963.1 protein_id gnl|my_center|LOCUS_12140 4642 4950 gene locus_tag LOCUS_12150 4642 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 5108 5566 gene locus_tag LOCUS_12160 5108 5566 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928694.1 protein_id gnl|my_center|LOCUS_12160 5570 5809 gene locus_tag LOCUS_12170 5570 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679683.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence127 <1 554 gene locus_tag LOCUS_12180 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937450.1:sensor histidine kinase 751 824 gene locus_tag LOCUS_t00210 751 824 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1036 3018 gene locus_tag LOCUS_12190 1036 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 3044 4018 gene locus_tag LOCUS_12200 3044 4018 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937471.1 protein_id gnl|my_center|LOCUS_12200 4203 5438 gene locus_tag LOCUS_12210 4203 5438 CDS product trehalose 6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927019.1 protein_id gnl|my_center|LOCUS_12210 >Feature sequence128 2235 1672 gene locus_tag LOCUS_12220 2235 1672 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084689.1 protein_id gnl|my_center|LOCUS_12220 3272 2310 gene locus_tag LOCUS_12230 3272 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 5094 3322 gene locus_tag LOCUS_12240 gene arnT 5094 3322 CDS product lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704923.1 protein_id gnl|my_center|LOCUS_12240 5954 5070 gene locus_tag LOCUS_12250 gene arnD 5954 5070 CDS product 4-deoxy-4-formamido-L-arabinose-phosphoundecaprenol deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267893.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence129 1251 1087 gene locus_tag LOCUS_12260 1251 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1617 1868 gene locus_tag LOCUS_12270 1617 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 3232 2342 gene locus_tag LOCUS_12280 3232 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 4316 4846 gene locus_tag LOCUS_12290 4316 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 5449 5288 gene locus_tag LOCUS_12300 5449 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12300 5582 5430 gene locus_tag LOCUS_12310 5582 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence130 <1 1142 gene locus_tag LOCUS_12320 <1 1142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867278.1:tungstate ABC transporter ATP-binding protein WtpC 1225 3666 gene locus_tag LOCUS_12330 1225 3666 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681381.1 protein_id gnl|my_center|LOCUS_12330 3690 3860 gene locus_tag LOCUS_12340 3690 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12340 4029 4298 gene locus_tag LOCUS_12350 4029 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 4345 5205 gene locus_tag LOCUS_12360 4345 5205 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_12360 >Feature sequence131 1675 611 gene locus_tag LOCUS_12370 1675 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 2729 1722 gene locus_tag LOCUS_12380 2729 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 4682 3174 gene locus_tag LOCUS_12390 4682 3174 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644570.1 protein_id gnl|my_center|LOCUS_12390 >Feature sequence132 574 1365 gene locus_tag LOCUS_12400 574 1365 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545667.1 protein_id gnl|my_center|LOCUS_12400 2158 1343 gene locus_tag LOCUS_12410 2158 1343 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868772.1 protein_id gnl|my_center|LOCUS_12410 2449 2784 gene locus_tag LOCUS_12420 2449 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 2906 3886 gene locus_tag LOCUS_12430 2906 3886 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_12430 3893 4765 gene locus_tag LOCUS_12440 3893 4765 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_12440 4765 5667 gene locus_tag LOCUS_12450 4765 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 >Feature sequence133 149 652 gene locus_tag LOCUS_12460 149 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 649 2682 gene locus_tag LOCUS_12470 gene fusA 649 2682 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_12470 2688 4232 gene locus_tag LOCUS_12480 2688 4232 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983276.1 protein_id gnl|my_center|LOCUS_12480 4449 5534 gene locus_tag LOCUS_12490 gene ispG 4449 5534 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546314.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence134 1902 208 gene locus_tag LOCUS_12500 1902 208 CDS product sugar phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096407.1 protein_id gnl|my_center|LOCUS_12500 2232 3866 gene locus_tag LOCUS_12510 2232 3866 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_12510 3909 4760 gene locus_tag LOCUS_12520 3909 4760 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220028.1 protein_id gnl|my_center|LOCUS_12520 4775 4939 gene locus_tag LOCUS_12530 4775 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 5127 5417 gene locus_tag LOCUS_12540 5127 5417 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809266.1 protein_id gnl|my_center|LOCUS_12540 5410 5781 gene locus_tag LOCUS_12550 5410 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence135 241 1077 gene locus_tag LOCUS_12560 241 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1099 2583 gene locus_tag LOCUS_12570 1099 2583 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_12570 2556 2708 gene locus_tag LOCUS_12580 2556 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 4053 2677 gene locus_tag LOCUS_12590 4053 2677 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546410.1 protein_id gnl|my_center|LOCUS_12590 4376 4720 gene locus_tag LOCUS_12600 4376 4720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 5312 4698 gene locus_tag LOCUS_12610 5312 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence136 4588 3851 gene locus_tag LOCUS_12620 4588 3851 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062387006.1 protein_id gnl|my_center|LOCUS_12620 5595 4585 gene locus_tag LOCUS_12630 5595 4585 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence137 509 1288 gene locus_tag LOCUS_12640 509 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1288 2643 gene locus_tag LOCUS_12650 1288 2643 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932125.1 protein_id gnl|my_center|LOCUS_12650 2662 3615 gene locus_tag LOCUS_12660 2662 3615 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927209.1 protein_id gnl|my_center|LOCUS_12660 3619 4536 gene locus_tag LOCUS_12670 3619 4536 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337064.1 protein_id gnl|my_center|LOCUS_12670 4533 5309 gene locus_tag LOCUS_12680 4533 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 5320 5583 gene locus_tag LOCUS_12690 5320 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence138 1070 1699 gene locus_tag LOCUS_12700 1070 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942017.1 protein_id gnl|my_center|LOCUS_12700 1696 2565 gene locus_tag LOCUS_12710 1696 2565 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_12710 3177 3380 gene locus_tag LOCUS_12720 3177 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 3471 4778 gene locus_tag LOCUS_12730 3471 4778 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_12730 >Feature sequence139 177 785 gene locus_tag LOCUS_12740 177 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 868 1392 gene locus_tag LOCUS_12750 868 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791831.1 protein_id gnl|my_center|LOCUS_12750 1344 2519 gene locus_tag LOCUS_12760 1344 2519 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_12760 2512 3612 gene locus_tag LOCUS_12770 gene mqnE 2512 3612 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393346.1 protein_id gnl|my_center|LOCUS_12770 3823 4053 gene locus_tag LOCUS_12780 3823 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 4050 4373 gene locus_tag LOCUS_12790 4050 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 4437 5486 gene locus_tag LOCUS_12800 gene mqnC 4437 5486 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545015.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence140 198 1499 gene locus_tag LOCUS_12810 198 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1730 2086 gene locus_tag LOCUS_12820 1730 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 2098 4464 gene locus_tag LOCUS_12830 2098 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 4490 4678 gene locus_tag LOCUS_12840 4490 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 5571 4903 gene locus_tag LOCUS_12850 5571 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12850 >Feature sequence141 46 1428 gene locus_tag LOCUS_12860 46 1428 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073841.1 protein_id gnl|my_center|LOCUS_12860 1441 3513 gene locus_tag LOCUS_12870 1441 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 3510 4136 gene locus_tag LOCUS_12880 3510 4136 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545712.1 protein_id gnl|my_center|LOCUS_12880 5714 4194 gene locus_tag LOCUS_12890 5714 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence142 1224 1418 gene locus_tag LOCUS_12900 1224 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 2416 1484 gene locus_tag LOCUS_12910 gene miaA 2416 1484 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_12910 2488 2973 gene locus_tag LOCUS_12920 2488 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 3106 5127 gene locus_tag LOCUS_12930 3106 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 5603 5124 gene locus_tag LOCUS_12940 5603 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 5709 5623 gene locus_tag LOCUS_t00220 5709 5623 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence143 1738 743 gene locus_tag LOCUS_12950 1738 743 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_12950 2091 1804 gene locus_tag LOCUS_12960 2091 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 2389 2135 gene locus_tag LOCUS_12970 2389 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 2789 2604 gene locus_tag LOCUS_12980 2789 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 3427 2933 gene locus_tag LOCUS_12990 3427 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 4784 4164 gene locus_tag LOCUS_13000 4784 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 5146 4784 gene locus_tag LOCUS_13010 5146 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 >Feature sequence144 67 846 gene locus_tag LOCUS_13020 67 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1425 2687 gene locus_tag LOCUS_13030 1425 2687 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021591.1 protein_id gnl|my_center|LOCUS_13030 2895 3173 gene locus_tag LOCUS_13040 2895 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 3166 3777 gene locus_tag LOCUS_13050 3166 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 4052 5362 gene locus_tag LOCUS_13060 4052 5362 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777343.1 protein_id gnl|my_center|LOCUS_13060 >Feature sequence145 <1 1409 gene locus_tag LOCUS_13070 <1 1409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403684.1:Mur ligase family protein 2168 3658 gene locus_tag LOCUS_13080 2168 3658 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067929.1 protein_id gnl|my_center|LOCUS_13080 3760 3948 gene locus_tag LOCUS_13090 3760 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 3990 4679 gene locus_tag LOCUS_13100 3990 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 4999 5075 gene locus_tag LOCUS_t00230 4999 5075 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 5089 5165 gene locus_tag LOCUS_t00240 5089 5165 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence146 103 384 gene locus_tag LOCUS_13110 103 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 417 581 gene locus_tag LOCUS_13120 417 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 581 769 gene locus_tag LOCUS_13130 581 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1202 5431 gene locus_tag LOCUS_13140 1202 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence147 698 465 gene locus_tag LOCUS_13150 698 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 1525 3249 gene locus_tag LOCUS_13160 1525 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 3335 4222 gene locus_tag LOCUS_13170 3335 4222 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767082.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence148 772 1557 gene locus_tag LOCUS_13180 772 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1557 2645 gene locus_tag LOCUS_13190 1557 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 2866 3570 gene locus_tag LOCUS_13200 2866 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 4907 3756 gene locus_tag LOCUS_13210 4907 3756 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957954.