COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..37700 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1136..1837 product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249248.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS 1916..2416 product deglycase PfpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250235.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene pfpI CDS 2566..3036 product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249106.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 3040..3921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 3924..4829 product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249108.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(4816..5100) product family 4A encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053633.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(5183..5818) product neutral amino acid NAAT transporter SnatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250610.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene snatA CDS complement(5971..6756) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250088.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene surE CDS 6840..7808 product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250086.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 8044..8301 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146566.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 8307..9530 product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867628.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 9586..10434 product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250080.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 10431..10946 product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250077.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 10943..12088 product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250076.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 12094..12939 product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250075.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 12936..13496 product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146568.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 13784..14455 product archaemetzincin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249467.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 14439..15089 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867690.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(15270..16301) product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250742.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene priS CDS complement(16294..17475) product DNA primase large subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250741.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene priL CDS complement(17535..18422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 note possible pseudo, frameshifted CDS complement(18419..19417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 note possible pseudo, frameshifted CDS 19646..20392 product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146498.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 20409..21170 product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867294.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(21160..22155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250153.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(22152..22622) product DUF1887 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250154.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(22639..23085) product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250155.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(23096..23269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147172.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(23253..23915) product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173254069.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(23917..24681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249431.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(24692..25912) product 3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249430.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene hxlA CDS complement(26012..26893) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene dapA CDS 27012..27167 product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250446.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(27169..27495) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250445.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(27874..29064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010885940.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(29132..30160) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868714.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 30218..30520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(30501..31526) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249900.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(31583..32770) product cell wall-binding repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867622.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(32966..34414) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249901.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene asnB CDS complement(34549..35289) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868552.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 35382..37196 product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249904.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(37193..37435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 sequence002 source 1..36122 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1101..2036 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250990.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 2142..3077 product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249823.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 3126..3767 product DUF257 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250993.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 3764..4438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(4398..5396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249824.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(5396..5986) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053690.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 6046..7128 product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 7131..7793 product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867891.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 7950..9341 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249828.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 9402..9818 product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867889.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 9985..10851 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249833.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene speB CDS complement(10852..12564) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249837.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(12595..13206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598770.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 13516..13986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249836.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 14115..14888 product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250494.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 14890..15927 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250493.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 15939..16706 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250492.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene rpl4p CDS 16717..16977 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250491.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 16989..17708 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250490.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 17719..18120 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250489.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 18132..18596 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867459.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene rplV CDS 18601..19233 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867458.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene rpsC CDS 19230..19430 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250486.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene rpmC CDS 19439..19735 product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050002739.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene yciH CDS 19732..19998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 19995..20330 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867454.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 20336..20761 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250482.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 20772..21134 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867452.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene rplX CDS 21137..21883 product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250480.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 21895..22437 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250479.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 22441..22611 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250478.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 22623..23015 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867448.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 23026..23580 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250476.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 23591..23974 product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250475.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 23974..24426 product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053733.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 24432..25025 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867444.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 25032..25739 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867443.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene rpsE CDS 25751..26215 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867442.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 26226..26669 product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867441.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 26702..28099 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867440.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene secY CDS 28308..28898 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146533.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 28891..29415 product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867438.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 29466..29738 product 50S ribosomal protein L34e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250466.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 29760..30332 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250465.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 30333..30581 product 50S ribosomal protein L14e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250464.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 30772..31785 product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250460.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 31887..32474 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250458.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 tRNA 32460..32546 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 32588..33034 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250457.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 33045..33587 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867652.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 33584..33994 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250455.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 34025..34801 product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868100.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 tRNA 34803..34890 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 34947..35309 product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250453.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 35316..35744 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250452.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene rplM sequence003 source 1..34545 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 497..1465 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895813.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene speB CDS 1462..2484 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296093.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene cysK CDS 2584..2892 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868443.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 2894..4072 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868444.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(4086..4304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146475.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(4378..6597) product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249110.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(6644..7912) product TIGR04013 family B12-binding domain/radical SAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250363.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(7975..8175) product archaeal histone HpkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250364.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene hpkA tRNA complement(8545..8620) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 8668..9138 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250365.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene dcd CDS complement(9135..9377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(9621..10385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(10475..10789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(10854..11873) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250367.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(11879..12529) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250368.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(12610..13101) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250369.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(13117..13569) product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867126.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(13589..13783) product protein translocase SEC61 complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250371.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(13815..14945) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250372.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene ftsZ CDS complement(15019..15837) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250373.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 16072..17070 product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053693.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 17076..17522 product DUF1850 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209477679.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 17524..19836 product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249888.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(19883..21091) product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250375.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 21144..21737 product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146546.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(21740..22876) product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250496.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 23245..23793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 23793..24602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868619.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(24960..25685) product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209477233.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(25669..26745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(26742..27074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147066.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(27227..28213) product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249596.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(28191..28499) product DUF3194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249595.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(28526..28873) product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868631.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 29000..29308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(29277..29522) product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173254056.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene pcc1 CDS complement(29515..30660) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249578.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 30802..31209 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249577.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(31192..32697) product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249576.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(32694..32987) product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249575.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(32980..33402) product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249574.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(33399..33644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249573.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(33641..33871) product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249572.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(33852..34166) product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249571.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene mnhG CDS complement(34163..34438) product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249570.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 sequence004 source 1..30494 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2474 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868880.1:V-type ATP synthase subunit A locus_tag LOCUS_01410 CDS 2471..3871 product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053740.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 3895..4536 product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250555.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 4600..5010 product DUF61 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250746.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 5016..5288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 5347..6966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598712.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 7376..8281 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250632.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(8327..8497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(8580..9032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 9130..10302 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250627.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(10359..10559) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868845.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(10689..11012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(11054..11794) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250643.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 11872..12924 product N(4)-bis(aminopropyl)spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250642.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene bpsA CDS 13167..13640 product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867679.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 13672..14040 product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545906.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene speD CDS 14073..14924 product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249102.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene speE CDS 15026..16315 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867870.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene thrC CDS 16463..16927 product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250688.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 17112..20918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 21004..22143 product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867962.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(22145..22738) product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867961.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(22782..23678) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250918.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 23743..24453 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250920.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 24440..24967 product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250921.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene otg CDS 24955..25956 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867513.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(26133..27512) product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868396.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(27552..29099) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868397.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 29375..29638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868791.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 29797..30162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01700 sequence005 source 1..26534 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 99..1148 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250754.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 1160..2587 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250753.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 2590..3549 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250752.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 3560..4567 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250751.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 4626..5090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 5087..5857 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250749.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 5854..6696 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250748.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 6825..7754 product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062388956.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(7743..8666) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868813.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 8726..9214 product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251062.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 9239..9799 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868811.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 9860..10312 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251060.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 10748..11872 product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868421.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene fbp CDS 12408..12791 product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868549.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 12901..14133 product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867591.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 14158..14562 product nucleic acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250895.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(14606..15508) product asparagine synthetase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250501.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(15667..16797) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250511.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(16811..17371) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250509.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 tRNA complement(17462..17539) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(17628..17705) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 17803..18861 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250860.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 18929..19642 product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250861.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 19652..20077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250862.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 20077..21870 product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868077.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 21915..23600 product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250863.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(23577..23903) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053759.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(24016..24663) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250865.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(24650..24880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 25159..25953 product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250866.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 misc_feature complement(25941..>26534) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867384.1:class I SAM-dependent methyltransferase locus_tag LOCUS_01990 sequence006 source 1..25572 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 64..585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 585..1460 product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545354.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene csm3 CDS 1460..2314 product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876703.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene csm4 CDS 2311..3531 product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021931.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene csm5 CDS 3528..4808 product CRISPR-associated CARF protein Csx1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871190.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene csx1 CDS 4992..6278 product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868210.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene cytX CDS 6283..7083 product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146833.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene thiM CDS 7073..7696 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868208.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene thiE CDS 7702..8778 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868207.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(8775..9233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249607.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 9437..10687 product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762231.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 10724..12247 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249609.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 12244..13278 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249610.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 13275..14177 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249611.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(14178..14393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(14453..15463) product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868428.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene hypE CDS 15578..16387 product DUF2666 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250214.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(16384..17688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250434.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(17815..18024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250435.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(18008..18187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(18124..18978) product damage-control phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249335.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 19031..19699 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249756.