>Feature sequence001 1136 1837 gene locus_tag LOCUS_00010 1136 1837 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249248.1 protein_id gnl|my_center|LOCUS_00010 1916 2416 gene locus_tag LOCUS_00020 gene pfpI 1916 2416 CDS product deglycase PfpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250235.1 protein_id gnl|my_center|LOCUS_00020 2566 3036 gene locus_tag LOCUS_00030 2566 3036 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249106.1 protein_id gnl|my_center|LOCUS_00030 3040 3921 gene locus_tag LOCUS_00040 3040 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3924 4829 gene locus_tag LOCUS_00050 3924 4829 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249108.1 protein_id gnl|my_center|LOCUS_00050 5100 4816 gene locus_tag LOCUS_00060 5100 4816 CDS product family 4A encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053633.1 protein_id gnl|my_center|LOCUS_00060 5818 5183 gene locus_tag LOCUS_00070 gene snatA 5818 5183 CDS product neutral amino acid NAAT transporter SnatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250610.1 protein_id gnl|my_center|LOCUS_00070 6756 5971 gene locus_tag LOCUS_00080 gene surE 6756 5971 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250088.1 protein_id gnl|my_center|LOCUS_00080 6840 7808 gene locus_tag LOCUS_00090 6840 7808 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250086.1 protein_id gnl|my_center|LOCUS_00090 8044 8301 gene locus_tag LOCUS_00100 8044 8301 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146566.1 protein_id gnl|my_center|LOCUS_00100 8307 9530 gene locus_tag LOCUS_00110 8307 9530 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867628.1 protein_id gnl|my_center|LOCUS_00110 9586 10434 gene locus_tag LOCUS_00120 9586 10434 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250080.1 protein_id gnl|my_center|LOCUS_00120 10431 10946 gene locus_tag LOCUS_00130 10431 10946 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250077.1 protein_id gnl|my_center|LOCUS_00130 10943 12088 gene locus_tag LOCUS_00140 10943 12088 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250076.1 protein_id gnl|my_center|LOCUS_00140 12094 12939 gene locus_tag LOCUS_00150 12094 12939 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250075.1 protein_id gnl|my_center|LOCUS_00150 12936 13496 gene locus_tag LOCUS_00160 12936 13496 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146568.1 protein_id gnl|my_center|LOCUS_00160 13784 14455 gene locus_tag LOCUS_00170 13784 14455 CDS product archaemetzincin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249467.1 protein_id gnl|my_center|LOCUS_00170 14439 15089 gene locus_tag LOCUS_00180 14439 15089 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867690.1 protein_id gnl|my_center|LOCUS_00180 16301 15270 gene locus_tag LOCUS_00190 gene priS 16301 15270 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250742.1 protein_id gnl|my_center|LOCUS_00190 17475 16294 gene locus_tag LOCUS_00200 gene priL 17475 16294 CDS product DNA primase large subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250741.1 protein_id gnl|my_center|LOCUS_00200 18422 17535 gene locus_tag LOCUS_00210 18422 17535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00210 19417 18419 gene locus_tag LOCUS_00220 19417 18419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00220 19646 20392 gene locus_tag LOCUS_00230 19646 20392 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146498.1 protein_id gnl|my_center|LOCUS_00230 20409 21170 gene locus_tag LOCUS_00240 20409 21170 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867294.1 protein_id gnl|my_center|LOCUS_00240 22155 21160 gene locus_tag LOCUS_00250 22155 21160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250153.1 protein_id gnl|my_center|LOCUS_00250 22622 22152 gene locus_tag LOCUS_00260 22622 22152 CDS product DUF1887 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250154.1 protein_id gnl|my_center|LOCUS_00260 23085 22639 gene locus_tag LOCUS_00270 23085 22639 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250155.1 protein_id gnl|my_center|LOCUS_00270 23269 23096 gene locus_tag LOCUS_00280 23269 23096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147172.1 protein_id gnl|my_center|LOCUS_00280 23915 23253 gene locus_tag LOCUS_00290 23915 23253 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173254069.1 protein_id gnl|my_center|LOCUS_00290 24681 23917 gene locus_tag LOCUS_00300 24681 23917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249431.1 protein_id gnl|my_center|LOCUS_00300 25912 24692 gene locus_tag LOCUS_00310 gene hxlA 25912 24692 CDS product 3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249430.1 protein_id gnl|my_center|LOCUS_00310 26893 26012 gene locus_tag LOCUS_00320 gene dapA 26893 26012 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_00320 27012 27167 gene locus_tag LOCUS_00330 27012 27167 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250446.1 protein_id gnl|my_center|LOCUS_00330 27495 27169 gene locus_tag LOCUS_00340 27495 27169 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250445.1 protein_id gnl|my_center|LOCUS_00340 29064 27874 gene locus_tag LOCUS_00350 29064 27874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010885940.1 protein_id gnl|my_center|LOCUS_00350 30160 29132 gene locus_tag LOCUS_00360 30160 29132 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868714.1 protein_id gnl|my_center|LOCUS_00360 30218 30520 gene locus_tag LOCUS_00370 30218 30520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 31526 30501 gene locus_tag LOCUS_00380 31526 30501 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249900.1 protein_id gnl|my_center|LOCUS_00380 32770 31583 gene locus_tag LOCUS_00390 32770 31583 CDS product cell wall-binding repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867622.1 protein_id gnl|my_center|LOCUS_00390 34414 32966 gene locus_tag LOCUS_00400 gene asnB 34414 32966 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249901.1 protein_id gnl|my_center|LOCUS_00400 35289 34549 gene locus_tag LOCUS_00410 35289 34549 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868552.1 protein_id gnl|my_center|LOCUS_00410 35382 37196 gene locus_tag LOCUS_00420 35382 37196 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249904.1 protein_id gnl|my_center|LOCUS_00420 37435 37193 gene locus_tag LOCUS_00430 37435 37193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 >Feature sequence002 1101 2036 gene locus_tag LOCUS_00440 1101 2036 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250990.1 protein_id gnl|my_center|LOCUS_00440 2142 3077 gene locus_tag LOCUS_00450 2142 3077 