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence149 <1 740 gene locus_tag LOCUS_13220 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545667.1:YkgJ family cysteine cluster protein 3682 779 gene locus_tag LOCUS_13230 3682 779 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920490.1 protein_id gnl|my_center|LOCUS_13230 4343 4095 gene locus_tag LOCUS_13240 4343 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence150 1016 336 gene locus_tag LOCUS_13250 1016 336 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941085.1 protein_id gnl|my_center|LOCUS_13250 2859 1036 gene locus_tag LOCUS_13260 2859 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 3336 2884 gene locus_tag LOCUS_13270 3336 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 4703 3384 gene locus_tag LOCUS_13280 4703 3384 CDS product FliI/YscN family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941081.1 protein_id gnl|my_center|LOCUS_13280 5434 4700 gene locus_tag LOCUS_13290 5434 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence151 288 2735 gene locus_tag LOCUS_13300 gene priA 288 2735 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405449.1 protein_id gnl|my_center|LOCUS_13300 2757 2984 gene locus_tag LOCUS_13310 2757 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 3496 4116 gene locus_tag LOCUS_13320 3496 4116 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360256.1 protein_id gnl|my_center|LOCUS_13320 >Feature sequence152 462 1373 gene locus_tag LOCUS_13330 462 1373 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480277.1 protein_id gnl|my_center|LOCUS_13330 1364 2374 gene locus_tag LOCUS_13340 1364 2374 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926960.1 protein_id gnl|my_center|LOCUS_13340 2383 3186 gene locus_tag LOCUS_13350 2383 3186 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877937.1 protein_id gnl|my_center|LOCUS_13350 3183 3587 gene locus_tag LOCUS_13360 3183 3587 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_13360 4098 3595 gene locus_tag LOCUS_13370 4098 3595 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398479.1 protein_id gnl|my_center|LOCUS_13370 4756 4226 gene locus_tag LOCUS_13380 gene pyrR 4756 4226 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887753.1 protein_id gnl|my_center|LOCUS_13380 <5521 4822 gene locus_tag LOCUS_13390 <5521 4822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939484.1:methyltransferase >Feature sequence153 222 4 gene locus_tag LOCUS_13400 222 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 2167 179 gene locus_tag LOCUS_13410 2167 179 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056499.1 protein_id gnl|my_center|LOCUS_13410 2353 3600 gene locus_tag LOCUS_13420 2353 3600 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941028.1 protein_id gnl|my_center|LOCUS_13420 3679 4425 gene locus_tag LOCUS_13430 3679 4425 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence154 59 1606 gene locus_tag LOCUS_13440 59 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1646 2686 gene locus_tag LOCUS_13450 1646 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 2903 3628 gene locus_tag LOCUS_13460 2903 3628 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095709.1 protein_id gnl|my_center|LOCUS_13460 3779 4564 gene locus_tag LOCUS_13470 3779 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 >Feature sequence155 390 1328 gene locus_tag LOCUS_13480 390 1328 CDS product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_13480 2696 1467 gene locus_tag LOCUS_13490 2696 1467 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187394984.1 protein_id gnl|my_center|LOCUS_13490 3007 2693 gene locus_tag LOCUS_13500 3007 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 4341 3193 gene locus_tag LOCUS_13510 4341 3193 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144029.1 protein_id gnl|my_center|LOCUS_13510 5077 4364 gene locus_tag LOCUS_13520 5077 4364 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228961.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence156 150 557 gene locus_tag LOCUS_13530 150 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1074 565 gene locus_tag LOCUS_13540 1074 565 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 protein_id gnl|my_center|LOCUS_13540 1103 1573 gene locus_tag LOCUS_13550 1103 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 1838 1575 gene locus_tag LOCUS_13560 1838 1575 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927120.1 protein_id gnl|my_center|LOCUS_13560 2034 1786 gene locus_tag LOCUS_13570 2034 1786 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933584.1 protein_id gnl|my_center|LOCUS_13570 3495 2050 gene locus_tag LOCUS_13580 gene cysS 3495 2050 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_13580 3975 3508 gene locus_tag LOCUS_13590 gene ispF 3975 3508 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963756.1 protein_id gnl|my_center|LOCUS_13590 4415 4008 gene locus_tag LOCUS_13600 4415 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 4654 4412 gene locus_tag LOCUS_13610 4654 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 5098 4838 gene locus_tag LOCUS_13620 5098 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13620 >Feature sequence157 416 1216 gene locus_tag LOCUS_13630 416 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1304 2956 gene locus_tag LOCUS_13640 gene panP 1304 2956 CDS product putative pyridoxal-dependent aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483514.1 protein_id gnl|my_center|LOCUS_13640 3017 3892 gene locus_tag LOCUS_13650 3017 3892 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878840.1 protein_id gnl|my_center|LOCUS_13650 <5330 3927 gene locus_tag LOCUS_13660 <5330 3927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001970104.1:extracellular solute-binding protein >Feature sequence158 <1 1061 gene locus_tag LOCUS_13670 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940275.1:radical SAM protein 1147 2286 gene locus_tag LOCUS_13680 1147 2286 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_13680 2596 3969 gene locus_tag LOCUS_13690 2596 3969 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107706.1 protein_id gnl|my_center|LOCUS_13690 3947 5008 gene locus_tag LOCUS_13700 gene nadA 3947 5008 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389688.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence159 1838 1326 gene locus_tag LOCUS_13710 1838 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 2525 1989 gene locus_tag LOCUS_13720 2525 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 3170 2568 gene locus_tag LOCUS_13730 3170 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 4169 3237 gene locus_tag LOCUS_13740 4169 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 <5261 4192 gene locus_tag LOCUS_13750 <5261 4192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942427.1:GspE/PulE family protein >Feature sequence160 327 1640 gene locus_tag LOCUS_13760 gene thiC 327 1640 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943635.1 protein_id gnl|my_center|LOCUS_13760 1645 2703 gene locus_tag LOCUS_13770 gene cobT 1645 2703 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943639.1 protein_id gnl|my_center|LOCUS_13770 2700 4040 gene locus_tag LOCUS_13780 gene rimO 2700 4040 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_13780 4037 5017 gene locus_tag LOCUS_13790 4037 5017 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence161 <1 2009 gene locus_tag LOCUS_13800 <1 2009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942079.1:tetratricopeptide repeat protein 2112 3149 gene locus_tag LOCUS_13810 2112 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 3274 4755 gene locus_tag LOCUS_13820 3274 4755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 >Feature sequence162 <1 1512 gene locus_tag LOCUS_13830 <1 1512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028172437.1:efflux RND transporter periplasmic adaptor subunit 1528 2877 gene locus_tag LOCUS_13840 1528 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 2997 3698 gene locus_tag LOCUS_13850 2997 3698 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015241729.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13850 3838 4989 gene locus_tag LOCUS_13860 3838 4989 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040680916.1 protein_id gnl|my_center|LOCUS_13860 >Feature sequence163 1538 669 gene locus_tag LOCUS_13870 1538 669 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986530.1 protein_id gnl|my_center|LOCUS_13870 1727 3766 gene locus_tag LOCUS_13880 1727 3766 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732543.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence164 1 360 gene locus_tag LOCUS_13890 1 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13890 378 779 gene locus_tag LOCUS_13900 378 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13900 776 1612 gene locus_tag LOCUS_13910 776 1612 CDS product nicotianamine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023912.1 protein_id gnl|my_center|LOCUS_13910 1613 2092 gene locus_tag LOCUS_13920 1613 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13920 2047 2721 gene locus_tag LOCUS_13930 2047 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13930 >Feature sequence165 267 944 gene locus_tag LOCUS_13940 267 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 2088 1030 gene locus_tag LOCUS_13950 2088 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 3461 2094 gene locus_tag LOCUS_13960 3461 2094 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_13960 4838 3465 gene locus_tag LOCUS_13970 4838 3465 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942417.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence166 2 532 gene locus_tag LOCUS_13980 2 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 997 719 gene locus_tag LOCUS_13990 997 719 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092213181.1 protein_id gnl|my_center|LOCUS_13990 1948 1097 gene locus_tag LOCUS_14000 1948 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 2847 1948 gene locus_tag LOCUS_14010 gene era 2847 1948 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 protein_id gnl|my_center|LOCUS_14010 3783 2866 gene locus_tag LOCUS_14020 3783 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 4394 3780 gene locus_tag LOCUS_14030 4394 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 5024 4410 gene locus_tag LOCUS_14040 gene yihA 5024 4410 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943641.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence167 1411 1034 gene locus_tag LOCUS_14050 gene queD 1411 1034 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020994.1 protein_id gnl|my_center|LOCUS_14050 2553 1438 gene locus_tag LOCUS_14060 gene dnaJ 2553 1438 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_14060 2747 3457 gene locus_tag LOCUS_14070 gene ubiE 2747 3457 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941531.1 protein_id gnl|my_center|LOCUS_14070 4166 3435 gene locus_tag LOCUS_14080 4166 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence168 270 968 gene locus_tag LOCUS_14090 270 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1430 1020 gene locus_tag LOCUS_14100 1430 1020 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392925.1 protein_id gnl|my_center|LOCUS_14100 2342 1479 gene locus_tag LOCUS_14110 2342 1479 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_14110 3199 2360 gene locus_tag LOCUS_14120 3199 2360 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence169 <1 1937 gene locus_tag LOCUS_14130 <1 1937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010871138.1:adenosylcobinamide amidohydrolase 1978 2991 gene locus_tag LOCUS_14140 1978 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 3003 3299 gene locus_tag LOCUS_14150 3003 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 3501 3764 gene locus_tag LOCUS_14160 3501 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 3832 4143 gene locus_tag LOCUS_14170 3832 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 4202 4861 gene locus_tag LOCUS_14180 4202 4861 CDS product CRISPR-associated endonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065262.1 protein_id gnl|my_center|LOCUS_14180 >Feature sequence170 269 1024 gene locus_tag LOCUS_14190 269 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 1014 1967 gene locus_tag LOCUS_14200 1014 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 1975 3483 gene locus_tag LOCUS_14210 1975 3483 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390841.1 protein_id gnl|my_center|LOCUS_14210 3507 4943 gene locus_tag LOCUS_14220 3507 4943 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266469.1 protein_id gnl|my_center|LOCUS_14220 >Feature sequence171 1275 235 gene locus_tag LOCUS_14230 1275 235 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071874.1 protein_id gnl|my_center|LOCUS_14230 1952 2194 gene locus_tag LOCUS_14240 1952 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 2644 2207 gene locus_tag LOCUS_14250 2644 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 3191 2769 gene locus_tag LOCUS_14260 3191 2769 CDS product thioredoxin fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881088.1 protein_id gnl|my_center|LOCUS_14260 3352 3188 gene locus_tag LOCUS_14270 3352 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 3474 4862 gene locus_tag LOCUS_14280 3474 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 >Feature sequence172 <1 1188 gene locus_tag LOCUS_14290 <1 1188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057022.1:NAD+ synthase 1384 1460 gene locus_tag LOCUS_t00250 1384 1460 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1587 2816 gene locus_tag LOCUS_14300 1587 2816 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545855.1 protein_id gnl|my_center|LOCUS_14300 2903 2831 gene locus_tag LOCUS_t00260 2903 2831 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2969 4027 gene locus_tag LOCUS_14310 2969 4027 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769604.1 protein_id gnl|my_center|LOCUS_14310 4354 4268 gene locus_tag LOCUS_t00270 4354 4268 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4723 4367 gene locus_tag LOCUS_14320 gene secG 4723 4367 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942271.