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene rnhB tRNA complement(19833..19910) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 19931..20431 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867606.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(20428..20766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(20763..21947) product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868230.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(21944..22657) product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250440.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 23210..24565 product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250437.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 24562..24801 product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250438.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 24806..25321 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250439.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 sequence007 source 1..24997 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(122..790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(757..1059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(1052..1282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(1255..2427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250259.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 2636..2980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867424.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 3068..3457 product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250142.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 3559..4605 product Xaa-Pro dipeptidase PepQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249918.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene pepQ CDS 4705..5226 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250125.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 5275..6078 product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250124.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene uppS CDS complement(6075..6746) product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250422.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(6810..7619) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250014.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(7695..8909) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249472.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene coaBC CDS complement(8962..9342) product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249470.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(9344..9718) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867782.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene crcB CDS complement(9708..9986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(9973..10146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(10244..10543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(10521..10847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(10837..11538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(11562..12416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249468.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 12599..13066 product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250071.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(13075..14820) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249258.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(14869..15861) product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249452.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 tRNA complement(15978..16055) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(16074..16832) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867145.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(16856..18718) product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146456.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(19067..20839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(20957..21190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(21197..22858) product DUF4932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249170.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(22855..24537) product DUF4932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249170.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(24674..24997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 sequence008 source 1..24709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(62..1519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(1524..2726) product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868809.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 2804..3112 product DUF5748 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250737.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(3120..4262) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250738.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(4220..5434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209475225.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 5605..6051 product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249062.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(6114..7484) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249112.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(7568..8569) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249113.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(8563..10188) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053795.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(10218..12038) product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868108.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(12048..13520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 13593..14531 product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146617.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 14786..15817 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868853.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 15814..16821 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868854.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 16930..18273 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867150.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 18364..19221 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867149.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 19218..20036 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867148.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 20047..21159 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867147.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 21170..22186 product transcriptional regulator TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892507.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene trmB misc_feature complement(22187..>24709) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010906004.1:alpha-mannosidase locus_tag LOCUS_02780 sequence009 source 1..21959 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..746 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868609.1:FlaD/FlaE family flagellar protein locus_tag LOCUS_02790 CDS 756..1271 product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249000.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 1274..1729 product flagellar protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147053.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 1754..2449 product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249002.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 2451..4076 product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249003.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 4082..5791 product archaellar assembly protein FlaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147051.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene flaJ CDS 5788..7704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 7764..9647 product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250266.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 9674..10528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 10577..11167 product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250264.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 11208..11864 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147186.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 11866..12498 product HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249007.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(12544..13680) product A24 family peptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249008.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(13691..13855) product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249009.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 14014..15216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188201438.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 15267..15629 product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249010.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 15610..16182 product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868704.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(16172..16405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249012.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 16595..17293 product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249013.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(17301..17897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(17899..18135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 18383..18997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250099.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(18998..21172) product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250098.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 sequence010 source 1..21800 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..943 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250934.1:pyruvate synthase subunit PorB locus_tag LOCUS_03020 CDS 1054..1944 product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250971.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(1950..3266) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867775.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(3362..4237) product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249628.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(4239..4778) product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868259.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 4913..5041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(5065..6282) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249500.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 6428..6991 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250217.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 7147..8019 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248984.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(8016..8624) product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249024.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene cas4 CDS complement(8630..9862) product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878533.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(9849..12512) product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878532.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene rad50 CDS complement(12509..13894) product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878531.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(13896..15563) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878530.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(15766..17955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(18131..18535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 note possible pseudo, frameshifted CDS 19174..20529 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250091.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene serS rRNA complement(20993..21107) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence011 source 1..21579 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3234..4577) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053749.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(4574..5476) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146501.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(5522..6847) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867301.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(6993..9212) product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251122.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(9377..11356) product alpha amylase N-terminal ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250721.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 11430..12455 product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250720.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 12480..13838 product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250719.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 13843..14295 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250590.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(14287..14748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 14933..15616 product DUF4152 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250597.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 15698..17584 product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250594.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene iorA CDS complement(17603..17851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146712.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 17923..18210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250592.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(18309..18983) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867624.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 19661..21022 product acetate--CoA ligase I subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868410.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene acdAII sequence012 source 1..21473 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 840..1451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249088.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 1732..2997 product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250852.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 3015..4916 product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867245.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 4926..8678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(8671..9717) product Clp1/GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146503.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 9921..10379 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867309.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(10388..11767) product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868821.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 tRNA complement(11867..11942) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA complement(11951..12028) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA complement(12178..12255) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 rRNA complement(12268..12382) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 CDS 12484..13065 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250912.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene scpB CDS 13263..14312 product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146527.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 14314..14685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867408.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 14682..15482 product RPA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146526.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 15533..16384 product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250907.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 16381..16773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250908.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 16783..17325 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868222.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene pyrE CDS complement(17341..18681) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251077.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(18686..19792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 19870..20352 product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251078.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene coaD sequence013 source 1..19059 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 430..732 product FUN14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250444.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 765..2084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868094.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 2137..2580 product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249180.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 2601..3185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 3185..3478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 3507..4115 product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251241.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(4112..4315) product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867951.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 4604..5968 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 6183..8123 product 1,4-alpha-glucan branching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867884.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 8204..8521 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250386.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 8591..9385 product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249694.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 9511..10317 product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867487.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 10314..11060 product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867487.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(11050..13551) product DUF5814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249521.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(13656..13847) product PCNA-inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249759.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 14166..15974 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249760.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene glmS CDS 15985..18858 product STT3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249761.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 sequence014 source 1..18948 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2726 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250518.1:alanine--tRNA ligase locus_tag LOCUS_03680 CDS complement(2759..3547) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868539.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 3589..5331 product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250525.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(5341..7026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 7090..7611 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250531.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 7595..8086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250532.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 8210..8941 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250639.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(9073..9861) product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250637.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(9866..10675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(10708..11394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(11436..11900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250634.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(12040..12471) product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251148.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(12527..13423) product thiamine-phosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868447.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 13631..14557 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251146.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene pyrB CDS 14554..15009 product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868441.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene pyrI CDS complement(15085..15672) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251144.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(15784..16512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053379.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(16667..18235) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146661.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 sequence015 source 1..18378 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 259..876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867736.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 917..1303 product DUF2240 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053860.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 1339..1725 product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867598.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 1747..3102 product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250361.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene dnaG CDS 3185..4900 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250359.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(4902..5195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250941.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 5322..6071 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249682.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene sufC CDS 6064..7392 product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249681.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 7639..8145 product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867824.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 8142..8396 product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867825.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 8393..8755 product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867826.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene mnhG CDS 8752..9033 product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250174.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 9027..9740 product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053840.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 9733..10077 product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867829.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 10074..11558 product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250171.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 11555..13414 product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250170.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 13415..14308 product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250169.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 14331..14909 product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053713.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 14900..15412 product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053712.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 15423..16607 product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250166.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 16613..17236 product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053711.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene nuoI misc_feature complement(17357..>18378) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250357.1:maltodextrin phosphorylase locus_tag LOCUS_04070 sequence016 source 1..17964 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 73..2514 product tRNA(Met) cytidine acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249705.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 2579..3088 product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249706.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 3085..3621 product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867206.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 3652..4563 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868678.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 4756..5292 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250651.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 5327..5887 product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868803.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 5887..6069 product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868804.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 6071..6616 product GTP-dependent dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053746.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 6606..6902 product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250647.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 6907..7080 product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250646.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 7298..7807 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868358.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 7857..8438 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250624.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(8426..8566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 8689..9660 product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250622.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene twy1 CDS 9761..11986 product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755810.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 11995..13089 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250620.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 13082..13765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250619.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 13813..14409 product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867934.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 14411..14845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 14826..15305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010885428.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 15302..16702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867931.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 sequence017 source 1..17163 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..639 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048053756.1:ATP-binding protein locus_tag LOCUS_04290 CDS complement(644..2533) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250999.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(2585..2968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(2886..3536) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251001.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 3592..3819 product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251002.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 3884..4513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251102.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(4488..5555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 5657..5989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 6004..7050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 7047..7937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 7934..9640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 9645..10418 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249118.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 10415..10822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250538.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 10809..11477 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249116.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(11463..12854) product DUF2079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011012764.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 13034..14284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(14287..15993) product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251106.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene arcS CDS complement(15996..16901) product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251107.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 sequence018 source 1..16992 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(280..936) product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251181.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene radB CDS complement(939..1577) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251182.