>Feature sequence01 201 629 gene locus_tag LOCUS_0010 201 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0010 763 1299 gene locus_tag LOCUS_0020 gene rplJ 763 1299 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881265.1 protein_id gnl|my_center|LOCUS_0020 1321 1713 gene locus_tag LOCUS_0030 gene rplL 1321 1713 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881266.1 protein_id gnl|my_center|LOCUS_0030 1764 1837 gene locus_tag LOCUS_t0010 1764 1837 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1847 2404 gene locus_tag LOCUS_0040 1847 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0040 2645 2436 gene locus_tag LOCUS_0050 2645 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0050 2959 2741 gene locus_tag LOCUS_0060 2959 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0060 3021 3836 gene locus_tag LOCUS_0070 gene murI 3021 3836 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202028.1 protein_id gnl|my_center|LOCUS_0070 3833 4483 gene locus_tag LOCUS_0080 3833 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0080 5922 4756 gene locus_tag LOCUS_0090 5922 4756 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391684.1 protein_id gnl|my_center|LOCUS_0090 6007 7269 gene locus_tag LOCUS_0100 6007 7269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0100 7278 8933 gene locus_tag LOCUS_0110 7278 8933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0110 9703 9098 gene locus_tag LOCUS_0120 gene udg 9703 9098 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147255.1 protein_id gnl|my_center|LOCUS_0120 10175 9720 gene locus_tag LOCUS_0130 10175 9720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0130 11539 10175 gene locus_tag LOCUS_0140 11539 10175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0140 13189 12416 gene locus_tag LOCUS_0150 13189 12416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0150 >Feature sequence02 2490 136 gene locus_tag LOCUS_0160 2490 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0160 3204 2599 gene locus_tag LOCUS_0170 gene recR 3204 2599 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722062.1 protein_id gnl|my_center|LOCUS_0170 4585 3209 gene locus_tag LOCUS_0180 gene dnaB 4585 3209 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583712.1 protein_id gnl|my_center|LOCUS_0180 5207 4755 gene locus_tag LOCUS_0190 5207 4755 CDS product DNA polymerase ligase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023353.1 protein_id gnl|my_center|LOCUS_0190 5779 7098 gene locus_tag LOCUS_0200 5779 7098 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880484.1 protein_id gnl|my_center|LOCUS_0200 7150 7374 gene locus_tag LOCUS_0210 7150 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0210 7371 8693 gene locus_tag LOCUS_0220 gene secD 7371 8693 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583952.1 protein_id gnl|my_center|LOCUS_0220 8697 9590 gene locus_tag LOCUS_0230 gene secF 8697 9590 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393192.1 protein_id gnl|my_center|LOCUS_0230 9587 11656 gene locus_tag LOCUS_0240 gene pheT 9587 11656 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545282.1 protein_id gnl|my_center|LOCUS_0240 >Feature sequence03 223 1001 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttaaaaagtcccagagtgggattgaaat 1140 1325 gene locus_tag LOCUS_0250 1140 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0250 1386 2009 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agtcccagagtgggattgaaat 2476 3276 gene locus_tag LOCUS_0260 2476 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0260 3450 4250 gene locus_tag LOCUS_0270 gene soj 3450 4250 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_0270 4306 4845 gene locus_tag LOCUS_0280 4306 4845 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880658.1 protein_id gnl|my_center|LOCUS_0280 4913 5713 gene locus_tag LOCUS_0290 4913 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0290 5710 7077 gene locus_tag LOCUS_0300 gene murC 5710 7077 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018214193.1 protein_id gnl|my_center|LOCUS_0300 7074 8126 gene locus_tag LOCUS_0310 gene miaB 7074 8126 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583438.1 protein_id gnl|my_center|LOCUS_0310 8521 9198 gene locus_tag LOCUS_0320 gene radC 8521 9198 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021974.1 protein_id gnl|my_center|LOCUS_0320 >Feature sequence04 1708 1388 gene locus_tag LOCUS_0330 1708 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0330 3990 2653 gene locus_tag LOCUS_0340 gene murD 3990 2653 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_0340 4137 5213 gene locus_tag LOCUS_0350 4137 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0350 5682 5215 gene locus_tag LOCUS_0360 5682 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0360 6105 5689 gene locus_tag LOCUS_0370 6105 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0370 6739 6149 gene locus_tag LOCUS_0380 6739 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0380 7080 6718 gene locus_tag LOCUS_0390 7080 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0390 8214 7084 gene locus_tag LOCUS_0400 8214 7084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0400 8709 8287 gene locus_tag LOCUS_0410 8709 8287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0410 >Feature