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence173 397 1968 gene locus_tag LOCUS_14330 397 1968 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680484.1 protein_id gnl|my_center|LOCUS_14330 1965 3308 gene locus_tag LOCUS_14340 1965 3308 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942487.1 protein_id gnl|my_center|LOCUS_14340 3325 3624 gene locus_tag LOCUS_14350 3325 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 3911 4111 gene locus_tag LOCUS_14360 3911 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 4112 4363 gene locus_tag LOCUS_14370 4112 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_14370 4664 4819 gene locus_tag LOCUS_14380 4664 4819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence174 444 587 gene locus_tag LOCUS_14390 444 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 709 2256 gene locus_tag LOCUS_14400 709 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 2687 3310 gene locus_tag LOCUS_14410 2687 3310 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113620978.1 protein_id gnl|my_center|LOCUS_14410 3456 3647 gene locus_tag LOCUS_14420 3456 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 3675 4001 gene locus_tag LOCUS_14430 3675 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 4005 4352 gene locus_tag LOCUS_14440 4005 4352 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053649.1 protein_id gnl|my_center|LOCUS_14440 >Feature sequence175 1144 41 gene locus_tag LOCUS_14450 gene dprA 1144 41 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_14450 2203 1145 gene locus_tag LOCUS_14460 gene secF 2203 1145 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939105.1 protein_id gnl|my_center|LOCUS_14460 3795 2221 gene locus_tag LOCUS_14470 gene secD 3795 2221 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943255.1 protein_id gnl|my_center|LOCUS_14470 4198 3842 gene locus_tag LOCUS_14480 4198 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 >Feature sequence176 4488 3334 gene locus_tag LOCUS_14490 4488 3334 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064757.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence177 677 1027 gene locus_tag LOCUS_14500 677 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 2293 1121 gene locus_tag LOCUS_14510 2293 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 2914 2297 gene locus_tag LOCUS_14520 2914 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 3144 2911 gene locus_tag LOCUS_14530 3144 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 <4864 3189 gene locus_tag LOCUS_14540 <4864 3189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011176617.1:GNVR domain-containing protein >Feature sequence178 448 1647 gene locus_tag LOCUS_14550 448 1647 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_14550 2666 1863 gene locus_tag LOCUS_14560 2666 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 2991 3248 gene locus_tag LOCUS_14570 2991 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 3293 4453 gene locus_tag LOCUS_14580 3293 4453 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191216118.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence179 613 146 gene locus_tag LOCUS_14590 613 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 815 603 gene locus_tag LOCUS_14600 815 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 2011 812 gene locus_tag LOCUS_14610 2011 812 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064402.1 protein_id gnl|my_center|LOCUS_14610 2235 2074 gene locus_tag LOCUS_14620 2235 2074 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_14620 2516 2331 gene locus_tag LOCUS_14630 2516 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 2962 2576 gene locus_tag LOCUS_14640 2962 2576 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940441.1 protein_id gnl|my_center|LOCUS_14640 3203 3985 gene locus_tag LOCUS_14650 3203 3985 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 protein_id gnl|my_center|LOCUS_14650 >Feature sequence180 2 601 gene locus_tag LOCUS_14660 2 601 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_14660 777 1970 gene locus_tag LOCUS_14670 777 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 2933 2187 gene locus_tag LOCUS_14680 2933 2187 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544975.1 protein_id gnl|my_center|LOCUS_14680 3230 2934 gene locus_tag LOCUS_14690 3230 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 3420 4667 gene locus_tag LOCUS_14700 3420 4667 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence181 32 703 gene locus_tag LOCUS_14710 32 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 753 1355 gene locus_tag LOCUS_14720 753 1355 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_14720 1377 2078 gene locus_tag LOCUS_14730 gene rsxA 1377 2078 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082952.1 protein_id gnl|my_center|LOCUS_14730 2142 2963 gene locus_tag LOCUS_14740 2142 2963 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355995.1 protein_id gnl|my_center|LOCUS_14740 3092 4102 gene locus_tag LOCUS_14750 gene pdxA 3092 4102 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_14750 4236 4565 gene locus_tag LOCUS_14760 4236 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 >Feature sequence182 286 92 gene locus_tag LOCUS_14770 286 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 551 760 gene locus_tag LOCUS_14780 551 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 1392 901 gene locus_tag LOCUS_14790 1392 901 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060740.1 protein_id gnl|my_center|LOCUS_14790 1850 3295 gene locus_tag LOCUS_14800 1850 3295 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941684.1 protein_id gnl|my_center|LOCUS_14800 3352 4455 gene locus_tag LOCUS_14810 3352 4455 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938041.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence183 576 651 gene locus_tag LOCUS_t00280 576 651 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1790 669 gene locus_tag LOCUS_14820 1790 669 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112621.1 protein_id gnl|my_center|LOCUS_14820 3733 1790 gene locus_tag LOCUS_14830 3733 1790 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940249.1 protein_id gnl|my_center|LOCUS_14830 <4733 3727 gene locus_tag LOCUS_14840 <4733 3727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003699855.1:DNA repair protein RecN >Feature sequence184 14 688 gene locus_tag LOCUS_14850 14 688 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966804.1 protein_id gnl|my_center|LOCUS_14850 749 1876 gene locus_tag LOCUS_14860 749 1876 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941744.1 protein_id gnl|my_center|LOCUS_14860 2004 3095 gene locus_tag LOCUS_14870 2004 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 3404 3234 gene locus_tag LOCUS_14880 3404 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 3964 3611 gene locus_tag LOCUS_14890 3964 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 4489 4037 gene locus_tag LOCUS_14900 4489 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 >Feature sequence185 651 373 gene locus_tag LOCUS_14910 651 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 2037 826 gene locus_tag LOCUS_14920 2037 826 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626085.1 protein_id gnl|my_center|LOCUS_14920 3542 2130 gene locus_tag LOCUS_14930 3542 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 4577 4068 gene locus_tag LOCUS_14940 4577 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence186 223 1323 gene locus_tag LOCUS_14950 223 1323 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942620.1 protein_id gnl|my_center|LOCUS_14950 1560 1874 gene locus_tag LOCUS_14960 1560 1874 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393078.1 protein_id gnl|my_center|LOCUS_14960 1871 2149 gene locus_tag LOCUS_14970 1871 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 2777 3415 gene locus_tag LOCUS_14980 2777 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 3588 4526 gene locus_tag LOCUS_14990 3588 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence187 2370 1102 gene locus_tag LOCUS_15000 2370 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 3683 2385 gene locus_tag LOCUS_15010 3683 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 4531 3689 gene locus_tag LOCUS_15020 4531 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 >Feature sequence188 1101 4 gene locus_tag LOCUS_15030 1101 4 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_15030 1837 1109 gene locus_tag LOCUS_15040 1837 1109 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943674.1 protein_id gnl|my_center|LOCUS_15040 2802 1840 gene locus_tag LOCUS_15050 2802 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 3617 2829 gene locus_tag LOCUS_15060 gene flgG 3617 2829 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_15060 4385 3630 gene locus_tag LOCUS_15070 gene flgF 4385 3630 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943677.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence189 702 43 gene locus_tag LOCUS_15080 gene hypB 702 43 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 protein_id gnl|my_center|LOCUS_15080 1082 732 gene locus_tag LOCUS_15090 gene hypA 1082 732 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933459.1 protein_id gnl|my_center|LOCUS_15090 2305 1295 gene locus_tag LOCUS_15100 gene hypE 2305 1295 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940978.1 protein_id gnl|my_center|LOCUS_15100 3454 2318 gene locus_tag LOCUS_15110 gene hypD 3454 2318 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545661.1 protein_id gnl|my_center|LOCUS_15110 4386 3547 gene locus_tag LOCUS_15120 4386 3547 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence190 2917 1775 gene locus_tag LOCUS_15130 gene wecB 2917 1775 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867673.1 protein_id gnl|my_center|LOCUS_15130 4325 3138 gene locus_tag LOCUS_15140 4325 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence191 2869 2210 gene locus_tag LOCUS_15150 2869 2210 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054522704.1 protein_id gnl|my_center|LOCUS_15150 3775 3023 gene locus_tag LOCUS_15160 3775 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942146.1 protein_id gnl|my_center|LOCUS_15160 <4658 3868 gene locus_tag LOCUS_15170 <4658 3868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942145.1:ABC-2 transporter permease >Feature sequence192 211 762 gene locus_tag LOCUS_15180 211 762 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754241.1 protein_id gnl|my_center|LOCUS_15180 1535 846 gene locus_tag LOCUS_15190 1535 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 2014 1607 gene locus_tag LOCUS_15200 2014 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 2525 2698 gene locus_tag LOCUS_15210 2525 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 2711 3568 gene locus_tag LOCUS_15220 2711 3568 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034581407.1 protein_id gnl|my_center|LOCUS_15220 3582 4289 gene locus_tag LOCUS_15230 3582 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence193 179 1075 gene locus_tag LOCUS_15240 179 1075 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421593.1 protein_id gnl|my_center|LOCUS_15240 1547 1083 gene locus_tag LOCUS_15250 gene ssb 1547 1083 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806953.1 protein_id gnl|my_center|LOCUS_15250 2190 1711 gene locus_tag LOCUS_15260 2190 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 3891 2206 gene locus_tag LOCUS_15270 3891 2206 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582947.1 protein_id gnl|my_center|LOCUS_15270 4544 4140 gene locus_tag LOCUS_15280 4544 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 >Feature sequence194 543 1220 gene locus_tag LOCUS_15290 543 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 1343 2086 gene locus_tag LOCUS_15300 1343 2086 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144194.1 protein_id gnl|my_center|LOCUS_15300 2079 2888 gene locus_tag LOCUS_15310 2079 2888 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942145.1 protein_id gnl|my_center|LOCUS_15310 2885 3763 gene locus_tag LOCUS_15320 2885 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 4040 4237 gene locus_tag LOCUS_15330 4040 4237 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405863.