>Feature sequence01 86 1147 gene locus_tag LOCUS_00010 86 1147 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405859.1 protein_id gnl|my_center|LOCUS_00010 1297 2787 gene locus_tag LOCUS_00020 gene dnaX 1297 2787 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582668.1 protein_id gnl|my_center|LOCUS_00020 2771 3085 gene locus_tag LOCUS_00030 2771 3085 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208604.1 protein_id gnl|my_center|LOCUS_00030 3095 3694 gene locus_tag LOCUS_00040 gene recR 3095 3694 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722062.1 protein_id gnl|my_center|LOCUS_00040 3712 5001 gene locus_tag LOCUS_00050 gene eno 3712 5001 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_00050 5073 5666 gene locus_tag LOCUS_00060 gene comEA 5073 5666 CDS product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398514.1 protein_id gnl|my_center|LOCUS_00060 5666 7660 gene locus_tag LOCUS_00070 5666 7660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7688 10192 gene locus_tag LOCUS_00080 gene polA 7688 10192 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583247.1 protein_id gnl|my_center|LOCUS_00080 10189 10788 gene locus_tag LOCUS_00090 gene coaE 10189 10788 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475784.1 protein_id gnl|my_center|LOCUS_00090 10761 11504 gene locus_tag LOCUS_00100 10761 11504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11584 13200 gene locus_tag LOCUS_00110 11584 13200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 13282 14004 gene locus_tag LOCUS_00120 13282 14004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 14560 13988 gene locus_tag LOCUS_00130 gene gmk 14560 13988 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547929.1 protein_id gnl|my_center|LOCUS_00130 15711 14560 gene locus_tag LOCUS_00140 15711 14560 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391791.1 protein_id gnl|my_center|LOCUS_00140 17120 15729 gene locus_tag LOCUS_00150 17120 15729 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081585.1 protein_id gnl|my_center|LOCUS_00150 18570 17155 gene locus_tag LOCUS_00160 18570 17155 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942656.1 protein_id gnl|my_center|LOCUS_00160 19994 18567 gene locus_tag LOCUS_00170 gene glgA 19994 18567 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546609.1 protein_id gnl|my_center|LOCUS_00170 21002 19998 gene locus_tag LOCUS_00180 gene galT 21002 19998 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546259.1 protein_id gnl|my_center|LOCUS_00180 22954 21017 gene locus_tag LOCUS_00190 22954 21017 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583261.1 protein_id gnl|my_center|LOCUS_00190 24426 22951 gene locus_tag LOCUS_00200 24426 22951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 24531 25649 gene locus_tag LOCUS_00210 gene ugpC 24531 25649 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_00210 25659 25940 gene locus_tag LOCUS_00220 25659 25940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 26043 27254 gene locus_tag LOCUS_00230 26043 27254 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_00230 28079 27279 gene locus_tag LOCUS_00240 28079 27279 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662590.1 protein_id gnl|my_center|LOCUS_00240 30070 28076 gene locus_tag LOCUS_00250 gene uvrB 30070 28076 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583249.1 protein_id gnl|my_center|LOCUS_00250 30965 30060 gene locus_tag LOCUS_00260 gene nadE 30965 30060 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081153.1 protein_id gnl|my_center|LOCUS_00260 31172 31086 gene locus_tag LOCUS_t00010 31172 31086 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 32459 31182 gene locus_tag LOCUS_00270 gene serS 32459 31182 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_00270 34923 32473 gene locus_tag LOCUS_00280 34923 32473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 36857 34938 gene locus_tag LOCUS_00290 36857 34938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 38040 36976 gene locus_tag LOCUS_00300 38040 36976 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941744.1 protein_id gnl|my_center|LOCUS_00300 38554 38051 gene locus_tag LOCUS_00310 38554 38051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248978.1 protein_id gnl|my_center|LOCUS_00310 39013 38615 gene locus_tag LOCUS_00320 39013 38615 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546098.1 protein_id gnl|my_center|LOCUS_00320 41112 39010 gene locus_tag LOCUS_00330 gene pcrA 41112 39010 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357577.1 protein_id gnl|my_center|LOCUS_00330 41783 41115 gene locus_tag LOCUS_00340 41783 41115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 42709 41795 gene locus_tag LOCUS_00350 gene sppA 42709 41795 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545082.1 protein_id gnl|my_center|LOCUS_00350 43823 42846 gene locus_tag LOCUS_00360 43823 42846 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583572.1 protein_id gnl|my_center|LOCUS_00360 44190 43801 gene locus_tag LOCUS_00370 gene rbfA 44190 43801 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392565.1 protein_id gnl|my_center|LOCUS_00370 44874 44194 gene locus_tag LOCUS_00380 44874 44194 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_00380 45082 45585 gene locus_tag LOCUS_00390 45082 45585 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_00390 45572 46960 gene locus_tag LOCUS_00400 45572 46960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 47769 47278 gene locus_tag LOCUS_00410 47769 47278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 48266 47766 gene locus_tag LOCUS_00420 48266 47766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 48743 48267 gene locus_tag LOCUS_00430 48743 48267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 49396 48758 gene locus_tag LOCUS_00440 49396 48758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 49754 49380 gene locus_tag LOCUS_00450 49754 49380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 50422 50273 gene locus_tag LOCUS_00460 50422 50273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 51669 50656 gene locus_tag LOCUS_00470 51669 50656 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021081.1 protein_id gnl|my_center|LOCUS_00470 52076 51666 gene locus_tag LOCUS_00480 52076 51666 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391911.1 protein_id gnl|my_center|LOCUS_00480 53026 52076 gene locus_tag LOCUS_00490 53026 52076 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020974.1 protein_id gnl|my_center|LOCUS_00490 53775 53026 gene locus_tag LOCUS_00500 53775 53026 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496372.1 protein_id gnl|my_center|LOCUS_00500 54562 53831 gene locus_tag LOCUS_00510 54562 53831 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583475.1 protein_id gnl|my_center|LOCUS_00510 55458 54562 gene locus_tag LOCUS_00520 55458 54562 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_00520 56186 55455 gene locus_tag LOCUS_00530 gene udp 56186 55455 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_00530 57608 56472 gene locus_tag LOCUS_00540 gene rpoD 57608 56472 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_00540 59332 57614 gene locus_tag LOCUS_00550 59332 57614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 60573 59467 gene locus_tag LOCUS_00560 60573 59467 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_00560 63226 60575 gene locus_tag LOCUS_00570 gene ppdK 63226 60575 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 protein_id gnl|my_center|LOCUS_00570 65391 63295 gene locus_tag LOCUS_00580 gene glyS 65391 63295 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861551.1 protein_id gnl|my_center|LOCUS_00580 66235 65372 gene locus_tag LOCUS_00590 gene glyQ 66235 65372 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226213.1 protein_id gnl|my_center|LOCUS_00590 66960 66259 gene locus_tag LOCUS_00600 66960 66259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 67634 66960 gene locus_tag LOCUS_00610 gene deoC 67634 66960 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693439.1 protein_id gnl|my_center|LOCUS_00610 68177 68428 gene locus_tag LOCUS_00620 68177 68428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 <69557 68466 gene locus_tag LOCUS_00630 <69557 68466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266619.1:M20 family metallopeptidase >Feature sequence02 133 1269 gene locus_tag LOCUS_00640 133 1269 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583054.1 protein_id gnl|my_center|LOCUS_00640 2468 1275 gene locus_tag LOCUS_00650 2468 1275 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948998.1 protein_id gnl|my_center|LOCUS_00650 2626 3924 gene locus_tag LOCUS_00660 gene hemW 2626 3924 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468788.1 protein_id gnl|my_center|LOCUS_00660 4902 3988 gene locus_tag LOCUS_00670 4902 3988 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_00670 5969 4902 gene locus_tag LOCUS_00680 5969 4902 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082660.1 protein_id gnl|my_center|LOCUS_00680 7513 5981 gene locus_tag LOCUS_00690 7513 5981 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583514.1 protein_id gnl|my_center|LOCUS_00690 8588 7578 gene locus_tag LOCUS_00700 8588 7578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 8791 10023 gene locus_tag LOCUS_00710 8791 10023 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819167.1 protein_id gnl|my_center|LOCUS_00710 11194 10013 gene locus_tag LOCUS_00720 11194 10013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 11406 12827 gene locus_tag LOCUS_00730 11406 12827 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_00730 14079 12844 gene locus_tag LOCUS_00740 gene mtaB 14079 12844 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_00740 15107 14079 gene locus_tag LOCUS_00750 gene hrcA 15107 14079 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246126.1 protein_id gnl|my_center|LOCUS_00750 16529 15198 gene locus_tag LOCUS_00760 gene glnA 16529 15198 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126606.1 protein_id gnl|my_center|LOCUS_00760 17005 16724 gene locus_tag LOCUS_00770 17005 16724 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905402.1 protein_id gnl|my_center|LOCUS_00770 20551 17165 gene locus_tag LOCUS_00780 20551 17165 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_00780 21546 20560 gene locus_tag LOCUS_00790 21546 20560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 22272 21613 gene locus_tag LOCUS_00800 22272 21613 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942096.1 protein_id gnl|my_center|LOCUS_00800 23677 22475 gene locus_tag LOCUS_00810 23677 22475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 24714 23878 gene locus_tag LOCUS_00820 24714 23878 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583151.1 protein_id gnl|my_center|LOCUS_00820 25997 25095 gene locus_tag LOCUS_00830 25997 25095 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404080.1 protein_id gnl|my_center|LOCUS_00830 27274 26075 gene locus_tag LOCUS_00840 27274 26075 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_00840 27591 28469 gene locus_tag LOCUS_00850 27591 28469 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336917.1 protein_id gnl|my_center|LOCUS_00850 28701 30368 gene locus_tag LOCUS_00860 28701 30368 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_00860 30368 33619 gene locus_tag LOCUS_00870 gene smc 30368 33619 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546468.1 protein_id gnl|my_center|LOCUS_00870 33708 34793 gene locus_tag LOCUS_00880 33708 34793 CDS product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404751.1 protein_id gnl|my_center|LOCUS_00880 34870 35622 gene locus_tag LOCUS_00890 34870 35622 CDS product Sir2 family NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869115.1 protein_id gnl|my_center|LOCUS_00890 35612 36301 gene locus_tag LOCUS_00900 35612 36301 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080208.1 protein_id gnl|my_center|LOCUS_00900 36352 37374 gene locus_tag LOCUS_00910 36352 37374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 37555 40314 gene locus_tag LOCUS_00920 37555 40314 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392653.1 protein_id gnl|my_center|LOCUS_00920 40324 41496 gene locus_tag LOCUS_00930 40324 41496 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868844.1 protein_id gnl|my_center|LOCUS_00930 41496 42716 gene locus_tag LOCUS_00940 41496 42716 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202629.1 protein_id gnl|my_center|LOCUS_00940 42859 43071 gene locus_tag LOCUS_00950 42859 43071 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566521.1 protein_id gnl|my_center|LOCUS_00950 43154 45565 gene locus_tag LOCUS_00960 43154 45565 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200734.1 protein_id gnl|my_center|LOCUS_00960 45562 46095 gene locus_tag LOCUS_00970 45562 46095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 46764 46123 gene locus_tag LOCUS_00980 46764 46123 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_00980 47789 46791 gene locus_tag LOCUS_00990 47789 46791 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086819.1 protein_id gnl|my_center|LOCUS_00990 47957 48898 gene locus_tag LOCUS_01000 47957 48898 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_01000 48900 49742 gene locus_tag LOCUS_01010 48900 49742 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949071.1 protein_id gnl|my_center|LOCUS_01010 49778 51439 gene locus_tag LOCUS_01020 49778 51439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 51616 51690 gene locus_tag LOCUS_t00020 51616 51690 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 51711 53633 gene locus_tag LOCUS_01030 gene thrS 51711 53633 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_01030 53864 54379 gene locus_tag LOCUS_01040 gene infC 53864 54379 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_01040 54333 54536 gene locus_tag LOCUS_01050 gene rpmI 54333 54536 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 protein_id gnl|my_center|LOCUS_01050 54554 54922 gene locus_tag LOCUS_01060 gene rplT 54554 54922 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583668.1 protein_id gnl|my_center|LOCUS_01060 55524 54979 gene locus_tag LOCUS_01070 55524 54979 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583215.1 protein_id gnl|my_center|LOCUS_01070 55700 56749 gene locus_tag LOCUS_01080 gene dprA 55700 56749 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546585.1 protein_id gnl|my_center|LOCUS_01080 56746 58023 gene locus_tag LOCUS_01090 gene trmFO 56746 58023 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392541.1 protein_id gnl|my_center|LOCUS_01090 58020 58898 gene locus_tag LOCUS_01100 58020 58898 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_01100 59772 59119 gene locus_tag LOCUS_01110 gene udk 59772 59119 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986880.1 protein_id gnl|my_center|LOCUS_01110 59874 61250 gene locus_tag LOCUS_01120 59874 61250 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391671.1 protein_id gnl|my_center|LOCUS_01120 61247 62203 gene locus_tag LOCUS_01130 61247 62203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 62295 62642 gene locus_tag LOCUS_01140 gene rpsF 62295 62642 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420522.1 protein_id gnl|my_center|LOCUS_01140 62626 63030 gene locus_tag LOCUS_01150 gene ssb 62626 63030 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545299.1 protein_id gnl|my_center|LOCUS_01150 63043 63297 gene locus_tag LOCUS_01160 gene rpsR 63043 63297 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583715.1 protein_id gnl|my_center|LOCUS_01160 63294 63740 gene locus_tag LOCUS_01170 gene rplI 63294 63740 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583713.1 protein_id gnl|my_center|LOCUS_01170 63746 65086 gene locus_tag LOCUS_01180 gene dnaB 63746 65086 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815191.1 protein_id gnl|my_center|LOCUS_01180 65120 65195 gene locus_tag LOCUS_t00030 65120 65195 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 65200 65274 gene locus_tag LOCUS_t00040 65200 65274 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 65277 65351 gene locus_tag LOCUS_t00050 65277 65351 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 65402 65477 gene locus_tag LOCUS_t00060 65402 65477 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 65485 65559 gene locus_tag LOCUS_t00070 65485 65559 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 65579 65654 gene locus_tag LOCUS_t00080 65579 65654 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 65680 67680 gene locus_tag LOCUS_01190 65680 67680 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583780.1 protein_id gnl|my_center|LOCUS_01190 67681 68640 gene locus_tag LOCUS_01200 67681 68640 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582789.1 protein_id gnl|my_center|LOCUS_01200 >Feature sequence03 2203 122 gene locus_tag LOCUS_01210 gene fusA 2203 122 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_01210 2688 2218 gene locus_tag LOCUS_01220 gene rpsG 2688 2218 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393941.1 protein_id gnl|my_center|LOCUS_01220 3077 2688 gene locus_tag LOCUS_01230 gene rpsL 3077 2688 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880443.1 protein_id gnl|my_center|LOCUS_01230 6973 3176 gene locus_tag LOCUS_01240 6973 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 9028 6989 gene locus_tag LOCUS_01250 gene fusA 9028 6989 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_01250 13214 9015 gene locus_tag LOCUS_01260 13214 9015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 13768 13292 gene locus_tag LOCUS_01270 gene moaC 13768 13292 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306447.1 protein_id gnl|my_center|LOCUS_01270 14743 13769 gene locus_tag LOCUS_01280 gene moaA 14743 13769 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965293.1 protein_id gnl|my_center|LOCUS_01280 15944 14727 gene locus_tag LOCUS_01290 15944 14727 CDS product endonuclease Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931016.1 protein_id gnl|my_center|LOCUS_01290 16609 15941 gene locus_tag LOCUS_01300 16609 15941 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867690.1 protein_id gnl|my_center|LOCUS_01300 17379 16603 gene locus_tag LOCUS_01310 17379 16603 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940917.1 protein_id gnl|my_center|LOCUS_01310 18392 17475 gene locus_tag LOCUS_01320 gene xerD 18392 17475 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294386.1 protein_id gnl|my_center|LOCUS_01320 18915 18385 gene locus_tag LOCUS_01330 18915 18385 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831173.1 protein_id gnl|my_center|LOCUS_01330 19535 18915 gene locus_tag LOCUS_01340 19535 18915 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869608.1 protein_id gnl|my_center|LOCUS_01340 20934 19525 gene locus_tag LOCUS_01350 20934 19525 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986932.1 protein_id gnl|my_center|LOCUS_01350 22699 20927 gene locus_tag LOCUS_01360 22699 20927 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033047490.1 protein_id gnl|my_center|LOCUS_01360 23044 22712 gene locus_tag LOCUS_01370 23044 22712 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583854.1 protein_id gnl|my_center|LOCUS_01370 23972 23028 gene locus_tag LOCUS_01380 23972 23028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 24568 23969 gene locus_tag LOCUS_01390 24568 23969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 25080 24577 gene locus_tag LOCUS_01400 25080 24577 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583857.1 protein_id gnl|my_center|LOCUS_01400 27104 25080 gene locus_tag LOCUS_01410 27104 25080 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583858.1 protein_id gnl|my_center|LOCUS_01410 27421 