sequence05 1075 506 gene locus_tag LOCUS_0420 1075 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0420 1478 1083 gene locus_tag LOCUS_0430 1478 1083 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085073.1 protein_id gnl|my_center|LOCUS_0430 1828 2241 gene locus_tag LOCUS_0440 gene rpsL 1828 2241 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258226.1 protein_id gnl|my_center|LOCUS_0440 2654 3142 gene locus_tag LOCUS_0450 gene rpsG 2654 3142 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081843.1 protein_id gnl|my_center|LOCUS_0450 3428 5548 gene locus_tag LOCUS_0460 gene fusA 3428 5548 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_0460 5591 5977 gene locus_tag LOCUS_0470 5591 5977 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384381.1 protein_id gnl|my_center|LOCUS_0470 6399 7697 gene locus_tag LOCUS_0480 6399 7697 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880501.1 protein_id gnl|my_center|LOCUS_0480 <8640 7795 gene locus_tag LOCUS_0490 <8640 7795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048356.1:DNA-directed RNA polymerase subunit beta' >Feature sequence06 <1 1107 gene locus_tag LOCUS_0500 <1 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228379.1:glycine--tRNA ligase 1108 1575 gene locus_tag LOCUS_0510 gene ruvC 1108 1575 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902123.1 protein_id gnl|my_center|LOCUS_0510 1577 3316 gene locus_tag LOCUS_0520 1577 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0520 3434 3625 gene locus_tag LOCUS_0530 3434 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0530 3759 4460 gene locus_tag LOCUS_0540 gene rpsB 3759 4460 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172954.1 protein_id gnl|my_center|LOCUS_0540 4464 4916 gene locus_tag LOCUS_0550 gene rpsK 4464 4916 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_0550 4927 5550 gene locus_tag LOCUS_0560 gene rpsD 4927 5550 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173699.1 protein_id gnl|my_center|LOCUS_0560 5603 6322 gene locus_tag LOCUS_0570 5603 6322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0570 6312 6665 gene locus_tag LOCUS_0580 gene rplQ 6312 6665 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633358.1 protein_id gnl|my_center|LOCUS_0580 6802 7152 gene locus_tag LOCUS_0590 gene rplM 6802 7152 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881226.1 protein_id gnl|my_center|LOCUS_0590 7142 7555 gene locus_tag LOCUS_0600 gene rpsI 7142 7555 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228699.1 protein_id gnl|my_center|LOCUS_0600 >Feature sequence07 1643 1215 gene locus_tag LOCUS_0610 gene rplO 1643 1215 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936637.1 protein_id gnl|my_center|LOCUS_0610 2104 1646 gene locus_tag LOCUS_0620 2104 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0620 2523 2113 gene locus_tag LOCUS_0630 gene rplR 2523 2113 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_0630 3093 2530 gene locus_tag LOCUS_0640 gene rplF 3093 2530 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393922.1 protein_id gnl|my_center|LOCUS_0640 3806 3420 gene locus_tag LOCUS_0650 gene rpsH 3806 3420 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185153.1 protein_id gnl|my_center|LOCUS_0650 4011 3826 gene locus_tag LOCUS_0660 4011 3826 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459104.1 protein_id gnl|my_center|LOCUS_0660 4626 4015 gene locus_tag LOCUS_0670 gene rplE 4626 4015 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583357.1 protein_id gnl|my_center|LOCUS_0670 5098 4790 gene locus_tag LOCUS_0680 gene rplX 5098 4790 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_0680 5592 5224 gene locus_tag LOCUS_0690 gene rplN 5592 5224 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258241.1 protein_id gnl|my_center|LOCUS_0690 5845 5558 gene locus_tag LOCUS_0700 gene rpsQ 5845 5558 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301190.1 protein_id gnl|my_center|LOCUS_0700 6017 5814 gene locus_tag LOCUS_0710 gene rpmC 6017 5814 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544971.1 protein_id gnl|my_center|LOCUS_0710 6433 6014 gene locus_tag LOCUS_0720 6433 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0720 7118 6444 gene locus_tag LOCUS_0730 gene rpsC 7118 6444 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185240.1 protein_id gnl|my_center|LOCUS_0730 7664 7122 gene locus_tag LOCUS_0740 7664 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0740 >Feature sequence08 981 610 gene locus_tag LOCUS_0750 981 610 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107654.1 protein_id gnl|my_center|LOCUS_0750 2825 1083 gene locus_tag LOCUS_0760 gene pilB 2825 1083 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546013.1 protein_id gnl|my_center|LOCUS_0760 3125 2829 gene locus_tag LOCUS_0770 3125 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0770 3744 3130 gene locus_tag LOCUS_0780 3744 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0780 4307 3753 gene locus_tag LOCUS_0790 4307 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0790 5479 4376 gene locus_tag LOCUS_0800 gene pilM 5479 4376 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181416674.1 protein_id gnl|my_center|LOCUS_0800 5483 6271 gene locus_tag LOCUS_0810 5483 6271 