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence195 377 126 gene locus_tag LOCUS_15340 377 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 762 2075 gene locus_tag LOCUS_15350 762 2075 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266800.1 protein_id gnl|my_center|LOCUS_15350 2110 3282 gene locus_tag LOCUS_15360 gene vpsj 2110 3282 CDS product exopolysaccharide biosynthesis protein VpsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843487.1 protein_id gnl|my_center|LOCUS_15360 3279 4463 gene locus_tag LOCUS_15370 3279 4463 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089037.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence196 589 77 gene locus_tag LOCUS_15380 589 77 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941953.1 protein_id gnl|my_center|LOCUS_15380 1209 805 gene locus_tag LOCUS_15390 1209 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1504 1175 gene locus_tag LOCUS_15400 1504 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 2582 1689 gene locus_tag LOCUS_15410 gene flgL 2582 1689 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_15410 3990 2617 gene locus_tag LOCUS_15420 gene flgK 3990 2617 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943669.1 protein_id gnl|my_center|LOCUS_15420 <4562 4002 gene locus_tag LOCUS_15430 <4562 4002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704959.1:chemotaxis response regulator protein-glutamate methylesterase >Feature sequence197 2177 489 gene locus_tag LOCUS_15440 2177 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 2990 2214 gene locus_tag LOCUS_15450 gene cobM 2990 2214 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871103.1 protein_id gnl|my_center|LOCUS_15450 4237 2969 gene locus_tag LOCUS_15460 4237 2969 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943626.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence198 995 1525 gene locus_tag LOCUS_15470 995 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 1527 2069 gene locus_tag LOCUS_15480 1527 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 2087 3604 gene locus_tag LOCUS_15490 gene mshL 2087 3604 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456314.1 protein_id gnl|my_center|LOCUS_15490 3725 4300 gene locus_tag LOCUS_15500 3725 4300 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387873.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence199 1279 20 gene locus_tag LOCUS_15510 1279 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 2308 1415 gene locus_tag LOCUS_15520 2308 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15520 2913 2305 gene locus_tag LOCUS_15530 2913 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15530 3667 4485 gene locus_tag LOCUS_15540 3667 4485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 >Feature sequence200 1526 207 gene locus_tag LOCUS_15550 1526 207 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272661.1 protein_id gnl|my_center|LOCUS_15550 1766 2584 gene locus_tag LOCUS_15560 1766 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 2805 3710 gene locus_tag LOCUS_15570 gene lpxC 2805 3710 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948308.1 protein_id gnl|my_center|LOCUS_15570 3711 4280 gene locus_tag LOCUS_15580 3711 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 >Feature sequence201 1295 2566 gene locus_tag LOCUS_15590 1295 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 4270 2555 gene locus_tag LOCUS_15600 4270 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 >Feature sequence202 654 1286 gene locus_tag LOCUS_15610 654 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 4156 1283 gene locus_tag LOCUS_15620 gene glnE 4156 1283 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114555.1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence203 996 610 gene locus_tag LOCUS_15630 gene ybeY 996 610 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942921.1 protein_id gnl|my_center|LOCUS_15630 3346 983 gene locus_tag LOCUS_15640 3346 983 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_15640 3731 4255 gene locus_tag LOCUS_15650 3731 4255 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938481.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence204 2692 431 gene locus_tag LOCUS_15660 2692 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 3097 3279 gene locus_tag LOCUS_15670 3097 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 3572 3333 gene locus_tag LOCUS_15680 3572 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 4167 3934 gene locus_tag LOCUS_15690 4167 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence205 123 683 gene locus_tag LOCUS_15700 123 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 676 1584 gene locus_tag LOCUS_15710 676 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1584 2246 gene locus_tag LOCUS_15720 gene radC 1584 2246 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546157.1 protein_id gnl|my_center|LOCUS_15720 2828 2256 gene locus_tag LOCUS_15730 2828 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 3933 2830 gene locus_tag LOCUS_15740 3933 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 >Feature sequence206 444 1628 gene locus_tag LOCUS_15750 444 1628 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_15750 1684 2346 gene locus_tag LOCUS_15760 1684 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 2731 2456 gene locus_tag LOCUS_15770 2731 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence207 >Feature sequence208 484 1059 gene locus_tag LOCUS_15780 484 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 1157 1630 gene locus_tag LOCUS_15790 1157 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15790 1630 2142 gene locus_tag LOCUS_15800 1630 2142 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837364.1 protein_id gnl|my_center|LOCUS_15800 2143 4137 gene locus_tag LOCUS_15810 2143 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15810 >Feature sequence209 930 172 gene locus_tag LOCUS_15820 930 172 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_15820 2433 1093 gene locus_tag LOCUS_15830 2433 1093 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583493.1 protein_id gnl|my_center|LOCUS_15830 2738 3508 gene locus_tag LOCUS_15840 2738 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 >Feature sequence210 645 1127 gene locus_tag LOCUS_15850 645 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 2599 1175 gene locus_tag LOCUS_15860 gene cobB 2599 1175 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545628.1 protein_id gnl|my_center|LOCUS_15860 2856 2614 gene locus_tag LOCUS_15870 2856 2614 CDS product dissimilatory sulfite reductase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937711.1 protein_id gnl|my_center|LOCUS_15870 4092 2944 gene locus_tag LOCUS_15880 gene dsrB 4092 2944 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937710.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence211 526 747 gene locus_tag LOCUS_15890 526 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 719 1147 gene locus_tag LOCUS_15900 719 1147 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484774.1 protein_id gnl|my_center|LOCUS_15900 2743 1211 gene locus_tag LOCUS_15910 2743 1211 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_15910 3231 3452 gene locus_tag LOCUS_15920 3231 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 3489 3815 gene locus_tag LOCUS_15930 3489 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 >Feature sequence212 312 2201 gene locus_tag LOCUS_15940 312 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 2221 2296 gene locus_tag LOCUS_t00290 2221 2296 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3096 2800 gene locus_tag LOCUS_15950 3096 2800 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869995.1 protein_id gnl|my_center|LOCUS_15950 3374 3093 gene locus_tag LOCUS_15960 3374 3093 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086649.1 protein_id gnl|my_center|LOCUS_15960 4077 3847 gene locus_tag LOCUS_15970 4077 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 >Feature sequence213 471 568 gene locus_tag LOCUS_t00300 471 568 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 1634 582 gene locus_tag LOCUS_15980 gene lptG 1634 582 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870030.1 protein_id gnl|my_center|LOCUS_15980 2126 1755 gene locus_tag LOCUS_15990 2126 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 2349 2119 gene locus_tag LOCUS_16000 2349 2119 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_16000 3626 2463 gene locus_tag LOCUS_16010 gene lptF 3626 2463 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_16010 <4186 3659 gene locus_tag LOCUS_16020 <4186 3659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009903674.1:folylpolyglutamate synthase/dihydrofolate synthase family protein >Feature sequence214 338 1141 gene locus_tag LOCUS_16030 338 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 1207 1590 gene locus_tag LOCUS_16040 1207 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 1593 2060 gene locus_tag LOCUS_16050 1593 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 2969 2226 gene locus_tag LOCUS_16060 2969 2226 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022138.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence215 263 748 gene locus_tag LOCUS_16070 gene mobB 263 748 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460721.1 protein_id gnl|my_center|LOCUS_16070 894 818 gene locus_tag LOCUS_t00310 894 818 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1207 1890 gene locus_tag LOCUS_16080 1207 1890 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939817.1 protein_id gnl|my_center|LOCUS_16080 1929 3395 gene locus_tag LOCUS_16090 gene selA 1929 3395 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048015.1 protein_id gnl|my_center|LOCUS_16090 3400 3984 gene locus_tag LOCUS_16100 3400 3984 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939175.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence216 506 1114 gene locus_tag LOCUS_16110 506 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16110 1135 1596 gene locus_tag LOCUS_16120 1135 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 1593 2222 gene locus_tag LOCUS_16130 1593 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 2267 2911 gene locus_tag LOCUS_16140 2267 2911 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203128.1 protein_id gnl|my_center|LOCUS_16140 3060 3809 gene locus_tag LOCUS_16150 3060 3809 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546386.1 protein_id gnl|my_center|LOCUS_16150 3806 4057 gene locus_tag LOCUS_16160 3806 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 >Feature sequence217 2121 430 gene locus_tag LOCUS_16170 2121 430 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_16170 3346 2159 gene locus_tag LOCUS_16180 3346 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 3562 3840 gene locus_tag LOCUS_16190 3562 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence218 2881 2405 gene locus_tag LOCUS_16200 2881 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 3824 3081 gene locus_tag LOCUS_16210 3824 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 4109 3849 gene locus_tag LOCUS_16220 4109 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence219 <1 645 gene locus_tag LOCUS_16230 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005168769.1:methyl-accepting chemotaxis protein 1162 731 gene locus_tag LOCUS_16240 gene tsaA 1162 731 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546312.1 protein_id gnl|my_center|LOCUS_16240 1506 1177 gene locus_tag LOCUS_16250 1506 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 3337 1496 gene locus_tag LOCUS_16260 3337 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 >Feature sequence220 <1 2115 gene locus_tag LOCUS_16270 <1 2115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545463.1:type III-A CRISPR-associated protein Cas10/Csm1 2126 2530 gene locus_tag LOCUS_16280 gene csm2 2126 2530 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546668.1 protein_id gnl|my_center|LOCUS_16280 2545 3240 gene locus_tag LOCUS_16290 gene csm3 2545 3240 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545508.