27104 gene locus_tag LOCUS_01420 27421 27104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 28887 27439 gene locus_tag LOCUS_01430 28887 27439 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965635.1 protein_id gnl|my_center|LOCUS_01430 28997 28921 gene locus_tag LOCUS_t00090 28997 28921 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 29084 29007 gene locus_tag LOCUS_t00100 29084 29007 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 29546 29136 gene locus_tag LOCUS_01440 29546 29136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 30931 29939 gene locus_tag LOCUS_01450 30931 29939 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_01450 31773 30928 gene locus_tag LOCUS_01460 gene ispH 31773 30928 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943241.1 protein_id gnl|my_center|LOCUS_01460 32363 31743 gene locus_tag LOCUS_01470 32363 31743 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_01470 33024 32353 gene locus_tag LOCUS_01480 gene cmk 33024 32353 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358949.1 protein_id gnl|my_center|LOCUS_01480 33451 33011 gene locus_tag LOCUS_01490 gene rpiB 33451 33011 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583174.1 protein_id gnl|my_center|LOCUS_01490 33563 34759 gene locus_tag LOCUS_01500 gene tyrS 33563 34759 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583842.1 protein_id gnl|my_center|LOCUS_01500 34838 36100 gene locus_tag LOCUS_01510 gene hisS 34838 36100 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016292.1 protein_id gnl|my_center|LOCUS_01510 36093 37844 gene locus_tag LOCUS_01520 gene aspS 36093 37844 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965567.1 protein_id gnl|my_center|LOCUS_01520 39204 38080 gene locus_tag LOCUS_01530 gene tgt 39204 38080 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583954.1 protein_id gnl|my_center|LOCUS_01530 40245 39217 gene locus_tag LOCUS_01540 gene queA 40245 39217 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_01540 40965 40252 gene locus_tag LOCUS_01550 40965 40252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 42250 40997 gene locus_tag LOCUS_01560 gene hflX 42250 40997 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081386.1 protein_id gnl|my_center|LOCUS_01560 42606 42247 gene locus_tag LOCUS_01570 42606 42247 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_01570 44177 42609 gene locus_tag LOCUS_01580 gene uvrC 44177 42609 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583837.1 protein_id gnl|my_center|LOCUS_01580 45789 44233 gene locus_tag LOCUS_01590 gene rny 45789 44233 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_01590 46233 45802 gene locus_tag LOCUS_01600 46233 45802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 47263 46223 gene locus_tag LOCUS_01610 gene recA 47263 46223 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583523.1 protein_id gnl|my_center|LOCUS_01610 47855 47316 gene locus_tag LOCUS_01620 gene thpR 47855 47316 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583814.1 protein_id gnl|my_center|LOCUS_01620 49087 47852 gene locus_tag LOCUS_01630 gene rimO 49087 47852 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_01630 49865 49158 gene locus_tag LOCUS_01640 49865 49158 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359020.1 protein_id gnl|my_center|LOCUS_01640 52238 49917 gene locus_tag LOCUS_01650 gene lon 52238 49917 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545466.1 protein_id gnl|my_center|LOCUS_01650 53476 52247 gene locus_tag LOCUS_01660 gene clpX 53476 52247 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816893.1 protein_id gnl|my_center|LOCUS_01660 54090 53473 gene locus_tag LOCUS_01670 gene clpP 54090 53473 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942436.1 protein_id gnl|my_center|LOCUS_01670 55315 54083 gene locus_tag LOCUS_01680 gene tig 55315 54083 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830810.1 protein_id gnl|my_center|LOCUS_01680 55423 55339 gene locus_tag LOCUS_t00110 55423 55339 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 55643 55568 gene locus_tag LOCUS_t00120 55643 55568 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 55732 55656 gene locus_tag LOCUS_t00130 55732 55656 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 55812 55736 gene locus_tag LOCUS_t00140 55812 55736 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 55918 55843 gene locus_tag LOCUS_t00150 55918 55843 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 56005 55929 gene locus_tag LOCUS_t00160 56005 55929 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 56097 56021 gene locus_tag LOCUS_t00170 56097 56021 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 56963 56160 gene locus_tag LOCUS_01690 gene murI 56963 56160 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_01690 59364 56956 gene locus_tag LOCUS_01700 59364 56956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 59810 59361 gene locus_tag LOCUS_01710 gene smpB 59810 59361 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880138.1 protein_id gnl|my_center|LOCUS_01710 60709 59792 gene locus_tag LOCUS_01720 60709 59792 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861614.1 protein_id gnl|my_center|LOCUS_01720 61145 60690 gene locus_tag LOCUS_01730 gene lspA 61145 60690 CDS product lipoprotein signal peptidase LspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642185.1 protein_id gnl|my_center|LOCUS_01730 61374 61138 gene locus_tag LOCUS_01740 61374 61138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 61480 61349 gene locus_tag LOCUS_01750 61480 61349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 61534 61626 gene locus_tag LOCUS_t00180 61534 61626 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 61771 62646 gene locus_tag LOCUS_01760 61771 62646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 62684 63454 gene locus_tag LOCUS_01770 62684 63454 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_01770 >Feature sequence04 44 2614 gene locus_tag LOCUS_01780 gene fdhF 44 2614 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_01780 2635 3468 gene locus_tag LOCUS_01790 2635 3468 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272216.1 protein_id gnl|my_center|LOCUS_01790 3474 4070 gene locus_tag LOCUS_01800 3474 4070 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817332.1 protein_id gnl|my_center|LOCUS_01800 4054 4761 gene locus_tag LOCUS_01810 gene fdhD 4054 4761 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546799.1 protein_id gnl|my_center|LOCUS_01810 5508 6683 gene locus_tag LOCUS_01820 5508 6683 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583824.1 protein_id gnl|my_center|LOCUS_01820 6680 9007 gene locus_tag LOCUS_01830 gene recG 6680 9007 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583501.1 protein_id gnl|my_center|LOCUS_01830 9007 9609 gene locus_tag LOCUS_01840 gene rsmD 9007 9609 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_01840 10047 9649 gene locus_tag LOCUS_01850 10047 9649 CDS product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546858.1 protein_id gnl|my_center|LOCUS_01850 10588 10040 gene locus_tag LOCUS_01860 10588 10040 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584065.1 protein_id gnl|my_center|LOCUS_01860 11101 10592 gene locus_tag LOCUS_01870 11101 10592 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868874.1 protein_id gnl|my_center|LOCUS_01870 12025 11147 gene locus_tag LOCUS_01880 12025 11147 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944001.1 protein_id gnl|my_center|LOCUS_01880 12946 13398 gene locus_tag LOCUS_01890 12946 13398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 15485 13836 gene locus_tag LOCUS_01900 gene hutU 15485 13836 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416707.1 protein_id gnl|my_center|LOCUS_01900 15707 16759 gene locus_tag LOCUS_01910 15707 16759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 16819 17367 gene locus_tag LOCUS_01920 16819 17367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 17429 17857 gene locus_tag LOCUS_01930 17429 17857 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933554.1 protein_id gnl|my_center|LOCUS_01930 17900 18817 gene locus_tag LOCUS_01940 17900 18817 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704312.1 protein_id gnl|my_center|LOCUS_01940 19054 19266 gene locus_tag LOCUS_01950 19054 19266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 19309 19869 gene locus_tag LOCUS_01960 19309 19869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 20640 19951 gene locus_tag LOCUS_01970 20640 19951 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024087.1 protein_id gnl|my_center|LOCUS_01970 20707 21564 gene locus_tag LOCUS_01980 20707 21564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 21561 22031 gene locus_tag LOCUS_01990 21561 22031 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868950.1 protein_id gnl|my_center|LOCUS_01990 22033 24345 gene locus_tag LOCUS_02000 22033 24345 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897245.1 protein_id gnl|my_center|LOCUS_02000 25987 24398 gene locus_tag LOCUS_02010 gene pckA 25987 24398 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392169.1 protein_id gnl|my_center|LOCUS_02010 26555 26076 gene locus_tag LOCUS_02020 26555 26076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 27195 27109 gene locus_tag LOCUS_t00190 27195 27109 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 27277 27204 gene locus_tag LOCUS_t00200 27277 27204 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 27362 27288 gene locus_tag LOCUS_t00210 27362 27288 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 28002 27427 gene locus_tag LOCUS_02030 gene yqeK 28002 27427 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016520.1 protein_id gnl|my_center|LOCUS_02030 28588 27986 gene locus_tag LOCUS_02040 gene nadD 28588 27986 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841927.1 protein_id gnl|my_center|LOCUS_02040 29597 28572 gene locus_tag LOCUS_02050 gene obgE 29597 28572 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228913.1 protein_id gnl|my_center|LOCUS_02050 30122 29874 gene locus_tag LOCUS_02060 gene rpmA 30122 29874 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583640.1 protein_id gnl|my_center|LOCUS_02060 30444 30115 gene locus_tag LOCUS_02070 gene rplU 30444 30115 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943851.1 protein_id gnl|my_center|LOCUS_02070 31603 30539 gene locus_tag LOCUS_02080 31603 30539 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967889.1 protein_id gnl|my_center|LOCUS_02080 34043 31590 gene locus_tag LOCUS_02090 gene gyrA 34043 31590 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947899.1 protein_id gnl|my_center|LOCUS_02090 35954 34053 gene locus_tag LOCUS_02100 gene gyrB 35954 34053 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815132.1 protein_id gnl|my_center|LOCUS_02100 36095 38554 gene locus_tag LOCUS_02110 36095 38554 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583832.1 protein_id gnl|my_center|LOCUS_02110 38544 40355 gene locus_tag LOCUS_02120 gene lepA 38544 40355 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229999.1 protein_id gnl|my_center|LOCUS_02120 40339 41490 gene locus_tag LOCUS_02130 gene hemW 40339 41490 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583471.1 protein_id gnl|my_center|LOCUS_02130 41602 42468 gene locus_tag LOCUS_02140 gene rapZ 41602 42468 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963833.1 protein_id gnl|my_center|LOCUS_02140 42465 43784 gene locus_tag LOCUS_02150 42465 43784 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462178.1 protein_id gnl|my_center|LOCUS_02150 43895 44614 gene locus_tag LOCUS_02160 gene whiA 43895 44614 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896330.1 protein_id gnl|my_center|LOCUS_02160 44607 45851 gene locus_tag LOCUS_02170 44607 45851 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340639.1 protein_id gnl|my_center|LOCUS_02170 45902 46921 gene locus_tag LOCUS_02180 gene gap 45902 46921 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_02180 46943 48133 gene locus_tag LOCUS_02190 46943 48133 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583493.1 protein_id gnl|my_center|LOCUS_02190 48202 48435 gene locus_tag LOCUS_02200 48202 48435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 48449 48533 gene locus_tag LOCUS_t00220 48449 48533 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 48549 48623 gene locus_tag LOCUS_t00230 48549 48623 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 48636 48711 gene locus_tag LOCUS_t00240 48636 48711 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 49517 51142 gene locus_tag LOCUS_02210 49517 51142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 >Feature sequence05 1980 1228 gene locus_tag LOCUS_02220 1980 1228 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_02220 2353 3438 gene locus_tag LOCUS_02230 2353 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 3478 3987 gene locus_tag LOCUS_02240 3478 3987 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397668.1 protein_id gnl|my_center|LOCUS_02240 4548 4006 gene locus_tag LOCUS_02250 4548 4006 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080450.1 protein_id gnl|my_center|LOCUS_02250 5218 4550 gene locus_tag LOCUS_02260 5218 4550 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272429.1 protein_id gnl|my_center|LOCUS_02260 6207 5215 gene locus_tag LOCUS_02270 6207 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 7282 6197 gene locus_tag LOCUS_02280 7282 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 8759 7728 gene locus_tag LOCUS_02290 gene mnmA 8759 7728 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583059.1 protein_id gnl|my_center|LOCUS_02290 8913 10334 gene locus_tag LOCUS_02300 8913 10334 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250240.1 protein_id gnl|my_center|LOCUS_02300 11881 10403 gene locus_tag LOCUS_02310 11881 10403 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_02310 12776 11904 gene locus_tag LOCUS_02320 gene hisJ 12776 11904 CDS product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227864.1 protein_id gnl|my_center|LOCUS_02320 14415 12931 gene locus_tag LOCUS_02330 gene hutH 14415 12931 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016650.1 protein_id gnl|my_center|LOCUS_02330 15121 14402 gene locus_tag LOCUS_02340 15121 14402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 15774 15118 gene locus_tag LOCUS_02350 15774 15118 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504032.1 protein_id gnl|my_center|LOCUS_02350 17115 15787 gene locus_tag LOCUS_02360 17115 15787 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582679.1 protein_id gnl|my_center|LOCUS_02360 20247 17116 gene locus_tag LOCUS_02370 gene ileS 20247 17116 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583781.1 protein_id gnl|my_center|LOCUS_02370 20585 23200 gene locus_tag LOCUS_02380 gene clpB 20585 23200 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546043.1 protein_id gnl|my_center|LOCUS_02380 23158 23934 gene locus_tag LOCUS_02390 gene rsmG 23158 23934 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966992.1 protein_id gnl|my_center|LOCUS_02390 24598 26274 gene locus_tag LOCUS_02400 24598 26274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 27287 26334 gene locus_tag LOCUS_02410 27287 26334 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356209.1 protein_id gnl|my_center|LOCUS_02410 28432 27284 gene locus_tag LOCUS_02420 28432 27284 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082660.1 protein_id gnl|my_center|LOCUS_02420 29952 28429 gene locus_tag LOCUS_02430 29952 28429 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865052.1 protein_id gnl|my_center|LOCUS_02430 31187 30021 gene locus_tag LOCUS_02440 31187 30021 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082657.1 protein_id gnl|my_center|LOCUS_02440 32310 31285 gene locus_tag LOCUS_02450 32310 31285 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583737.1 protein_id gnl|my_center|LOCUS_02450 33655 32321 gene locus_tag LOCUS_02460 33655 32321 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582601.1 protein_id gnl|my_center|LOCUS_02460 35091 33652 gene locus_tag LOCUS_02470 35091 33652 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582600.1 protein_id gnl|my_center|LOCUS_02470 35313 36413 gene locus_tag LOCUS_02480 35313 36413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 36417 38450 gene locus_tag LOCUS_02490 gene ligA 36417 38450 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_02490 38447 38725 gene locus_tag LOCUS_02500 38447 38725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 38727 40142 gene locus_tag LOCUS_02510 gene gatA 38727 40142 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051434.1 protein_id gnl|my_center|LOCUS_02510 40162 41607 gene locus_tag LOCUS_02520 gene gatB 40162 41607 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_02520 >Feature sequence06 <1 650 gene locus_tag LOCUS_02530 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583310.1:beta-ketoacyl-ACP synthase II 2414 708 gene locus_tag LOCUS_02540 2414 708 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966455.1 protein_id gnl|my_center|LOCUS_02540 2558 3022 gene locus_tag LOCUS_02550 2558 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 3024 4040 gene locus_tag LOCUS_02560 3024 4040 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583737.1 protein_id gnl|my_center|LOCUS_02560 4037 4996 gene locus_tag LOCUS_02570 gene pfkA 4037 4996 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583740.1 protein_id gnl|my_center|LOCUS_02570 4998 6401 gene locus_tag LOCUS_02580 4998 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 6391 7800 gene locus_tag LOCUS_02590 6391 7800 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_02590 7895 9082 gene locus_tag LOCUS_02600 7895 9082 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582490.1 protein_id gnl|my_center|LOCUS_02600 9079 10347 gene locus_tag LOCUS_02610 9079 10347 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080938.1 protein_id gnl|my_center|LOCUS_02610 10902 10828 gene locus_tag LOCUS_t00250 10902 10828 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 10990 10914 gene locus_tag LOCUS_t00260 10990 10914 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 12830 11049 gene locus_tag LOCUS_02620 12830 11049 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542452.1 protein_id gnl|my_center|LOCUS_02620 13738 12827 gene locus_tag LOCUS_02630 gene rodA 13738 12827 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583594.1 protein_id gnl|my_center|LOCUS_02630 14851 14066 gene locus_tag LOCUS_02640 gene minD 14851 14066 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016205.1 protein_id gnl|my_center|LOCUS_02640 15468 14854 gene locus_tag LOCUS_02650 gene minC 15468 14854 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024932954.1 protein_id gnl|my_center|LOCUS_02650 17223 15478 gene locus_tag LOCUS_02660 gene mrdA 17223 15478 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583753.1 protein_id gnl|my_center|LOCUS_02660 17602 17210 gene locus_tag LOCUS_02670 17602 17210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 18462 17647 gene locus_tag LOCUS_02680 18462 17647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 19460 18459 gene locus_tag LOCUS_02690 19460 18459 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_02690 20017 19472 gene locus_tag LOCUS_02700 20017 19472 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048033.1 protein_id gnl|my_center|LOCUS_02700 20256 20014 gene locus_tag LOCUS_02710 20256 20014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 20773 20246 gene locus_tag LOCUS_02720 20773 20246 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399375.1 protein_id gnl|my_center|LOCUS_02720 21122 20748 gene locus_tag LOCUS_02730 21122 20748 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214305.1 