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249823.1 protein_id gnl|my_center|LOCUS_00450 3126 3767 gene locus_tag LOCUS_00460 3126 3767 CDS product DUF257 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250993.1 protein_id gnl|my_center|LOCUS_00460 3764 4438 gene locus_tag LOCUS_00470 3764 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 5396 4398 gene locus_tag LOCUS_00480 5396 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249824.1 protein_id gnl|my_center|LOCUS_00480 5986 5396 gene locus_tag LOCUS_00490 5986 5396 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053690.1 protein_id gnl|my_center|LOCUS_00490 6046 7128 gene locus_tag LOCUS_00500 6046 7128 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_00500 7131 7793 gene locus_tag LOCUS_00510 7131 7793 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867891.1 protein_id gnl|my_center|LOCUS_00510 7950 9341 gene locus_tag LOCUS_00520 7950 9341 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249828.1 protein_id gnl|my_center|LOCUS_00520 9402 9818 gene locus_tag LOCUS_00530 9402 9818 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867889.1 protein_id gnl|my_center|LOCUS_00530 9985 10851 gene locus_tag LOCUS_00540 gene speB 9985 10851 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249833.1 protein_id gnl|my_center|LOCUS_00540 12564 10852 gene locus_tag LOCUS_00550 12564 10852 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249837.1 protein_id gnl|my_center|LOCUS_00550 13206 12595 gene locus_tag LOCUS_00560 13206 12595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598770.1 protein_id gnl|my_center|LOCUS_00560 13516 13986 gene locus_tag LOCUS_00570 13516 13986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249836.1 protein_id gnl|my_center|LOCUS_00570 14115 14888 gene locus_tag LOCUS_00580 14115 14888 CDS product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250494.1 protein_id gnl|my_center|LOCUS_00580 14890 15927 gene locus_tag LOCUS_00590 14890 15927 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250493.1 protein_id gnl|my_center|LOCUS_00590 15939 16706 gene locus_tag LOCUS_00600 gene rpl4p 15939 16706 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250492.1 protein_id gnl|my_center|LOCUS_00600 16717 16977 gene locus_tag LOCUS_00610 16717 16977 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250491.1 protein_id gnl|my_center|LOCUS_00610 16989 17708 gene locus_tag LOCUS_00620 16989 17708 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250490.1 protein_id gnl|my_center|LOCUS_00620 17719 18120 gene locus_tag LOCUS_00630 17719 18120 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250489.1 protein_id gnl|my_center|LOCUS_00630 18132 18596 gene locus_tag LOCUS_00640 gene rplV 18132 18596 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867459.1 protein_id gnl|my_center|LOCUS_00640 18601 19233 gene locus_tag LOCUS_00650 gene rpsC 18601 19233 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867458.1 protein_id gnl|my_center|LOCUS_00650 19230 19430 gene locus_tag LOCUS_00660 gene rpmC 19230 19430 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250486.1 protein_id gnl|my_center|LOCUS_00660 19439 19735 gene locus_tag LOCUS_00670 gene yciH 19439 19735 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050002739.1 protein_id gnl|my_center|LOCUS_00670 19732 19998 gene locus_tag LOCUS_00680 19732 19998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 19995 20330 gene locus_tag LOCUS_00690 19995 20330 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867454.1 protein_id gnl|my_center|LOCUS_00690 20336 20761 gene locus_tag LOCUS_00700 20336 20761 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250482.1 protein_id gnl|my_center|LOCUS_00700 20772 21134 gene locus_tag LOCUS_00710 gene rplX 20772 21134 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867452.1 protein_id gnl|my_center|LOCUS_00710 21137 21883 gene locus_tag LOCUS_00720 21137 21883 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250480.1 protein_id gnl|my_center|LOCUS_00720 21895 22437 gene locus_tag LOCUS_00730 21895 22437 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250479.1 protein_id gnl|my_center|LOCUS_00730 22441 22611 gene locus_tag LOCUS_00740 22441 22611 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250478.1 protein_id gnl|my_center|LOCUS_00740 22623 23015 gene locus_tag LOCUS_00750 22623 23015 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867448.1 protein_id gnl|my_center|LOCUS_00750 23026 23580 gene locus_tag LOCUS_00760 23026 23580 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250476.1 protein_id gnl|my_center|LOCUS_00760 23591 23974 gene locus_tag LOCUS_00770 23591 23974 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250475.1 protein_id gnl|my_center|LOCUS_00770 23974 24426 gene locus_tag LOCUS_00780 23974 24426 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053733.1 protein_id gnl|my_center|LOCUS_00780 24432 25025 gene locus_tag LOCUS_00790 24432 25025 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867444.1 protein_id gnl|my_center|LOCUS_00790 25032 25739 gene locus_tag LOCUS_00800 gene rpsE 25032 25739 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867443.1 protein_id gnl|my_center|LOCUS_00800 25751 26215 gene locus_tag LOCUS_00810 25751 26215 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867442.1 protein_id gnl|my_center|LOCUS_00810 26226 26669 gene locus_tag LOCUS_00820 26226 26669 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867441.1 protein_id gnl|my_center|LOCUS_00820 26702 28099 gene locus_tag LOCUS_00830 gene secY 26702 28099 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867440.1 protein_id gnl|my_center|LOCUS_00830 28308 28898 gene locus_tag LOCUS_00840 28308 28898 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146533.1 protein_id gnl|my_center|LOCUS_00840 28891 29415 gene locus_tag LOCUS_00850 28891 29415 CDS product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867438.1 protein_id gnl|my_center|LOCUS_00850 29466 29738 gene locus_tag LOCUS_00860 29466 29738 CDS product 50S ribosomal protein L34e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250466.1 protein_id gnl|my_center|LOCUS_00860 29760 30332 gene locus_tag LOCUS_00870 29760 30332 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250465.1 protein_id gnl|my_center|LOCUS_00870 30333 30581 gene locus_tag LOCUS_00880 30333 30581 CDS product 50S ribosomal protein L14e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250464.1 protein_id gnl|my_center|LOCUS_00880 30772 31785 gene locus_tag LOCUS_00890 30772 31785 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250460.1 protein_id