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546189.1 protein_id gnl|my_center|LOCUS_0810 6817 6254 gene locus_tag LOCUS_0820 6817 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0820 7034 6961 gene locus_tag LOCUS_t0020 7034 6961 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence09 898 1446 gene locus_tag LOCUS_0830 898 1446 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_0830 2943 1798 gene locus_tag LOCUS_0840 2943 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0840 4067 3135 gene locus_tag LOCUS_0850 4067 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0850 4488 4123 gene locus_tag LOCUS_0860 4488 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0860 6916 4478 gene locus_tag LOCUS_0870 gene secA 6916 4478 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082002.1 protein_id gnl|my_center|LOCUS_0870 >Feature sequence10 <1 1683 gene locus_tag LOCUS_0880 <1 1683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939361.1:peptide-binding protein 1680 2639 gene locus_tag LOCUS_0890 1680 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0890 2646 2730 gene locus_tag LOCUS_t0030 2646 2730 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3345 5063 gene locus_tag LOCUS_0900 3345 5063 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_0900 5513 5983 gene locus_tag LOCUS_0910 5513 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0910 6298 6621 gene locus_tag LOCUS_0920 6298 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0920 6628 6700 gene locus_tag LOCUS_t0040 6628 6700 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence11 <1 643 gene locus_tag LOCUS_0930 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082230.1:UDP-N-acetylmuramate dehydrogenase 1205 1558 gene locus_tag LOCUS_0940 1205 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0940 2942 2007 gene locus_tag LOCUS_0950 2942 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0950 5452 3149 gene locus_tag LOCUS_0960 5452 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0960 6003 5449 gene locus_tag LOCUS_0970 6003 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0970 6620 6210 gene locus_tag LOCUS_0980 6620 6210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0980 >Feature sequence12 3 548 gene locus_tag LOCUS_0990 3 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0990 813 1049 gene locus_tag LOCUS_1000 813 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1000 1769 1035 gene locus_tag LOCUS_1010 1769 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1010 3151 1766 gene locus_tag LOCUS_1020 3151 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1020 4663 3173 gene locus_tag LOCUS_1030 4663 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1030 5035 4688 gene locus_tag LOCUS_1040 5035 4688 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876395.1 protein_id gnl|my_center|LOCUS_1040 5129 5056 gene locus_tag LOCUS_t0050 5129 5056 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence13 <1 641 gene locus_tag LOCUS_1050 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081074.1:type I glyceraldehyde-3-phosphate dehydrogenase 662 1414 gene locus_tag LOCUS_1060 gene fba1 662 1414 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902472.1 protein_id gnl|my_center|LOCUS_1060 1411 2049 gene locus_tag LOCUS_1070 1411 2049 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_1070 2240 2611 gene locus_tag LOCUS_1080 2240 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1080 2893 4158 gene locus_tag LOCUS_1090 2893 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1090 4581 5096 gene locus_tag LOCUS_1100 gene infC 4581 5096 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583670.1 protein_id gnl|my_center|LOCUS_1100 >Feature sequence14 452 727 gene locus_tag LOCUS_1110 gene rpsO 452 727 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081540.1 protein_id gnl|my_center|LOCUS_1110 740 922 gene locus_tag LOCUS_1120 740 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1120 925 1272 gene locus_tag LOCUS_1130 gene rplT 925 1272 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386545.1 protein_id gnl|my_center|LOCUS_1130 1276 2811 gene locus_tag LOCUS_1140 1276 2811 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583879.1 protein_id gnl|my_center|LOCUS_1140 3864 2803 gene locus_tag LOCUS_1150 3864 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1150 4258 3881 gene locus_tag LOCUS_1160 4258 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1160 4656 4315 gene locus_tag LOCUS_1170 4656 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1170 5921 4653 gene locus_tag LOCUS_1180 5921 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1180 >Feature sequence15 366 2660 gene locus_tag LOCUS_1190 366 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1190 2669 2890 gene locus_tag LOCUS_1200 2669 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1200 3686 2892 gene locus_tag LOCUS_1210 gene rsmA 3686 2892 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166215.1 protein_id gnl|my_center|LOCUS_1210 5601 3676 gene locus_tag LOCUS_1220 gene pcrA 5601 3676 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989805.1 protein_id gnl|my_center|LOCUS_1220 >Feature sequence16 200 1216 gene locus_tag LOCUS_1230 200 1216 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_1230 1232 2497 gene locus_tag LOCUS_1240 