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 1732..2736 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249816.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 2953..3102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(3107..3952) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868801.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(3974..5041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(5016..6185) product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053635.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(6182..6487) product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868800.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(6529..7050) product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871083.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(7080..9827) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249966.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 10020..10613 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251083.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 10606..11175 product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251082.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(11184..11435) product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251081.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(11550..12701) product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251228.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(12804..14069) product bifunctional L-myo-inositol-1-phosphate cytidylyltransferase/CDP-L-myo-inositol myo-inositolphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868152.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 14169..14882 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867275.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(14907..15926) product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249634.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene gyaR CDS 16015..16845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 sequence019 source 1..16879 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 185..895 product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250338.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 888..1094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250339.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 1162..1947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 1944..2159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(2308..2934) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250354.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene tmk CDS complement(3028..3735) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250355.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(3746..4831) product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867600.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 4962..6011 product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249867.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene tdh CDS 6146..8014 product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250356.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 8091..8336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 8477..9661 product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251167.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 9769..10617 product DUF835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251166.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 10711..11421 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867428.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(11365..12111) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250224.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(12116..12373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 note possible pseudo, frameshifted CDS 12756..13436 product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251230.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 13433..13786 product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251233.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(13776..15272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868132.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(15281..16042) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868133.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 sequence020 source 1..16792 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(46..525) product PH1570 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250114.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(530..1540) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867714.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene sppA CDS 1602..2453 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867495.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 2514..2750 product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249927.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 2762..2935 product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249926.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(3124..4182) product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250141.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(4367..4618) product DUF504 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868176.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(4628..5317) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249269.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 5764..6060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 6067..6987 product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053897.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 7110..9227 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250000.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene metG CDS 9309..9689 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867195.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 9714..10004 product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250211.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 10185..10634 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053714.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 10724..11434 product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209477179.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 11447..11974 product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867975.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 12093..12377 product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868833.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 12381..12578 product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250050.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 12687..13514 product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250051.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 13511..13684 product RNA-protein complex protein Nop10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867970.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 13690..14472 product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867971.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 14521..15792 product TIGR00375 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249838.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(15793..16110) product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868474.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(16086..16472) product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868473.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 sequence021 source 1..16682 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1224..1592) product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251036.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(1582..2049) product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867848.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(2046..2321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251034.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(2318..2581) product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251033.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(2578..2928) product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251032.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene mnhG CDS complement(2925..3224) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146638.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(3221..3724) product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867852.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(4106..4531) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867840.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(4528..5517) product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053771.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(5514..6809) product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867842.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(6806..7330) product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867843.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(7327..7797) product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251039.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(7802..8149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053770.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(8151..9686) product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251037.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(9683..10045) product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251036.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(10042..10488) product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251035.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(10481..10777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251034.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(10774..11040) product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251033.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(11037..11402) product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251032.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene mnhG CDS complement(11399..11662) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251031.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(11659..12159) product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867852.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 12382..13749 product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251119.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 13810..14298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 14324..15628 product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251120.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 15716..16378 product DUF257 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209474667.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 sequence022 source 1..16622 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(232..1416) product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868478.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene porA CDS complement(1427..1744) product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250932.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene porD CDS complement(1800..2735) product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250931.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(2741..3913) product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250930.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(3923..4240) product 3-methyl-2-oxobutanoate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250929.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(4306..4863) product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868483.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 5122..6084 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250927.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(6081..7352) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250926.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene hflX CDS 7604..9229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250925.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 9308..9667 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250924.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(9668..10006) product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250923.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(10021..11337) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250513.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene hisS CDS complement(11385..11993) product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867324.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(12023..13477) product dolichyl-phosphate-mannose--protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209475414.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 13598..15475 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868458.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(15527..16252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088856129.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 sequence023 source 1..16475 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 349..1215 product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249729.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 1233..2069 product tyrosine recombinase XerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249728.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene xerA CDS complement(2071..3459) product ADP-specific phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249331.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene pfkC CDS complement(3666..4274) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249325.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 4384..5097 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249330.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 5234..6565 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250162.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 6697..8124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 8273..8656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 note possible pseudo, frameshifted CDS 8746..8985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 note possible pseudo, internal stop codon, frameshifted CDS 8985..9218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 note possible pseudo, frameshifted CDS complement(9225..10850) product DUF4932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146715.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 10953..11489 product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250601.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(11476..12405) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250600.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 12534..12857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(12847..13281) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228850.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(13354..14337) product cell wall-binding repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249097.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 tRNA complement(14571..14647) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(14791..15414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250858.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 tRNA 15493..15569 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 sequence024 source 1..16111 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 1996..2082 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 2104..2178 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 2230..2559 product methionine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867535.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene metG CDS 2560..3390 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene speB CDS 3395..4525 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251155.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene thrC CDS complement(4538..4978) product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147325.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(4985..6544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251151.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 6623..8044 product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251254.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(8041..9135) product TRM11 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248963.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 9315..10604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248964.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 10570..10878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 10875..11273 product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868534.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(11254..12270) product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251173.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(12236..13117) product DUF835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251174.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(13177..14103) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251175.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene moaA CDS complement(14165..14569) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868143.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 14787..15467 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249143.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 misc_feature complement(15464..>16111) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249142.1:gamma-glutamyl-gamma-aminobutyrate hydrolase family protein locus_tag LOCUS_05810 sequence025 source 1..15649 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1155 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250246.1:C1 family peptidase locus_tag LOCUS_05820 CDS 1262..2134 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147080.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 2149..2565 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147078.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 2605..2907 product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868107.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 2913..4073 product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250248.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 4113..5180 product DUF1464 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250249.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 5234..6556 product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250250.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene cdr CDS complement(6583..7410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251143.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(7411..7686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250941.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(7753..8931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250410.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(9221..10417) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867356.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 10647..11312 product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867364.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(11325..11786) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867840.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(11790..12755) product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939562.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(12752..13990) product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867842.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(13987..14535) product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867843.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(14532..14975) product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867844.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(14977..15318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05990 sequence026 source 1..15430 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(120..299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(284..1018) product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868346.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene mpgP CDS complement(1024..2208) product mannosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868345.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene mpgS CDS complement(2331..3728) product ADP-specific glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250061.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(3754..4320) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250062.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene pgiA CDS complement(4394..4975) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868689.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(4978..5157) product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250063.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(5218..5883) product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250064.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(5861..6745) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250065.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(6811..7650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(7705..8094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(8091..9068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 9311..10264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053704.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 10289..11206 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146981.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(11186..11761) product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250952.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene mobA CDS complement(11762..12886) product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250252.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(12883..13668) product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250526.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 13767..14213 product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867291.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(14421..14597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(14876..15406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 sequence027 source 1..15279 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(239..685) product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868432.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(691..1221) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251225.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(1211..1840) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251226.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene pyrF CDS complement(1852..2448) product DUF4443 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251227.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 2616..3698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(3691..5844) product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868544.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene topA CDS complement(5885..6769) product ADP-dependent ribose-1-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250979.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 6899..7741 product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251235.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(7821..8579) product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250149.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(8576..8920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 9020..9835 product GTP cyclohydrolase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249744.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(9824..10231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 note possible pseudo, frameshifted CDS complement(10221..10535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 note possible pseudo, frameshifted CDS 10664..12082 product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249650.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 12087..13412 product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249649.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(13434..13877) product COG2426 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249640.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(13894..14532) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209478368.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 14594..14920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 14869..15126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 sequence028 source 1..14787 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(385..717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251223.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(701..1474) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251222.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(1505..2725) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251221.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene ftsZ CDS complement(2747..2941) product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868406.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 3146..3568 product KEOPS complex subunit Cgi121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251219.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene cgi121 CDS 3710..4885 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868404.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 4901..5164 product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251217.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 5177..6379 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053896.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 6369..6692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251215.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 6851..7495 product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250638.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 note possible pseudo, frameshifted CDS 7467..7664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 note possible pseudo, frameshifted CDS 7661..7972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 7965..9080 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440658.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 9077..10132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(10145..10852) product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867475.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(10886..12304) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249895.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 12513..13367 product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250915.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 13358..13888 product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250914.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 13921..14421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868123.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 sequence029 source 1..14597 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 491..646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 739..1497 product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249272.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(1522..2112) product CPBP-Thermo-1 family intramembane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249394.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(2135..2956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(3018..4406) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250239.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 4502..5401 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249604.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene ftsY CDS complement(5398..5952) product archaeoflavoprotein AfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064401.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene afpA CDS 6014..6460 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249473.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(6493..7035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(7245..9902) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249476.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 10068..11123 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053650.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(11124..12293) product cell wall-binding repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867621.