gnl|my_center|LOCUS_00890 31887 32474 gene locus_tag LOCUS_00900 31887 32474 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250458.1 protein_id gnl|my_center|LOCUS_00900 32460 32546 gene locus_tag LOCUS_t00010 32460 32546 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 32588 33034 gene locus_tag LOCUS_00910 32588 33034 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250457.1 protein_id gnl|my_center|LOCUS_00910 33045 33587 gene locus_tag LOCUS_00920 33045 33587 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867652.1 protein_id gnl|my_center|LOCUS_00920 33584 33994 gene locus_tag LOCUS_00930 33584 33994 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250455.1 protein_id gnl|my_center|LOCUS_00930 34025 34801 gene locus_tag LOCUS_00940 34025 34801 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868100.1 protein_id gnl|my_center|LOCUS_00940 34803 34890 gene locus_tag LOCUS_t00020 34803 34890 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 34947 35309 gene locus_tag LOCUS_00950 34947 35309 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250453.1 protein_id gnl|my_center|LOCUS_00950 35316 35744 gene locus_tag LOCUS_00960 gene rplM 35316 35744 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250452.1 protein_id gnl|my_center|LOCUS_00960 >Feature sequence003 497 1465 gene locus_tag LOCUS_00970 gene speB 497 1465 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895813.1 protein_id gnl|my_center|LOCUS_00970 1462 2484 gene locus_tag LOCUS_00980 gene cysK 1462 2484 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296093.1 protein_id gnl|my_center|LOCUS_00980 2584 2892 gene locus_tag LOCUS_00990 2584 2892 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868443.1 protein_id gnl|my_center|LOCUS_00990 2894 4072 gene locus_tag LOCUS_01000 2894 4072 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868444.1 protein_id gnl|my_center|LOCUS_01000 4304 4086 gene locus_tag LOCUS_01010 4304 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146475.1 protein_id gnl|my_center|LOCUS_01010 6597 4378 gene locus_tag LOCUS_01020 6597 4378 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249110.1 protein_id gnl|my_center|LOCUS_01020 7912 6644 gene locus_tag LOCUS_01030 7912 6644 CDS product TIGR04013 family B12-binding domain/radical SAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250363.1 protein_id gnl|my_center|LOCUS_01030 8175 7975 gene locus_tag LOCUS_01040 gene hpkA 8175 7975 CDS product archaeal histone HpkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250364.1 protein_id gnl|my_center|LOCUS_01040 8620 8545 gene locus_tag LOCUS_t00030 8620 8545 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8668 9138 gene locus_tag LOCUS_01050 gene dcd 8668 9138 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250365.1 protein_id gnl|my_center|LOCUS_01050 9377 9135 gene locus_tag LOCUS_01060 9377 9135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 10385 9621 gene locus_tag LOCUS_01070 10385 9621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 10789 10475 gene locus_tag LOCUS_01080 10789 10475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 11873 10854 gene locus_tag LOCUS_01090 11873 10854 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250367.1 protein_id gnl|my_center|LOCUS_01090 12529 11879 gene locus_tag LOCUS_01100 12529 11879 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250368.1 protein_id gnl|my_center|LOCUS_01100 13101 12610 gene locus_tag LOCUS_01110 13101 12610 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250369.1 protein_id gnl|my_center|LOCUS_01110 13569 13117 gene locus_tag LOCUS_01120 13569 13117 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867126.1 protein_id gnl|my_center|LOCUS_01120 13783 13589 gene locus_tag LOCUS_01130 13783 13589 CDS product protein translocase SEC61 complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250371.1 protein_id gnl|my_center|LOCUS_01130 14945 13815 gene locus_tag LOCUS_01140 gene ftsZ 14945 13815 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250372.1 protein_id gnl|my_center|LOCUS_01140 15837 15019 gene locus_tag LOCUS_01150 15837 15019 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250373.1 protein_id gnl|my_center|LOCUS_01150 16072 17070 gene locus_tag LOCUS_01160 16072 17070 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053693.1 protein_id gnl|my_center|LOCUS_01160 17076 17522 gene locus_tag LOCUS_01170 17076 17522 CDS product DUF1850 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209477679.1 protein_id gnl|my_center|LOCUS_01170 17524 19836 gene locus_tag LOCUS_01180 17524 19836 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249888.1 protein_id gnl|my_center|LOCUS_01180 21091 19883 gene locus_tag LOCUS_01190 21091 19883 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250375.1 protein_id gnl|my_center|LOCUS_01190 21144 21737 gene locus_tag LOCUS_01200 21144 21737 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146546.1 protein_id gnl|my_center|LOCUS_01200 22876 21740 gene locus_tag LOCUS_01210 22876 21740 CDS product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250496.1 protein_id gnl|my_center|LOCUS_01210 23245 23793 gene locus_tag LOCUS_01220 23245 23793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 23793 24602 gene locus_tag LOCUS_01230 23793 24602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868619.1 protein_id gnl|my_center|LOCUS_01230 25685 24960 gene locus_tag LOCUS_01240 25685 24960 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209477233.1 protein_id gnl|my_center|LOCUS_01240 26745 25669 gene locus_tag LOCUS_01250 26745 25669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 27074 26742 gene locus_tag LOCUS_01260 27074 26742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147066.1 protein_id gnl|my_center|LOCUS_01260 28213 27227 gene locus_tag LOCUS_01270 28213 27227 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249596.1 protein_id gnl|my_center|LOCUS_01270 28499 28191 gene locus_tag LOCUS_01280 28499 28191 CDS product DUF3194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249595.1 protein_id gnl|my_center|LOCUS_01280 28873 28526 gene locus_tag LOCUS_01290 28873 28526 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868631.1 protein_id gnl|my_center|LOCUS_01290 29000 29308 gene locus_tag LOCUS_01300 29000 29308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 29522 29277 gene locus_tag LOCUS_01310 gene pcc1 29522 29277 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173254056.1 protein_id gnl|my_center|LOCUS_01310 30660 29515 gene locus_tag LOCUS_01320 30660 29515 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249578.1 protein_id