1232 2497 CDS product endonuclease Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931016.1 protein_id gnl|my_center|LOCUS_1240 2508 4133 gene locus_tag LOCUS_1250 2508 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1250 4146 5228 gene locus_tag LOCUS_1260 gene dprA 4146 5228 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546585.1 protein_id gnl|my_center|LOCUS_1260 >Feature sequence17 260 1540 gene locus_tag LOCUS_1270 260 1540 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592994.1 protein_id gnl|my_center|LOCUS_1270 1537 2577 gene locus_tag LOCUS_1280 gene tsaD 1537 2577 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288444.1 protein_id gnl|my_center|LOCUS_1280 3048 3431 gene locus_tag LOCUS_1290 gene speD 3048 3431 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496461.1 protein_id gnl|my_center|LOCUS_1290 3979 3428 gene locus_tag LOCUS_1300 gene amrA 3979 3428 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941768.1 protein_id gnl|my_center|LOCUS_1300 5457 4306 gene locus_tag LOCUS_1310 gene murG 5457 4306 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930513.1 protein_id gnl|my_center|LOCUS_1310 >Feature sequence18 1300 572 gene locus_tag LOCUS_1320 1300 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1320 1511 1284 gene locus_tag LOCUS_1330 gene rpmE 1511 1284 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966172.1 protein_id gnl|my_center|LOCUS_1330 1825 1899 gene locus_tag LOCUS_t0060 1825 1899 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3137 1929 gene locus_tag LOCUS_1340 3137 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1340 <5456 3200 gene locus_tag LOCUS_1350 <5456 3200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266915.1:peptidoglycan DD-metalloendopeptidase family protein >Feature sequence19 1183 467 gene locus_tag LOCUS_1360 1183 467 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545318.1 protein_id gnl|my_center|LOCUS_1360 4202 1203 gene locus_tag LOCUS_1370 4202 1203 CDS product intein-containing RctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870187.1 protein_id gnl|my_center|LOCUS_1370 4985 4545 gene locus_tag LOCUS_1380 4985 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1380 >Feature sequence20 3105 2071 gene locus_tag LOCUS_1390 gene amrS 3105 2071 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228858.1 protein_id gnl|my_center|LOCUS_1390 3821 3102 gene locus_tag LOCUS_1400 3821 3102 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405060.1 protein_id gnl|my_center|LOCUS_1400 3909 3825 gene locus_tag LOCUS_t0070 3909 3825 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4124 4050 gene locus_tag LOCUS_t0080 4124 4050 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence21 369 1415 gene locus_tag LOCUS_1410 gene mltG 369 1415 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438164.1 protein_id gnl|my_center|LOCUS_1410 1461 2513 gene locus_tag LOCUS_1420 1461 2513 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963746.1 protein_id gnl|my_center|LOCUS_1420 2525 3349 gene locus_tag LOCUS_1430 gene amrB 2525 3349 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005130.1 protein_id gnl|my_center|LOCUS_1430 3910 3563 gene locus_tag LOCUS_1440 3910 3563 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546371.1 protein_id gnl|my_center|LOCUS_1440 4338 3907 gene locus_tag LOCUS_1450 4338 3907 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064945.1 protein_id gnl|my_center|LOCUS_1450 >Feature sequence22 405 854 gene locus_tag LOCUS_1460 gene rplI 405 854 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256838.1 protein_id gnl|my_center|LOCUS_1460 851 2527 gene locus_tag LOCUS_1470 gene pyrG 851 2527 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876058.1 protein_id gnl|my_center|LOCUS_1470 3815 2505 gene locus_tag LOCUS_1480 3815 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1480 >Feature sequence23 279 2009 gene locus_tag LOCUS_1490 gene thrS 279 2009 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_1490 2533 4239 gene locus_tag LOCUS_1500 2533 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1500 >Feature sequence24 492 1619 gene locus_tag LOCUS_1510 492 1619 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_1510 2010 2195 gene locus_tag LOCUS_1520 2010 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1520 2505 3161 gene locus_tag LOCUS_1530 2505 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1530 3158 3742 gene locus_tag LOCUS_1540 3158 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1540 3812 4024 gene locus_tag LOCUS_1550 3812 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1550 >Feature sequence25 <1 1077 gene locus_tag LOCUS_1560 <1 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584040.1:cysteine--tRNA ligase 1077 2357 gene locus_tag LOCUS_1570 1077 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1570 <4523 2450 gene locus_tag LOCUS_1580 <4523 2450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583264.1:AAA family ATPase >Feature sequence26 <1 711 gene locus_tag LOCUS_1590 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003732525.1:UDP-N-acetylglucosamine 1-carboxyvinyltransferase 771 1778 gene locus_tag LOCUS_1600 gene mreB 771 1778 CDS product cell shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229650.1 protein_id gnl|my_center|LOCUS_1600 