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 12709..13773 product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249511.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene mtnA CDS 13836..14513 product C2H2-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146961.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 sequence030 source 1..14326 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 78..755 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249260.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene pyrH CDS complement(758..1453) product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251184.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 1573..2547 product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250976.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 2556..3353 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250977.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 3340..4158 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250978.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 4169..4903 product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249885.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene mobB CDS complement(5030..5905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(5988..7199) product CGP-CTERM-anchored Cys-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868446.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 7318..8160 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867380.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(8161..8862) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251251.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 8939..9331 product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250426.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 9309..9881 product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146540.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 9874..10401 product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250130.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene cyaB CDS complement(10426..11040) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(11051..11863) product DUF4392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249434.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(11865..12551) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251191.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 12648..13070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249897.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 misc_feature complement(13138..>14326) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_158298054.1:Eco57I restriction-modification methylase domain-containing protein locus_tag LOCUS_06890 sequence031 source 1..14260 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(17..92) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 190..266 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA 274..351 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 358..434 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 545..754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 732..980 product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250035.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 1001..4357 product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867738.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 4363..7080 product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250033.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 7082..8272 product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867740.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene rpoA2 CDS 8287..8592 product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867741.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 8592..9029 product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250030.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 9040..9483 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250029.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 9488..10138 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250028.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene rpsG CDS 10365..12563 product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249264.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 13351..14244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 sequence032 source 1..13912 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 51..2138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(2159..2779) product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868332.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(2757..3443) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146909.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 3682..3927 product DUF131 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250763.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 3928..5109 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868335.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 5144..6298 product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250765.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene mfnA CDS complement(6288..6464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 note possible pseudo, frameshifted CDS complement(6478..7149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 note possible pseudo, frameshifted CDS 7423..7776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 7779..8528 product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867800.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 8554..9381 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251059.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(9382..9846) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868568.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(9828..10376) product DUF531 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868567.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 10511..10810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250975.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(11443..12342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(12354..12878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 13385..13900 product transcription factor E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868546.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene tfe sequence033 source 1..13778 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 93..710 product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867872.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene psmB CDS 729..2675 product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250379.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(2676..2999) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867180.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 3093..3878 product UbiA prenyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250275.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 3889..4812 product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249101.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 4790..5932 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250274.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 5982..6686 product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067911.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 6689..7336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868091.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 7388..8206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249099.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(8207..8773) product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249014.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene pgsA CDS complement(8783..9316) product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053622.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(9313..10920) product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249016.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 10975..11739 product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868692.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 11761..12321 product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868691.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(12324..13517) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249178.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 sequence034 source 1..13579 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 110..757 product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249977.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 note possible pseudo, internal stop codon, frameshifted CDS complement(975..1715) product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249661.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(1783..2601) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250112.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene folP CDS complement(2681..3562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250143.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 3704..7360 product reverse gyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868381.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene rgy CDS 7633..8427 product HTH-type transcriptional regulator TrmBL2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249426.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene trmBL2 CDS complement(8444..8680) product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146942.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(8677..8997) product Sjogren's syndrome/scleroderma autoantigen 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868383.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(9000..9728) product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249429.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 9797..10330 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146583.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 10647..11648 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249506.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 11658..12656 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868647.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 12668..13423 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249930.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 sequence035 source 1..13579 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(366..1556) product TIGR00529 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867137.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 1787..4987 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250699.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene ileS CDS 5078..5257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 5257..6372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249598.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(6661..7884) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083141.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(7877..9703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(9700..10392) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878518.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 10516..11355 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250984.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(11568..13256) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251012.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 sequence036 source 1..13544 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(204..821) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249198.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene hisG CDS complement(821..1708) product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053641.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(1937..2713) product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249891.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(2718..3692) product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249890.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 tRNA 3772..3849 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(3901..4905) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250578.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(4902..5756) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250577.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 5927..6382 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250202.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 6413..7849 product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250203.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 7846..8127 product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868697.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 8108..8710 product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250205.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(8740..10017) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249937.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(10053..10796) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867271.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 10892..11740 product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249940.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene fba sequence037 source 1..13457 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1250..2200) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251108.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene arcC CDS 2412..2948 product DUF3201 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251071.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 2950..4104 product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868893.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 4104..5108 product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868892.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 5154..5990 product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868033.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(5987..6967) product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251076.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 7104..9065 product glyceraldehyde-3-phosphate:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251113.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene gor CDS 9216..9893 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251079.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene tpiA CDS complement(9962..10927) product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250772.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 11054..11791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250775.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(11788..12276) product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146511.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(12291..13433) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250771.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 sequence038 source 1..13404 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(271..1551) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250842.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(1600..2373) product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250846.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(2822..3172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(3163..4104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 4335..5057 product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867248.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 5067..5447 product DUF473 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867249.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(5444..6199) product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250849.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene nucS CDS 6282..7475 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250985.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene gcvT CDS complement(7479..8342) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250986.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 8433..9191 product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249636.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene cobB CDS 9188..9583 product DUF3783 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250025.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 9618..10349 product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867638.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 10309..10875 product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867637.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 11177..11434 product 50S ribosomal protein L35ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867507.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 11489..12619 product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146544.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(12611..13186) product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249797.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 sequence039 source 1..13368 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 53..493 product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249956.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene pfdA CDS complement(494..1189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(1119..1334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(1358..2281) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249955.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(2419..2829) product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868486.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(2831..3988) product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249135.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(3999..5051) product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249136.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 5214..5882 product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249137.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(5922..6602) product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867184.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(6608..7864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867185.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 8024..9067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 9073..9579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(9576..10541) product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249140.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 10795..12042 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249141.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(12054..12764) product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883498.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 sequence040 source 1..12758 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(934..1290) product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251250.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene pth2 CDS complement(1345..3396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867938.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(3469..4785) product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249447.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene aspS CDS complement(4791..5288) product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868454.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 tRNA 5540..5617 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 5627..5704 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(5730..6731) product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879767.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene amrS CDS complement(6753..8741) product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011011610.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 8844..10394 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250508.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 10443..11777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(11764..12492) product DUF2110 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250973.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 sequence041 source 1..12697 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 154..522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08200 note possible pseudo, frameshifted CDS 562..2307 product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249711.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene tgtA CDS 2340..3863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248987.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 4099..4839 product metallophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250443.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(4819..5043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 5158..5442 product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250146.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 5452..5841 product DUF555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250145.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(5860..6756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 6874..8466 product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250144.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene pyrG CDS complement(8481..9377) product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053775.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(9458..12154) product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868798.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 misc_feature complement(12151..>12697) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868797.1:hydrophobe/amphiphile efflux-3 (HAE3) family transporter locus_tag LOCUS_08310 sequence042 source 1..12687 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 157..738 product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251194.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 827..1738 product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251195.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(1799..3094) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062387703.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 3306..4223 product isoaspartyl peptidase/L-asparaginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251196.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 4228..5388 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867337.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 5420..6547 product tRNA (guanine(9)-/adenine(9)-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249377.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene trm10 CDS complement(6567..7463) product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250134.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene map CDS 7651..9096 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249505.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene proS CDS 9199..10719 product dihydropteroate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249274.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 10771..12069 product 2,3-phosphoglycerate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249990.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 12062..12451 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248958.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 sequence043 source 1..12571 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(244..669) product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250572.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(681..6767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(6865..7359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250570.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(7509..8552) product lysyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250128.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(8616..9614) product TIGR01177 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249932.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 9704..10933 product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250018.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(10954..11955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 sequence044 source 1..12371 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(553..2799) product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932519.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(2796..3506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(3520..4581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 4709..6097 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774915.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 6107..7051 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257890.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 7048..7896 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 7896..8969 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867305.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene ugpC CDS 8981..9994 product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868244.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(9985..11580) product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249504.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 sequence045 source 1..12370 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(182..832) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868159.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(1023..1586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868493.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(1614..2360) product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249490.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(2363..2533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146988.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(2565..2897) product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868495.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(3090..4361) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249483.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(4545..4991) product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251016.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(4988..5416) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251017.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(5397..5606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251018.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(5658..6311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 note possible pseudo, frameshifted CDS complement(6200..6937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 note possible pseudo, frameshifted CDS complement(6937..7722) product NADPH-dependent hydrogenase/sulfhydrogenase 1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251020.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene hydD CDS complement(7733..8584) product NADPH-dependent hydrogenase/sulfhydrogenase 1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867990.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene hydG CDS complement(8581..9684) product NADPH-dependent hydrogenase/sulfhydrogenase 1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251022.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene hydB CDS 10072..11064 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251029.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 sequence046 source 1..11961 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 471..1526 product DUF835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251137.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(1527..2354) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250696.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 2471..2995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 3001..4875 product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545213.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 4933..5265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(5448..5615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 5786..6049 product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251068.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene moaD CDS 6051..6185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08810 note possible pseudo, internal stop codon CDS 6240..6749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 note possible pseudo, internal stop codon CDS 6761..7339 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053782.