gnl|my_center|LOCUS_01320 30802 31209 gene locus_tag LOCUS_01330 30802 31209 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249577.1 protein_id gnl|my_center|LOCUS_01330 32697 31192 gene locus_tag LOCUS_01340 32697 31192 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249576.1 protein_id gnl|my_center|LOCUS_01340 32987 32694 gene locus_tag LOCUS_01350 32987 32694 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249575.1 protein_id gnl|my_center|LOCUS_01350 33402 32980 gene locus_tag LOCUS_01360 33402 32980 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249574.1 protein_id gnl|my_center|LOCUS_01360 33644 33399 gene locus_tag LOCUS_01370 33644 33399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249573.1 protein_id gnl|my_center|LOCUS_01370 33871 33641 gene locus_tag LOCUS_01380 33871 33641 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249572.1 protein_id gnl|my_center|LOCUS_01380 34166 33852 gene locus_tag LOCUS_01390 gene mnhG 34166 33852 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249571.1 protein_id gnl|my_center|LOCUS_01390 34438 34163 gene locus_tag LOCUS_01400 34438 34163 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249570.1 protein_id gnl|my_center|LOCUS_01400 >Feature sequence004 <1 2474 gene locus_tag LOCUS_01410 <1 2474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868880.1:V-type ATP synthase subunit A 2471 3871 gene locus_tag LOCUS_01420 2471 3871 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053740.1 protein_id gnl|my_center|LOCUS_01420 3895 4536 gene locus_tag LOCUS_01430 3895 4536 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250555.1 protein_id gnl|my_center|LOCUS_01430 4600 5010 gene locus_tag LOCUS_01440 4600 5010 CDS product DUF61 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250746.1 protein_id gnl|my_center|LOCUS_01440 5016 5288 gene locus_tag LOCUS_01450 5016 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 5347 6966 gene locus_tag LOCUS_01460 5347 6966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598712.1 protein_id gnl|my_center|LOCUS_01460 7376 8281 gene locus_tag LOCUS_01470 7376 8281 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250632.1 protein_id gnl|my_center|LOCUS_01470 8497 8327 gene locus_tag LOCUS_01480 8497 8327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 9032 8580 gene locus_tag LOCUS_01490 9032 8580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 9130 10302 gene locus_tag LOCUS_01500 9130 10302 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250627.1 protein_id gnl|my_center|LOCUS_01500 10559 10359 gene locus_tag LOCUS_01510 10559 10359 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868845.1 protein_id gnl|my_center|LOCUS_01510 11012 10689 gene locus_tag LOCUS_01520 11012 10689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 11794 11054 gene locus_tag LOCUS_01530 11794 11054 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250643.1 protein_id gnl|my_center|LOCUS_01530 11872 12924 gene locus_tag LOCUS_01540 gene bpsA 11872 12924 CDS product N(4)-bis(aminopropyl)spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250642.1 protein_id gnl|my_center|LOCUS_01540 13167 13640 gene locus_tag LOCUS_01550 13167 13640 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867679.1 protein_id gnl|my_center|LOCUS_01550 13672 14040 gene locus_tag LOCUS_01560 gene speD 13672 14040 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545906.1 protein_id gnl|my_center|LOCUS_01560 14073 14924 gene locus_tag LOCUS_01570 gene speE 14073 14924 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249102.1 protein_id gnl|my_center|LOCUS_01570 15026 16315 gene locus_tag LOCUS_01580 gene thrC 15026 16315 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867870.1 protein_id gnl|my_center|LOCUS_01580 16463 16927 gene locus_tag LOCUS_01590 16463 16927 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250688.1 protein_id gnl|my_center|LOCUS_01590 17112 20918 gene locus_tag LOCUS_01600 17112 20918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 21004 22143 gene locus_tag LOCUS_01610 21004 22143 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867962.1 protein_id gnl|my_center|LOCUS_01610 22738 22145 gene locus_tag LOCUS_01620 22738 22145 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867961.1 protein_id gnl|my_center|LOCUS_01620 23678 22782 gene locus_tag LOCUS_01630 23678 22782 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250918.1 protein_id gnl|my_center|LOCUS_01630 23743 24453 gene locus_tag LOCUS_01640 23743 24453 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250920.1 protein_id gnl|my_center|LOCUS_01640 24440 24967 gene locus_tag LOCUS_01650 gene otg 24440 24967 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250921.1 protein_id gnl|my_center|LOCUS_01650 24955 25956 gene locus_tag LOCUS_01660 24955 25956 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867513.1 protein_id gnl|my_center|LOCUS_01660 27512 26133 gene locus_tag LOCUS_01670 27512 26133 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868396.1 protein_id gnl|my_center|LOCUS_01670 29099 27552 gene locus_tag LOCUS_01680 29099 27552 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868397.1 protein_id gnl|my_center|LOCUS_01680 29375 29638 gene locus_tag LOCUS_01690 29375 29638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868791.1 protein_id gnl|my_center|LOCUS_01690 29797 30162 gene locus_tag LOCUS_01700 29797 30162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 >Feature sequence005 99 1148 gene locus_tag LOCUS_01710 99 1148 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250754.1 protein_id gnl|my_center|LOCUS_01710 1160 2587 gene locus_tag LOCUS_01720 1160 2587 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250753.1 protein_id gnl|my_center|LOCUS_01720 2590 3549 gene locus_tag LOCUS_01730 2590 3549 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250752.1 protein_id gnl|my_center|LOCUS_01730 3560 4567 gene locus_tag LOCUS_01740 3560 4567 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250751.1 protein_id gnl|my_center|LOCUS_01740 4626 5090 gene locus_tag LOCUS_01750 4626 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 5087 5857 gene locus_tag LOCUS_01760 5087 5857 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250749.1 protein_id gnl|my_center|LOCUS_01760 5854 6696 gene locus_tag LOCUS_01770 5854 6696 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250748.1 protein_id gnl|my_center|LOCUS_01770 6825 7754 gene locus_tag LOCUS_01780 6825 7754 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062388956.1 protein_id gnl|my_center|LOCUS_01780 8666 7743 gene locus_tag LOCUS_01790 