1780 3021 gene locus_tag LOCUS_1610 1780 3021 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919797.1 protein_id gnl|my_center|LOCUS_1610 3028 4053 gene locus_tag LOCUS_1620 3028 4053 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 protein_id gnl|my_center|LOCUS_1620 >Feature sequence27 1032 241 gene locus_tag LOCUS_1630 1032 241 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869613.1 protein_id gnl|my_center|LOCUS_1630 1830 1039 gene locus_tag LOCUS_1640 1830 1039 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877280.1 protein_id gnl|my_center|LOCUS_1640 1940 1857 gene locus_tag LOCUS_t0090 1940 1857 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2221 2030 gene locus_tag LOCUS_1650 2221 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1650 2432 2360 gene locus_tag LOCUS_t0100 2432 2360 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3454 3527 gene locus_tag LOCUS_t0110 3454 3527 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence28 853 431 gene locus_tag LOCUS_1660 gene rplK 853 431 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081512.1 protein_id gnl|my_center|LOCUS_1660 1417 866 gene locus_tag LOCUS_1670 gene nusG 1417 866 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258049.1 protein_id gnl|my_center|LOCUS_1670 1619 1422 gene locus_tag LOCUS_1680 1619 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1680 3578 1662 gene locus_tag LOCUS_1690 gene gyrB 3578 1662 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868886.1 protein_id gnl|my_center|LOCUS_1690 <4360 3719 gene locus_tag LOCUS_1700 <4360 3719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003131470.1:primosomal protein N' >Feature sequence29 1122 2918 gene locus_tag LOCUS_1710 gene lepA 1122 2918 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030952.1 protein_id gnl|my_center|LOCUS_1710 2915 3319 gene locus_tag LOCUS_1720 2915 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1720 <4353 3332 gene locus_tag LOCUS_1730 <4353 3332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393885.1:peptidoglycan bridge formation glycyltransferase FemA/FemB family protein >Feature sequence30 883 290 gene locus_tag LOCUS_1740 883 290 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392695.1 protein_id gnl|my_center|LOCUS_1740 1238 894 gene locus_tag LOCUS_1750 1238 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1750 2752 1241 gene locus_tag LOCUS_1760 gene metG 2752 1241 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041424295.1 protein_id gnl|my_center|LOCUS_1760 3732 2749 gene locus_tag LOCUS_1770 3732 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1770 4268 3762 gene locus_tag LOCUS_1780 4268 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1780 >Feature sequence31 <1 725 gene locus_tag LOCUS_1790 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080054.1:glycosyltransferase 1171 1243 gene locus_tag LOCUS_t0120 1171 1243 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1417 3180 gene locus_tag LOCUS_1800 1417 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1800 3236 3309 gene locus_tag LOCUS_t0130 3236 3309 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence32 533 1441 gene locus_tag LOCUS_1810 533 1441 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545688.1 protein_id gnl|my_center|LOCUS_1810 1420 1716 gene locus_tag LOCUS_1820 1420 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1820 1676 3403 gene locus_tag LOCUS_1830 1676 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1830 <4338 3453 gene locus_tag LOCUS_1840 <4338 3453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001111376.1:FAD-dependent thymidylate synthase >Feature sequence33 381 1046 gene locus_tag LOCUS_1850 381 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1850 1173 1490 gene locus_tag LOCUS_1860 1173 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1860 1502 2587 gene locus_tag LOCUS_1870 1502 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1870 2616 3914 gene locus_tag LOCUS_1880 gene nusA 2616 3914 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_1880 4268 3987 gene locus_tag LOCUS_1890 4268 3987 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_1890 >Feature sequence34 866 1294 gene locus_tag LOCUS_1900 gene mraZ 866 1294 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_1900 1297 2193 gene locus_tag LOCUS_1910 gene rsmH 1297 2193 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_1910 2190 2519 gene locus_tag LOCUS_1920 2190 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1920 2536 4182 gene locus_tag LOCUS_1930 2536 4182 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266230.1 protein_id gnl|my_center|LOCUS_1930 >Feature sequence35 556 101 gene locus_tag LOCUS_1940 gene rpiB 556 101 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_1940 2812 581 gene locus_tag LOCUS_1950 2812 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1950 3507 2800 gene locus_tag LOCUS_1960 gene rnc 3507 2800 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557292.1 protein_id gnl|my_center|LOCUS_1960 3957 3517 gene locus_tag LOCUS_1970 gene nusB 3957 3517 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909412.1 protein_id gnl|my_center|LOCUS_1970 4231 3971 gene locus_tag LOCUS_1980 4231 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1980 >Feature