protein_id gnl|my_center|LOCUS_02730 22119 21109 gene locus_tag LOCUS_02740 22119 21109 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583459.1 protein_id gnl|my_center|LOCUS_02740 23134 22112 gene locus_tag LOCUS_02750 gene amrS 23134 22112 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_02750 24538 23135 gene locus_tag LOCUS_02760 gene gltA 24538 23135 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272418.1 protein_id gnl|my_center|LOCUS_02760 25370 24525 gene locus_tag LOCUS_02770 25370 24525 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868068.1 protein_id gnl|my_center|LOCUS_02770 26152 25355 gene locus_tag LOCUS_02780 26152 25355 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129618.1 protein_id gnl|my_center|LOCUS_02780 28032 26152 gene locus_tag LOCUS_02790 gene metG 28032 26152 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930950.1 protein_id gnl|my_center|LOCUS_02790 28397 28047 gene locus_tag LOCUS_02800 28397 28047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 28530 28883 gene locus_tag LOCUS_02810 gene rsfS 28530 28883 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_02810 28942 29922 gene locus_tag LOCUS_02820 gene trxB 28942 29922 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583127.1 protein_id gnl|my_center|LOCUS_02820 29927 30601 gene locus_tag LOCUS_02830 29927 30601 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583126.1 protein_id gnl|my_center|LOCUS_02830 31580 30648 gene locus_tag LOCUS_02840 gene argF 31580 30648 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_02840 32902 31580 gene locus_tag LOCUS_02850 32902 31580 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147002.1 protein_id gnl|my_center|LOCUS_02850 34637 33186 gene locus_tag LOCUS_02860 34637 33186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 35962 34652 gene locus_tag LOCUS_02870 35962 34652 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060924.1 protein_id gnl|my_center|LOCUS_02870 36062 36280 gene locus_tag LOCUS_02880 36062 36280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 36822 37160 gene locus_tag LOCUS_02890 36822 37160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02890 37332 38114 gene locus_tag LOCUS_02900 gene rpsB 37332 38114 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460417.1 protein_id gnl|my_center|LOCUS_02900 38111 38701 gene locus_tag LOCUS_02910 gene tsf 38111 38701 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583563.1 protein_id gnl|my_center|LOCUS_02910 >Feature sequence07 3 2084 gene locus_tag LOCUS_02920 3 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 2094 3353 gene locus_tag LOCUS_02930 2094 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 4107 4739 gene locus_tag LOCUS_02940 4107 4739 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249655.1 protein_id gnl|my_center|LOCUS_02940 4766 5071 gene locus_tag LOCUS_02950 4766 5071 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393974.1 protein_id gnl|my_center|LOCUS_02950 5223 5570 gene locus_tag LOCUS_02960 5223 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 5667 6095 gene locus_tag LOCUS_02970 5667 6095 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201060.1 protein_id gnl|my_center|LOCUS_02970 6098 7315 gene locus_tag LOCUS_02980 6098 7315 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176674.1 protein_id gnl|my_center|LOCUS_02980 7406 8011 gene locus_tag LOCUS_02990 7406 8011 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033860.1 protein_id gnl|my_center|LOCUS_02990 8854 8603 gene locus_tag LOCUS_03000 8854 8603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 9305 8901 gene locus_tag LOCUS_03010 9305 8901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 9644 9569 gene locus_tag LOCUS_t00270 9644 9569 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 9796 10392 gene locus_tag LOCUS_03020 9796 10392 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249474.1 protein_id gnl|my_center|LOCUS_03020 11530 10586 gene locus_tag LOCUS_03030 11530 10586 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933107.1 protein_id gnl|my_center|LOCUS_03030 12177 11527 gene locus_tag LOCUS_03040 12177 11527 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546862.1 protein_id gnl|my_center|LOCUS_03040 12749 12249 gene locus_tag LOCUS_03050 12749 12249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 13126 12761 gene locus_tag LOCUS_03060 13126 12761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 13929 13132 gene locus_tag LOCUS_03070 13929 13132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 15130 14243 gene locus_tag LOCUS_03080 15130 14243 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545247.1 protein_id gnl|my_center|LOCUS_03080 15974 15123 gene locus_tag LOCUS_03090 15974 15123 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079932.1 protein_id gnl|my_center|LOCUS_03090 16481 17176 gene locus_tag LOCUS_03100 16481 17176 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583389.1 protein_id gnl|my_center|LOCUS_03100 17331 18500 gene locus_tag LOCUS_03110 gene pilM 17331 18500 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_03110 18504 19085 gene locus_tag LOCUS_03120 18504 19085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 19082 19675 gene locus_tag LOCUS_03130 19082 19675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 19686 19988 gene locus_tag LOCUS_03140 19686 19988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 20004 21071 gene locus_tag LOCUS_03150 20004 21071 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583399.1 protein_id gnl|my_center|LOCUS_03150 22351 21188 gene locus_tag LOCUS_03160 22351 21188 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750457.1 protein_id gnl|my_center|LOCUS_03160 22967 22407 gene locus_tag LOCUS_03170 22967 22407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 23736 22978 gene locus_tag LOCUS_03180 gene surE 23736 22978 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545452.1 protein_id gnl|my_center|LOCUS_03180 23802 24929 gene locus_tag LOCUS_03190 gene alr 23802 24929 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_03190 25170 25346 gene locus_tag LOCUS_03200 25170 25346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 25830 27002 gene locus_tag LOCUS_03210 25830 27002 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459114.1 protein_id gnl|my_center|LOCUS_03210 26995 27561 gene locus_tag LOCUS_03220 26995 27561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 27625 28386 gene locus_tag LOCUS_03230 gene moeB 27625 28386 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228615.1 protein_id gnl|my_center|LOCUS_03230 28582 28936 gene locus_tag LOCUS_tm00010 28582 28936 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 28948 29541 gene locus_tag LOCUS_03240 28948 29541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 29526 30116 gene locus_tag LOCUS_03250 29526 30116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 30514 30113 gene locus_tag LOCUS_03260 30514 30113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 31186 30545 gene locus_tag LOCUS_03270 31186 30545 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975723.1 protein_id gnl|my_center|LOCUS_03270 31262 34255 gene locus_tag LOCUS_03280 31262 34255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 34265 37432 gene locus_tag LOCUS_03290 34265 37432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 38254 37445 gene locus_tag LOCUS_03300 38254 37445 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947384.1 protein_id gnl|my_center|LOCUS_03300 >Feature sequence08 1115 357 gene locus_tag LOCUS_03310 1115 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680349.1 protein_id gnl|my_center|LOCUS_03310 2218 1247 gene locus_tag LOCUS_03320 2218 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 2712 2437 gene locus_tag LOCUS_03330 2712 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 4004 2934 gene locus_tag LOCUS_03340 4004 2934 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459574.1 protein_id gnl|my_center|LOCUS_03340 4356 4267 gene locus_tag LOCUS_t00280 4356 4267 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4820 4335 gene locus_tag LOCUS_03350 4820 4335 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963450.1 protein_id gnl|my_center|LOCUS_03350 5253 4864 gene locus_tag LOCUS_03360 5253 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 5370 6311 gene locus_tag LOCUS_03370 5370 6311 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080469.1 protein_id gnl|my_center|LOCUS_03370 6397 7095 gene locus_tag LOCUS_03380 6397 7095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 7095 7607 gene locus_tag LOCUS_03390 7095 7607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 8637 7609 gene locus_tag LOCUS_03400 gene mtnA 8637 7609 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080652.1 protein_id gnl|my_center|LOCUS_03400 8819 8637 gene locus_tag LOCUS_03410 gene rpmB 8819 8637 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012547624.1 protein_id gnl|my_center|LOCUS_03410 8921 9253 gene locus_tag LOCUS_03420 8921 9253 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813375.1 protein_id gnl|my_center|LOCUS_03420 9254 10873 gene locus_tag LOCUS_03430 9254 10873 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262763.1 protein_id gnl|my_center|LOCUS_03430 10881 11669 gene locus_tag LOCUS_03440 10881 11669 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174269896.1 protein_id gnl|my_center|LOCUS_03440 11671 13005 gene locus_tag LOCUS_03450 11671 13005 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964854.1 protein_id gnl|my_center|LOCUS_03450 12998 15619 gene locus_tag LOCUS_03460 12998 15619 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546426.1 protein_id gnl|my_center|LOCUS_03460 15815 16345 gene locus_tag LOCUS_03470 15815 16345 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_03470 16358 16678 gene locus_tag LOCUS_03480 gene trxA 16358 16678 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140882.1 protein_id gnl|my_center|LOCUS_03480 17368 16712 gene locus_tag LOCUS_03490 gene rpe 17368 16712 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957271.1 protein_id gnl|my_center|LOCUS_03490 18045 17365 gene locus_tag LOCUS_03500 18045 17365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 18109 18600 gene locus_tag LOCUS_03510 gene coaD 18109 18600 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583503.1 protein_id gnl|my_center|LOCUS_03510 18590 19066 gene locus_tag LOCUS_03520 18590 19066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 19035 19196 gene locus_tag LOCUS_03530 19035 19196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 19322 20608 gene locus_tag LOCUS_03540 gene asnS 19322 20608 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583296.1 protein_id gnl|my_center|LOCUS_03540 20605 21627 gene locus_tag LOCUS_03550 gene holA 20605 21627 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468790.1 protein_id gnl|my_center|LOCUS_03550 21929 21633 gene locus_tag LOCUS_03560 21929 21633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 22134 22499 gene locus_tag LOCUS_03570 22134 22499 CDS product DUF2089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583104.1 protein_id gnl|my_center|LOCUS_03570 22496 23443 gene locus_tag LOCUS_03580 22496 23443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 23443 23832 gene locus_tag LOCUS_03590 23443 23832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 23875 25287 gene locus_tag LOCUS_03600 23875 25287 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250240.1 protein_id gnl|my_center|LOCUS_03600 25528 26205 gene locus_tag LOCUS_03610 25528 26205 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_03610 26206 27927 gene locus_tag LOCUS_03620 gene polX 26206 27927 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_03620 27927 28607 gene locus_tag LOCUS_03630 27927 28607 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018010902.1 protein_id gnl|my_center|LOCUS_03630 28604 29518 gene locus_tag LOCUS_03640 28604 29518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 30348 29527 gene locus_tag LOCUS_03650 30348 29527 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941313.1 protein_id gnl|my_center|LOCUS_03650 31189 30335 gene locus_tag LOCUS_03660 31189 30335 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941312.1 protein_id gnl|my_center|LOCUS_03660 31727 31179 gene locus_tag LOCUS_03670 31727 31179 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_03670 32017 31724 gene locus_tag LOCUS_03680 32017 31724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 >Feature sequence09 <1 533 gene locus_tag LOCUS_03690 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004535402.1:8-oxoguanine deaminase 1263 553 gene locus_tag LOCUS_03700 1263 553 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021568.1 protein_id gnl|my_center|LOCUS_03700 3205 1370 gene locus_tag LOCUS_03710 3205 1370 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932766.1 protein_id gnl|my_center|LOCUS_03710 4446 3202 gene locus_tag LOCUS_03720 4446 3202 CDS product ATP citrate lyase citrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932767.1 protein_id gnl|my_center|LOCUS_03720 5666 4446 gene locus_tag LOCUS_03730 gene icd 5666 4446 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 protein_id gnl|my_center|LOCUS_03730 7621 5663 gene locus_tag LOCUS_03740 7621 5663 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881159.1 protein_id gnl|my_center|LOCUS_03740 8297 7602 gene locus_tag LOCUS_03750 8297 7602 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694171.1 protein_id gnl|my_center|LOCUS_03750 8489 8899 gene locus_tag LOCUS_03760 8489 8899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 9398 8925 gene locus_tag LOCUS_03770 9398 8925 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869796.1 protein_id gnl|my_center|LOCUS_03770 10579 9446 gene locus_tag LOCUS_03780 10579 9446 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249077.1 protein_id gnl|my_center|LOCUS_03780 10848 10576 gene locus_tag LOCUS_03790 10848 10576 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249076.1 protein_id gnl|my_center|LOCUS_03790 11332 10838 gene locus_tag LOCUS_03800 11332 10838 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064203.1 protein_id gnl|my_center|LOCUS_03800 12728 11325 gene locus_tag LOCUS_03810 12728 11325 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146532.1 protein_id gnl|my_center|LOCUS_03810 13961 12798 gene locus_tag LOCUS_03820 13961 12798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 14335 13958 gene locus_tag LOCUS_03830 14335 13958 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052767.1 protein_id gnl|my_center|LOCUS_03830 14355 14981 gene locus_tag LOCUS_03840 14355 14981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 15306 15013 gene locus_tag LOCUS_03850 15306 15013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 16163 15303 gene locus_tag LOCUS_03860 16163 15303 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583689.1 protein_id gnl|my_center|LOCUS_03860 18063 16447 gene locus_tag LOCUS_03870 gene groL 18063 16447 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392083.1 protein_id gnl|my_center|LOCUS_03870 18365 18075 gene locus_tag LOCUS_03880 gene groES 18365 18075 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_03880 18666 19136 gene locus_tag LOCUS_03890 18666 19136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 19117 19746 gene locus_tag LOCUS_03900 gene tsaB 19117 19746 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817349.1 protein_id gnl|my_center|LOCUS_03900 19743 20210 gene locus_tag LOCUS_03910 gene rimI 19743 20210 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583327.1 protein_id gnl|my_center|LOCUS_03910 20191 21198 gene locus_tag LOCUS_03920 gene tsaD 20191 21198 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414585.1 protein_id gnl|my_center|LOCUS_03920 21254 21919 gene locus_tag LOCUS_03930 21254 21919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 21903 22880 gene locus_tag LOCUS_03940 21903 22880 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947942.1 protein_id gnl|my_center|LOCUS_03940 22850 23650 gene locus_tag LOCUS_03950 gene rsmA 22850 23650 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986025.1 protein_id gnl|my_center|LOCUS_03950 23706 24092 gene locus_tag LOCUS_03960 gene gcvH 23706 24092 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964219.1 protein_id gnl|my_center|LOCUS_03960 24097 25437 gene locus_tag LOCUS_03970 gene gcvPA 24097 25437 CDS product aminomethyl-transferring glycine dehydrogenase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903221.1 protein_id gnl|my_center|LOCUS_03970 25434 26897 gene locus_tag LOCUS_03980 gene gcvPB 25434 26897 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230209.1 protein_id gnl|my_center|LOCUS_03980 26884 28524 gene locus_tag LOCUS_03990 gene argS 26884 28524 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546374.1 protein_id gnl|my_center|LOCUS_03990 >Feature sequence10 <1 627 gene locus_tag LOCUS_04000 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583200.1:ABC transporter ATP-binding protein 643 1134 gene locus_tag LOCUS_04010 643 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 2065 1343 gene locus_tag LOCUS_04020 2065 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583157.1 protein_id gnl|my_center|LOCUS_04020 2861 2148 gene locus_tag LOCUS_04030 2861 2148 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583690.1 protein_id gnl|my_center|LOCUS_04030 3671 2865 gene locus_tag LOCUS_04040 3671 2865 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250846.1 protein_id gnl|my_center|LOCUS_04040 4070 3672 gene locus_tag LOCUS_04050 4070 3672 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868145.1 protein_id gnl|my_center|LOCUS_04050 5087 4155 gene locus_tag LOCUS_04060 5087 4155 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545618.1 protein_id gnl|my_center|LOCUS_04060 6261 5092 gene locus_tag LOCUS_04070 gene porA 6261 5092 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082460.1 protein_id gnl|my_center|LOCUS_04070 6613 6275 gene locus_tag LOCUS_04080 6613 6275 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582672.1 protein_id gnl|my_center|LOCUS_04080 7179 6610 gene locus_tag LOCUS_04090 7179 6610 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582671.1 protein_id gnl|my_center|LOCUS_04090 7458 7261 gene locus_tag LOCUS_04100 7458 7261 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080635.1 protein_id gnl|my_center|LOCUS_04100 10126 7514 gene locus_tag LOCUS_04110 10126 7514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 10409 11686 gene locus_tag LOCUS_04120 10409 11686 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681109.1 protein_id gnl|my_center|LOCUS_04120 11754 12116 gene locus_tag LOCUS_04130 11754 12116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 12134 12481 gene locus_tag LOCUS_04140 12134 12481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 12481 12556 gene locus_tag LOCUS_t00290 12481 12556 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12790 13995 gene locus_tag LOCUS_04150 12790 13995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 13996 16341 gene locus_tag LOCUS_04160 13996 16341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 16906 16334 gene locus_tag LOCUS_04170 16906 16334 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876490.1 protein_id gnl|my_center|LOCUS_04170 17700 16912 gene locus_tag LOCUS_04180 17700 16912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04180 18035 19222 gene locus_tag LOCUS_04190 18035 19222 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_04190 19222 19470 gene locus_tag LOCUS_04200 19222 19470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 19817 20521 gene locus_tag LOCUS_04210 19817 20521 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257323.1 