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 7483..8319 product DUF835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251166.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 8337..10331 product IGHMBP2 family helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249133.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 10319..10900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251141.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 11079..11330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 note possible pseudo, frameshifted misc_feature complement(11327..>11961) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251135.1:phosphoglucosamine mutase locus_tag LOCUS_08880 sequence047 source 1..11960 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 866..1765 product UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251204.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(1707..2477) product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251203.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene cas6 CDS 2695..3894 product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146504.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 4260..5171 product serine/threonine-protein kinase RIO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251200.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 5217..5717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053787.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(5700..6647) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251198.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 6740..7570 product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250430.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene udp tRNA complement(7865..7952) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(8013..8579) product DUF366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251187.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(8579..9052) product magnesium-dependent phosphatase-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251186.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(9066..10550) product DUF2139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251098.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(10611..11324) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251213.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene queC misc_feature complement(11329..>11960) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048053788.1:dihydroorotate dehydrogenase locus_tag LOCUS_09000 sequence048 source 1..11908 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 11..86 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(96..1361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(1444..2316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(2378..3724) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250240.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(3947..6298) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250243.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene ppsA CDS complement(6456..7853) product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867220.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(7835..8908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(8898..9884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867218.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(9881..10543) product TrmB family transcriptional regulator sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867217.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 sequence049 source 1..11802 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(376..1821) product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598693.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene gltA CDS complement(1818..2690) product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250277.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(2857..3618) product tRNA (adenine(57)-N(1)/adenine(58)-N(1))-methyltransferase TrmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867553.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene trmI CDS complement(3624..4241) product DUF257 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867552.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 4315..4623 product signal recognition particle protein Srp19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146554.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(4624..4866) product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867550.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 5208..7373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 7512..8513 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867867.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 8525..9682 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867866.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 9675..10652 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146644.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 10663..11637 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867864.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 sequence050 source 1..11567 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2173..3399 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868871.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 3380..4129 product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868872.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(4092..4784) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249281.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(5914..6972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598721.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 7259..8164 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250758.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 8187..9014 product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868874.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(9007..10221) product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250558.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(10426..11100) product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251010.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 sequence051 source 1..11240 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(843..1052) product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250260.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(1049..1258) product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250261.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(1316..1687) product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053845.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene rpl7ae CDS 1827..2381 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249905.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(2392..3903) product AMP phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249307.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(3999..4238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(4332..4577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(4577..5356) product cell division ATPase MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867687.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene minD CDS complement(5659..6468) product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867773.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(6468..7799) product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867774.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 7907..8197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146769.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 8202..9014 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249300.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 9018..9344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249297.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 9322..9714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249294.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(9759..10241) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147315.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 misc_feature complement(10266..>11240) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250097.1:phosphoglycerate kinase locus_tag LOCUS_09430 sequence052 source 1..11157 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(244..2490) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146523.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 2605..3207 product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868137.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 3238..3420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 3571..3975 product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867887.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(3993..4736) product tungstate ABC transporter permease WtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867277.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene wtpB CDS complement(4833..5882) product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248970.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene wtpA CDS complement(5963..6853) product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052273639.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(6927..7166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249974.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 tRNA 7866..7953 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(7974..8750) product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251208.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(8756..9130) product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251209.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 9223..9744 product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251207.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(9741..10106) product DUF2304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251206.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 misc_feature complement(10112..>11157) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251205.1:HAD-IA family hydrolase locus_tag LOCUS_09560 sequence053 source 1..10945 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 499..1656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 1815..2774 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249654.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 2891..3121 product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868182.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 3121..5136 product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868183.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene feoB CDS 5153..5410 product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249907.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 5499..6740 product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868078.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 6801..7154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250521.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(7139..8059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(8060..8371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(8579..9370) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869320.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene proC CDS complement(9385..10392) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250394.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene asd misc_feature complement(10392..>10945) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868155.1:threonine synthase locus_tag LOCUS_09680 sequence054 source 1..10868 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 428..985 product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249857.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(956..1483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(1480..2118) product DUF120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868498.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 2218..3438 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250179.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(3567..4700) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250181.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene wecB CDS complement(4697..5983) product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062390429.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 6270..7349 product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250183.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(7350..7910) product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867670.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(7913..8188) product lipoate protein ligase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146571.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 8279..10168 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250186.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 repeat_region 10635..10864 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttccaataagactcttggagaattgaaat sequence055 source 1..10789 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 511..1071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250192.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 1068..1304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 1371..2618 product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250190.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene prf1 CDS complement(2598..3485) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250188.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(3542..4864) product biotin--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053663.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 5138..5992 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251185.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(6013..6489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250158.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(6523..7551) product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250232.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene fen CDS 7731..9119 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249616.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 9193..9891 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249618.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(9903..10208) product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249619.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 sequence056 source 1..10723 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 116..1519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979925.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(1597..1842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(1852..2466) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868634.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(2438..2776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868635.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(2879..3418) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868289.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene cysC CDS complement(3455..3670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(3775..5181) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249252.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(5251..6582) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249166.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene purF CDS 6736..7431 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249165.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(7531..8535) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249163.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene purM CDS 8934..10598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 sequence057 source 1..10526 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(782..1744) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868614.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(1754..2074) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868615.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 2437..3168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867544.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(3165..4409) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249709.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 4643..5935 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249710.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene asnS CDS complement(6055..7347) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251056.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene eno CDS 7465..8121 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene deoC CDS 8118..8405 product family 4B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598724.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(8410..9021) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251052.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(9128..10465) product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251051.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 sequence058 source 1..10513 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(465..1031) product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249087.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 1150..1524 product DUF356 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249084.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(1532..2062) product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146952.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 2169..2636 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249080.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 2720..3739 product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868713.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 tRNA 3803..3880 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 4189..4854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867544.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(5016..6128) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270496.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 tRNA complement(6168..6245) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA 6350..6437 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(6774..7529) product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867402.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(7532..8338) product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867401.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 8433..9473 product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249740.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 9500..9928 product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867807.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 sequence059 source 1..10491 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1611 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867901.1:NEW3 domain-containing protein locus_tag LOCUS_10220 CDS 1613..2596 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867900.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(2635..5520) product intein-containing RctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870187.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(5671..6144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868124.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(6075..6980) product tRNA (cytosine(49)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249315.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(6990..7415) product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867748.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 7472..8329 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249318.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene panB CDS complement(8326..9168) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146703.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(9161..9487) product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250731.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 tRNA complement(9532..9619) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(9637..9945) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867802.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene rpsJ sequence060 source 1..10294 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 302..1498 product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250233.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 1508..2158 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249502.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(2262..4211) product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867817.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene rqcH CDS complement(4192..5538) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251170.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(5674..7131) product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251169.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(7145..8122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 8247..8924 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249763.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 8942..9721 product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876426.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 sequence061 source 1..10186 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(107..301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 336..2246 product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249735.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(2273..4291) product CGP-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249529.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(4447..5052) product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867942.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(5081..6145) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(6156..7997) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249526.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(8099..9643) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249525.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 sequence062 source 1..10175 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1088..1387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 2029..2976 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene argF CDS complement(2993..3700) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147220.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(3741..4646) product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250507.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 4743..5342 product regulator of amino acid metabolism, contains ACT domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147148.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(5326..5601) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(5898..8210) product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250947.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene hypF CDS 8374..8685 product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868105.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene cutA CDS 8695..9276 product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146478.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 9273..9968 product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061278.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 sequence063 source 1..10144 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(403..1101) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249730.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene sfsA CDS 1189..2235 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249732.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(2278..2505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146969.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 tRNA 2608..2685 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 2785..4281 product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250791.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 4478..4714 product antitoxin VapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146550.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 4687..5058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(5063..5389) product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868731.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(5399..6511) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250787.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 6576..7178 product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250786.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene pcp CDS complement(7153..7455) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250777.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(7460..8071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250776.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(8136..8936) product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250433.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene mtnP sequence064 source 1..10099 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(464..1468) product phosphorylating glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249716.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(1551..3215) product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249629.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene thsB CDS 3421..4086 product Kae1-associated kinase Bud32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249630.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 4100..4657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(4673..6361) product DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249633.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(6358..6822) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249309.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene moaC CDS 6910..7239 product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250876.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 7317..8279 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867900.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 8284..9204 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867902.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 sequence065 source 1..10088 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(206..433) product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250273.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene rpl18a CDS complement(439..1125) product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868639.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(1154..1426) product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868638.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(1433..1588) product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250270.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(1751..2419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(2730..3803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(3796..4713) product DUF4855 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249397.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(4886..5479) product asparagine synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053718.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(5482..5820) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146744.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(6002..6454) product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250227.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(6458..6871) product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250226.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(6906..7274) product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248986.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(7298..8143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 note possible pseudo, frameshifted CDS complement(8106..9092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 note possible pseudo, frameshifted CDS complement(9339..9857) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250258.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene ndk sequence066 source 1..9985 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 282..359 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(814..1299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(1521..2669) product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249334.