8666 7743 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868813.1 protein_id gnl|my_center|LOCUS_01790 8726 9214 gene locus_tag LOCUS_01800 8726 9214 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251062.1 protein_id gnl|my_center|LOCUS_01800 9239 9799 gene locus_tag LOCUS_01810 9239 9799 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868811.1 protein_id gnl|my_center|LOCUS_01810 9860 10312 gene locus_tag LOCUS_01820 9860 10312 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251060.1 protein_id gnl|my_center|LOCUS_01820 10748 11872 gene locus_tag LOCUS_01830 gene fbp 10748 11872 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868421.1 protein_id gnl|my_center|LOCUS_01830 12408 12791 gene locus_tag LOCUS_01840 12408 12791 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868549.1 protein_id gnl|my_center|LOCUS_01840 12901 14133 gene locus_tag LOCUS_01850 12901 14133 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867591.1 protein_id gnl|my_center|LOCUS_01850 14158 14562 gene locus_tag LOCUS_01860 14158 14562 CDS product nucleic acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250895.1 protein_id gnl|my_center|LOCUS_01860 15508 14606 gene locus_tag LOCUS_01870 15508 14606 CDS product asparagine synthetase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250501.1 protein_id gnl|my_center|LOCUS_01870 16797 15667 gene locus_tag LOCUS_01880 16797 15667 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250511.1 protein_id gnl|my_center|LOCUS_01880 17371 16811 gene locus_tag LOCUS_01890 17371 16811 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250509.1 protein_id gnl|my_center|LOCUS_01890 17539 17462 gene locus_tag LOCUS_t00040 17539 17462 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 17705 17628 gene locus_tag LOCUS_t00050 17705 17628 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 17803 18861 gene locus_tag LOCUS_01900 17803 18861 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250860.1 protein_id gnl|my_center|LOCUS_01900 18929 19642 gene locus_tag LOCUS_01910 18929 19642 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250861.1 protein_id gnl|my_center|LOCUS_01910 19652 20077 gene locus_tag LOCUS_01920 19652 20077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250862.1 protein_id gnl|my_center|LOCUS_01920 20077 21870 gene locus_tag LOCUS_01930 20077 21870 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868077.1 protein_id gnl|my_center|LOCUS_01930 21915 23600 gene locus_tag LOCUS_01940 21915 23600 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250863.1 protein_id gnl|my_center|LOCUS_01940 23903 23577 gene locus_tag LOCUS_01950 23903 23577 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053759.1 protein_id gnl|my_center|LOCUS_01950 24663 24016 gene locus_tag LOCUS_01960 24663 24016 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250865.1 protein_id gnl|my_center|LOCUS_01960 24880 24650 gene locus_tag LOCUS_01970 24880 24650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 25159 25953 gene locus_tag LOCUS_01980 25159 25953 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250866.1 protein_id gnl|my_center|LOCUS_01980 <26534 25941 gene locus_tag LOCUS_01990 <26534 25941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867384.1:class I SAM-dependent methyltransferase >Feature sequence006 64 585 gene locus_tag LOCUS_02000 64 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 585 1460 gene locus_tag LOCUS_02010 gene csm3 585 1460 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545354.1 protein_id gnl|my_center|LOCUS_02010 1460 2314 gene locus_tag LOCUS_02020 gene csm4 1460 2314 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876703.1 protein_id gnl|my_center|LOCUS_02020 2311 3531 gene locus_tag LOCUS_02030 gene csm5 2311 3531 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021931.1 protein_id gnl|my_center|LOCUS_02030 3528 4808 gene locus_tag LOCUS_02040 gene csx1 3528 4808 CDS product CRISPR-associated CARF protein Csx1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871190.1 protein_id gnl|my_center|LOCUS_02040 4992 6278 gene locus_tag LOCUS_02050 gene cytX 4992 6278 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868210.1 protein_id gnl|my_center|LOCUS_02050 6283 7083 gene locus_tag LOCUS_02060 gene thiM 6283 7083 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146833.1 protein_id gnl|my_center|LOCUS_02060 7073 7696 gene locus_tag LOCUS_02070 gene thiE 7073 7696 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868208.1 protein_id gnl|my_center|LOCUS_02070 7702 8778 gene locus_tag LOCUS_02080 7702 8778 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868207.1 protein_id gnl|my_center|LOCUS_02080 9233 8775 gene locus_tag LOCUS_02090 9233 8775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249607.1 protein_id gnl|my_center|LOCUS_02090 9437 10687 gene locus_tag LOCUS_02100 9437 10687 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762231.1 protein_id gnl|my_center|LOCUS_02100 10724 12247 gene locus_tag LOCUS_02110 10724 12247 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249609.1 protein_id gnl|my_center|LOCUS_02110 12244 13278 gene locus_tag LOCUS_02120 12244 13278 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249610.1 protein_id gnl|my_center|LOCUS_02120 13275 14177 gene locus_tag LOCUS_02130 13275 14177 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249611.1 protein_id gnl|my_center|LOCUS_02130 14393 14178 gene locus_tag LOCUS_02140 14393 14178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 15463 14453 gene locus_tag LOCUS_02150 gene hypE 15463 14453 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868428.1 protein_id gnl|my_center|LOCUS_02150 15578 16387 gene locus_tag LOCUS_02160 15578 16387 CDS product DUF2666 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250214.1 protein_id gnl|my_center|LOCUS_02160 17688 16384 gene locus_tag LOCUS_02170 17688 16384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250434.1 protein_id gnl|my_center|LOCUS_02170 18024 17815 gene locus_tag LOCUS_02180 18024 17815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250435.1 protein_id gnl|my_center|LOCUS_02180 18187 18008 gene locus_tag LOCUS_02190 18187 18008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 18978 18124 gene locus_tag LOCUS_02200 18978 18124 CDS product damage-control phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249335.1 protein_id gnl|my_center|LOCUS_02200 19031 19699 gene locus_tag LOCUS_02210 gene rnhB 19031 19699 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249756.1 protein_id gnl|my_center|LOCUS_02210 19910 19833 gene locus_tag LOCUS_t00060 19910 19833 