protein_id gnl|my_center|LOCUS_04210 22683 20680 gene locus_tag LOCUS_04220 22683 20680 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 protein_id gnl|my_center|LOCUS_04220 22879 22667 gene locus_tag LOCUS_04230 22879 22667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 24861 22927 gene locus_tag LOCUS_04240 24861 22927 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_04240 25273 24983 gene locus_tag LOCUS_04250 25273 24983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 25559 25299 gene locus_tag LOCUS_04260 25559 25299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 25771 26631 gene locus_tag LOCUS_04270 25771 26631 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880542.1 protein_id gnl|my_center|LOCUS_04270 26902 27381 gene locus_tag LOCUS_04280 26902 27381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 >Feature sequence11 225 962 gene locus_tag LOCUS_04290 225 962 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393480.1 protein_id gnl|my_center|LOCUS_04290 950 1954 gene locus_tag LOCUS_04300 950 1954 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948771.1 protein_id gnl|my_center|LOCUS_04300 1941 2666 gene locus_tag LOCUS_04310 1941 2666 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392949.1 protein_id gnl|my_center|LOCUS_04310 2706 4169 gene locus_tag LOCUS_04320 2706 4169 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060924.1 protein_id gnl|my_center|LOCUS_04320 4182 5318 gene locus_tag LOCUS_04330 4182 5318 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583661.1 protein_id gnl|my_center|LOCUS_04330 7517 5634 gene locus_tag LOCUS_04340 7517 5634 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249027.1 protein_id gnl|my_center|LOCUS_04340 8519 7527 gene locus_tag LOCUS_04350 8519 7527 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811663.1 protein_id gnl|my_center|LOCUS_04350 9547 8531 gene locus_tag LOCUS_04360 9547 8531 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_04360 10574 9534 gene locus_tag LOCUS_04370 10574 9534 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583050.1 protein_id gnl|my_center|LOCUS_04370 11412 11014 gene locus_tag LOCUS_04380 gene ndk 11412 11014 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846241.1 protein_id gnl|my_center|LOCUS_04380 11927 11412 gene locus_tag LOCUS_04390 11927 11412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04390 12709 11942 gene locus_tag LOCUS_04400 12709 11942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04400 14409 12709 gene locus_tag LOCUS_04410 14409 12709 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391946.1 protein_id gnl|my_center|LOCUS_04410 14729 14418 gene locus_tag LOCUS_04420 14729 14418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 14836 15846 gene locus_tag LOCUS_04430 14836 15846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 15988 17001 gene locus_tag LOCUS_04440 15988 17001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 17387 18997 gene locus_tag LOCUS_04450 17387 18997 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913630.1 protein_id gnl|my_center|LOCUS_04450 19070 19996 gene locus_tag LOCUS_04460 gene oppB 19070 19996 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245554.1 protein_id gnl|my_center|LOCUS_04460 20004 20915 gene locus_tag LOCUS_04470 20004 20915 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966905.1 protein_id gnl|my_center|LOCUS_04470 20927 21928 gene locus_tag LOCUS_04480 20927 21928 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966904.1 protein_id gnl|my_center|LOCUS_04480 21928 22917 gene locus_tag LOCUS_04490 21928 22917 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_04490 24329 23226 gene locus_tag LOCUS_04500 gene thiI 24329 23226 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496669.1 protein_id gnl|my_center|LOCUS_04500 24626 25834 gene locus_tag LOCUS_04510 24626 25834 CDS product DUF401 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320021.1 protein_id gnl|my_center|LOCUS_04510 25885 25975 gene locus_tag LOCUS_t00300 25885 25975 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 26088 26507 gene locus_tag LOCUS_04520 26088 26507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 26623 27138 gene locus_tag LOCUS_04530 gene raiA 26623 27138 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773749.1 protein_id gnl|my_center|LOCUS_04530 >Feature sequence12 1640 681 gene locus_tag LOCUS_04540 1640 681 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583149.1 protein_id gnl|my_center|LOCUS_04540 3003 1633 gene locus_tag LOCUS_04550 gene glmU 3003 1633 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931068.1 protein_id gnl|my_center|LOCUS_04550 4387 3155 gene locus_tag LOCUS_04560 4387 3155 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772253.1 protein_id gnl|my_center|LOCUS_04560 5374 4406 gene locus_tag LOCUS_04570 5374 4406 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680329.1 protein_id gnl|my_center|LOCUS_04570 6248 5472 gene locus_tag LOCUS_04580 gene mtnP 6248 5472 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250433.1 protein_id gnl|my_center|LOCUS_04580 6328 6402 gene locus_tag LOCUS_t00310 6328 6402 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6839 6381 gene locus_tag LOCUS_04590 gene dtd 6839 6381 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583334.1 protein_id gnl|my_center|LOCUS_04590 8790 6799 gene locus_tag LOCUS_04600 8790 6799 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_04600 9379 8864 gene locus_tag LOCUS_04610 9379 8864 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832698.1 protein_id gnl|my_center|LOCUS_04610 10501 9449 gene locus_tag LOCUS_04620 gene secF 10501 9449 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393192.1 protein_id gnl|my_center|LOCUS_04620 11784 10513 gene locus_tag LOCUS_04630 gene secD 11784 10513 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583952.1 protein_id gnl|my_center|LOCUS_04630 12511 11849 gene locus_tag LOCUS_04640 12511 11849 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_04640 13068 12508 gene locus_tag LOCUS_04650 13068 12508 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583745.1 protein_id gnl|my_center|LOCUS_04650 14308 13070 gene locus_tag LOCUS_04660 14308 13070 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986786.1 protein_id gnl|my_center|LOCUS_04660 16397 14295 gene locus_tag LOCUS_04670 16397 14295 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460388.1 protein_id gnl|my_center|LOCUS_04670 16665 16399 gene locus_tag LOCUS_04680 gene rpsO 16665 16399 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808855.1 protein_id gnl|my_center|LOCUS_04680 17683 16751 gene locus_tag LOCUS_04690 17683 16751 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986788.1 protein_id gnl|my_center|LOCUS_04690 18521 17670 gene locus_tag LOCUS_04700 gene truB 18521 17670 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546120.1 protein_id gnl|my_center|LOCUS_04700 18969 18484 gene locus_tag LOCUS_04710 18969 18484 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583251.1 protein_id gnl|my_center|LOCUS_04710 20161 18962 gene locus_tag LOCUS_04720 20161 18962 CDS product YbbR-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966359.1 protein_id gnl|my_center|LOCUS_04720 21008 20163 gene locus_tag LOCUS_04730 gene cdaA 21008 20163 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808428.1 protein_id gnl|my_center|LOCUS_04730 24189 21082 gene locus_tag LOCUS_04740 24189 21082 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839328.1 protein_id gnl|my_center|LOCUS_04740 25359 24193 gene locus_tag LOCUS_04750 25359 24193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 >Feature sequence13 678 205 gene locus_tag LOCUS_04760 678 205 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258099.1 protein_id gnl|my_center|LOCUS_04760 2022 688 gene locus_tag LOCUS_04770 gene folC 2022 688 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582053.1 protein_id gnl|my_center|LOCUS_04770 4665 2023 gene locus_tag LOCUS_04780 4665 2023 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048157.1 protein_id gnl|my_center|LOCUS_04780 5109 4684 gene locus_tag LOCUS_04790 5109 4684 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249520.1 protein_id gnl|my_center|LOCUS_04790 5311 5385 gene locus_tag LOCUS_t00320 5311 5385 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5404 6120 gene locus_tag LOCUS_04800 5404 6120 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047987.1 protein_id gnl|my_center|LOCUS_04800 6574 7374 gene locus_tag LOCUS_04810 gene rsmH 6574 7374 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949033.1 protein_id gnl|my_center|LOCUS_04810 7371 7637 gene locus_tag LOCUS_04820 7371 7637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 7627 9321 gene locus_tag LOCUS_04830 7627 9321 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965429.1 protein_id gnl|my_center|LOCUS_04830 9321 10772 gene locus_tag LOCUS_04840 9321 10772 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_04840 10756 12132 gene locus_tag LOCUS_04850 10756 12132 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545266.1 protein_id gnl|my_center|LOCUS_04850 12136 13065 gene locus_tag LOCUS_04860 gene mraY 12136 13065 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893058.1 protein_id gnl|my_center|LOCUS_04860 13073 14416 gene locus_tag LOCUS_04870 gene murD 13073 14416 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_04870 14413 15486 gene locus_tag LOCUS_04880 gene ftsW 14413 15486 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_04880 15488 16570 gene locus_tag LOCUS_04890 gene murG 15488 16570 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545433.1 protein_id gnl|my_center|LOCUS_04890 16563 17942 gene locus_tag LOCUS_04900 gene murC 16563 17942 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583606.1 protein_id gnl|my_center|LOCUS_04900 17926 18837 gene locus_tag LOCUS_04910 gene murB 17926 18837 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 protein_id gnl|my_center|LOCUS_04910 18815 19768 gene locus_tag LOCUS_04920 18815 19768 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583317.1 protein_id gnl|my_center|LOCUS_04920 19765 20364 gene locus_tag LOCUS_04930 19765 20364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 20361 21566 gene locus_tag LOCUS_04940 gene ftsA 20361 21566 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_04940 21585 22640 gene locus_tag LOCUS_04950 gene ftsZ 21585 22640 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_04950 22641 23528 gene locus_tag LOCUS_04960 22641 23528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 >Feature sequence14 2058 1627 gene locus_tag LOCUS_04970 gene nuoE 2058 1627 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584034.1 protein_id gnl|my_center|LOCUS_04970 3697 2036 gene locus_tag LOCUS_04980 gene nuoF 3697 2036 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_04980 4070 3702 gene locus_tag LOCUS_04990 4070 3702 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_04990 4623 4057 gene locus_tag LOCUS_05000 4623 4057 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_05000 5084 4620 gene locus_tag LOCUS_05010 5084 4620 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082449.1 protein_id gnl|my_center|LOCUS_05010 5479 6213 gene locus_tag LOCUS_05020 5479 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 8934 6559 gene locus_tag LOCUS_05030 8934 6559 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869170.1 protein_id gnl|my_center|LOCUS_05030 9418 8948 gene locus_tag LOCUS_05040 gene cutC 9418 8948 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846892.1 protein_id gnl|my_center|LOCUS_05040 10318 9428 gene locus_tag LOCUS_05050 10318 9428 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869168.1 protein_id gnl|my_center|LOCUS_05050 12020 10383 gene locus_tag LOCUS_05060 12020 10383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 13296 12052 gene locus_tag LOCUS_05070 13296 12052 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869166.1 protein_id gnl|my_center|LOCUS_05070 13925 13449 gene locus_tag LOCUS_05080 13925 13449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 14311 13931 gene locus_tag LOCUS_05090 14311 13931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 15914 14379 gene locus_tag LOCUS_05100 15914 14379 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869171.1 protein_id gnl|my_center|LOCUS_05100 16559 16924 gene locus_tag LOCUS_05110 16559 16924 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583279.1 protein_id gnl|my_center|LOCUS_05110 16909 17736 gene locus_tag LOCUS_05120 16909 17736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 19503 17920 gene locus_tag LOCUS_05130 19503 17920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 19851 19552 gene locus_tag LOCUS_05140 19851 19552 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082953.1 protein_id gnl|my_center|LOCUS_05140 20452 19862 gene locus_tag LOCUS_05150 gene rsxA 20452 19862 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_05150 21054 20449 gene locus_tag LOCUS_05160 gene rsxE 21054 20449 CDS product electron transport complex subunit RsxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583456.1 protein_id gnl|my_center|LOCUS_05160 21647 21051 gene locus_tag LOCUS_05170 21647 21051 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583455.1 protein_id gnl|my_center|LOCUS_05170 22645 21644 gene locus_tag LOCUS_05180 22645 21644 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583454.1 protein_id gnl|my_center|LOCUS_05180 <24001 22638 gene locus_tag LOCUS_05190 <24001 22638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003428488.1:electron transport complex subunit RsxC >Feature sequence15 1543 1310 gene locus_tag LOCUS_05200 1543 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 2599 1754 gene locus_tag LOCUS_05210 2599 1754 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876526.1 protein_id gnl|my_center|LOCUS_05210 4167 3286 gene locus_tag LOCUS_05220 4167 3286 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583214.1 protein_id gnl|my_center|LOCUS_05220 5711 4281 gene locus_tag LOCUS_05230 gene pyk 5711 4281 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584142.1 protein_id gnl|my_center|LOCUS_05230 6810 5692 gene locus_tag LOCUS_05240 gene dnaJ 6810 5692 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920758.1 protein_id gnl|my_center|LOCUS_05240 8643 6814 gene locus_tag LOCUS_05250 gene dnaK 8643 6814 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582444.1 protein_id gnl|my_center|LOCUS_05250 9283 8645 gene locus_tag LOCUS_05260 9283 8645 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880243.1 protein_id gnl|my_center|LOCUS_05260 11609 10242 gene locus_tag LOCUS_05270 11609 10242 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 protein_id gnl|my_center|LOCUS_05270 14102 11793 gene locus_tag LOCUS_05280 gene priA 14102 11793 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989822.1 protein_id gnl|my_center|LOCUS_05280 15285 14095 gene locus_tag LOCUS_05290 gene metK 15285 14095 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546806.1 protein_id gnl|my_center|LOCUS_05290 16483 15278 gene locus_tag LOCUS_05300 gene coaBC 16483 15278 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722165.1 protein_id gnl|my_center|LOCUS_05300 16664 16467 gene locus_tag LOCUS_05310 16664 16467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 17855 16722 gene locus_tag LOCUS_05320 17855 16722 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305385.1 protein_id gnl|my_center|LOCUS_05320 18721 17852 gene locus_tag LOCUS_05330 gene ftsX 18721 17852 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198720.1 protein_id gnl|my_center|LOCUS_05330 19373 18714 gene locus_tag LOCUS_05340 gene ftsE 19373 18714 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228039.1 protein_id gnl|my_center|LOCUS_05340 20281 19370 gene locus_tag LOCUS_05350 20281 19370 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583758.1 protein_id gnl|my_center|LOCUS_05350 21116 20229 gene locus_tag LOCUS_05360 gene prfB 21116 20229 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082004.1 protein_id gnl|my_center|LOCUS_05360 <23803 21338 gene locus_tag LOCUS_05370 <23803 21338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583762.1:preprotein translocase subunit SecA >Feature sequence16 576 1079 gene locus_tag LOCUS_05380 576 1079 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249699.1 protein_id gnl|my_center|LOCUS_05380 2198 1104 gene locus_tag LOCUS_05390 2198 1104 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815362.1 protein_id gnl|my_center|LOCUS_05390 2704 2201 gene locus_tag LOCUS_05400 2704 2201 CDS product DUF2148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761545.1 protein_id gnl|my_center|LOCUS_05400 3055 2729 gene locus_tag LOCUS_05410 3055 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 3396 3055 gene locus_tag LOCUS_05420 3396 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 3905 3393 gene locus_tag LOCUS_05430 3905 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 4157 4783 gene locus_tag LOCUS_05440 4157 4783 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869499.1 protein_id gnl|my_center|LOCUS_05440 4794 5771 gene locus_tag LOCUS_05450 gene trpS 4794 5771 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583821.1 protein_id gnl|my_center|LOCUS_05450 5771 6436 gene locus_tag LOCUS_05460 5771 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 6378 6908 gene locus_tag LOCUS_05470 gene scpB 6378 6908 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842431.1 protein_id gnl|my_center|LOCUS_05470 7364 7804 gene locus_tag LOCUS_05480 7364 7804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 8059 8352 gene locus_tag LOCUS_05490 8059 8352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 8354 8677 gene locus_tag LOCUS_05500 8354 8677 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878370.1 protein_id gnl|my_center|LOCUS_05500 8674 9573 gene locus_tag LOCUS_05510 8674 9573 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_05510 9557 10333 gene locus_tag LOCUS_05520 9557 10333 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015646122.1 protein_id gnl|my_center|LOCUS_05520 10391 11041 gene locus_tag LOCUS_05530 10391 11041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 11346 11924 gene locus_tag LOCUS_05540 11346 11924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 12559 11930 gene locus_tag LOCUS_05550 12559 11930 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392225.1 protein_id gnl|my_center|LOCUS_05550 12761 14569 gene locus_tag LOCUS_05560 12761 14569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 14662 15183 gene locus_tag LOCUS_05570 14662 15183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 15297 15857 gene locus_tag LOCUS_05580 15297 15857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808298.1 protein_id gnl|my_center|LOCUS_05580 15913 16761 gene locus_tag LOCUS_05590 15913 16761 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583151.1 protein_id gnl|my_center|LOCUS_05590 18665 16803 gene locus_tag LOCUS_05600 gene mnmG 18665 16803 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583474.1 protein_id gnl|my_center|LOCUS_05600 18799 18921 gene locus_tag LOCUS_05610 18799 18921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 18982 19968 gene locus_tag LOCUS_05620 18982 19968 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971592.1 protein_id gnl|my_center|LOCUS_05620 19991 20842 gene locus_tag LOCUS_05630 gene accD 19991 20842 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_05630 >Feature sequence17 307 382 gene locus_tag LOCUS_t00330 307 382 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 641 1177 gene locus_tag LOCUS_05640 gene nusG 641 1177 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810198.1 protein_id gnl|my_center|LOCUS_05640 1188 1622 