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(2695..3495) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251246.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 3568..5205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 5312..5890 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053721.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 5900..6250 product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250070.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 6330..7118 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249754.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 7115..7939 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249755.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 8005..8808 product diadenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249465.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(8872..9150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053674.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(9162..9809) product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249615.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 sequence067 source 1..9893 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(44..496) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250236.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 602..1765 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250237.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(1758..2198) product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598730.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 2389..2568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249069.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 2565..4181 product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249070.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 4304..5752 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249074.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 5745..6251 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867435.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 6248..6529 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249076.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 6519..7670 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249077.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 7713..9056 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582603.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 9149..9559 product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249883.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene tnpA sequence068 source 1..9759 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..546 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250841.1:[protein ADP-ribosylglutamate] hydrolase locus_tag LOCUS_11150 CDS 559..981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 1014..2456 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250837.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(2524..3093) product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250834.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(3100..3405) product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250833.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(3432..4016) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250832.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(4082..4756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868679.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(4786..6471) product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053886.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(6601..7527) product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251091.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(7532..8494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(8415..9353) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842263.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 sequence069 source 1..9543 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 334..942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249130.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 1024..1197 product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088862262.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 1208..1483 product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867152.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(1489..2499) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251247.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(2601..2810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251086.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 2893..4200 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053885.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene rlmD CDS 4268..4696 product HTH-type transcriptional regulator LrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867694.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene lrpA tRNA 4838..4915 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(4920..5336) product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146774.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 5465..6211 product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249603.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(6155..6766) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250285.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(6800..8962) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868004.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 sequence070 source 1..9524 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(107..418) product V-type ATP synthase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147203.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(528..1556) product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250429.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(1738..2430) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868887.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(2435..3949) product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868888.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(3946..4800) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250544.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 4959..6050 product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 6052..7350 product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250913.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 7420..7842 product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868894.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene speD CDS complement(7843..8262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(8275..9000) product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250541.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 tRNA 9157..9232 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 sequence071 source 1..9285 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1488..2312) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249850.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene rsmA CDS complement(2322..2939) product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867500.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(3018..3383) product DNA-directed RNA polymerase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868224.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(3390..3683) product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249853.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(3640..4842) product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249854.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 4886..5188 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249855.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 5321..6640 product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249859.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene gatD CDS 6646..8523 product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249862.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene gatE sequence072 source 1..9091 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..587 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249801.1:RNA-guided endonuclease TnpB family protein locus_tag LOCUS_11550 CDS 774..1367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(1369..2580) product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249865.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene hmgA CDS complement(2601..3368) product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249866.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(3534..3782) product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146864.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 3929..4336 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867231.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 4342..5862 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146486.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(5863..6009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 6240..7010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868476.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 sequence073 source 1..8848 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 318..1187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(1405..2547) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249758.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 2745..3335 product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250120.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 3339..3971 product DUF2067 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867176.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 3961..4248 product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867175.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 4285..4671 product ribonuclease III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053838.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(4673..5482) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250116.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(5525..7006) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250133.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(7097..7330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053807.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 7435..7974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053664.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 misc_feature complement(7958..>8848) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251252.1:tRNA pseudouridine(13) synthase TruD locus_tag LOCUS_11740 sequence074 source 1..8539 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 368..1009 product DUF432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250891.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 1012..2100 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250890.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(2116..4716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 5213..6028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(6017..6220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(6286..6918) product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250883.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(6915..7307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(7320..8351) product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250878.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene dph2 sequence075 source 1..8502 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 411..830 product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251243.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 901..1896 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249612.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(1893..3167) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250287.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(3168..3908) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250288.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(3889..4071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(4073..4270) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250290.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(4271..4561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(4562..4942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(5044..6309) product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251014.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 6412..7575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250381.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 7585..8379 product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249061.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene dph5 sequence076 source 1..8488 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 87..395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 425..988 product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249693.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(999..1421) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868380.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 1477..2013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249519.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(2025..2456) product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201060.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(2527..2985) product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249518.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(3036..3176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 3293..3592 product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249517.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(3581..4018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 note possible pseudo, frameshifted CDS complement(4707..5495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(5553..6440) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867986.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(6443..7306) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867985.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(7341..8393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 sequence077 source 1..8403 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 75..1208 product tungsten cofactor oxidoreductase radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755814.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(1236..1634) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146785.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 1773..2954 product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065687.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 2951..4285 product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146783.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 4290..5366 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146519.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 5483..5686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(5860..6270) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250962.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 6408..7121 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081657.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 7118..8068 product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081655.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(8097..8315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 sequence078 source 1..8376 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 287..490 product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146862.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(487..1248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(1245..1628) product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146588.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(1570..2877) product DUF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249748.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(2874..4019) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249749.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(4016..5704) product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249750.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene top6B CDS complement(5725..6345) product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867717.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(6332..7123) product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867716.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(7132..7509) product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146587.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene eif1A CDS 7657..7947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(7951..8334) product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249910.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 sequence079 source 1..8313 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(136..1257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(1316..1435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(1960..2727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(2908..3687) product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250424.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(3684..4688) product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250425.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(4742..5614) product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250428.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(5693..6298) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250447.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene rpsB CDS complement(6305..7336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250448.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(7347..7523) product DNA-directed RNA polymerase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867659.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 tRNA complement(7545..7622) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(7641..7835) product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867658.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 sequence080 source 1..8272 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(84..1769) product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250100.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(1874..4027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250101.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(4030..4818) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088854783.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(4811..5749) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250103.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 6042..6371 product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084207606.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 6340..6984 product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868343.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 tRNA complement(7085..7162) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 misc_feature complement(7265..>8272) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249503.1:pyridoxal phosphate-dependent aminotransferase locus_tag LOCUS_12440 sequence081 source 1..8140 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..576 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011761882.1:undecaprenyl-diphosphate phosphatase locus_tag LOCUS_12450 CDS 573..1829 product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250139.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 1832..2965 product DUF835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250138.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(2941..4050) product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250950.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene hypD CDS complement(4053..4277) product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868354.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(4361..5530) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868558.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(5721..6032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 tRNA 6582..6668 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(6677..6898) product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249884.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 6967..7806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249881.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 sequence082 source 1..7954 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..920 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250732.1:M20 family metallo-hydrolase locus_tag LOCUS_12540 CDS 1291..2571 product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250733.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 2618..3361 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250735.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(3375..3608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(3618..4619) product acetoin:2,6-dichlorophenolindophenol oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198892.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene acoB CDS complement(4621..5625) product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene pdhA CDS complement(5692..6132) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867668.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(6138..6446) product DUF6506 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966779.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(6479..6598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(6633..7616) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(7604..7954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 sequence083 source 1..7863 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(246..1121) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249565.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 1350..2426 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867726.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(2476..3204) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851426.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 3337..4362 product DUF3226 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249064.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(4592..6913) product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868838.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(6986..7798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 sequence084 source 1..7855 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 505..726 product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020854.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 727..1371 product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020851.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(1374..2648) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867692.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(2612..3136) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867691.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 3487..3903 product hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250958.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene hypA CDS 3900..4655 product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250957.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 4672..5166 product hydrogenase 3 maturation endopeptidase HyCI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250954.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(5143..5862) product electron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250160.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(5934..6509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 misc_feature complement(6584..>7855) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048147345.1:ATP-dependent protease LonB locus_tag LOCUS_12800 sequence085 source 1..7747 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(634..969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(966..1514) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250005.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 1600..1728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 1845..2147 product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867536.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(2515..2838) product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249482.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(2900..3454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(3454..4077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(4070..4672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(4669..5349) product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249999.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(5549..5896) product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146718.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(5906..6049) product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249479.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(6146..6661) product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064432.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(6735..7115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(7142..7675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 sequence086 source 1..7723 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1032 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249801.1:RNA-guided endonuclease TnpB family protein locus_tag LOCUS_12950 CDS complement(1022..1417) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053361.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(1414..2088) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392690.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(2089..2370) product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393974.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(2398..3702) product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146906.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene rbcL CDS 4006..4209 product archaeal histone HpkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251239.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene hpkB CDS complement(4244..4759) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251238.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(4764..5327) product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868739.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 5384..5698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248968.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 5701..6246 product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248969.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 sequence087 source 1..7616 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(564..3941) product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250804.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(3883..4944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868506.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(4955..6379) product DUF515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146991.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 6471..6806 product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250807.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 sequence088 source 1..7551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1192..2223 product DUF5305 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250652.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 2282..3052 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250894.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 3052..3720 product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250893.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(3780..4073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 4297..4989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(4967..5236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 5235..6119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048151087.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 sequence089 source 1..7496 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 352..1635 product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867911.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 1641..2339 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867910.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene upp CDS 2507..2986 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867179.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(2983..4053) product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146675.