sequence36 720 343 gene locus_tag LOCUS_1990 gene rnpA 720 343 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081756.1 protein_id gnl|my_center|LOCUS_1990 1230 2606 gene locus_tag LOCUS_2000 gene dnaA 1230 2606 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229057.1 protein_id gnl|my_center|LOCUS_2000 2825 3946 gene locus_tag LOCUS_2010 gene dnaN 2825 3946 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012615304.1 protein_id gnl|my_center|LOCUS_2010 >Feature sequence37 715 86 gene locus_tag LOCUS_2020 715 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2020 972 1178 gene locus_tag LOCUS_2030 972 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2030 1540 1229 gene locus_tag LOCUS_2040 gene rplU 1540 1229 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545103.1 protein_id gnl|my_center|LOCUS_2040 1899 1546 gene locus_tag LOCUS_2050 1899 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2050 2198 3043 gene locus_tag LOCUS_2060 2198 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2060 3033 3740 gene locus_tag LOCUS_2070 gene sufC 3033 3740 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876773.1 protein_id gnl|my_center|LOCUS_2070 >Feature sequence38 64 1053 gene locus_tag LOCUS_2080 64 1053 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_2080 1046 2122 gene locus_tag LOCUS_2090 gene prfB 1046 2122 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205591.1 protein_id gnl|my_center|LOCUS_2090 2134 2823 gene locus_tag LOCUS_2100 gene ftsE 2134 2823 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082104.1 protein_id gnl|my_center|LOCUS_2100 2833 3741 gene locus_tag LOCUS_2110 gene ftsX 2833 3741 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564193.1 protein_id gnl|my_center|LOCUS_2110 >Feature sequence39 <1 3156 gene locus_tag LOCUS_2120 <1 3156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583781.1:isoleucine--tRNA ligase >Feature sequence40 459 163 gene locus_tag LOCUS_2130 459 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2130 2596 437 gene locus_tag LOCUS_2140 2596 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2140 3550 2771 gene locus_tag LOCUS_2150 3550 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2150 >Feature sequence41 <1 646 gene locus_tag LOCUS_2160 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003013734.1:recombinase RecA 654 1334 gene locus_tag LOCUS_2170 654 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2170 1490 3985 gene locus_tag LOCUS_2180 1490 3985 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109716.1 protein_id gnl|my_center|LOCUS_2180 >Feature sequence42 1928 564 gene locus_tag LOCUS_2190 1928 564 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496482.1 protein_id gnl|my_center|LOCUS_2190 3701 1938 gene locus_tag LOCUS_2200 3701 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2200 >Feature sequence43 492 1415 gene locus_tag LOCUS_2210 492 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2210 1674 1408 gene locus_tag LOCUS_2220 gene rpsT 1674 1408 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774009.1 protein_id gnl|my_center|LOCUS_2220 2038 1826 gene locus_tag LOCUS_2230 2038 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2230 3279 2125 gene locus_tag LOCUS_2240 3279 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2240 >Feature sequence44 411 2048 gene locus_tag LOCUS_2250 411 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2250 2198 3217 gene locus_tag LOCUS_2260 gene ruvB 2198 3217 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_2260 >Feature sequence45 >Feature sequence46 165 1625 gene locus_tag LOCUS_2270 gene gatA 165 1625 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546781.1 protein_id gnl|my_center|LOCUS_2270 1603 3480 gene locus_tag LOCUS_2280 gene mrdA 1603 3480 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444536.1 protein_id gnl|my_center|LOCUS_2280 >Feature sequence47 478 909 gene locus_tag LOCUS_2290 478 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2290 997 1070 gene locus_tag LOCUS_t0140 997 1070 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1475 1687 gene locus_tag LOCUS_2300 1475 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2300 1690 2970 gene locus_tag LOCUS_2310 1690 2970 CDS product DNA methyltransferase C1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545124.1 protein_id gnl|my_center|LOCUS_2310 >Feature sequence48 2477 2848 gene locus_tag LOCUS_2320 2477 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2320 <3500 2842 gene locus_tag LOCUS_2330 <3500 2842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978370.1:glycosyltransferase >Feature sequence49 3114 2179 gene locus_tag LOCUS_2340 3114 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2340 >Feature sequence50 432 644 gene locus_tag LOCUS_2350 gene infA 432 644 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879986.1 protein_id gnl|my_center|LOCUS_2350 889 1278 gene locus_tag LOCUS_2360 gene rpsM 889 1278 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903912.1 protein_id gnl|my_center|LOCUS_2360 1306 1890 gene locus_tag LOCUS_2370 gene tsf 1306 1890 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228249.1 protein_id gnl|my_center|LOCUS_2370 1898 2254 gene locus_tag LOCUS_2380 1898 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2380 2244 2927 gene