gene locus_tag LOCUS_05650 gene rplK 1188 1622 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012548197.1 protein_id gnl|my_center|LOCUS_05650 1667 2371 gene locus_tag LOCUS_05660 gene rplA 1667 2371 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_05660 2513 3055 gene locus_tag LOCUS_05670 gene rplJ 2513 3055 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048982.1 protein_id gnl|my_center|LOCUS_05670 3075 3452 gene locus_tag LOCUS_05680 gene rplL 3075 3452 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081509.1 protein_id gnl|my_center|LOCUS_05680 4353 3514 gene locus_tag LOCUS_05690 gene ispE 4353 3514 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947969.1 protein_id gnl|my_center|LOCUS_05690 4587 5609 gene locus_tag LOCUS_05700 gene pheS 4587 5609 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403382.1 protein_id gnl|my_center|LOCUS_05700 5621 8026 gene locus_tag LOCUS_05710 gene pheT 5621 8026 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458979.1 protein_id gnl|my_center|LOCUS_05710 8023 9693 gene locus_tag LOCUS_05720 gene polX 8023 9693 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020772.1 protein_id gnl|my_center|LOCUS_05720 9690 12038 gene locus_tag LOCUS_05730 9690 12038 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458990.1 protein_id gnl|my_center|LOCUS_05730 12048 14276 gene locus_tag LOCUS_05740 12048 14276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 14310 14386 gene locus_tag LOCUS_t00340 14310 14386 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14410 14685 gene locus_tag LOCUS_05750 14410 14685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 14678 14959 gene locus_tag LOCUS_05760 14678 14959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 14967 16055 gene locus_tag LOCUS_05770 14967 16055 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438644.1 protein_id gnl|my_center|LOCUS_05770 17178 16078 gene locus_tag LOCUS_05780 17178 16078 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083179.1 protein_id gnl|my_center|LOCUS_05780 17350 17697 gene locus_tag LOCUS_05790 17350 17697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 17702 18382 gene locus_tag LOCUS_05800 gene radC 17702 18382 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546157.1 protein_id gnl|my_center|LOCUS_05800 18517 20583 gene locus_tag LOCUS_05810 18517 20583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 >Feature sequence18 792 1853 gene locus_tag LOCUS_05820 792 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 4058 2157 gene locus_tag LOCUS_05830 4058 2157 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986480.1 protein_id gnl|my_center|LOCUS_05830 5185 4052 gene locus_tag LOCUS_05840 5185 4052 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986481.1 protein_id gnl|my_center|LOCUS_05840 6108 5251 gene locus_tag LOCUS_05850 6108 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 6872 6105 gene locus_tag LOCUS_05860 6872 6105 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762400.1 protein_id gnl|my_center|LOCUS_05860 7796 6888 gene locus_tag LOCUS_05870 gene fmt 7796 6888 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583791.1 protein_id gnl|my_center|LOCUS_05870 8299 7793 gene locus_tag LOCUS_05880 gene def 8299 7793 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279455.1 protein_id gnl|my_center|LOCUS_05880 8868 8296 gene locus_tag LOCUS_05890 8868 8296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 9690 8869 gene locus_tag LOCUS_05900 gene prmC 9690 8869 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_05900 10780 9701 gene locus_tag LOCUS_05910 gene prfA 10780 9701 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880532.1 protein_id gnl|my_center|LOCUS_05910 11373 10777 gene locus_tag LOCUS_05920 11373 10777 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966171.1 protein_id gnl|my_center|LOCUS_05920 12832 11363 gene locus_tag LOCUS_05930 gene rho 12832 11363 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966173.1 protein_id gnl|my_center|LOCUS_05930 13502 12867 gene locus_tag LOCUS_05940 13502 12867 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922736.1 protein_id gnl|my_center|LOCUS_05940 14244 13507 gene locus_tag LOCUS_05950 14244 13507 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392938.1 protein_id gnl|my_center|LOCUS_05950 14341 15636 gene locus_tag LOCUS_05960 14341 15636 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867672.1 protein_id gnl|my_center|LOCUS_05960 15633 17081 gene locus_tag LOCUS_05970 15633 17081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 17078 18097 gene locus_tag LOCUS_05980 gene csaB 17078 18097 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886807.1 protein_id gnl|my_center|LOCUS_05980 18135 18716 gene locus_tag LOCUS_05990 18135 18716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 19853 18738 gene locus_tag LOCUS_06000 19853 18738 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582795.1 protein_id gnl|my_center|LOCUS_06000 >Feature sequence19 <1 603 gene locus_tag LOCUS_06010 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582819.1:fibronectin type III domain-containing protein 854 2164 gene locus_tag LOCUS_06020 gene dnaA 854 2164 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582428.1 protein_id gnl|my_center|LOCUS_06020 2385 3500 gene locus_tag LOCUS_06030 gene dnaN 2385 3500 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035260.1 protein_id gnl|my_center|LOCUS_06030 3500 4537 gene locus_tag LOCUS_06040 gene recF 3500 4537 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475454.1 protein_id gnl|my_center|LOCUS_06040 4534 5091 gene locus_tag LOCUS_06050 4534 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 5163 5297 gene locus_tag LOCUS_06060 5163 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 5305 5622 gene locus_tag LOCUS_06070 gene rnpA 5305 5622 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242628.1 protein_id gnl|my_center|LOCUS_06070 5619 5828 gene locus_tag LOCUS_06080 gene yidD 5619 5828 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081754.1 protein_id gnl|my_center|LOCUS_06080 5838 6959 gene locus_tag LOCUS_06090 5838 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 6961 7410 gene locus_tag LOCUS_06100 6961 7410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 7407 8753 gene locus_tag LOCUS_06110 gene mnmE 7407 8753 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700790.1 protein_id gnl|my_center|LOCUS_06110 8980 11316 gene locus_tag LOCUS_06120 8980 11316 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987122.1 protein_id gnl|my_center|LOCUS_06120 11316 11864 gene locus_tag LOCUS_06130 11316 11864 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223812.1 protein_id gnl|my_center|LOCUS_06130 11869 13101 gene locus_tag LOCUS_06140 11869 13101 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090011.1 protein_id gnl|my_center|LOCUS_06140 13129 14142 gene locus_tag LOCUS_06150 13129 14142 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528955.1 protein_id gnl|my_center|LOCUS_06150 14216 15748 gene locus_tag LOCUS_06160 14216 15748 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948025.1 protein_id gnl|my_center|LOCUS_06160 15735 16805 gene locus_tag LOCUS_06170 15735 16805 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390596.1 protein_id gnl|my_center|LOCUS_06170 16802 17737 gene locus_tag LOCUS_06180 16802 17737 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528958.1 protein_id gnl|my_center|LOCUS_06180 17878 18582 gene locus_tag LOCUS_06190 17878 18582 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476241.1 protein_id gnl|my_center|LOCUS_06190 >Feature sequence20 717 325 gene locus_tag LOCUS_06200 gene rpsI 717 325 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_06200 1659 718 gene locus_tag LOCUS_06210 1659 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 2473 1712 gene locus_tag LOCUS_06220 gene truA 2473 1712 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583376.1 protein_id gnl|my_center|LOCUS_06220 3267 2470 gene locus_tag LOCUS_06230 3267 2470 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991426.1 protein_id gnl|my_center|LOCUS_06230 4106 3264 gene locus_tag LOCUS_06240 4106 3264 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583374.1 protein_id gnl|my_center|LOCUS_06240 4906 4094 gene locus_tag LOCUS_06250 4906 4094 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711757.1 protein_id gnl|my_center|LOCUS_06250 5259 4903 gene locus_tag LOCUS_06260 gene rplQ 5259 4903 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357477.1 protein_id gnl|my_center|LOCUS_06260 6193 5273 gene locus_tag LOCUS_06270 6193 5273 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583371.1 protein_id gnl|my_center|LOCUS_06270 6836 6207 gene locus_tag LOCUS_06280 gene rpsD 6836 6207 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545818.1 protein_id gnl|my_center|LOCUS_06280 7241 6849 gene locus_tag LOCUS_06290 gene rpsK 7241 6849 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583369.1 protein_id gnl|my_center|LOCUS_06290 7627 7256 gene locus_tag LOCUS_06300 gene rpsM 7627 7256 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583368.1 protein_id gnl|my_center|LOCUS_06300 7985 7770 gene locus_tag LOCUS_06310 gene infA 7985 7770 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521905.1 protein_id gnl|my_center|LOCUS_06310 8747 8001 gene locus_tag LOCUS_06320 gene map 8747 8001 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_06320 9390 8734 gene locus_tag LOCUS_06330 9390 8734 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_06330 10655 9390 gene locus_tag LOCUS_06340 gene secY 10655 9390 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_06340 11079 10657 gene locus_tag LOCUS_06350 gene rplO 11079 10657 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288687.1 protein_id gnl|my_center|LOCUS_06350 11584 11060 gene locus_tag LOCUS_06360 gene rpsE 11584 11060 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896437.1 protein_id gnl|my_center|LOCUS_06360 11962 11594 gene locus_tag LOCUS_06370 gene rplR 11962 11594 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583361.1 protein_id gnl|my_center|LOCUS_06370 12523 11975 gene locus_tag LOCUS_06380 gene rplF 12523 11975 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258246.1 protein_id gnl|my_center|LOCUS_06380 12930 12535 gene locus_tag LOCUS_06390 gene rpsH 12930 12535 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036371522.1 protein_id gnl|my_center|LOCUS_06390 13125 12940 gene locus_tag LOCUS_06400 13125 12940 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081809.1 protein_id gnl|my_center|LOCUS_06400 13745 13134 gene locus_tag LOCUS_06410 gene rplE 13745 13134 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393925.1 protein_id gnl|my_center|LOCUS_06410 14105 13758 gene locus_tag LOCUS_06420 gene rplX 14105 13758 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583356.1 protein_id gnl|my_center|LOCUS_06420 14483 14115 gene locus_tag LOCUS_06430 gene rplN 14483 14115 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779438.1 protein_id gnl|my_center|LOCUS_06430 14725 14480 gene locus_tag LOCUS_06440 gene rpsQ 14725 14480 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301190.1 protein_id gnl|my_center|LOCUS_06440 14931 14728 gene locus_tag LOCUS_06450 gene rpmC 14931 14728 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644737.1 protein_id gnl|my_center|LOCUS_06450 15356 14934 gene locus_tag LOCUS_06460 gene rplP 15356 14934 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_06460 16040 15366 gene locus_tag LOCUS_06470 gene rpsC 16040 15366 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583351.1 protein_id gnl|my_center|LOCUS_06470 16383 16042 gene locus_tag LOCUS_06480 16383 16042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 16670 16395 gene locus_tag LOCUS_06490 gene rpsS 16670 16395 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583349.1 protein_id gnl|my_center|LOCUS_06490 17500 16673 gene locus_tag LOCUS_06500 gene rplB 17500 16673 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583348.1 protein_id gnl|my_center|LOCUS_06500 17797 17513 gene locus_tag LOCUS_06510 gene rplW 17797 17513 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081832.1 protein_id gnl|my_center|LOCUS_06510 18428 17790 gene locus_tag LOCUS_06520 gene rplD 18428 17790 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_06520 19041 18430 gene locus_tag LOCUS_06530 gene rplC 19041 18430 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173714.1 protein_id gnl|my_center|LOCUS_06530 19361 19053 gene locus_tag LOCUS_06540 gene rpsJ 19361 19053 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638059.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence21 683 393 gene locus_tag LOCUS_06550 683 393 CDS product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047969.1 protein_id gnl|my_center|LOCUS_06550 1619 684 gene locus_tag LOCUS_06560 1619 684 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867920.1 protein_id gnl|my_center|LOCUS_06560 3301 1616 gene locus_tag LOCUS_06570 3301 1616 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053795.1 protein_id gnl|my_center|LOCUS_06570 4222 3443 gene locus_tag LOCUS_06580 gene folE2 4222 3443 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_06580 4583 4203 gene locus_tag LOCUS_06590 gene queD 4583 4203 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082502.1 protein_id gnl|my_center|LOCUS_06590 5256 4624 gene locus_tag LOCUS_06600 5256 4624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 5581 5387 gene locus_tag LOCUS_06610 5581 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 5875 8385 gene locus_tag LOCUS_06620 5875 8385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 8810 8532 gene locus_tag LOCUS_06630 8810 8532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 9111 8815 gene locus_tag LOCUS_06640 9111 8815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 10002 11237 gene locus_tag LOCUS_06650 10002 11237 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732668.1 protein_id gnl|my_center|LOCUS_06650 11575 12420 gene locus_tag LOCUS_06660 11575 12420 CDS product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439094.1 protein_id gnl|my_center|LOCUS_06660 12420 12884 gene locus_tag LOCUS_06670 12420 12884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417884.1 protein_id gnl|my_center|LOCUS_06670 12885 14210 gene locus_tag LOCUS_06680 12885 14210 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439092.1 protein_id gnl|my_center|LOCUS_06680 14425 15750 gene locus_tag LOCUS_06690 14425 15750 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860380.1 protein_id gnl|my_center|LOCUS_06690 15919 16077 gene locus_tag LOCUS_06700 15919 16077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 16093 16588 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttgtagctaacctataagggattgaaac 16901 16647 gene locus_tag LOCUS_06710 16901 16647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 17540 16941 gene locus_tag LOCUS_06720 17540 16941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 18323 17751 gene locus_tag LOCUS_06730 18323 17751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020605.1 protein_id gnl|my_center|LOCUS_06730 18684 18343 gene locus_tag LOCUS_06740 18684 18343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 >Feature sequence22 3 620 gene locus_tag LOCUS_06750 3 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 829 617 gene locus_tag LOCUS_06760 829 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 1277 822 gene locus_tag LOCUS_06770 1277 822 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343928.1 protein_id gnl|my_center|LOCUS_06770 1681 1274 gene locus_tag LOCUS_06780 1681 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 2367 1678 gene locus_tag LOCUS_06790 2367 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 2528 3415 gene locus_tag LOCUS_06800 gene era 2528 3415 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 protein_id gnl|my_center|LOCUS_06800 3967 3542 gene locus_tag LOCUS_06810 3967 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 4804 3995 gene locus_tag LOCUS_06820 gene uppP 4804 3995 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392108.1 protein_id gnl|my_center|LOCUS_06820 5791 4850 gene locus_tag LOCUS_06830 5791 4850 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_06830 6277 5795 gene locus_tag LOCUS_06840 gene ispF 6277 5795 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963756.1 protein_id gnl|my_center|LOCUS_06840 6936 6262 gene locus_tag LOCUS_06850 6936 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06850 8269 6938 gene locus_tag LOCUS_06860 gene radA 8269 6938 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453976.1 protein_id gnl|my_center|LOCUS_06860 9737 8250 gene locus_tag LOCUS_06870 gene lysS 9737 8250 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_06870 10234 9737 gene locus_tag LOCUS_06880 gene greA 10234 9737 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_06880 11222 10227 gene locus_tag LOCUS_06890 gene dusB 11222 10227 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_06890 11973 11200 gene locus_tag LOCUS_06900 11973 11200 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578367.1 protein_id gnl|my_center|LOCUS_06900 12250 11975 gene locus_tag LOCUS_06910 12250 11975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 12665 12192 gene locus_tag LOCUS_06920 12665 12192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 12733 13635 gene locus_tag LOCUS_06930 12733 13635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 14495 13749 gene locus_tag LOCUS_06940 14495 13749 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224329.1 protein_id gnl|my_center|LOCUS_06940 15975 14506 gene locus_tag LOCUS_06950 gene glpK 15975 14506 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583206.1 protein_id gnl|my_center|LOCUS_06950 17604 16063 gene locus_tag LOCUS_06960 gene guaA 17604 16063 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439265.1 protein_id gnl|my_center|LOCUS_06960 18682 17588 gene locus_tag LOCUS_06970 18682 17588 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183240.1 protein_id gnl|my_center|LOCUS_06970 >Feature sequence23 134 23 gene locus_tag LOCUS_r00010 134 23 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1111 914 gene locus_tag LOCUS_06980 1111 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 4481 1118 gene locus_tag LOCUS_r00020 4481 1118 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 6202 4641 gene locus_tag LOCUS_r00030 6202 4641 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 7107 6532 gene locus_tag LOCUS_06990 7107 6532 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_06990 7456 7088 gene locus_tag LOCUS_07000 7456 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 7604 8068 gene locus_tag LOCUS_07010 7604 8068 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428407.1 protein_id gnl|my_center|LOCUS_07010 8678 8085 gene locus_tag LOCUS_07020 gene iorB 8678 8085 CDS product indolepyruvate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877455.1 protein_id gnl|my_center|LOCUS_07020 10537 8675 gene locus_tag LOCUS_07030 gene iorA 10537 8675 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877454.1 protein_id gnl|my_center|LOCUS_07030 12070 10547 gene locus_tag LOCUS_07040 12070 10547 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_07040 13104 12076 gene locus_tag LOCUS_07050 13104 12076 CDS product bis-aminopropyl spermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064426.1 protein_id gnl|my_center|LOCUS_07050 13197 13556 gene locus_tag LOCUS_07060 gene acpS 13197 13556 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545321.1 protein_id gnl|my_center|LOCUS_07060 13537 15114 gene locus_tag LOCUS_07070 13537 15114 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_07070 15092 16096 gene locus_tag LOCUS_07080 15092 