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 4286..4579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 4651..5298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249695.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(5343..6098) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249696.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(6095..6889) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249697.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 sequence090 source 1..7461 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1296..2120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 2107..2532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 2529..3482 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 3503..4738 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250796.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 4735..5160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 5194..5841 product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250917.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 5843..6757 product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 misc_feature complement(6800..>7461) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251109.1:NAD(P)/FAD-dependent oxidoreductase locus_tag LOCUS_13310 sequence091 source 1..7384 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 247..1386 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250022.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 1412..2176 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868110.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 2209..2400 product antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249290.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 2387..2764 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249289.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 2769..3446 product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868109.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene pxpB CDS 3443..3898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 note possible pseudo, frameshifted CDS 3880..4431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 note possible pseudo, frameshifted CDS 4606..5724 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958343.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(5729..6856) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249523.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 sequence092 source 1..7283 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..705 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249982.1:ribosome biogenesis/translation initiation ATPase RLI locus_tag LOCUS_13410 CDS 767..1384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 1359..1718 product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868701.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(1715..2551) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055428724.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(2570..3772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250410.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 3973..4800 product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598716.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(4797..6341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250127.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(6331..6738) product Holliday junction resolvase Hjc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250126.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene hjc CDS 6841..7245 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146698.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene gcvH sequence093 source 1..7271 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2824..3039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250658.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 3039..3491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250657.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 3605..4189 product DUF1102 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879573.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 4186..4722 product DUF1102 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879572.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 4797..5297 product DUF1102 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879572.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 5294..6367 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868600.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 sequence094 source 1..7248 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(385..1347) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867172.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(1347..1688) product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(1681..1977) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173559.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(1993..2871) product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249814.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene cbiB CDS complement(2871..3605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 3648..3896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249813.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 3893..4534 product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867728.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 4602..5084 product alpha-ribazole phosphatase CobZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249809.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene cobZ CDS 5222..5908 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867168.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene cobS sequence095 source 1..7168 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(8..1399) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868417.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 1983..2882 product 2-phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249989.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 2879..3370 product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(3497..4132) product DUF257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250559.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(4355..5092) product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249821.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene thyX CDS complement(5222..5908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(6042..6425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 note possible pseudo, frameshifted CDS complement(6394..6660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 note possible pseudo, frameshifted sequence096 source 1..7085 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 341..670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 note possible pseudo, frameshifted CDS complement(667..1116) product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867538.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(1113..1781) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146553.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(1786..2871) product DUF4157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251156.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(2908..3510) product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251157.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene psmB CDS complement(3700..4242) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867368.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(4305..4967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(5083..5358) product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249515.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene albA CDS 5561..6916 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249516.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene purB sequence097 source 1..7060 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(385..867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(1022..2392) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250059.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene glmM CDS complement(2408..2794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(2796..4178) product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868347.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(4506..5348) product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966201.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 5417..6451 product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880717.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 sequence098 source 1..7042 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(642..1271) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249568.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(1320..1469) product DNA-directed RNA polymerase subunit P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249567.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(1498..1776) product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249566.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(2027..2836) product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250584.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene rrp42 CDS complement(2840..3580) product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867734.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene rrp41 CDS complement(3564..4337) product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250586.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene rrp4 CDS complement(4334..5044) product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867732.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(5055..5840) product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867731.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene psmA CDS complement(5951..6313) product ribonuclease P protein component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250718.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 sequence099 source 1..6976 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(302..502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 780..1028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250157.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(1009..1182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(1351..1824) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147291.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 1995..2717 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868772.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 2728..3504 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024284.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(3501..4928) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868526.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene pyk CDS 5027..5227 product TIGR04140 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250774.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(5224..5391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(5435..5572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(5575..6621) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868238.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 sequence100 source 1..6919 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 272..514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 511..1095 product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250047.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 1299..2927 product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867141.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene thsB CDS complement(3046..3276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068578131.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 3565..5022 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249149.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene guaB CDS 5095..6516 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867139.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene ppcA sequence101 source 1..6828 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(18..752) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249698.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 849..1370 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867279.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(1408..1926) product molybdopterin-guanine dinucleotide biosynthesis protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249700.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 2237..3490 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053195.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(3582..5489) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249703.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 5673..6647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878943.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 sequence102 source 1..6820 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 405..2267 product tungsten-containing formaldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868317.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene for CDS 2431..2661 product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146579.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(2674..3420) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250970.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(3417..4457) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869579.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(4466..5578) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868127.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(5575..6261) product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868126.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 6400..6801 product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250966.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 sequence103 source 1..6664 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 13..144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(478..1134) product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249969.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(1097..1483) product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(1480..1779) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259332.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(1796..5332) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053701.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene smc CDS complement(5434..6291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14320 sequence104 source 1..6522 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(171..1988) product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250017.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene aor CDS complement(2123..4180) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146750.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(4182..4529) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868054.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(4600..5394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 5288..5563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(5696..6175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 sequence105 source 1..6346 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(207..3092) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250412.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene leuS CDS 3293..4891 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868194.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(4877..5959) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250406.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 sequence106 source 1..6282 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(115..1866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250219.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 1982..3445 product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250220.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(3442..3651) product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250221.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 3838..4338 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867730.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 4386..5432 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249713.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 5801..6280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14470 note possible pseudo, frameshifted sequence107 source 1..6194 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 153..335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 625..1062 product CGGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870086.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 1174..2442 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249958.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(2429..3247) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249686.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 3438..4208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251176.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 4162..5598 product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146488.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 sequence108 source 1..6185 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(8..361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 855..1250 product UPF0146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250727.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 1386..2738 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250728.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene glmM CDS complement(2740..3552) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250729.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 3853..5739 product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250730.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 sequence109 source 1..6003 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 300..1352 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393776.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(1369..2538) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250510.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 2839..4032 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249461.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(4007..4528) product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249462.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene cyaB CDS complement(4529..5011) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868086.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(4989..5546) product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868085.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 sequence110 source 1..5941 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..707 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868164.1:phosphate ABC transporter permease subunit PstC locus_tag LOCUS_14650 CDS 694..1527 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868165.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene pstA CDS 1524..2288 product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146811.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 2285..2887 product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250821.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(3056..4207) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250825.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 4383..4802 product Tfx family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251101.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(4782..5456) product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251100.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(5449..5793) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251099.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 sequence111 source 1..5941 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(458..3118) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250225.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(3132..3338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 3256..5298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 5386..5823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 sequence112 source 1..5909 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..644 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868255.1:MFS transporter locus_tag LOCUS_14770 CDS 666..1316 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867952.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(1311..1649) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249458.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 1796..3166 product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146589.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 3172..4497 product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249454.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(4502..4651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 4767..5183 product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250390.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene nikR tRNA 5228..5304 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 sequence113 source 1..5775 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 712..2457 product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036303.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 2468..2980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 3035..3604 product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250689.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene thpR CDS complement(3581..4870) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868644.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 5023..5340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14880 note possible pseudo, frameshifted sequence114 source 1..5524 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(809..1012) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250038.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(1032..1727) product transcriptional regulator SurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250037.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene surR CDS 1870..2544 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250036.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(2578..3588) product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249622.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 3734..4183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867816.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 4358..5158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 sequence115 source 1..5428 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..725 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966125.1:ribosomal protein S18-alanine N-acetyltransferase locus_tag LOCUS_14950 CDS 967..1821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020615.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(1797..2099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(2433..2564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 2721..4118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 4128..5054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15000 sequence116 source 1..5418 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 765..2120 product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250331.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene gcvPA CDS 2113..3612 product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868896.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene gcvPB CDS 3709..4596 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582485.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 sequence117 source 1..5415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 143..2200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 2214..3371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 3387..3569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 3571..5379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 sequence118 source 1..5392 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1150..1650 product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868645.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 1670..2860 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249496.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(2876..3946) product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249915.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(4040..5167) product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868007.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(5174..5365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 sequence119 source 1..5328 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 21..98 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(130..594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 note possible pseudo, frameshifted CDS 686..1195 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868792.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene rimI CDS 1205..1717 product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868793.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene endA CDS complement(1714..2376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146928.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(2379..2672) product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868360.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(2662..3654) product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249945.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(3664..3933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249944.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 misc_feature complement(4140..>5328) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868362.1:carbon starvation protein A locus_tag LOCUS_15200 sequence120 source 1..5293 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(244..1014) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250096.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(1019..1993) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867784.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(1986..2450) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250094.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 2640..3248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 3296..3727 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250093.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 3693..4433 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250092.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(4430..4993) product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250407.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 sequence121 source 1..5272 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(729..1007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(1170..1892) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868387.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(1885..2892) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868388.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 2979..4247 product acyl-CoA--6-aminopenicillanic acid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332932.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 4298..5026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15320 sequence122 source 1..5270 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 23..1999 product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250548.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 2014..2499 product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250549.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 2533..3144 product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250550.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 3150..4262 product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868882.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 4259..4567 product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868881.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 sequence123 source 1..5183 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1960..2784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249845.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(2784..3833) product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene amrS CDS complement(3844..4290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(4275..4487) product antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867995.