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19931 20431 gene locus_tag LOCUS_02220 19931 20431 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867606.1 protein_id gnl|my_center|LOCUS_02220 20766 20428 gene locus_tag LOCUS_02230 20766 20428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 21947 20763 gene locus_tag LOCUS_02240 21947 20763 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868230.1 protein_id gnl|my_center|LOCUS_02240 22657 21944 gene locus_tag LOCUS_02250 22657 21944 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250440.1 protein_id gnl|my_center|LOCUS_02250 23210 24565 gene locus_tag LOCUS_02260 23210 24565 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250437.1 protein_id gnl|my_center|LOCUS_02260 24562 24801 gene locus_tag LOCUS_02270 24562 24801 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250438.1 protein_id gnl|my_center|LOCUS_02270 24806 25321 gene locus_tag LOCUS_02280 24806 25321 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250439.1 protein_id gnl|my_center|LOCUS_02280 >Feature sequence007 790 122 gene locus_tag LOCUS_02290 790 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 1059 757 gene locus_tag LOCUS_02300 1059 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 1282 1052 gene locus_tag LOCUS_02310 1282 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 2427 1255 gene locus_tag LOCUS_02320 2427 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250259.1 protein_id gnl|my_center|LOCUS_02320 2636 2980 gene locus_tag LOCUS_02330 2636 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867424.1 protein_id gnl|my_center|LOCUS_02330 3068 3457 gene locus_tag LOCUS_02340 3068 3457 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250142.1 protein_id gnl|my_center|LOCUS_02340 3559 4605 gene locus_tag LOCUS_02350 gene pepQ 3559 4605 CDS product Xaa-Pro dipeptidase PepQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249918.1 protein_id gnl|my_center|LOCUS_02350 4705 5226 gene locus_tag LOCUS_02360 4705 5226 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250125.1 protein_id gnl|my_center|LOCUS_02360 5275 6078 gene locus_tag LOCUS_02370 gene uppS 5275 6078 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250124.1 protein_id gnl|my_center|LOCUS_02370 6746 6075 gene locus_tag LOCUS_02380 6746 6075 CDS product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250422.1 protein_id gnl|my_center|LOCUS_02380 7619 6810 gene locus_tag LOCUS_02390 7619 6810 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250014.1 protein_id gnl|my_center|LOCUS_02390 8909 7695 gene locus_tag LOCUS_02400 gene coaBC 8909 7695 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249472.1 protein_id gnl|my_center|LOCUS_02400 9342 8962 gene locus_tag LOCUS_02410 9342 8962 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249470.1 protein_id gnl|my_center|LOCUS_02410 9718 9344 gene locus_tag LOCUS_02420 gene crcB 9718 9344 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867782.1 protein_id gnl|my_center|LOCUS_02420 9986 9708 gene locus_tag LOCUS_02430 9986 9708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 10146 9973 gene locus_tag LOCUS_02440 10146 9973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 10543 10244 gene locus_tag LOCUS_02450 10543 10244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 10847 10521 gene locus_tag LOCUS_02460 10847 10521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 11538 10837 gene locus_tag LOCUS_02470 11538 10837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 12416 11562 gene locus_tag LOCUS_02480 12416 11562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249468.1 protein_id gnl|my_center|LOCUS_02480 12599 13066 gene locus_tag LOCUS_02490 12599 13066 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250071.1 protein_id gnl|my_center|LOCUS_02490 14820 13075 gene locus_tag LOCUS_02500 14820 13075 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249258.1 protein_id gnl|my_center|LOCUS_02500 15861 14869 gene locus_tag LOCUS_02510 15861 14869 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249452.1 protein_id gnl|my_center|LOCUS_02510 16055 15978 gene locus_tag LOCUS_t00070 16055 15978 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 16832 16074 gene locus_tag LOCUS_02520 16832 16074 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867145.1 protein_id gnl|my_center|LOCUS_02520 18718 16856 gene locus_tag LOCUS_02530 18718 16856 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146456.1 protein_id gnl|my_center|LOCUS_02530 20839 19067 gene locus_tag LOCUS_02540 20839 19067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 21190 20957 gene locus_tag LOCUS_02550 21190 20957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 22858 21197 gene locus_tag LOCUS_02560 22858 21197 CDS product DUF4932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249170.1 protein_id gnl|my_center|LOCUS_02560 24537 22855 gene locus_tag LOCUS_02570 24537 22855 CDS product DUF4932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249170.1 protein_id gnl|my_center|LOCUS_02570 24997 24674 gene locus_tag LOCUS_02580 24997 24674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 >Feature sequence008 1519 62 gene locus_tag LOCUS_02590 1519 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 2726 1524 gene locus_tag LOCUS_02600 2726 1524 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868809.1 protein_id gnl|my_center|LOCUS_02600 2804 3112 gene locus_tag LOCUS_02610 2804 3112 CDS product DUF5748 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250737.1 protein_id gnl|my_center|LOCUS_02610 4262 3120 gene locus_tag LOCUS_02620 4262 3120 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250738.1 protein_id gnl|my_center|LOCUS_02620 5434 4220 gene locus_tag LOCUS_02630 5434 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209475225.1 protein_id gnl|my_center|LOCUS_02630 5605 6051 gene locus_tag LOCUS_02640 5605 6051 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249062.1 protein_id gnl|my_center|LOCUS_02640 7484 6114 gene locus_tag LOCUS_02650 7484 6114 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249112.1 protein_id gnl|my_center|LOCUS_02650 8569 7568 gene locus_tag LOCUS_02660 8569 7568 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249113.1 protein_id gnl|my_center|LOCUS_02660 10188 8563 gene locus_tag LOCUS_02670 10188 8563 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053795.1 protein_id gnl|my_center|LOCUS_02670 12038 10218 gene locus_tag LOCUS_02680 12038 10218 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868108.1 protein_id gnl|my_center|LOCUS_02680 13520 12048 gene locus_tag LOCUS_02690 