16096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 16138 16767 gene locus_tag LOCUS_07090 16138 16767 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583839.1 protein_id gnl|my_center|LOCUS_07090 17548 16742 gene locus_tag LOCUS_07100 gene lgt 17548 16742 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_07100 17914 17678 gene locus_tag LOCUS_07110 17914 17678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 >Feature sequence24 449 240 gene locus_tag LOCUS_07120 449 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 559 1398 gene locus_tag LOCUS_07130 gene xerC 559 1398 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545085.1 protein_id gnl|my_center|LOCUS_07130 1612 2565 gene locus_tag LOCUS_07140 1612 2565 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078565.1 protein_id gnl|my_center|LOCUS_07140 3162 2668 gene locus_tag LOCUS_07150 3162 2668 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965322.1 protein_id gnl|my_center|LOCUS_07150 3509 4189 gene locus_tag LOCUS_07160 3509 4189 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880335.1 protein_id gnl|my_center|LOCUS_07160 4277 5824 gene locus_tag LOCUS_07170 4277 5824 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_07170 5838 6155 gene locus_tag LOCUS_07180 5838 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 6148 6600 gene locus_tag LOCUS_07190 6148 6600 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868008.1 protein_id gnl|my_center|LOCUS_07190 6609 7748 gene locus_tag LOCUS_07200 6609 7748 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868007.1 protein_id gnl|my_center|LOCUS_07200 8799 7981 gene locus_tag LOCUS_07210 8799 7981 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869167.1 protein_id gnl|my_center|LOCUS_07210 9002 8823 gene locus_tag LOCUS_07220 9002 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 10576 8999 gene locus_tag LOCUS_07230 gene fdrA 10576 8999 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393612.1 protein_id gnl|my_center|LOCUS_07230 11439 10567 gene locus_tag LOCUS_07240 11439 10567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 12227 11502 gene locus_tag LOCUS_07250 12227 11502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 12426 13043 gene locus_tag LOCUS_07260 gene plsY 12426 13043 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547474.1 protein_id gnl|my_center|LOCUS_07260 13040 14071 gene locus_tag LOCUS_07270 gene rlmN 13040 14071 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082231.1 protein_id gnl|my_center|LOCUS_07270 14764 14105 gene locus_tag LOCUS_07280 14764 14105 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965420.1 protein_id gnl|my_center|LOCUS_07280 14946 15782 gene locus_tag LOCUS_07290 14946 15782 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391687.1 protein_id gnl|my_center|LOCUS_07290 15775 16587 gene locus_tag LOCUS_07300 gene panB 15775 16587 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082243.1 protein_id gnl|my_center|LOCUS_07300 16589 17455 gene locus_tag LOCUS_07310 gene panC 16589 17455 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080408.1 protein_id gnl|my_center|LOCUS_07310 17436 17810 gene locus_tag LOCUS_07320 17436 17810 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191357.1 protein_id gnl|my_center|LOCUS_07320 >Feature sequence25 79 792 gene locus_tag LOCUS_07330 gene pyrH 79 792 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546671.1 protein_id gnl|my_center|LOCUS_07330 794 1357 gene locus_tag LOCUS_07340 gene frr 794 1357 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_07340 1354 2055 gene locus_tag LOCUS_07350 1354 2055 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081614.1 protein_id gnl|my_center|LOCUS_07350 2052 3203 gene locus_tag LOCUS_07360 2052 3203 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_07360 3200 4225 gene locus_tag LOCUS_07370 gene rseP 3200 4225 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392556.1 protein_id gnl|my_center|LOCUS_07370 4222 5268 gene locus_tag LOCUS_07380 gene ispG 4222 5268 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546314.1 protein_id gnl|my_center|LOCUS_07380 5370 6347 gene locus_tag LOCUS_07390 5370 6347 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_07390 6334 8424 gene locus_tag LOCUS_07400 6334 8424 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964604.1 protein_id gnl|my_center|LOCUS_07400 8405 8857 gene locus_tag LOCUS_07410 8405 8857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 8857 10146 gene locus_tag LOCUS_07420 8857 10146 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_07420 10146 10547 gene locus_tag LOCUS_07430 10146 10547 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086294.1 protein_id gnl|my_center|LOCUS_07430 10544 11311 gene locus_tag LOCUS_07440 10544 11311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 11346 11729 gene locus_tag LOCUS_07450 11346 11729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 11792 14074 gene locus_tag LOCUS_07460 11792 14074 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022632.1 protein_id gnl|my_center|LOCUS_07460 14071 14715 gene locus_tag LOCUS_07470 14071 14715 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437518.1 protein_id gnl|my_center|LOCUS_07470 16025 14727 gene locus_tag LOCUS_07480 16025 14727 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250780.1 protein_id gnl|my_center|LOCUS_07480 17126 16092 gene locus_tag LOCUS_07490 17126 16092 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939164.1 protein_id gnl|my_center|LOCUS_07490 >Feature sequence26 1041 1646 gene locus_tag LOCUS_07500 1041 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 1658 2284 gene locus_tag LOCUS_07510 1658 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 2288 2881 gene locus_tag LOCUS_07520 2288 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 3638 4453 gene locus_tag LOCUS_07530 3638 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 4467 5438 gene locus_tag LOCUS_07540 4467 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 6185 7450 gene locus_tag LOCUS_07550 6185 7450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 7525 9042 gene locus_tag LOCUS_07560 7525 9042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 9059 9586 gene locus_tag LOCUS_07570 9059 9586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 9583 10731 gene locus_tag LOCUS_07580 9583 10731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 11089 10736 gene locus_tag LOCUS_07590 11089 10736 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081696.1 protein_id gnl|my_center|LOCUS_07590 12327 11086 gene locus_tag LOCUS_07600 12327 11086 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964633.1 protein_id gnl|my_center|LOCUS_07600 12568 12353 gene locus_tag LOCUS_07610 12568 12353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 14105 12552 gene locus_tag LOCUS_07620 14105 12552 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 protein_id gnl|my_center|LOCUS_07620 15826 14102 gene locus_tag LOCUS_07630 15826 14102 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044971525.1 protein_id gnl|my_center|LOCUS_07630 16877 15819 gene locus_tag LOCUS_07640 16877 15819 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878368.1 protein_id gnl|my_center|LOCUS_07640 >Feature sequence27 367 1104 gene locus_tag LOCUS_07650 367 1104 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583447.1 protein_id gnl|my_center|LOCUS_07650 2152 1091 gene locus_tag LOCUS_07660 2152 1091 CDS product UPF0104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880498.1 protein_id gnl|my_center|LOCUS_07660 3326 2130 gene locus_tag LOCUS_07670 3326 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 6666 3307 gene locus_tag LOCUS_07680 gene mfd 6666 3307 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579687.1 protein_id gnl|my_center|LOCUS_07680 7232 6663 gene locus_tag LOCUS_07690 gene pth 7232 6663 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583861.1 protein_id gnl|my_center|LOCUS_07690 7657 8121 gene locus_tag LOCUS_07700 7657 8121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 8173 9453 gene locus_tag LOCUS_07710 8173 9453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 9450 10937 gene locus_tag LOCUS_07720 9450 10937 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504021.1 protein_id gnl|my_center|LOCUS_07720 10919 12445 gene locus_tag LOCUS_07730 10919 12445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 12442 13659 gene locus_tag LOCUS_07740 12442 13659 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880318.1 protein_id gnl|my_center|LOCUS_07740 13659 14426 gene locus_tag LOCUS_07750 13659 14426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 14604 15875 gene locus_tag LOCUS_07760 14604 15875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 <16518 15902 gene locus_tag LOCUS_07770 <16518 15902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810213.1:glutamate--tRNA ligase >Feature sequence28 152 925 gene locus_tag LOCUS_07780 gene ymdB 152 925 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_07780 913 2010 gene locus_tag LOCUS_07790 913 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 1997 3256 gene locus_tag LOCUS_07800 gene miaB 1997 3256 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392626.1 protein_id gnl|my_center|LOCUS_07800 3253 4164 gene locus_tag LOCUS_07810 gene miaA 3253 4164 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_07810 4148 5383 gene locus_tag LOCUS_07820 4148 5383 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_07820 5969 5394 gene locus_tag LOCUS_07830 5969 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 5920 6063 gene locus_tag LOCUS_07840 5920 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 6437 7666 gene locus_tag LOCUS_07850 gene pepT 6437 7666 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963798.1 protein_id gnl|my_center|LOCUS_07850 8590 7739 gene locus_tag LOCUS_07860 8590 7739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 9701 8958 gene locus_tag LOCUS_07870 9701 8958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 10615 9698 gene locus_tag LOCUS_07880 10615 9698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 10791 11243 gene locus_tag LOCUS_07890 10791 11243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 11240 12292 gene locus_tag LOCUS_07900 gene nusA 11240 12292 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_07900 12279 14186 gene locus_tag LOCUS_07910 gene infB 12279 14186 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881330.1 protein_id gnl|my_center|LOCUS_07910 14186 14851 gene locus_tag LOCUS_07920 14186 14851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 15036 16304 gene locus_tag LOCUS_07930 gene gltA 15036 16304 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082125.1 protein_id gnl|my_center|LOCUS_07930 >Feature sequence29 90 440 gene locus_tag LOCUS_07940 90 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 427 1128 gene locus_tag LOCUS_07950 427 1128 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057232.1 protein_id gnl|my_center|LOCUS_07950 1572 1177 gene locus_tag LOCUS_07960 1572 1177 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_07960 1766 2185 gene locus_tag LOCUS_07970 gene speD 1766 2185 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460188.1 protein_id gnl|my_center|LOCUS_07970 2157 3092 gene locus_tag LOCUS_07980 gene speE 2157 3092 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583812.1 protein_id gnl|my_center|LOCUS_07980 3089 4390 gene locus_tag LOCUS_07990 3089 4390 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583295.1 protein_id gnl|my_center|LOCUS_07990 4471 6291 gene locus_tag LOCUS_08000 4471 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 6324 7046 gene locus_tag LOCUS_08010 6324 7046 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546598.1 protein_id gnl|my_center|LOCUS_08010 7043 8242 gene locus_tag LOCUS_08020 7043 8242 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583204.1 protein_id gnl|my_center|LOCUS_08020 8253 9683 gene locus_tag LOCUS_08030 8253 9683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 9726 10181 gene locus_tag LOCUS_08040 9726 10181 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_08040 10711 10481 gene locus_tag LOCUS_08050 10711 10481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 10800 11414 gene locus_tag LOCUS_08060 10800 11414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 11398 12495 gene locus_tag LOCUS_08070 gene norA 11398 12495 CDS product multidrug efflux MFS transporter NorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458987.1 protein_id gnl|my_center|LOCUS_08070 13238 12492 gene locus_tag LOCUS_08080 13238 12492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 14968 13391 gene locus_tag LOCUS_08090 gene murJ 14968 13391 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544918.1 protein_id gnl|my_center|LOCUS_08090 <16363 14958 gene locus_tag LOCUS_08100 <16363 14958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391758.1:DUF5693 family protein >Feature sequence30 1752 1306 gene locus_tag LOCUS_08110 1752 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 2084 1860 gene locus_tag LOCUS_08120 2084 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 2544 2119 gene locus_tag LOCUS_08130 2544 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 2871 2548 gene locus_tag LOCUS_08140 2871 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 3290 4354 gene locus_tag LOCUS_08150 3290 4354 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 protein_id gnl|my_center|LOCUS_08150 4583 5428 gene locus_tag LOCUS_08160 4583 5428 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583151.1 protein_id gnl|my_center|LOCUS_08160 6577 5486 gene locus_tag LOCUS_08170 6577 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 7258 6578 gene locus_tag LOCUS_08180 7258 6578 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948714.1 protein_id gnl|my_center|LOCUS_08180 7839 7291 gene locus_tag LOCUS_08190 7839 7291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 8039 8680 gene locus_tag LOCUS_08200 8039 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 8829 9392 gene locus_tag LOCUS_08210 gene efp 8829 9392 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_08210 9389 9724 gene locus_tag LOCUS_08220 9389 9724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 9747 10121 gene locus_tag LOCUS_08230 gene nusB 9747 10121 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204940.1 protein_id gnl|my_center|LOCUS_08230 10102 10377 gene locus_tag LOCUS_08240 10102 10377 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979253.1 protein_id gnl|my_center|LOCUS_08240 10387 11277 gene locus_tag LOCUS_08250 10387 11277 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_08250 11277 13109 gene locus_tag LOCUS_08260 gene dxs 11277 13109 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_08260 13114 13881 gene locus_tag LOCUS_08270 13114 13881 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081998.1 protein_id gnl|my_center|LOCUS_08270 13878 14687 gene locus_tag LOCUS_08280 13878 14687 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409651.1 protein_id gnl|my_center|LOCUS_08280 >Feature sequence31 1720 779 gene locus_tag LOCUS_08290 1720 779 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_08290 2784 1717 gene locus_tag LOCUS_08300 2784 1717 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_08300 4321 2804 gene locus_tag LOCUS_08310 4321 2804 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964022.1 protein_id gnl|my_center|LOCUS_08310 5505 4396 gene locus_tag LOCUS_08320 5505 4396 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276126.1 protein_id gnl|my_center|LOCUS_08320 6736 5786 gene locus_tag LOCUS_08330 6736 5786 CDS product carbamate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098404.1 protein_id gnl|my_center|LOCUS_08330 7750 6740 gene locus_tag LOCUS_08340 gene argF 7750 6740 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393492.1 protein_id gnl|my_center|LOCUS_08340 8749 7760 gene locus_tag LOCUS_08350 gene argF 8749 7760 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393492.1 protein_id gnl|my_center|LOCUS_08350 9719 8913 gene locus_tag LOCUS_08360 9719 8913 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392942.1 protein_id gnl|my_center|LOCUS_08360 11100 9724 gene locus_tag LOCUS_08370 11100 9724 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887796.1 protein_id gnl|my_center|LOCUS_08370 12839 11106 gene locus_tag LOCUS_08380 gene ade 12839 11106 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964205.1 protein_id gnl|my_center|LOCUS_08380 14172 12832 gene locus_tag LOCUS_08390 gene ssnA 14172 12832 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047946.1 protein_id gnl|my_center|LOCUS_08390 15374 14391 gene locus_tag LOCUS_08400 15374 14391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 >Feature sequence32 <1 1806 gene locus_tag LOCUS_08410 <1 1806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393574.1:stalk domain-containing protein 1803 2975 gene locus_tag LOCUS_08420 1803 2975 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644929.1 protein_id gnl|my_center|LOCUS_08420 5804 2982 gene locus_tag LOCUS_08430 gene uvrA 5804 2982 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228683.1 protein_id gnl|my_center|LOCUS_08430 6736 5801 gene locus_tag LOCUS_08440 6736 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 6872 7321 gene locus_tag LOCUS_08450 6872 7321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 7314 8333 gene locus_tag LOCUS_08460 7314 8333 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582485.1 protein_id gnl|my_center|LOCUS_08460 8330 9112 gene locus_tag LOCUS_08470 8330 9112 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582486.1 protein_id gnl|my_center|LOCUS_08470 11098 9491 gene locus_tag LOCUS_08480 11098 9491 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582481.1 protein_id gnl|my_center|LOCUS_08480 11968 11330 gene locus_tag LOCUS_08490 11968 11330 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965038.1 protein_id gnl|my_center|LOCUS_08490 12362 12610 gene locus_tag LOCUS_08500 12362 12610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 12620 13444 gene locus_tag LOCUS_08510 gene fsa 12620 13444 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403055.1 protein_id gnl|my_center|LOCUS_08510 >Feature sequence33 173 793 gene locus_tag LOCUS_08520 gene pcp 173 793 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861300.1 protein_id gnl|my_center|LOCUS_08520 929 1447 gene locus_tag LOCUS_08530 929 1447 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761066.1 protein_id gnl|my_center|LOCUS_08530 1493 2206 gene locus_tag LOCUS_08540 1493 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 2821 3171 gene locus_tag LOCUS_08550 2821 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 3214 3516 gene locus_tag LOCUS_08560 3214 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 3545 4078 gene locus_tag LOCUS_08570 3545 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 4857 5834 gene locus_tag LOCUS_08580 4857 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 5850 7199 gene locus_tag LOCUS_08590 5850 7199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 7865 9130 gene locus_tag LOCUS_08600 7865 9130 CDS product amidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920590.1 protein_id gnl|my_center|LOCUS_08600 9131 10978 gene locus_tag LOCUS_08610 9131 10978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 12352 11501 gene locus_tag LOCUS_08620 12352 11501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 12881 12297 gene locus_tag LOCUS_08630 12881 12297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 >Feature sequence34 2794 1469 gene locus_tag LOCUS_08640 gene glmM 2794 1469 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_08640 4477 2915 gene locus_tag LOCUS_08650 4477 2915 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_08650 