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 misc_feature complement(4552..>5183) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249643.1:ABC transporter permease locus_tag LOCUS_15420 sequence124 source 1..5153 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 324..656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868635.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 625..1230 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868634.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 1223..4171 product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879204.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 4162..4830 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879203.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 sequence125 source 1..5141 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 230..439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 559..1710 product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199088.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene dgoD CDS complement(1713..2708) product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030183075.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 2792..3559 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 3678..4331 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene eda sequence126 source 1..5085 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 331..1167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 1219..1890 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870305.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 1887..2423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 2416..3468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 3465..4601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 sequence127 source 1..5039 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..599 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868584.1:proton-conducting transporter membrane subunit locus_tag LOCUS_15570 CDS complement(689..1504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811766.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 1875..2834 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158098.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 2836..3930 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496669.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene thiI CDS 3966..4487 product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250949.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 4700..4894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15620 sequence128 source 1..4996 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 152..1000 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879265.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 1006..1983 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879266.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 1976..2968 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879267.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(2953..3417) product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868429.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS 3622..4350 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249243.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 4608..4739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 sequence129 source 1..4985 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1586 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249997.1:DNRLRE domain-containing protein locus_tag LOCUS_15690 CDS 1737..3164 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249399.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene cysS CDS complement(3237..3449) product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251015.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(3613..4890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 sequence130 source 1..4975 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 141..599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(710..892) product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146944.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 999..1559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250197.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(1575..2807) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250198.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(2851..3243) product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250199.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(3254..4414) product aconitase X catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250200.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 tRNA 4525..4602 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(4597..4944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 sequence131 source 1..4871 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(43..1302) product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene gdhA CDS 1712..2227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 2224..2499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 2501..2731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(2728..3177) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249832.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(3180..4460) product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249831.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 sequence132 source 1..4865 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(204..452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146592.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(510..1244) product L-serine kinase SerK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249333.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene serK CDS 1419..2801 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249879.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(2788..3588) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249878.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene truA CDS complement(3970..4383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 sequence133 source 1..4769 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 310..756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(764..1435) product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249156.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene purQ CDS complement(1437..1682) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147194.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene purS CDS complement(1693..2829) product formate--phosphoribosylaminoimidazolecarboxamide ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249158.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(2831..4126) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249159.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene purD CDS 4233..4664 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870121.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene purE sequence134 source 1..4738 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(336..563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(646..1212) product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249145.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(1209..1646) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249146.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(1648..1839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(1892..2815) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249148.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene guaA CDS complement(2869..3870) product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147266.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(3937..4353) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146813.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(4350..4577) product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146815.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 sequence135 source 1..4717 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..986 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250732.1:M20 family metallo-hydrolase locus_tag LOCUS_16050 CDS 989..1696 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391583.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 1698..2225 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964727.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 2194..2493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 2528..2953 product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249707.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(2988..3554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 misc_feature complement(3683..>4717) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389386.1:Stk1 family PASTA domain-containing Ser/Thr kinase locus_tag LOCUS_16110 sequence136 source 1..4685 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(129..317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146562.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(473..1375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147069.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 1539..2573 product tungstate ABC transporter ATP-binding protein WtpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867278.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene wtpC CDS 2669..3793 product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053677.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(3790..4434) product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867232.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 sequence137 source 1..4674 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1261..2193) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868720.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(2171..3211) product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868721.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(3204..4661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16190 sequence138 source 1..4504 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(524..1111) product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053779.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene udg CDS complement(1080..1469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867810.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 1639..3384 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251095.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 3397..3678 product DUF3213 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146619.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(3675..3896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(4005..4229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 sequence139 source 1..4373 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 131..466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 471..1151 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250377.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene rpiA CDS 1203..1373 product preprotein translocase subunit Sec61beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250902.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(1508..2167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146525.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 2391..2963 product GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250904.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene engB CDS complement(2967..4037) product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146514.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene radA sequence140 source 1..4356 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(948..1583) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251025.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(1661..2683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(2779..3333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 sequence141 source 1..4327 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(209..436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(632..1459) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249998.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(1464..2222) product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868711.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 sequence142 source 1..4274 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(146..1459) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249801.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(1456..1611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(1708..1878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(2008..2172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(2257..2814) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene rfbC CDS complement(2825..3271) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877824.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(3268..3450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(3581..3982) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868296.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(3983..4186) product DUF2281 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868295.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 sequence143 source 1..4254 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 312..1313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 1462..2181 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017120.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 2300..2884 product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867981.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 2959..3405 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250402.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 3402..4034 product Ribonuclease P protein component 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250401.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(4031..4210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 sequence144 source 1..4229 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 881..1426 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249493.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 1438..2739 product tRNA(Ile2) 2-agmatinylcytidine synthetase TiaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249508.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene tiaS CDS 2892..3290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 3331..4083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16560 sequence145 source 1..4119 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 299..1177 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015758.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 1178..1738 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925129.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 1728..2492 product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS 2527..3840 product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869430.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 sequence146 source 1..4097 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1309..2499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867758.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(2559..3071) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250569.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 tRNA complement(3128..3204) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS complement(3347..4000) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053836.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 sequence147 source 1..4047 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 737..1201 product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene nuoE CDS 1194..3002 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene nuoF sequence148 source 1..4025 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 219..1343 product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250421.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene fni CDS 1483..2808 product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146740.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 2813..3838 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250419.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 sequence149 source 1..3808 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..807 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066467.1:anaerobic carbon-monoxide dehydrogenase catalytic subunit locus_tag LOCUS_16690 CDS 887..1693 product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460477.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 1694..1888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16710 sequence150 source 1..3774 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(195..791) product TasA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250769.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(1063..2058) product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250662.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(2094..2516) product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250661.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(2506..2907) product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250660.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 sequence151 source 1..3754 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(472..1614) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868852.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 1824..1976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 2136..3509 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004069588.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 sequence152 source 1..3619 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 151..1170 product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250566.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene rtcA CDS 1288..2856 product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250573.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 2867..3259 product OadG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250574.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 sequence153 source 1..3612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 366..833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 910..3366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16840 sequence154 source 1..3609 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..832 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388070.1:NADH-quinone oxidoreductase subunit H locus_tag LOCUS_16850 CDS 835..2463 product hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868591.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 2451..2969 product formate hydrogenlyase complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393672.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 2962..3543 product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388074.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 sequence155 source 1..3594 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(375..1187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868328.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 1332..2321 product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(2318..3319) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193384984.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 sequence156 source 1..3588 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(934..1467) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867323.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(1464..2666) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251048.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 2729..3223 product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251047.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 sequence157 source 1..3569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 196..1053 product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146582.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 1059..2072 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868074.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 2234..3373 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249959.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 sequence158 source 1..3428 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(138..728) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249201.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene hisH CDS complement(1911..2906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 sequence159 source 1..3428 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 274..453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(686..2611) product CGP-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146626.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 2753..3295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068320206.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 sequence160 source 1..3423 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 103..618 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249996.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 624..1310 product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249459.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(1329..2297) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249460.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene corA CDS complement(2307..3137) product 7,8-dihydropterin-6-methyl-4-(beta-D-ribofuranosyl)-aminobenzene-5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869799.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 sequence161 source 1..3325 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..767 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249652.1:ATP-binding protein locus_tag LOCUS_17070 CDS 803..1126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(1121..1375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(1608..1736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(1880..3322) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937687.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 sequence162 source 1..3253 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 438..1307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(1290..2921) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005602533.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(2914..3066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 sequence163 source 1..3195 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1506..1787) product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249719.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(1780..2310) product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249720.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 misc_feature complement(2395..>3195) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867676.1:glycine--tRNA ligase locus_tag LOCUS_17170 sequence164 source 1..3186 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 252..2279 product DUF5693 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391758.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 sequence165 source 1..3142 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 535..939 product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250582.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene sepF CDS 1008..1610 product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868148.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(1605..1907) product tRNA-binding protein Pbp11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250561.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene pbp11 CDS complement(1913..2581) product DUF257 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868214.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(2634..3071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 sequence166 source 1..2992 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1427..2938) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249872.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 sequence167 source 1..2885 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 103..231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 273..827 product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868122.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 859..2157 product ADP-specific phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249331.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene pfkC sequence168 source 1..2879 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(56..1414) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888077.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(1547..2563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 sequence169 source 1..2848 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 421..1380 product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene meaB CDS 1377..1775 product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene mce CDS 1904..2356 product DUF835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249967.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 sequence170 source 1..2817 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1689..2579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251189.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 sequence171 source 1..2815 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(110..1510) product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868821.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 sequence172 source 1..2779 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(404..1033) product IS607-like element ISTko1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249606.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 1331..2653 product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146740.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 sequence173 source 1..2752 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(64..243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 394..588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(1054..2241) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081432771.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(2390..2521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(2518..2694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17410 sequence174 source 1..2682 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 251..463 product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053680.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 464..691 product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249666.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 sequence175 source 1..2664 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1127 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460067.1:UxaA family hydrolase locus_tag LOCUS_17440 CDS 1143..2102 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 sequence176 source 1..2657 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 186..662 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250801.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(691..1599) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053754.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 misc_feature complement(1605..>2657) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868504.1:type II secretion system F family protein locus_tag LOCUS_17480 sequence177 source 1..2584 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(626..781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 961..2046 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146822.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 sequence178 source 1..2553 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(124..348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 474..623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 636..1010 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 1105..1725 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860823.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 1798..2283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 note possible pseudo, frameshifted sequence179 source 1..2521 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 189..2519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 sequence180 source 1..2505 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 243..1130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249481.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570