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence221 460 1367 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcaatcccttcttaaatcaggtcaattctttc 1881 1603 gene locus_tag LOCUS_16300 gene cas2 1881 1603 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392029.1 protein_id gnl|my_center|LOCUS_16300 2158 1883 gene locus_tag LOCUS_16310 gene cas2 2158 1883 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256456.1 protein_id gnl|my_center|LOCUS_16310 3312 2155 gene locus_tag LOCUS_16320 3312 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 3876 3439 gene locus_tag LOCUS_16330 3876 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 >Feature sequence222 430 1020 gene locus_tag LOCUS_16340 430 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence223 495 1058 gene locus_tag LOCUS_16350 495 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 1183 1728 gene locus_tag LOCUS_16360 1183 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1756 2301 gene locus_tag LOCUS_16370 1756 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 2294 3076 gene locus_tag LOCUS_16380 2294 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 3076 3885 gene locus_tag LOCUS_16390 3076 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence224 454 176 gene locus_tag LOCUS_16400 454 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1076 654 gene locus_tag LOCUS_16410 gene hicB 1076 654 CDS product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077627724.1 protein_id gnl|my_center|LOCUS_16410 1258 1073 gene locus_tag LOCUS_16420 1258 1073 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928914.1 protein_id gnl|my_center|LOCUS_16420 1787 1413 gene locus_tag LOCUS_16430 1787 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 2101 1784 gene locus_tag LOCUS_16440 2101 1784 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211161.1 protein_id gnl|my_center|LOCUS_16440 2742 2485 gene locus_tag LOCUS_16450 2742 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 3532 2954 gene locus_tag LOCUS_16460 3532 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 >Feature sequence225 478 1458 gene locus_tag LOCUS_16470 478 1458 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546449.1 protein_id gnl|my_center|LOCUS_16470 1455 3224 gene locus_tag LOCUS_16480 1455 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 3190 3855 gene locus_tag LOCUS_16490 3190 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 3893 3979 gene locus_tag LOCUS_t00320 3893 3979 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence226 2813 717 gene locus_tag LOCUS_16500 2813 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 <3955 2803 gene locus_tag LOCUS_16510 <3955 2803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444593.1:AmmeMemoRadiSam system protein B >Feature sequence227 43 1689 gene locus_tag LOCUS_16520 43 1689 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387750.1 protein_id gnl|my_center|LOCUS_16520 1709 3397 gene locus_tag LOCUS_16530 1709 3397 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387750.1 protein_id gnl|my_center|LOCUS_16530 >Feature sequence228 632 862 gene locus_tag LOCUS_16540 632 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 855 1109 gene locus_tag LOCUS_16550 855 1109 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_16550 1180 2262 gene locus_tag LOCUS_16560 gene wecB 1180 2262 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_16560 2723 2950 gene locus_tag LOCUS_16570 2723 2950 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_16570 2962 3324 gene locus_tag LOCUS_16580 2962 3324 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143969.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence229 205 384 gene locus_tag LOCUS_16590 205 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 1485 496 gene locus_tag LOCUS_16600 1485 496 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104632.1 protein_id gnl|my_center|LOCUS_16600 1918 1502 gene locus_tag LOCUS_16610 1918 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 1997 2449 gene locus_tag LOCUS_16620 1997 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 3753 2653 gene locus_tag LOCUS_16630 3753 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence230 239 1669 gene locus_tag LOCUS_16640 gene pyk 239 1669 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066546.1 protein_id gnl|my_center|LOCUS_16640 1887 1963 gene locus_tag LOCUS_t00330 1887 1963 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2398 2183 gene locus_tag LOCUS_16650 2398 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 3549 2377 gene locus_tag LOCUS_16660 3549 2377 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence231 1740 370 gene locus_tag LOCUS_16670 gene asnS 1740 370 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937318.1 protein_id gnl|my_center|LOCUS_16670 3616 1742 gene locus_tag LOCUS_16680 3616 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 >Feature sequence232 835 512 gene locus_tag LOCUS_16690 835 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 1794 1096 gene locus_tag LOCUS_16700 1794 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 1942 1742 gene locus_tag LOCUS_16710 1942 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 2217 2765 gene locus_tag LOCUS_16720 2217 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 2772 3191 gene locus_tag LOCUS_16730 2772 3191 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393157.1 protein_id gnl|my_center|LOCUS_16730 3277 3609 gene locus_tag LOCUS_16740 3277 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence233 90 527 gene locus_tag LOCUS_16750 90 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 579 3347 gene locus_tag LOCUS_16760 gene fdhF 579 3347 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 transl_except (pos:1710..1712,aa:Sec) note codon on position 378 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_16760 >Feature sequence234 <1 870 gene locus_tag LOCUS_16770 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942465.1:[protein-PII] uridylyltransferase 1130 2428 gene locus_tag LOCUS_16780 1130 2428 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545822.1 protein_id gnl|my_center|LOCUS_16780 2563 2901 gene locus_tag LOCUS_16790 2563 2901 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_16790 2913 3500 gene locus_tag LOCUS_16800 2913 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16800 3596 3781 gene locus_tag LOCUS_16810 3596 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16810 >Feature sequence235 <3815 1316 gene locus_tag LOCUS_16820 <3815 1316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389851.1:translocation/assembly module TamB domain-containing protein >Feature sequence236 3808 1025 gene locus_tag LOCUS_16830 3808 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence237 968 171 gene locus_tag LOCUS_16840 gene fetB 968 171 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_16840 1644 1009 gene locus_tag LOCUS_16850 1644 1009 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090793.1 protein_id gnl|my_center|LOCUS_16850 3503 1641 gene locus_tag LOCUS_16860 gene mnmG 3503 1641 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence238 952 344 gene locus_tag LOCUS_16870 952 344 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_16870 1339 989 gene locus_tag LOCUS_16880 1339 989 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146466.1 protein_id gnl|my_center|LOCUS_16880 1509 1354 gene locus_tag LOCUS_16890 1509 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 2882 1578 gene locus_tag LOCUS_16900 gene nrfD 2882 1578 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937995.1 protein_id gnl|my_center|LOCUS_16900 3725 2910 gene locus_tag LOCUS_16910 3725 2910 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937996.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence239 258 70 gene locus_tag LOCUS_16920 258 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 907 829 gene locus_tag LOCUS_t00340 907 829 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1121 1046 gene locus_tag LOCUS_t00350 1121 1046 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3627 1195 gene locus_tag LOCUS_16930 gene lon 3627 1195 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705882.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence240 301 104 gene locus_tag LOCUS_16940 301 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 1278 616 gene locus_tag LOCUS_16950 1278 616 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965552.1 protein_id gnl|my_center|LOCUS_16950 2920 1265 gene locus_tag LOCUS_16960 2920 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 >Feature sequence241 1516 230 gene locus_tag LOCUS_16970 gene tyrS 1516 230 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_16970 3196 1634 gene locus_tag LOCUS_16980 gene rny 3196 1634 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_16980 >Feature sequence242 2 1192 gene locus_tag LOCUS_16990 2 1192 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186167.1 protein_id gnl|my_center|LOCUS_16990 1354 3117 gene locus_tag LOCUS_17000 1354 3117 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546634.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence243 999 112 gene locus_tag LOCUS_17010 999 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 1555 1196 gene locus_tag LOCUS_17020 1555 1196 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969010.1 protein_id gnl|my_center|LOCUS_17020 1817 1521 gene locus_tag LOCUS_17030 1817 1521 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969011.1 protein_id gnl|my_center|LOCUS_17030 2831 1998 gene locus_tag LOCUS_17040 2831 1998 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948584.1 protein_id gnl|my_center|LOCUS_17040 >Feature sequence244 95 1090 gene locus_tag LOCUS_17050 gene waaC 95 1090 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_17050 1094 1729 gene locus_tag LOCUS_17060 1094 1729 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_17060 1751 2209 gene locus_tag LOCUS_17070 1751 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 2221 3210 gene locus_tag LOCUS_17080 2221 3210 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_17080 >Feature sequence245 2668 1103 gene locus_tag LOCUS_17090 gene metG 2668 1103 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939333.1 protein_id gnl|my_center|LOCUS_17090 3486 2689 gene locus_tag LOCUS_17100 3486 2689 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence246 <1 931 gene locus_tag LOCUS_17110 <1 931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583289.1:radical SAM protein 1166 990 gene locus_tag LOCUS_17120 1166 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 1588 1250 gene locus_tag LOCUS_17130 1588 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 2357 1713 gene locus_tag LOCUS_17140 gene thiE 2357 1713 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_17140 2560 2354 gene locus_tag LOCUS_17150 gene thiS 2560 2354 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919747.1 protein_id gnl|my_center|LOCUS_17150 3711 2596 gene locus_tag LOCUS_17160 gene thiH 3711 2596 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962602.1 protein_id gnl|my_center|LOCUS_17160 >Feature sequence247 1091 252 gene locus_tag LOCUS_17170 1091 252 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390485.1 protein_id gnl|my_center|LOCUS_17170 1515 2708 gene locus_tag LOCUS_17180 1515 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 2829 3200 gene locus_tag LOCUS_17190 2829 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence248 1826 450 gene locus_tag LOCUS_17200 1826 450 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880700.1 protein_id gnl|my_center|LOCUS_17200 3099 1885 gene locus_tag LOCUS_17210 3099 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 >Feature sequence249 2313 862 gene locus_tag LOCUS_17220 gene flhF 2313 862 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965445.1 protein_id gnl|my_center|LOCUS_17220 <3693 2303 gene locus_tag LOCUS_17230 <3693 2303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943681.1:flagellar biosynthesis protein FlhA >Feature sequence250 1734 529 gene locus_tag LOCUS_17240 1734 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 2602 1715 gene locus_tag LOCUS_17250 2602 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 <3677 3095 gene locus_tag LOCUS_17260 <3677 3095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015943077.1:glycosyltransferase >Feature sequence251 2162 3277 gene locus_tag LOCUS_17270 2162 3277 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025517.