13520 12048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 13593 14531 gene locus_tag LOCUS_02700 13593 14531 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146617.1 protein_id gnl|my_center|LOCUS_02700 14786 15817 gene locus_tag LOCUS_02710 14786 15817 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868853.1 protein_id gnl|my_center|LOCUS_02710 15814 16821 gene locus_tag LOCUS_02720 15814 16821 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868854.1 protein_id gnl|my_center|LOCUS_02720 16930 18273 gene locus_tag LOCUS_02730 16930 18273 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867150.1 protein_id gnl|my_center|LOCUS_02730 18364 19221 gene locus_tag LOCUS_02740 18364 19221 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867149.1 protein_id gnl|my_center|LOCUS_02740 19218 20036 gene locus_tag LOCUS_02750 19218 20036 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867148.1 protein_id gnl|my_center|LOCUS_02750 20047 21159 gene locus_tag LOCUS_02760 20047 21159 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867147.1 protein_id gnl|my_center|LOCUS_02760 21170 22186 gene locus_tag LOCUS_02770 gene trmB 21170 22186 CDS product transcriptional regulator TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892507.1 protein_id gnl|my_center|LOCUS_02770 <24709 22187 gene locus_tag LOCUS_02780 <24709 22187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010906004.1:alpha-mannosidase >Feature sequence009 <1 746 gene locus_tag LOCUS_02790 <1 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868609.1:FlaD/FlaE family flagellar protein 756 1271 gene locus_tag LOCUS_02800 756 1271 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249000.1 protein_id gnl|my_center|LOCUS_02800 1274 1729 gene locus_tag LOCUS_02810 1274 1729 CDS product flagellar protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147053.1 protein_id gnl|my_center|LOCUS_02810 1754 2449 gene locus_tag LOCUS_02820 1754 2449 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249002.1 protein_id gnl|my_center|LOCUS_02820 2451 4076 gene locus_tag LOCUS_02830 2451 4076 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249003.1 protein_id gnl|my_center|LOCUS_02830 4082 5791 gene locus_tag LOCUS_02840 gene flaJ 4082 5791 CDS product archaellar assembly protein FlaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147051.1 protein_id gnl|my_center|LOCUS_02840 5788 7704 gene locus_tag LOCUS_02850 5788 7704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 7764 9647 gene locus_tag LOCUS_02860 7764 9647 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250266.1 protein_id gnl|my_center|LOCUS_02860 9674 10528 gene locus_tag LOCUS_02870 9674 10528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 10577 11167 gene locus_tag LOCUS_02880 10577 11167 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250264.1 protein_id gnl|my_center|LOCUS_02880 11208 11864 gene locus_tag LOCUS_02890 11208 11864 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147186.1 protein_id gnl|my_center|LOCUS_02890 11866 12498 gene locus_tag LOCUS_02900 11866 12498 CDS product HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249007.1 protein_id gnl|my_center|LOCUS_02900 13680 12544 gene locus_tag LOCUS_02910 13680 12544 CDS product A24 family peptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249008.1 protein_id gnl|my_center|LOCUS_02910 13855 13691 gene locus_tag LOCUS_02920 13855 13691 CDS product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249009.1 protein_id gnl|my_center|LOCUS_02920 14014 15216 gene locus_tag LOCUS_02930 14014 15216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188201438.1 protein_id gnl|my_center|LOCUS_02930 15267 15629 gene locus_tag LOCUS_02940 15267 15629 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249010.1 protein_id gnl|my_center|LOCUS_02940 15610 16182 gene locus_tag LOCUS_02950 15610 16182 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868704.1 protein_id gnl|my_center|LOCUS_02950 16405 16172 gene locus_tag LOCUS_02960 16405 16172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249012.1 protein_id gnl|my_center|LOCUS_02960 16595 17293 gene locus_tag LOCUS_02970 16595 17293 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249013.1 protein_id gnl|my_center|LOCUS_02970 17897 17301 gene locus_tag LOCUS_02980 17897 17301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 18135 17899 gene locus_tag LOCUS_02990 18135 17899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 18383 18997 gene locus_tag LOCUS_03000 18383 18997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250099.1 protein_id gnl|my_center|LOCUS_03000 21172 18998 gene locus_tag LOCUS_03010 21172 18998 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250098.1 protein_id gnl|my_center|LOCUS_03010 >Feature sequence010 <1 943 gene locus_tag LOCUS_03020 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250934.1:pyruvate synthase subunit PorB 1054 1944 gene locus_tag LOCUS_03030 1054 1944 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250971.1 protein_id gnl|my_center|LOCUS_03030 3266 1950 gene locus_tag LOCUS_03040 3266 1950 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867775.1 protein_id gnl|my_center|LOCUS_03040 4237 3362 gene locus_tag LOCUS_03050 4237 3362 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249628.1 protein_id gnl|my_center|LOCUS_03050 4778 4239 gene locus_tag LOCUS_03060 4778 4239 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868259.1 protein_id gnl|my_center|LOCUS_03060 4913 5041 gene locus_tag LOCUS_03070 4913 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 6282 5065 gene locus_tag LOCUS_03080 6282 5065 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249500.1 protein_id gnl|my_center|LOCUS_03080 6428 6991 gene locus_tag LOCUS_03090 6428 6991 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250217.1 protein_id gnl|my_center|LOCUS_03090 7147 8019 gene locus_tag LOCUS_03100 7147 8019 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248984.1 protein_id gnl|my_center|LOCUS_03100 8624 8016 gene locus_tag LOCUS_03110 gene cas4 8624 8016 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249024.1 protein_id gnl|my_center|LOCUS_03110 9862 8630 gene locus_tag LOCUS_03120 9862 8630 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878533.1 protein_id gnl|my_center|LOCUS_03120 12512 9849 gene locus_tag LOCUS_03130 gene rad50 12512 9849 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878532.1 protein_id gnl|my_center|LOCUS_03130 13894 12509 gene locus_tag LOCUS_03140 13894 12509 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878531.1 protein_id gnl|my_center|LOCUS_03140 15563 