locus_tag LOCUS_2390 gene thpR 2244 2927 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583814.1 protein_id gnl|my_center|LOCUS_2390 2935 3008 gene locus_tag LOCUS_t0150 2935 3008 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3015 3089 gene locus_tag LOCUS_t0160 3015 3089 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3093 3166 gene locus_tag LOCUS_t0170 3093 3166 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence51 160 1392 gene locus_tag LOCUS_2400 gene tig 160 1392 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105215.1 protein_id gnl|my_center|LOCUS_2400 1604 2191 gene locus_tag LOCUS_2410 gene clpP 1604 2191 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081059.1 protein_id gnl|my_center|LOCUS_2410 2226 3098 gene locus_tag LOCUS_2420 2226 3098 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_2420 >Feature sequence52 2121 406 gene locus_tag LOCUS_2430 2121 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2430 2765 2127 gene locus_tag LOCUS_2440 2765 2127 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545748.1 protein_id gnl|my_center|LOCUS_2440 3154 2762 gene locus_tag LOCUS_2450 3154 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2450 >Feature sequence53 183 665 gene locus_tag LOCUS_2460 183 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2460 704 2416 gene locus_tag LOCUS_2470 704 2416 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_2470 >Feature sequence54 588 1043 gene locus_tag LOCUS_2480 gene smpB 588 1043 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167013.1 protein_id gnl|my_center|LOCUS_2480 1040 2485 gene locus_tag LOCUS_2490 1040 2485 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060802.1 protein_id gnl|my_center|LOCUS_2490 2482 2946 gene locus_tag LOCUS_2500 2482 2946 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_2500 >Feature sequence55 1294 428 gene locus_tag LOCUS_2510 1294 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2510 1335 1955 gene locus_tag LOCUS_2520 1335 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2520 2799 2545 gene locus_tag LOCUS_2530 2799 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2530 >Feature sequence56 281 353 gene locus_tag LOCUS_t0180 281 353 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 561 791 gene locus_tag LOCUS_2540 561 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2540 971 1465 gene locus_tag LOCUS_2550 971 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2550 2037 2483 gene locus_tag LOCUS_2560 2037 2483 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582920.1 protein_id gnl|my_center|LOCUS_2560 2480 2908 gene locus_tag LOCUS_2570 2480 2908 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582921.1 protein_id gnl|my_center|LOCUS_2570 2931 3236 gene locus_tag LOCUS_2580 2931 3236 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_2580 >Feature sequence57 130 702 gene locus_tag LOCUS_2590 130 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2590 819 2147 gene locus_tag LOCUS_2600 819 2147 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081014.1 protein_id gnl|my_center|LOCUS_2600 2546 2758 gene locus_tag LOCUS_2610 2546 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2610 >Feature sequence58 440 1507 gene locus_tag LOCUS_2620 gene galT 440 1507 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080684.1 protein_id gnl|my_center|LOCUS_2620 1511 2764 gene locus_tag LOCUS_2630 gene rpoD 1511 2764 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_2630 2845 3060 gene locus_tag LOCUS_2640 2845 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2640 >Feature sequence59 579 82 gene locus_tag LOCUS_2650 579 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2650 527 760 gene locus_tag LOCUS_2660 527 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2660 1703 1775 gene locus_tag LOCUS_t0190 1703 1775 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1888 2391 gene locus_tag LOCUS_2670 1888 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2670 >Feature sequence60 <3158 876 gene locus_tag LOCUS_2680 <3158 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546043.1:ATP-dependent chaperone ClpB >Feature sequence61 1737 2573 gene locus_tag LOCUS_2690 1737 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2690 >Feature sequence62 2467 26 gene locus_tag LOCUS_2700 gene ppsA 2467 26 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881404.1 protein_id gnl|my_center|LOCUS_2700 >Feature sequence63 1480 1214 gene locus_tag LOCUS_2710 1480 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2710 2150 2077 gene locus_tag LOCUS_t0200 2150 2077 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence64 1461 178 gene locus_tag LOCUS_2720 1461 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2720 1963 1424 gene locus_tag LOCUS_2730 gene scpB 1963 1424 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842431.1 protein_id gnl|my_center|LOCUS_2730 2712 1960 gene locus_tag LOCUS_2740 2712 1960 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389685.1 protein_id gnl|my_center|LOCUS_2740 >Feature sequence65 194 535 gene locus_tag LOCUS_2750 194 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2750 >Feature sequence66 <1 652 gene locus_tag LOCUS_2760 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010908442.1:chromosome segregation protein SMC 670 1125 gene locus_tag LOCUS_2770 gene rpiB 670 1125 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_2770 1138 2895 gene locus_tag LOCUS_2780 1138 2895 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889708.1 protein_id gnl|my_center|LOCUS_2780 >Feature sequence67 2295 1273 gene locus_tag LOCUS_2790 2295 1273 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986808.1 protein_id gnl|my_center|LOCUS_2790 >Feature sequence68 <1 1176 gene locus_tag LOCUS_2800 <1 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881134.