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence252 1101 496 gene locus_tag LOCUS_17280 1101 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 1993 1115 gene locus_tag LOCUS_17290 1993 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 2981 2001 gene locus_tag LOCUS_17300 2981 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 >Feature sequence253 332 1489 gene locus_tag LOCUS_17310 332 1489 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433836.1 protein_id gnl|my_center|LOCUS_17310 2213 1566 gene locus_tag LOCUS_17320 2213 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 2645 3490 gene locus_tag LOCUS_17330 2645 3490 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence254 257 694 gene locus_tag LOCUS_17340 gene flgC 257 694 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_17340 697 1005 gene locus_tag LOCUS_17350 gene fliE 697 1005 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986961.1 protein_id gnl|my_center|LOCUS_17350 1092 2654 gene locus_tag LOCUS_17360 gene fliF 1092 2654 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941078.1 protein_id gnl|my_center|LOCUS_17360 2661 3017 gene locus_tag LOCUS_17370 2661 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 3053 3619 gene locus_tag LOCUS_17380 3053 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17380 >Feature sequence255 138 1343 gene locus_tag LOCUS_17390 138 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1449 2600 gene locus_tag LOCUS_17400 1449 2600 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_17400 2597 3190 gene locus_tag LOCUS_17410 2597 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence256 185 451 gene locus_tag LOCUS_17420 185 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 1086 1265 gene locus_tag LOCUS_17430 1086 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17430 >Feature sequence257 <3591 2799 gene locus_tag LOCUS_17440 <3591 2799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681379.1:restriction endonuclease subunit S >Feature sequence258 <1 683 gene locus_tag LOCUS_17450 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903589.1:electron transfer flavoprotein subunit beta/FixA family protein 683 1651 gene locus_tag LOCUS_17460 683 1651 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877798.1 protein_id gnl|my_center|LOCUS_17460 1744 2850 gene locus_tag LOCUS_17470 1744 2850 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941162.1 protein_id gnl|my_center|LOCUS_17470 3195 2854 gene locus_tag LOCUS_17480 3195 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3412 3498 gene locus_tag LOCUS_t00360 3412 3498 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence259 745 1287 gene locus_tag LOCUS_17490 745 1287 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938826.1 protein_id gnl|my_center|LOCUS_17490 1284 1811 gene locus_tag LOCUS_17500 1284 1811 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938827.1 protein_id gnl|my_center|LOCUS_17500 2695 1934 gene locus_tag LOCUS_17510 gene truA 2695 1934 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048349.1 protein_id gnl|my_center|LOCUS_17510 2916 3362 gene locus_tag LOCUS_17520 2916 3362 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939197.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence260 1625 447 gene locus_tag LOCUS_17530 1625 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2607 1684 gene locus_tag LOCUS_17540 2607 1684 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392705.1 protein_id gnl|my_center|LOCUS_17540 3350 2679 gene locus_tag LOCUS_17550 3350 2679 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392706.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence261 560 288 gene locus_tag LOCUS_17560 gene hupB 560 288 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081127.1 protein_id gnl|my_center|LOCUS_17560 1891 704 gene locus_tag LOCUS_17570 gene ftsY 1891 704 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_17570 3196 1964 gene locus_tag LOCUS_17580 3196 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 >Feature sequence262 151 615 gene locus_tag LOCUS_17590 151 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 798 1196 gene locus_tag LOCUS_17600 798 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 1248 2915 gene locus_tag LOCUS_17610 1248 2915 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037071209.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence263 7 237 gene locus_tag LOCUS_17620 7 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 564 836 gene locus_tag LOCUS_17630 564 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 817 1152 gene locus_tag LOCUS_17640 817 1152 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074374.1 protein_id gnl|my_center|LOCUS_17640 1273 1716 gene locus_tag LOCUS_17650 1273 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544980.1 protein_id gnl|my_center|LOCUS_17650 2039 2242 gene locus_tag LOCUS_17660 2039 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 2679 2290 gene locus_tag LOCUS_17670 2679 2290 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_17670 2900 2676 gene locus_tag LOCUS_17680 2900 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 >Feature sequence264 208 1878 gene locus_tag LOCUS_17690 gene nadB 208 1878 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_17690 1969 3192 gene locus_tag LOCUS_17700 1969 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 3318 3241 gene locus_tag LOCUS_t00370 3318 3241 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3412 3340 gene locus_tag LOCUS_t00380 3412 3340 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence265 1489 1932 gene locus_tag LOCUS_17710 1489 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 2949 1969 gene locus_tag LOCUS_17720 2949 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence266 356 1219 gene locus_tag LOCUS_17730 gene mtnP 356 1219 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_17730 1402 1280 gene locus_tag LOCUS_17740 1402 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 2891 1395 gene locus_tag LOCUS_17750 2891 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 >Feature sequence267 375 1370 gene locus_tag LOCUS_17760 gene fliM 375 1370 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938209.1 protein_id gnl|my_center|LOCUS_17760 1363 1689 gene locus_tag LOCUS_17770 gene fliN 1363 1689 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941090.1 protein_id gnl|my_center|LOCUS_17770 1686 1991 gene locus_tag LOCUS_17780 1686 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 2110 2889 gene locus_tag LOCUS_17790 gene fliP 2110 2889 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_17790 2897 3166 gene locus_tag LOCUS_17800 gene fliQ 2897 3166 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937354.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence268 <1 588 gene locus_tag LOCUS_17810 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940692.1:DnaJ C-terminal domain-containing protein 602 1120 gene locus_tag LOCUS_17820 gene hpt 602 1120 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_17820 1136 3346 gene locus_tag LOCUS_17830 1136 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence269 594 160 gene locus_tag LOCUS_17840 gene paaI 594 160 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391943.1 protein_id gnl|my_center|LOCUS_17840 1378 1178 gene locus_tag LOCUS_17850 1378 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 1897 1475 gene locus_tag LOCUS_17860 1897 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 2316 1894 gene locus_tag LOCUS_17870 2316 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 3015 3467 gene locus_tag LOCUS_17880 3015 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 >Feature sequence270 <1 947 gene locus_tag LOCUS_17890 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196953.1:hopanoid biosynthesis associated radical SAM protein HpnJ 1330 1458 gene locus_tag LOCUS_17900 1330 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 1455 2723 gene locus_tag LOCUS_17910 1455 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence271 809 519 gene locus_tag LOCUS_17920 809 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 1749 904 gene locus_tag LOCUS_17930 1749 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 2147 1872 gene locus_tag LOCUS_17940 2147 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 3320 2403 gene locus_tag LOCUS_17950 3320 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence272 968 426 gene locus_tag LOCUS_17960 968 426 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146568.1 protein_id gnl|my_center|LOCUS_17960 1774 971 gene locus_tag LOCUS_17970 1774 971 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942115.1 protein_id gnl|my_center|LOCUS_17970 2884 1778 gene locus_tag LOCUS_17980 2884 1778 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939231.1 protein_id gnl|my_center|LOCUS_17980 3068 2892 gene locus_tag LOCUS_17990 3068 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence273 140 1345 gene locus_tag LOCUS_18000 140 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 1363 3255 gene locus_tag LOCUS_18010 1363 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 >Feature sequence274 <1 573 gene locus_tag LOCUS_18020 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022007.1:PAS domain-containing protein 868 1338 gene locus_tag LOCUS_18030 868 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 3306 1549 gene locus_tag LOCUS_18040 3306 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence275 323 30 gene locus_tag LOCUS_18050 323 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 603 358 gene locus_tag LOCUS_18060 603 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 1443 688 gene locus_tag LOCUS_18070 1443 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 2005 1595 gene locus_tag LOCUS_18080 2005 1595 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_18080 <3438 2073 gene locus_tag LOCUS_18090 <3438 2073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938076.1:F0F1 ATP synthase subunit beta >Feature sequence276 123 1436 gene locus_tag LOCUS_18100 gene gnfL 123 1436 CDS product nitrogen fixation sensor histidine kinase GnfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941669.1 protein_id gnl|my_center|LOCUS_18100 1515 2864 gene locus_tag LOCUS_18110 1515 2864 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842237.1 protein_id gnl|my_center|LOCUS_18110 3127 2939 gene locus_tag LOCUS_18120 3127 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence277 403 600 gene locus_tag LOCUS_18130 403 600 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942676.1 protein_id gnl|my_center|LOCUS_18130 610 1662 gene locus_tag LOCUS_18140 gene pilM 610 1662 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_18140 1659 2249 gene locus_tag LOCUS_18150 1659 2249 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942674.1 protein_id gnl|my_center|LOCUS_18150 2249 2887 gene locus_tag LOCUS_18160 2249 2887 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942673.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence278 692 1276 gene locus_tag LOCUS_18170 692 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 1293 2663 gene locus_tag LOCUS_18180 1293 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence279 2314 320 gene locus_tag LOCUS_18190 2314 320 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023875.1 protein_id gnl|my_center|LOCUS_18190 3026 2343 gene locus_tag LOCUS_18200 3026 2343 CDS product CAAX prenyl protease-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942635.1 protein_id gnl|my_center|LOCUS_18200 >Feature sequence280 1096 206 gene locus_tag LOCUS_18210 1096 206 CDS product UbiA-like polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205587.1 protein_id gnl|my_center|LOCUS_18210 1872 1126 gene locus_tag LOCUS_18220 1872 1126 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940624.1 protein_id gnl|my_center|LOCUS_18220 2051 2329 gene locus_tag LOCUS_18230 2051 2329 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence281 2937 2233 gene locus_tag LOCUS_18240 2937 2233 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109792089.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence282 971 21 gene locus_tag LOCUS_18250 971 21 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942288.1 protein_id gnl|my_center|LOCUS_18250 1222 2484 gene locus_tag LOCUS_18260 1222 2484 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_18260 2488 2904 gene locus_tag LOCUS_18270 2488 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence283 165 437 gene locus_tag LOCUS_18280 165 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 407 1156 gene locus_tag LOCUS_18290 407 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 1256 2641 gene locus_tag LOCUS_18300 1256 2641 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062283476.1 protein_id gnl|my_center|LOCUS_18300 2653 3309 gene locus_tag LOCUS_18310 2653 3309 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773049.