6459 4480 gene locus_tag LOCUS_08660 6459 4480 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880423.1 protein_id gnl|my_center|LOCUS_08660 7386 6751 gene locus_tag LOCUS_08670 7386 6751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 7943 7383 gene locus_tag LOCUS_08680 gene rpoE 7943 7383 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 protein_id gnl|my_center|LOCUS_08680 8021 8650 gene locus_tag LOCUS_08690 gene plsY 8021 8650 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016461.1 protein_id gnl|my_center|LOCUS_08690 8700 8789 gene locus_tag LOCUS_t00350 8700 8789 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9018 10118 gene locus_tag LOCUS_08700 gene arsB 9018 10118 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 protein_id gnl|my_center|LOCUS_08700 10237 10506 gene locus_tag LOCUS_08710 10237 10506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 10448 10804 gene locus_tag LOCUS_08720 10448 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080190.1 protein_id gnl|my_center|LOCUS_08720 11686 11123 gene locus_tag LOCUS_08730 11686 11123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 >Feature sequence35 477 1598 gene locus_tag LOCUS_08740 477 1598 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880006.1 protein_id gnl|my_center|LOCUS_08740 2119 1643 gene locus_tag LOCUS_08750 2119 1643 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060740.1 protein_id gnl|my_center|LOCUS_08750 2760 2200 gene locus_tag LOCUS_08760 2760 2200 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583840.1 protein_id gnl|my_center|LOCUS_08760 4527 2776 gene locus_tag LOCUS_08770 4527 2776 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545652.1 protein_id gnl|my_center|LOCUS_08770 4936 4520 gene locus_tag LOCUS_08780 4936 4520 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022904.1 protein_id gnl|my_center|LOCUS_08780 6534 4933 gene locus_tag LOCUS_08790 6534 4933 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057809.1 protein_id gnl|my_center|LOCUS_08790 7146 6574 gene locus_tag LOCUS_08800 7146 6574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 8421 7159 gene locus_tag LOCUS_08810 gene glgC 8421 7159 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154339.1 protein_id gnl|my_center|LOCUS_08810 9444 8482 gene locus_tag LOCUS_08820 gene ruvB 9444 8482 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939530.1 protein_id gnl|my_center|LOCUS_08820 10003 9437 gene locus_tag LOCUS_08830 gene ruvA 10003 9437 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223336.1 protein_id gnl|my_center|LOCUS_08830 10491 10000 gene locus_tag LOCUS_08840 gene ruvC 10491 10000 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_08840 11256 10495 gene locus_tag LOCUS_08850 11256 10495 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081500.1 protein_id gnl|my_center|LOCUS_08850 11538 11266 gene locus_tag LOCUS_08860 11538 11266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 >Feature sequence36 323 880 gene locus_tag LOCUS_08870 323 880 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763312.1 protein_id gnl|my_center|LOCUS_08870 867 1388 gene locus_tag LOCUS_08880 867 1388 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 protein_id gnl|my_center|LOCUS_08880 1512 1790 gene locus_tag LOCUS_08890 1512 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 3621 1894 gene locus_tag LOCUS_08900 3621 1894 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880806.1 protein_id gnl|my_center|LOCUS_08900 4625 3909 gene locus_tag LOCUS_08910 4625 3909 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897796.1 protein_id gnl|my_center|LOCUS_08910 6340 4571 gene locus_tag LOCUS_08920 6340 4571 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393463.1 protein_id gnl|my_center|LOCUS_08920 6394 7053 gene locus_tag LOCUS_08930 6394 7053 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_08930 7240 7959 gene locus_tag LOCUS_08940 7240 7959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 8895 8134 gene locus_tag LOCUS_08950 8895 8134 CDS product FRG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017872006.1 protein_id gnl|my_center|LOCUS_08950 9678 9043 gene locus_tag LOCUS_08960 9678 9043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 10204 9689 gene locus_tag LOCUS_08970 10204 9689 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582541.1 protein_id gnl|my_center|LOCUS_08970 <10963 10353 gene locus_tag LOCUS_08980 <10963 10353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987127.1:Lsa family ABC-F type ribosomal protection protein >Feature sequence37 1044 487 gene locus_tag LOCUS_08990 1044 487 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948910.1 protein_id gnl|my_center|LOCUS_08990 1545 1988 gene locus_tag LOCUS_09000 1545 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 2093 2893 gene locus_tag LOCUS_09010 2093 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 3081 3269 gene locus_tag LOCUS_09020 3081 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 3806 3447 gene locus_tag LOCUS_09030 3806 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 4096 6168 gene locus_tag LOCUS_09040 4096 6168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 6896 7123 gene locus_tag LOCUS_09050 6896 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 7120 7467 gene locus_tag LOCUS_09060 7120 7467 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_09060 8394 8555 gene locus_tag LOCUS_09070 8394 8555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 8545 8799 gene locus_tag LOCUS_09080 8545 8799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 9121 9351 gene locus_tag LOCUS_09090 9121 9351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 9541 9741 gene locus_tag LOCUS_09100 9541 9741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 9756 9989 gene locus_tag LOCUS_09110 9756 9989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 10059 10319 gene locus_tag LOCUS_09120 10059 10319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 10316 10480 gene locus_tag LOCUS_09130 10316 10480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 >Feature sequence38 395 934 gene locus_tag LOCUS_09140 gene yfcE 395 934 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314009.1 protein_id gnl|my_center|LOCUS_09140 931 1692 gene locus_tag LOCUS_09150 931 1692 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582622.1 protein_id gnl|my_center|LOCUS_09150 1679 2599 gene locus_tag LOCUS_09160 1679 2599 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429290.1 protein_id gnl|my_center|LOCUS_09160 3191 2610 gene locus_tag LOCUS_09170 3191 2610 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073754.1 protein_id gnl|my_center|LOCUS_09170 3321 4094 gene locus_tag LOCUS_09180 3321 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 5411 4134 gene locus_tag LOCUS_09190 5411 4134 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063044.1 protein_id gnl|my_center|LOCUS_09190 6807 5470 gene locus_tag LOCUS_09200 6807 5470 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_09200 8423 7119 gene locus_tag LOCUS_09210 gene gabT 8423 7119 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093009.1 protein_id gnl|my_center|LOCUS_09210 8607 9518 gene locus_tag LOCUS_09220 gene ptb 8607 9518 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357252.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence39 2057 300 gene locus_tag LOCUS_09230 2057 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 3233 2190 gene locus_tag LOCUS_09240 gene ychF 3233 2190 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293105.1 protein_id gnl|my_center|LOCUS_09240 3388 3314 gene locus_tag LOCUS_t00360 3388 3314 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3465 3392 gene locus_tag LOCUS_t00370 3465 3392 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3740 3501 gene locus_tag LOCUS_09250 3740 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 4182 3709 gene locus_tag LOCUS_09260 4182 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 5186 4404 gene locus_tag LOCUS_09270 5186 4404 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048247.1 protein_id gnl|my_center|LOCUS_09270 6567 5233 gene locus_tag LOCUS_09280 gene pepV 6567 5233 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048281.1 protein_id gnl|my_center|LOCUS_09280 6760 8346 gene locus_tag LOCUS_09290 6760 8346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 10078 8426 gene locus_tag LOCUS_09300 10078 8426 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259102.1 protein_id gnl|my_center|LOCUS_09300 >Feature sequence40 <1 900 gene locus_tag LOCUS_09310 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243040.1:ABC transporter substrate-binding protein 887 1900 gene locus_tag LOCUS_09320 887 1900 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015590540.1 protein_id gnl|my_center|LOCUS_09320 1887 2627 gene locus_tag LOCUS_09330 gene lptB 1887 2627 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467801.1 protein_id gnl|my_center|LOCUS_09330 2676 3926 gene locus_tag LOCUS_09340 2676 3926 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_09340 3936 4565 gene locus_tag LOCUS_09350 gene upp 3936 4565 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583176.1 protein_id gnl|my_center|LOCUS_09350 4565 5542 gene locus_tag LOCUS_09360 4565 5542 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356585.1 protein_id gnl|my_center|LOCUS_09360 5539 6666 gene locus_tag LOCUS_09370 gene wecB 5539 6666 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583765.1 protein_id gnl|my_center|LOCUS_09370 6653 7912 gene locus_tag LOCUS_09380 gene murA 6653 7912 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460694.1 protein_id gnl|my_center|LOCUS_09380 7887 8699 gene locus_tag LOCUS_09390 gene dapF 7887 8699 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878250.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence41 2057 1044 gene locus_tag LOCUS_09400 2057 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 2098 2517 gene locus_tag LOCUS_09410 2098 2517 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943826.1 protein_id gnl|my_center|LOCUS_09410 4064 2718 gene locus_tag LOCUS_09420 4064 2718 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943345.1 protein_id gnl|my_center|LOCUS_09420 4700 4065 gene locus_tag LOCUS_09430 4700 4065 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082798.1 protein_id gnl|my_center|LOCUS_09430 6276 4906 gene locus_tag LOCUS_09440 gene lpdA 6276 4906 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582893.1 protein_id gnl|my_center|LOCUS_09440 6739 6386 gene locus_tag LOCUS_09450 6739 6386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 7064 6702 gene locus_tag LOCUS_09460 7064 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 7202 7879 gene locus_tag LOCUS_09470 7202 7879 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939274.1 protein_id gnl|my_center|LOCUS_09470 9535 7856 gene locus_tag LOCUS_09480 9535 7856 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence42 1293 622 gene locus_tag LOCUS_09490 1293 622 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870952.1 protein_id gnl|my_center|LOCUS_09490 3142 1253 gene locus_tag LOCUS_09500 gene ftsH 3142 1253 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583233.1 protein_id gnl|my_center|LOCUS_09500 3566 3165 gene locus_tag LOCUS_09510 3566 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 5081 3714 gene locus_tag LOCUS_09520 gene tilS 5081 3714 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434952.1 protein_id gnl|my_center|LOCUS_09520 5345 6100 gene locus_tag LOCUS_09530 gene lipM 5345 6100 CDS product octanoyltransferase LipM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398586.1 protein_id gnl|my_center|LOCUS_09530 6134 7801 gene locus_tag LOCUS_09540 6134 7801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 7801 8622 gene locus_tag LOCUS_09550 7801 8622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 >Feature sequence43 369 1151 gene locus_tag LOCUS_09560 369 1151 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016207.1 protein_id gnl|my_center|LOCUS_09560 1313 1798 gene locus_tag LOCUS_09570 1313 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 3136 2384 gene locus_tag LOCUS_09580 3136 2384 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249930.1 protein_id gnl|my_center|LOCUS_09580 3507 4163 gene locus_tag LOCUS_09590 3507 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 4164 5210 gene locus_tag LOCUS_09600 4164 5210 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682144.1 protein_id gnl|my_center|LOCUS_09600 6724 5420 gene locus_tag LOCUS_09610 6724 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 7358 7194 gene locus_tag LOCUS_09620 7358 7194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 7654 8175 gene locus_tag LOCUS_09630 7654 8175 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546732.1 protein_id gnl|my_center|LOCUS_09630 8255 8434 gene locus_tag LOCUS_09640 8255 8434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence44 523 290 gene locus_tag LOCUS_09650 523 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 3166 1157 gene locus_tag LOCUS_09660 3166 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 4806 3238 gene locus_tag LOCUS_09670 gene xylB 4806 3238 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_09670 6043 4808 gene locus_tag LOCUS_09680 6043 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 6723 6091 gene locus_tag LOCUS_09690 6723 6091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 7408 6737 gene locus_tag LOCUS_09700 7408 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 8199 7423 gene locus_tag LOCUS_09710 gene fabG 8199 7423 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence45 370 1548 gene locus_tag LOCUS_09720 370 1548 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871044.1 protein_id gnl|my_center|LOCUS_09720 2294 1566 gene locus_tag LOCUS_09730 2294 1566 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_09730 4513 2294 gene locus_tag LOCUS_09740 4513 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 4634 5359 gene locus_tag LOCUS_09750 4634 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 5455 6918 gene locus_tag LOCUS_09760 5455 6918 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_09760 6925 7929 gene locus_tag LOCUS_09770 6925 7929 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868892.1 protein_id gnl|my_center|LOCUS_09770 <8790 7979 gene locus_tag LOCUS_09780 <8790 7979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245629.1:bacillopeptidase F >Feature sequence46 268 726 gene locus_tag LOCUS_09790 gene folK 268 726 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582990.1 protein_id gnl|my_center|LOCUS_09790 1520 723 gene locus_tag LOCUS_09800 1520 723 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026257.1 protein_id gnl|my_center|LOCUS_09800 2035 1517 gene locus_tag LOCUS_09810 2035 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 2846 2202 gene locus_tag LOCUS_09820 2846 2202 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064926.1 protein_id gnl|my_center|LOCUS_09820 3261 2839 gene locus_tag LOCUS_09830 3261 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 4236 3274 gene locus_tag LOCUS_09840 4236 3274 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582467.1 protein_id gnl|my_center|LOCUS_09840 5543 4416 gene locus_tag LOCUS_09850 5543 4416 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_09850 <8780 5972 gene locus_tag LOCUS_09860 <8780 5972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990858.1:SBBP repeat-containing protein >Feature sequence47 2266 1229 gene locus_tag LOCUS_09870 2266 1229 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869258.1 protein_id gnl|my_center|LOCUS_09870 4071 2278 gene locus_tag LOCUS_09880 gene aor 4071 2278 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250017.1 protein_id gnl|my_center|LOCUS_09880 4970 4422 gene locus_tag LOCUS_09890 4970 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 5607 5984 gene locus_tag LOCUS_09900 5607 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 6034 6489 gene locus_tag LOCUS_09910 6034 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 7185 6496 gene locus_tag LOCUS_09920 7185 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 7638 7234 gene locus_tag LOCUS_09930 7638 7234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 >Feature sequence48 347 1027 gene locus_tag LOCUS_09940 347 1027 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546731.1 protein_id gnl|my_center|LOCUS_09940 1034 2785 gene locus_tag LOCUS_09950 1034 2785 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_09950 3001 3870 gene locus_tag LOCUS_09960 3001 3870 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868851.1 protein_id gnl|my_center|LOCUS_09960 3918 4112 gene locus_tag LOCUS_09970 3918 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 4109 4966 gene locus_tag LOCUS_09980 gene pstC 4109 4966 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_09980 4963 5811 gene locus_tag LOCUS_09990 gene pstA 4963 5811 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990843.1 protein_id gnl|my_center|LOCUS_09990 5805 6560 gene locus_tag LOCUS_10000 gene pstB 5805 6560 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096663.1 protein_id gnl|my_center|LOCUS_10000 6578 7243 gene locus_tag LOCUS_10010 gene phoU 6578 7243 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence49 535 1044 gene locus_tag LOCUS_10020 535 1044 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583273.1 protein_id gnl|my_center|LOCUS_10020 1155 1709 gene locus_tag LOCUS_10030 1155 1709 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146547.1 protein_id gnl|my_center|LOCUS_10030 1706 2194 gene locus_tag LOCUS_10040 1706 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 2204 2707 gene locus_tag LOCUS_10050 2204 2707 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964366.1 protein_id gnl|my_center|LOCUS_10050 3146 4249 gene locus_tag LOCUS_10060 3146 4249 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060968.1 protein_id gnl|my_center|LOCUS_10060 4253 5563 gene locus_tag LOCUS_10070 4253 5563 CDS product bifunctional L-myo-inositol-1-phosphate cytidylyltransferase/CDP-L-myo-inositol myo-inositolphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880881.1 protein_id gnl|my_center|LOCUS_10070 >Feature sequence50 1383 196 gene locus_tag LOCUS_10080 gene dinB 1383 196 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940720.1 protein_id gnl|my_center|LOCUS_10080 1490 1921 gene locus_tag LOCUS_10090 1490 1921 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 protein_id gnl|my_center|LOCUS_10090 2117 1926 gene locus_tag LOCUS_10100 2117 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 4206 2143 gene locus_tag LOCUS_10110 4206 2143 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_10110 5221 4379 gene locus_tag LOCUS_10120 5221 4379 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878253.1 protein_id gnl|my_center|LOCUS_10120 6870 5218 gene locus_tag LOCUS_10130 6870 5218 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545733.1 protein_id gnl|my_center|LOCUS_10130 >Feature sequence51 2484 3242 gene locus_tag LOCUS_10140 gene trmD 2484 3242 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_10140 3239 3793 gene locus_tag LOCUS_10150 3239 3793 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813203.1 protein_id gnl|my_center|LOCUS_10150 4008 4592 gene locus_tag LOCUS_10160 4008 4592 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060893.1 protein_id gnl|my_center|LOCUS_10160 4629 5330 gene locus_tag LOCUS_10170 4629 5330 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062281989.1 protein_id gnl|my_center|LOCUS_10170 5336 6526 gene locus_tag LOCUS_10180 5336 6526 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584117.1 protein_id gnl|my_center|LOCUS_10180 6529 6903 gene locus_tag LOCUS_10190 6529 6903 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878336.