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase 1173 2012 gene locus_tag LOCUS_2810 1173 2012 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002663.1 protein_id gnl|my_center|LOCUS_2810 2746 2009 gene locus_tag LOCUS_2820 2746 2009 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535747.1 protein_id gnl|my_center|LOCUS_2820 >Feature sequence69 125 1780 gene locus_tag LOCUS_2830 gene groL 125 1780 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081434.1 protein_id gnl|my_center|LOCUS_2830 >Feature sequence70 560 18 gene locus_tag LOCUS_2840 560 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2840 1289 570 gene locus_tag LOCUS_2850 1289 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2850 <2827 1277 gene locus_tag LOCUS_2860 <2827 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583452.1:valine--tRNA ligase >Feature sequence71 2669 1098 gene locus_tag LOCUS_2870 gene argS 2669 1098 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583838.1 protein_id gnl|my_center|LOCUS_2870 >Feature sequence72 365 586 gene locus_tag LOCUS_2880 365 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2880 588 995 gene locus_tag LOCUS_2890 588 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2890 1324 1767 gene locus_tag LOCUS_2900 1324 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2900 >Feature sequence73 1873 1487 gene locus_tag LOCUS_2910 1873 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2910 2061 1873 gene locus_tag LOCUS_2920 2061 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2920 >Feature sequence74 <1 1218 gene locus_tag LOCUS_2930 <1 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937814.1:translation initiation factor IF-2 1237 1668 gene locus_tag LOCUS_2940 1237 1668 CDS product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868935.1 protein_id gnl|my_center|LOCUS_2940 >Feature sequence75 673 945 gene locus_tag LOCUS_2950 gene rpmA 673 945 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081742.1 protein_id gnl|my_center|LOCUS_2950 2083 923 gene locus_tag LOCUS_2960 2083 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2960 >Feature sequence76 231 812 gene locus_tag LOCUS_2970 231 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2970 894 1313 gene locus_tag LOCUS_2980 894 1313 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880818.1 protein_id gnl|my_center|LOCUS_2980 >Feature sequence77 1768 695 gene locus_tag LOCUS_2990 1768 695 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143858.1 protein_id gnl|my_center|LOCUS_2990 2458 1841 gene locus_tag LOCUS_3000 2458 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3000 >Feature sequence78 367 6 gene locus_tag LOCUS_tm0010 367 6 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 533 462 gene locus_tag LOCUS_t0210 533 462 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1092 1277 gene locus_tag LOCUS_3010 1092 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3010 1590 2294 gene locus_tag LOCUS_3020 1590 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3020 2302 2559 gene locus_tag LOCUS_3030 2302 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3030 >Feature sequence79 >Feature sequence80 997 698 gene locus_tag LOCUS_3040 997 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3040 2212 1148 gene locus_tag LOCUS_3050 2212 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3050 >Feature sequence81 1723 2199 gene locus_tag LOCUS_3060 gene ndk 1723 2199 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146967.1 protein_id gnl|my_center|LOCUS_3060 >Feature sequence82 271 1005 gene locus_tag LOCUS_3070 271 1005 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_3070 1005 2159 gene locus_tag LOCUS_3080 gene eno 1005 2159 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979231.1 protein_id gnl|my_center|LOCUS_3080 2145 2216 gene locus_tag LOCUS_t0220 2145 2216 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence83 1035 1757 gene locus_tag LOCUS_3090 gene tpiA 1035 1757 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583495.1 protein_id gnl|my_center|LOCUS_3090 1844 1915 gene locus_tag LOCUS_t0230 1844 1915 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence84 <1 839 gene locus_tag LOCUS_3100 <1 839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879045.1:restriction endonuclease 1674 1363 gene locus_tag LOCUS_3110 1674 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3110 2280 1741 gene locus_tag LOCUS_3120 gene pth 2280 1741 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880175.1 protein_id gnl|my_center|LOCUS_3120 >Feature sequence85 1671 163 gene locus_tag LOCUS_3130 1671 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3130 2108 1683 gene locus_tag LOCUS_3140 2108 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3140 >Feature sequence86