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence284 708 3131 gene locus_tag LOCUS_18320 708 3131 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169250172.1 protein_id gnl|my_center|LOCUS_18320 >Feature sequence285 214 870 gene locus_tag LOCUS_18330 gene rpe 214 870 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_18330 886 1314 gene locus_tag LOCUS_18340 gene arfB 886 1314 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090218.1 protein_id gnl|my_center|LOCUS_18340 2960 1377 gene locus_tag LOCUS_18350 2960 1377 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940375.1 protein_id gnl|my_center|LOCUS_18350 >Feature sequence286 1549 617 gene locus_tag LOCUS_18360 1549 617 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_18360 1699 2622 gene locus_tag LOCUS_18370 1699 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 >Feature sequence287 <3292 126 gene locus_tag LOCUS_18380 <3292 126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776318.1:glutamine--fructose-6-phosphate transaminase (isomerizing) >Feature sequence288 <1 663 gene locus_tag LOCUS_18390 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990687.1:formylglycine-generating enzyme family protein note possible pseudo, internal stop codon 960 1169 gene locus_tag LOCUS_18400 960 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 1267 2445 gene locus_tag LOCUS_18410 1267 2445 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence289 1515 349 gene locus_tag LOCUS_18420 1515 349 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_18420 2358 1525 gene locus_tag LOCUS_18430 gene dapF 2358 1525 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence290 >Feature sequence291 365 2212 gene locus_tag LOCUS_18440 365 2212 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970940.1 protein_id gnl|my_center|LOCUS_18440 2470 2778 gene locus_tag LOCUS_18450 2470 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 >Feature sequence292 507 184 gene locus_tag LOCUS_18460 507 184 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942007.1 protein_id gnl|my_center|LOCUS_18460 680 501 gene locus_tag LOCUS_18470 680 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 1373 828 gene locus_tag LOCUS_18480 1373 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 2212 1373 gene locus_tag LOCUS_18490 2212 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 <3185 2332 gene locus_tag LOCUS_18500 <3185 2332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_220354845.1:restriction endonuclease >Feature sequence293 1690 581 gene locus_tag LOCUS_18510 gene rlmN 1690 581 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_18510 <3167 1647 gene locus_tag LOCUS_18520 <3167 1647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142843.1:SDR family NAD(P)-dependent oxidoreductase >Feature sequence294 2749 1121 gene locus_tag LOCUS_18530 gene hflX 2749 1121 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941674.1 protein_id gnl|my_center|LOCUS_18530 >Feature sequence295 52 1092 gene locus_tag LOCUS_18540 52 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 1159 2283 gene locus_tag LOCUS_18550 1159 2283 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650924.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence296 1971 832 gene locus_tag LOCUS_18560 1971 832 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_18560 >Feature sequence297 1197 67 gene locus_tag LOCUS_18570 1197 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 2533 1328 gene locus_tag LOCUS_18580 2533 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 <3145 2517 gene locus_tag LOCUS_18590 <3145 2517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_218919404.1:DapH/DapD/GlmU-related protein >Feature sequence298 416 1990 gene locus_tag LOCUS_18600 416 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence299 1231 257 gene locus_tag LOCUS_18610 1231 257 CDS product NgoFVII family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280501.1 protein_id gnl|my_center|LOCUS_18610 2419 1244 gene locus_tag LOCUS_18620 2419 1244 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869708.1 protein_id gnl|my_center|LOCUS_18620 2930 2409 gene locus_tag LOCUS_18630 2930 2409 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970457.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence300 360 833 gene locus_tag LOCUS_18640 360 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18640 905 1585 gene locus_tag LOCUS_18650 905 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18650 1667 2854 gene locus_tag LOCUS_18660 1667 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence301 998 258 gene locus_tag LOCUS_18670 998 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 1591 1382 gene locus_tag LOCUS_18680 1591 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 1733 1981 gene locus_tag LOCUS_18690 1733 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 1988 2182 gene locus_tag LOCUS_18700 1988 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18700 2643 2383 gene locus_tag LOCUS_18710 2643 2383 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_18710 2885 2643 gene locus_tag LOCUS_18720 2885 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence302 974 450 gene locus_tag LOCUS_18730 974 450 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357763.1 protein_id gnl|my_center|LOCUS_18730 1740 979 gene locus_tag LOCUS_18740 1740 979 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867247.1 protein_id gnl|my_center|LOCUS_18740 2392 3045 gene locus_tag LOCUS_18750 2392 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 >Feature sequence303 2 403 gene locus_tag LOCUS_18760 2 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 2652 772 gene locus_tag LOCUS_18770 2652 772 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence304 798 3080 gene locus_tag LOCUS_18780 gene lonB 798 3080 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902178.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence305 371 129 gene locus_tag LOCUS_18790 371 129 CDS product DUF6364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404326.1 protein_id gnl|my_center|LOCUS_18790 796 647 gene locus_tag LOCUS_18800 796 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 974 2770 gene locus_tag LOCUS_18810 974 2770 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948373.1 protein_id gnl|my_center|LOCUS_18810 >Feature sequence306 1270 419 gene locus_tag LOCUS_18820 1270 419 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_18820 2353 1280 gene locus_tag LOCUS_18830 2353 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392352.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence307 239 1816 gene locus_tag LOCUS_18840 239 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 1820 2770 gene locus_tag LOCUS_18850 1820 2770 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence308 538 236 gene locus_tag LOCUS_18860 538 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 764 471 gene locus_tag LOCUS_18870 764 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 1426 914 gene locus_tag LOCUS_18880 1426 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 1907 1455 gene locus_tag LOCUS_18890 1907 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 2646 2020 gene locus_tag LOCUS_18900 2646 2020 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942196.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence309 3 866 gene locus_tag LOCUS_18910 gene galE 3 866 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987061.1 protein_id gnl|my_center|LOCUS_18910 1568 885 gene locus_tag LOCUS_18920 1568 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 <3086 1672 gene locus_tag LOCUS_18930 <3086 1672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939485.1:YcaO-like family protein >Feature sequence310 19 825 gene locus_tag LOCUS_18940 19 825 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_18940 2819 876 gene locus_tag LOCUS_18950 2819 876 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403289.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence311 227 475 gene locus_tag LOCUS_18960 227 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 892 2604 gene locus_tag LOCUS_18970 892 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence312 444 1856 gene locus_tag LOCUS_18980 444 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence313 1477 1812 gene locus_tag LOCUS_18990 1477 1812 CDS product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071871.1 protein_id gnl|my_center|LOCUS_18990 <3047 1859 gene locus_tag LOCUS_19000 <3047 1859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943874.1:excinuclease ABC subunit UvrB >Feature sequence314 316 131 gene locus_tag LOCUS_19010 316 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 1514 264 gene locus_tag LOCUS_19020 1514 264 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791443.1 protein_id gnl|my_center|LOCUS_19020 2208 1528 gene locus_tag LOCUS_19030 2208 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 2843 2214 gene locus_tag LOCUS_19040 2843 2214 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence315 1987 2283 gene locus_tag LOCUS_19050 1987 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 >Feature sequence316 308 844 gene locus_tag LOCUS_19060 308 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 961 1533 gene locus_tag LOCUS_19070 961 1533 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440210.1 protein_id gnl|my_center|LOCUS_19070 1608 2891 gene locus_tag LOCUS_19080 gene hemL 1608 2891 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941005.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence317 1839 280 gene locus_tag LOCUS_19090 1839 280 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461578.1 protein_id gnl|my_center|LOCUS_19090 2583 1840 gene locus_tag LOCUS_19100 gene cobB1 2583 1840 CDS product NAD-dependent protein deacylase Cob1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879172.1 protein_id gnl|my_center|LOCUS_19100 >Feature sequence318 1679 2311 gene locus_tag LOCUS_19110 1679 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 >Feature sequence319 708 127 gene locus_tag LOCUS_19120 708 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 1426 773 gene locus_tag LOCUS_19130 1426 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 2229 1678 gene locus_tag LOCUS_19140 2229 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence320 238 786 gene locus_tag LOCUS_19150 238 786 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877617.1 protein_id gnl|my_center|LOCUS_19150 884 1069 gene locus_tag LOCUS_19160 884 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 1947 1129 gene locus_tag LOCUS_19170 gene epmA 1947 1129 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942397.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence321 <1 894 gene locus_tag LOCUS_19180 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459112.1:dipeptide ABC transporter ATP-binding protein 879 1817 gene locus_tag LOCUS_19190 879 1817 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023386.1 protein_id gnl|my_center|LOCUS_19190 1814 2665 gene locus_tag LOCUS_19200 1814 2665 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990759.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence322 2954 684 gene locus_tag LOCUS_19210 2954 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 >Feature sequence323 723 400 gene locus_tag LOCUS_19220 723 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 1315 1902 gene locus_tag LOCUS_19230 1315 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 2959 2177 gene locus_tag LOCUS_19240 2959 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 >Feature sequence324 1 123 gene locus_tag LOCUS_19250 1 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 110 544 gene locus_tag LOCUS_19260 110 544 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067454.1 protein_id gnl|my_center|LOCUS_19260 584 1588 gene locus_tag LOCUS_19270 gene gap 584 1588 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219957.1 protein_id gnl|my_center|LOCUS_19270 1604 2359 gene locus_tag LOCUS_19280 gene tpiA 1604 2359 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942272.1 protein_id gnl|my_center|LOCUS_19280 2392 2748 gene locus_tag LOCUS_19290 gene secG 2392 2748 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942271.1 protein_id gnl|my_center|LOCUS_19290 2760 2846 gene locus_tag LOCUS_t00390 2760 2846 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence325 <1 860 gene locus_tag LOCUS_19300 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946660.1:penicillin-binding protein 1A 1446 1081 gene locus_tag LOCUS_19310 1446 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 2733 2371 gene locus_tag LOCUS_19320 2733 2371 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356595.1 protein_id gnl|my_center|LOCUS_19320 >Feature sequence326 476 2593 gene locus_tag LOCUS_19330 476 2593 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878258.1 protein_id gnl|my_center|LOCUS_19330 >Feature sequence327 587 2332 gene locus_tag LOCUS_19340 587 2332 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence328 171 1481 gene locus_tag LOCUS_19350 171 1481 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940434.1 protein_id gnl|my_center|LOCUS_19350 >Feature sequence329 808 368 gene locus_tag LOCUS_19360 gene rsfS 808 368 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943827.1 protein_id gnl|my_center|LOCUS_19360 1482 805 gene locus_tag LOCUS_19370 gene nadD 1482 805 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841927.1 protein_id gnl|my_center|LOCUS_19370 2749 1493 gene locus_tag LOCUS_19380 2749 1493 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 protein_id gnl|my_center|LOCUS_19380 >Feature sequence330 316 567 gene locus_tag LOCUS_19390 316 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 568 1353 gene locus_tag LOCUS_19400 568 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 >Feature sequence331 456 196 gene locus_tag LOCUS_19410 456 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 548 1045 gene locus_tag LOCUS_19420 548 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 2099 1167 gene locus_tag LOCUS_19430 2099 1167 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_19430 2558 2232 gene locus_tag LOCUS_19440 2558 2232 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_19440 2787 2548 gene locus_tag LOCUS_19450 2787 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence332 2315 1122 gene locus_tag LOCUS_19460 2315 1122 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087142.1 protein_id gnl|my_center|LOCUS_19460 >Feature sequence333 64 459 gene locus_tag LOCUS_19470 64 459 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770889.1 protein_id gnl|my_center|LOCUS_19470 693 1538 gene locus_tag LOCUS_19480 693 1538 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208285.1 protein_id gnl|my_center|LOCUS_19480 1627 2118 gene locus_tag LOCUS_19490 1627 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 >Feature sequence334 715 1113 gene locus_tag LOCUS_19500 715 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 1139 1465 gene locus_tag LOCUS_19510 1139 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 1476 1868 gene locus_tag LOCUS_19520 1476 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 1846 2049 gene locus_tag LOCUS_19530 1846 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2042 2296 gene locus_tag LOCUS_19540 2042 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19540 2308 2751 gene locus_tag LOCUS_19550 2308 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence335 189 527 gene locus_tag LOCUS_19560 189 527 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_19560 556 1887 gene locus_tag LOCUS_19570 556 1887 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405103.1 protein_id gnl|my_center|LOCUS_19570 >Feature sequence336 1859 174 gene locus_tag LOCUS_19580 1859 174 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940474.