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence52 2434 1808 gene locus_tag LOCUS_10200 2434 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 3270 2440 gene locus_tag LOCUS_10210 gene proC 3270 2440 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258104.1 protein_id gnl|my_center|LOCUS_10210 4010 3267 gene locus_tag LOCUS_10220 4010 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 4266 5159 gene locus_tag LOCUS_10230 gene ftcD 4266 5159 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080786.1 protein_id gnl|my_center|LOCUS_10230 5171 6439 gene locus_tag LOCUS_10240 gene hutI 5171 6439 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244327.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence53 162 641 gene locus_tag LOCUS_10250 162 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 719 2941 gene locus_tag LOCUS_10260 719 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 3030 4031 gene locus_tag LOCUS_10270 3030 4031 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173671.1 protein_id gnl|my_center|LOCUS_10270 4041 4949 gene locus_tag LOCUS_10280 4041 4949 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939732.1 protein_id gnl|my_center|LOCUS_10280 4961 5962 gene locus_tag LOCUS_10290 4961 5962 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence54 35 124 gene locus_tag LOCUS_t00380 35 124 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 696 280 gene locus_tag LOCUS_10300 696 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 967 710 gene locus_tag LOCUS_10310 967 710 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546040.1 protein_id gnl|my_center|LOCUS_10310 1245 967 gene locus_tag LOCUS_10320 gene rpsP 1245 967 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583886.1 protein_id gnl|my_center|LOCUS_10320 2405 1284 gene locus_tag LOCUS_10330 gene ffh 2405 1284 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081977.1 protein_id gnl|my_center|LOCUS_10330 2998 2612 gene locus_tag LOCUS_10340 2998 2612 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393779.1 protein_id gnl|my_center|LOCUS_10340 3886 3044 gene locus_tag LOCUS_10350 3886 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 4583 3852 gene locus_tag LOCUS_10360 gene rncS 4583 3852 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_10360 5568 4567 gene locus_tag LOCUS_10370 gene plsX 5568 4567 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_10370 5773 5570 gene locus_tag LOCUS_10380 gene rpmF 5773 5570 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888992.1 protein_id gnl|my_center|LOCUS_10380 <6836 5830 gene locus_tag LOCUS_10390 <6836 5830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011475758.1:leucine--tRNA ligase >Feature sequence55 2704 1820 gene locus_tag LOCUS_10400 gene xdhB 2704 1820 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948906.1 protein_id gnl|my_center|LOCUS_10400 3518 2676 gene locus_tag LOCUS_10410 3518 2676 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902575.1 protein_id gnl|my_center|LOCUS_10410 4494 3502 gene locus_tag LOCUS_10420 4494 3502 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948644.1 protein_id gnl|my_center|LOCUS_10420 5087 4482 gene locus_tag LOCUS_10430 5087 4482 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940878.1 protein_id gnl|my_center|LOCUS_10430 5553 5077 gene locus_tag LOCUS_10440 5553 5077 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_10440 <6739 5555 gene locus_tag LOCUS_10450 <6739 5555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338051.1:NAD-dependent dihydropyrimidine dehydrogenase subunit PreA >Feature sequence56 807 328 gene locus_tag LOCUS_10460 807 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053780.1 protein_id gnl|my_center|LOCUS_10460 956 1753 gene locus_tag LOCUS_10470 956 1753 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_10470 1971 2150 gene locus_tag LOCUS_10480 1971 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 2147 3574 gene locus_tag LOCUS_10490 2147 3574 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015590803.1 protein_id gnl|my_center|LOCUS_10490 3567 4073 gene locus_tag LOCUS_10500 3567 4073 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082049.1 protein_id gnl|my_center|LOCUS_10500 4155 4448 gene locus_tag LOCUS_10510 4155 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 4445 6376 gene locus_tag LOCUS_10520 gene feoB 4445 6376 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060770.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence57 1690 1615 gene locus_tag LOCUS_t00390 1690 1615 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1806 2654 gene locus_tag LOCUS_10530 1806 2654 CDS product isoaspartyl peptidase/L-asparaginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939517.1 protein_id gnl|my_center|LOCUS_10530 2682 3680 gene locus_tag LOCUS_10540 2682 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 3746 4921 gene locus_tag LOCUS_10550 3746 4921 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_10550 6035 4923 gene locus_tag LOCUS_10560 6035 4923 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence58 546 295 gene locus_tag LOCUS_10570 546 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 839 621 gene locus_tag LOCUS_10580 839 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1377 1610 gene locus_tag LOCUS_10590 1377 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1595 2314 gene locus_tag LOCUS_10600 1595 2314 CDS product DtxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582916.1 protein_id gnl|my_center|LOCUS_10600 2314 2538 gene locus_tag LOCUS_10610 2314 2538 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582917.1 protein_id gnl|my_center|LOCUS_10610 2566 4599 gene locus_tag LOCUS_10620 gene feoB 2566 4599 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582918.1 protein_id gnl|my_center|LOCUS_10620 >Feature sequence59 <1 1422 gene locus_tag LOCUS_10630 <1 1422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880825.1:alanine--tRNA ligase 1436 1876 gene locus_tag LOCUS_10640 gene ruvX 1436 1876 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440635.1 protein_id gnl|my_center|LOCUS_10640 1873 2814 gene locus_tag LOCUS_10650 gene mltG 1873 2814 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438164.1 protein_id gnl|my_center|LOCUS_10650 2817 3050 gene locus_tag LOCUS_10660 2817 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 3078 5558 gene locus_tag LOCUS_10670 3078 5558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence60 1408 1572 gene locus_tag LOCUS_10680 gene scfA 1408 1572 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815210.1 protein_id gnl|my_center|LOCUS_10680 1574 2977 gene locus_tag LOCUS_10690 gene scfB 1574 2977 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048084.1 protein_id gnl|my_center|LOCUS_10690 3462 2998 gene locus_tag LOCUS_10700 3462 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 3835 3440 gene locus_tag LOCUS_10710 3835 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 4078 3836 gene locus_tag LOCUS_10720 gene moaD 4078 3836 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251068.1 protein_id gnl|my_center|LOCUS_10720 <5364 4226 gene locus_tag LOCUS_10730 <5364 4226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582976.1:M6 family metalloprotease domain-containing protein >Feature sequence61 <1 849 gene locus_tag LOCUS_10740 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969296.1:IS256-like element ISRm5 family transposase 965 828 gene locus_tag LOCUS_10750 965 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 3979 962 gene locus_tag LOCUS_10760 3979 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 4371 4249 gene locus_tag LOCUS_10770 4371 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 >Feature sequence62 476 1177 gene locus_tag LOCUS_10780 476 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 protein_id gnl|my_center|LOCUS_10780 1193 1420 gene locus_tag LOCUS_10790 1193 1420 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082295.1 protein_id gnl|my_center|LOCUS_10790 1432 2499 gene locus_tag LOCUS_10800 1432 2499 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869339.1 protein_id gnl|my_center|LOCUS_10800 2499 3245 gene locus_tag LOCUS_10810 2499 3245 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420710.1 protein_id gnl|my_center|LOCUS_10810 3247 3801 gene locus_tag LOCUS_10820 3247 3801 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357379.1 protein_id gnl|my_center|LOCUS_10820 3801 4151 gene locus_tag LOCUS_10830 3801 4151 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251013.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence63 952 710 gene locus_tag LOCUS_10840 gene acpP 952 710 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771263.1 protein_id gnl|my_center|LOCUS_10840 1879 1124 gene locus_tag LOCUS_10850 gene fabG 1879 1124 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_10850 2771 1872 gene locus_tag LOCUS_10860 gene fabD 2771 1872 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546099.1 protein_id gnl|my_center|LOCUS_10860 3751 2768 gene locus_tag LOCUS_10870 3751 2768 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438099.1 protein_id gnl|my_center|LOCUS_10870 4250 3753 gene locus_tag LOCUS_10880 gene fabZ 4250 3753 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939641.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence64 <1 984 gene locus_tag LOCUS_10890 <1 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393453.1:pyridoxal phosphate-dependent aminotransferase 2050 1043 gene locus_tag LOCUS_10900 2050 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 3334 2072 gene locus_tag LOCUS_10910 3334 2072 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867389.1 protein_id gnl|my_center|LOCUS_10910 3556 4008 gene locus_tag LOCUS_10920 3556 4008 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815091.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence65 168 557 gene locus_tag LOCUS_10930 168 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 740 2389 gene locus_tag LOCUS_10940 740 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 3422 2541 gene locus_tag LOCUS_10950 3422 2541 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582793.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence66 2599 869 gene locus_tag LOCUS_10960 2599 869 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080006.1 protein_id gnl|my_center|LOCUS_10960 3267 2596 gene locus_tag LOCUS_10970 3267 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence67 <1 1174 gene locus_tag LOCUS_10980 <1 1174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583152.1:AAA family ATPase 1171 1779 gene locus_tag LOCUS_10990 gene tmk 1171 1779 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173647.1 protein_id gnl|my_center|LOCUS_10990 1772 2725 gene locus_tag LOCUS_11000 1772 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 >Feature sequence68 1282 335 gene locus_tag LOCUS_11010 gene wtpA 1282 335 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867274.1 protein_id gnl|my_center|LOCUS_11010 1490 2710 gene locus_tag LOCUS_11020 gene ahcY 1490 2710 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870905.1 protein_id gnl|my_center|LOCUS_11020 2725 3465 gene locus_tag LOCUS_11030 2725 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141459.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence69 1391 612 gene locus_tag LOCUS_11040 1391 612 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174408902.1 protein_id gnl|my_center|LOCUS_11040 2686 1532 gene locus_tag LOCUS_11050 2686 1532 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_11050 3030 2698 gene locus_tag LOCUS_11060 3030 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 3440 3234 gene locus_tag LOCUS_11070 3440 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 >Feature sequence70 1334 1107 gene locus_tag LOCUS_11080 1334 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1644 1357 gene locus_tag LOCUS_11090 1644 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 3121 2051 gene locus_tag LOCUS_11100 3121 2051 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020340.1 protein_id gnl|my_center|LOCUS_11100 <3692 3118 gene locus_tag LOCUS_11110 <3692 3118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020339.1:ABC transporter permease >Feature sequence71 270 1781 gene locus_tag LOCUS_11120 gene cysS 270 1781 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249399.1 protein_id gnl|my_center|LOCUS_11120 1771 2535 gene locus_tag LOCUS_11130 gene rlmB 1771 2535 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966431.1 protein_id gnl|my_center|LOCUS_11130 2573 3046 gene locus_tag LOCUS_11140 gene sigH 2573 3046 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966429.1 protein_id gnl|my_center|LOCUS_11140 3093 3167 gene locus_tag LOCUS_t00400 3093 3167 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3172 3257 gene locus_tag LOCUS_t00410 3172 3257 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3260 3334 gene locus_tag LOCUS_t00420 3260 3334 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3344 3420 gene locus_tag LOCUS_t00430 3344 3420 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3442 3517 gene locus_tag LOCUS_t00440 3442 3517 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence72 1322 435 gene locus_tag LOCUS_11150 gene pdxS 1322 435 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583836.1 protein_id gnl|my_center|LOCUS_11150 2607 1375 gene locus_tag LOCUS_11160 2607 1375 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_11160 2878 2648 gene locus_tag LOCUS_11170 2878 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 >Feature sequence73 2135 1224 gene locus_tag LOCUS_11180 gene ptb 2135 1224 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357252.1 protein_id gnl|my_center|LOCUS_11180 3051 2149 gene locus_tag LOCUS_11190 gene ptb 3051 2149 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357252.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence74 1950 1066 gene locus_tag LOCUS_11200 gene cysK 1950 1066 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_11200 2488 1943 gene locus_tag LOCUS_11210 gene cysE 2488 1943 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081107.1 protein_id gnl|my_center|LOCUS_11210 2848 2624 gene locus_tag LOCUS_11220 2848 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 >Feature sequence75 <1 2665 gene locus_tag LOCUS_11230 <1 2665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545054.1:HD domain-containing protein >Feature sequence76 <1 586 gene locus_tag LOCUS_11240 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073149.1:methyltransferase domain-containing protein 685 1704 gene locus_tag LOCUS_11250 685 1704 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216554.1 protein_id gnl|my_center|LOCUS_11250 2231 1938 gene locus_tag LOCUS_11260 2231 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 2559 3065 gene locus_tag LOCUS_11270 2559 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 >Feature sequence77 <3241 157 gene locus_tag LOCUS_11280 <3241 157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938486.1:EAL domain-containing protein >Feature sequence78 552 2090 gene locus_tag LOCUS_11290 gene istA 552 2090 CDS product IS21-like element ISBf2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203618.1 protein_id gnl|my_center|LOCUS_11290 2087 2845 gene locus_tag LOCUS_11300 gene istB 2087 2845 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016268417.1 protein_id gnl|my_center|LOCUS_11300 >Feature sequence79 2433 1360 gene locus_tag LOCUS_11310 2433 1360 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617806.1 protein_id gnl|my_center|LOCUS_11310 2628 2467 gene locus_tag LOCUS_11320 2628 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 >Feature sequence80 309 782 gene locus_tag LOCUS_11330 309 782 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869796.1 protein_id gnl|my_center|LOCUS_11330 1241 1759 gene locus_tag LOCUS_11340 1241 1759 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256496.1 protein_id gnl|my_center|LOCUS_11340 2554 2925 gene locus_tag LOCUS_11350 2554 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 >Feature sequence81 550 2130 gene locus_tag LOCUS_11360 550 2130 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080960.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence82 <1 655 gene locus_tag LOCUS_11370 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087772.1:SprT family zinc-dependent metalloprotease 1750 2232 gene locus_tag LOCUS_11380 1750 2232 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880818.1 protein_id gnl|my_center|LOCUS_11380 <2923 2308 gene locus_tag LOCUS_11390 <2923 2308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071541467.1:copper amine oxidase N-terminal domain-containing protein >Feature sequence83 386 730 gene locus_tag LOCUS_11400 386 730 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583880.1 protein_id gnl|my_center|LOCUS_11400 874 800 gene locus_tag LOCUS_t00450 874 800 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1065 2738 gene locus_tag LOCUS_11410 1065 2738 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_11410 2739 2828 gene locus_tag LOCUS_t00460 2739 2828 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence84 318 917 gene locus_tag LOCUS_11420 318 917 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_11420 1056 2303 gene locus_tag LOCUS_11430 gene gdhA 1056 2303 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_11430 >Feature sequence85 150 1133 gene locus_tag LOCUS_11440 150 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1351 2694 gene locus_tag LOCUS_11450 gene ssnA 1351 2694 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047946.1 protein_id gnl|my_center|LOCUS_11450 >Feature sequence86 >Feature sequence87 615 1460 gene locus_tag LOCUS_11460 615 1460 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811761.1 protein_id gnl|my_center|LOCUS_11460 <2697 1507 gene locus_tag LOCUS_11470 <2697 1507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765644.1:glutamine synthetase family protein >Feature sequence88 44 1636 gene locus_tag LOCUS_11480 44 1636 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_11480 1790 2305 gene locus_tag LOCUS_11490 1790 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 2302 2553 gene locus_tag LOCUS_11500 2302 2553 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393237.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence89 50 1609 gene locus_tag LOCUS_11510 50 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1606 2229 gene locus_tag LOCUS_11520 1606 2229 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404017.1 protein_id gnl|my_center|LOCUS_11520 >Feature sequence90 903 643 gene locus_tag LOCUS_11530 903 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 2445 1072 gene locus_tag LOCUS_11540 2445 1072 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence91 193 468 gene locus_tag LOCUS_11550 193 468 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250016.1 protein_id gnl|my_center|LOCUS_11550 1567 470 gene locus_tag LOCUS_11560 1567 470 CDS product tungsten cofactor oxidoreductase radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868082.1 protein_id gnl|my_center|LOCUS_11560 <2569 1647 gene locus_tag LOCUS_11570 <2569 1647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986475.1:aldehyde ferredoxin oxidoreductase family protein >Feature sequence92 687 469 gene locus_tag LOCUS_11580 687 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1006 788 gene locus_tag LOCUS_11590 1006 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1400 1020 gene locus_tag LOCUS_11600 1400 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 <2535 1444 gene locus_tag LOCUS_11610 <2535 1444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080474.1:RNA-guided endonuclease TnpB family protein