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence337 1581 577 gene locus_tag LOCUS_19590 1581 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 2233 1559 gene locus_tag LOCUS_19600 2233 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 2654 2190 gene locus_tag LOCUS_19610 2654 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 >Feature sequence338 137 2752 gene locus_tag LOCUS_19620 gene glnD 137 2752 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence339 <1 1295 gene locus_tag LOCUS_19630 <1 1295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932984.1:beta-phosphoglucomutase family hydrolase 1594 1394 gene locus_tag LOCUS_19640 1594 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 2303 1788 gene locus_tag LOCUS_19650 2303 1788 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941194.1 protein_id gnl|my_center|LOCUS_19650 >Feature sequence340 <1 1560 gene locus_tag LOCUS_19660 <1 1560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_146312796.1:AAA family ATPase 1587 2531 gene locus_tag LOCUS_19670 1587 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 2528 2797 gene locus_tag LOCUS_19680 2528 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 >Feature sequence341 1194 385 gene locus_tag LOCUS_19690 1194 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 1775 1176 gene locus_tag LOCUS_19700 1775 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 2709 1768 gene locus_tag LOCUS_19710 2709 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence342 <1 2408 gene locus_tag LOCUS_19720 <1 2408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942970.1:UPF0182 family protein >Feature sequence343 1465 551 gene locus_tag LOCUS_19730 1465 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 >Feature sequence344 678 73 gene locus_tag LOCUS_19740 gene plsY 678 73 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_19740 975 1790 gene locus_tag LOCUS_19750 gene panC 975 1790 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080408.1 protein_id gnl|my_center|LOCUS_19750 >Feature sequence345 215 970 gene locus_tag LOCUS_19760 215 970 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888532.1 protein_id gnl|my_center|LOCUS_19760 >Feature sequence346 385 1107 gene locus_tag LOCUS_19770 385 1107 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_19770 1107 2276 gene locus_tag LOCUS_19780 1107 2276 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_19780 >Feature sequence347 18 554 gene locus_tag LOCUS_19790 18 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 547 1128 gene locus_tag LOCUS_19800 gene gmhB 547 1128 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259582.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence348 484 705 gene locus_tag LOCUS_19810 484 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 949 1242 gene locus_tag LOCUS_19820 949 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 1716 1588 gene locus_tag LOCUS_19830 1716 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 2165 1818 gene locus_tag LOCUS_19840 2165 1818 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250020.1 protein_id gnl|my_center|LOCUS_19840 2355 2155 gene locus_tag LOCUS_19850 2355 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence349 571 413 gene locus_tag LOCUS_19860 571 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 1176 679 gene locus_tag LOCUS_19870 1176 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 1669 1178 gene locus_tag LOCUS_19880 gene radC 1669 1178 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942813.1 protein_id gnl|my_center|LOCUS_19880 <2754 1989 gene locus_tag LOCUS_19890 <2754 1989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816488.1:toprim domain-containing protein >Feature sequence350 1604 405 gene locus_tag LOCUS_19900 1604 405 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023091.1 protein_id gnl|my_center|LOCUS_19900 <2732 1810 gene locus_tag LOCUS_19910 <2732 1810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958440.1:ATP-binding protein >Feature sequence351 952 317 gene locus_tag LOCUS_19920 952 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 1175 1324 gene locus_tag LOCUS_19930 1175 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 1951 1373 gene locus_tag LOCUS_19940 1951 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 2436 1948 gene locus_tag LOCUS_19950 2436 1948 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_19950 >Feature sequence352 1197 814 gene locus_tag LOCUS_19960 1197 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence353 1 741 gene locus_tag LOCUS_19970 1 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 1073 1552 gene locus_tag LOCUS_19980 1073 1552 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583144.1 protein_id gnl|my_center|LOCUS_19980 1566 2009 gene locus_tag LOCUS_19990 1566 2009 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021802.1 protein_id gnl|my_center|LOCUS_19990 2042 2203 gene locus_tag LOCUS_20000 2042 2203 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_20000 >Feature sequence354 2090 1635 gene locus_tag LOCUS_20010 2090 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 2293 2093 gene locus_tag LOCUS_20020 2293 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence355 331 1317 gene locus_tag LOCUS_20030 gene pstS 331 1317 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_20030 >Feature sequence356 1478 219 gene locus_tag LOCUS_20040 gene nifB 1478 219 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933205.1 protein_id gnl|my_center|LOCUS_20040 <2639 1495 gene locus_tag LOCUS_20050 <2639 1495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933204.1:nitrogenase component 1 >Feature sequence357 2115 751 gene locus_tag LOCUS_20060 2115 751 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933204.1 protein_id gnl|my_center|LOCUS_20060 <2634 2119 gene locus_tag LOCUS_20070 <2634 2119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933203.1:nitrogenase iron-molybdenum cofactor biosynthesis protein NifE >Feature sequence358 329 1600 gene locus_tag LOCUS_20080 329 1600 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_20080 1603 2199 gene locus_tag LOCUS_20090 1603 2199 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228074.1 protein_id gnl|my_center|LOCUS_20090 >Feature sequence359 <2621 551 gene locus_tag LOCUS_20100 <2621 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074199.1:glycerol-3-phosphate 1-O-acyltransferase PlsB >Feature sequence360 179 1153 gene locus_tag LOCUS_20110 179 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 2463 1063 gene locus_tag LOCUS_20120 2463 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 >Feature sequence361 <1 632 gene locus_tag LOCUS_20130 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028054418.1:site-specific integrase 629 1759 gene locus_tag LOCUS_20140 629 1759 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040680916.1 protein_id gnl|my_center|LOCUS_20140 >Feature sequence362 289 83 gene locus_tag LOCUS_20150 289 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 1107 289 gene locus_tag LOCUS_20160 1107 289 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000788527.1 protein_id gnl|my_center|LOCUS_20160 2005 1097 gene locus_tag LOCUS_20170 2005 1097 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870102.1 protein_id gnl|my_center|LOCUS_20170 2268 2002 gene locus_tag LOCUS_20180 2268 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 >Feature sequence363 1727 957 gene locus_tag LOCUS_20190 1727 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 2347 1934 gene locus_tag LOCUS_20200 2347 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 >Feature sequence364 <1 618 gene locus_tag LOCUS_20210 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940492.1:flagellar biosynthetic protein FliR 679 1743 gene locus_tag LOCUS_20220 gene flhB 679 1743 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858726.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence365 162 1964 gene locus_tag LOCUS_20230 gene aspS 162 1964 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_20230 2199 2050 gene locus_tag LOCUS_20240 2199 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence366 <2566 854 gene locus_tag LOCUS_20250 <2566 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235045002.1:PAS domain S-box protein >Feature sequence367 672 118 gene locus_tag LOCUS_20260 672 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 1507 662 gene locus_tag LOCUS_20270 1507 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 1790 2017 gene locus_tag LOCUS_20280 1790 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 2017 2301 gene locus_tag LOCUS_20290 2017 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence368 2025 31 gene locus_tag LOCUS_20300 2025 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 >Feature sequence369 >Feature sequence370 1929 763 gene locus_tag LOCUS_20310 gene ahbD 1929 763 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_20310 >Feature sequence371 980 96 gene locus_tag LOCUS_20320 gene xrt 980 96 CDS product exosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176633.1 protein_id gnl|my_center|LOCUS_20320 1550 987 gene locus_tag LOCUS_20330 1550 987 CDS product EpsI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176634.1 protein_id gnl|my_center|LOCUS_20330 1922 1794 gene locus_tag LOCUS_20340 1922 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 2239 2018 gene locus_tag LOCUS_20350 2239 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 >Feature sequence372 787 164 gene locus_tag LOCUS_20360 787 164 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_20360 946 794 gene locus_tag LOCUS_20370 946 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 1385 1095 gene locus_tag LOCUS_20380 1385 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 1720 1364 gene locus_tag LOCUS_20390 gene tnpB 1720 1364 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084591.1 protein_id gnl|my_center|LOCUS_20390 2121 1717 gene locus_tag LOCUS_20400 2121 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 >Feature sequence373 151 480 gene locus_tag LOCUS_20410 151 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20410 527 877 gene locus_tag LOCUS_20420 527 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 1217 1666 gene locus_tag LOCUS_20430 1217 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 1686 2465 gene locus_tag LOCUS_20440 1686 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 >Feature sequence374 303 944 gene locus_tag LOCUS_20450 303 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 1465 989 gene locus_tag LOCUS_20460 1465 989 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941174.1 protein_id gnl|my_center|LOCUS_20460 1980 1489 gene locus_tag LOCUS_20470 1980 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 <2528 1971 gene locus_tag LOCUS_20480 <2528 1971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070465.1:rhodanese-like domain-containing protein >Feature sequence375 400 1083 gene locus_tag LOCUS_20490 400 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 1417 1614 gene locus_tag LOCUS_20500 1417 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 1617 1976 gene locus_tag LOCUS_20510 1617 1976 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968151.1 protein_id gnl|my_center|LOCUS_20510 >Feature sequence376 225 37 gene locus_tag LOCUS_20520 225 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 1440 304 gene locus_tag LOCUS_20530 1440 304 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939813.1 protein_id gnl|my_center|LOCUS_20530 1979 1563 gene locus_tag LOCUS_20540 1979 1563 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_20540 2220 1972 gene locus_tag LOCUS_20550 2220 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 >Feature sequence377