13896 gene locus_tag LOCUS_03150 15563 13896 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878530.1 protein_id gnl|my_center|LOCUS_03150 17955 15766 gene locus_tag LOCUS_03160 17955 15766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 18535 18131 gene locus_tag LOCUS_03170 18535 18131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03170 19174 20529 gene locus_tag LOCUS_03180 gene serS 19174 20529 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250091.1 protein_id gnl|my_center|LOCUS_03180 21107 20993 gene locus_tag LOCUS_r00010 21107 20993 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence011 4577 3234 gene locus_tag LOCUS_03190 4577 3234 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053749.1 protein_id gnl|my_center|LOCUS_03190 5476 4574 gene locus_tag LOCUS_03200 5476 4574 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146501.1 protein_id gnl|my_center|LOCUS_03200 6847 5522 gene locus_tag LOCUS_03210 6847 5522 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867301.1 protein_id gnl|my_center|LOCUS_03210 9212 6993 gene locus_tag LOCUS_03220 9212 6993 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251122.1 protein_id gnl|my_center|LOCUS_03220 11356 9377 gene locus_tag LOCUS_03230 11356 9377 CDS product alpha amylase N-terminal ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250721.1 protein_id gnl|my_center|LOCUS_03230 11430 12455 gene locus_tag LOCUS_03240 11430 12455 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250720.1 protein_id gnl|my_center|LOCUS_03240 12480 13838 gene locus_tag LOCUS_03250 12480 13838 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250719.1 protein_id gnl|my_center|LOCUS_03250 13843 14295 gene locus_tag LOCUS_03260 13843 14295 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250590.1 protein_id gnl|my_center|LOCUS_03260 14748 14287 gene locus_tag LOCUS_03270 14748 14287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 14933 15616 gene locus_tag LOCUS_03280 14933 15616 CDS product DUF4152 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250597.1 protein_id gnl|my_center|LOCUS_03280 15698 17584 gene locus_tag LOCUS_03290 gene iorA 15698 17584 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250594.1 protein_id gnl|my_center|LOCUS_03290 17851 17603 gene locus_tag LOCUS_03300 17851 17603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146712.1 protein_id gnl|my_center|LOCUS_03300 17923 18210 gene locus_tag LOCUS_03310 17923 18210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250592.1 protein_id gnl|my_center|LOCUS_03310 18983 18309 gene locus_tag LOCUS_03320 18983 18309 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867624.1 protein_id gnl|my_center|LOCUS_03320 19661 21022 gene locus_tag LOCUS_03330 gene acdAII 19661 21022 CDS product acetate--CoA ligase I subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868410.1 protein_id gnl|my_center|LOCUS_03330 >Feature sequence012 840 1451 gene locus_tag LOCUS_03340 840 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249088.1 protein_id gnl|my_center|LOCUS_03340 1732 2997 gene locus_tag LOCUS_03350 1732 2997 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250852.1 protein_id gnl|my_center|LOCUS_03350 3015 4916 gene locus_tag LOCUS_03360 3015 4916 CDS product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867245.1 protein_id gnl|my_center|LOCUS_03360 4926 8678 gene locus_tag LOCUS_03370 4926 8678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 9717 8671 gene locus_tag LOCUS_03380 9717 8671 CDS product Clp1/GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146503.1 protein_id gnl|my_center|LOCUS_03380 9921 10379 gene locus_tag LOCUS_03390 9921 10379 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867309.1 protein_id gnl|my_center|LOCUS_03390 11767 10388 gene locus_tag LOCUS_03400 11767 10388 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868821.1 protein_id gnl|my_center|LOCUS_03400 11942 11867 gene locus_tag LOCUS_t00080 11942 11867 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 12028 11951 gene locus_tag LOCUS_t00090 12028 11951 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 12255 12178 gene locus_tag LOCUS_t00100 12255 12178 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 12382 12268 gene locus_tag LOCUS_r00020 12382 12268 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 12484 13065 gene locus_tag LOCUS_03410 gene scpB 12484 13065 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250912.1 protein_id gnl|my_center|LOCUS_03410 13263 14312 gene locus_tag LOCUS_03420 13263 14312 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146527.1 protein_id gnl|my_center|LOCUS_03420 14314 14685 gene locus_tag LOCUS_03430 14314 14685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867408.1 protein_id gnl|my_center|LOCUS_03430 14682 15482 gene locus_tag LOCUS_03440 14682 15482 CDS product RPA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146526.1 protein_id gnl|my_center|LOCUS_03440 15533 16384 gene locus_tag LOCUS_03450 15533 16384 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250907.1 protein_id gnl|my_center|LOCUS_03450 16381 16773 gene locus_tag LOCUS_03460 16381 16773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250908.1 protein_id gnl|my_center|LOCUS_03460 16783 17325 gene locus_tag LOCUS_03470 gene pyrE 16783 17325 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868222.1 protein_id gnl|my_center|LOCUS_03470 18681 17341 gene locus_tag LOCUS_03480 18681 17341 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251077.1 protein_id gnl|my_center|LOCUS_03480 19792 18686 gene locus_tag LOCUS_03490 19792 18686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 19870 20352 gene locus_tag LOCUS_03500 gene coaD 19870 20352 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251078.1 protein_id gnl|my_center|LOCUS_03500 >Feature sequence013 430 732 gene locus_tag LOCUS_03510 430 732 CDS product FUN14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250444.1 protein_id gnl|my_center|LOCUS_03510 765 2084 gene locus_tag LOCUS_03520 765 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868094.1 protein_id gnl|my_center|LOCUS_03520 2137 2580 gene locus_tag LOCUS_03530 2137 2580 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249180.1 protein_id gnl|my_center|LOCUS_03530 2601 3185 gene locus_tag LOCUS_03540 2601 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 3185 3478 gene locus_tag LOCUS_03550 3185 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 3507 4115 gene locus_tag LOCUS_03560 3507 4115 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251241.1 protein_id gnl|my_center|LOCUS_03560 4315 4112 gene locus_tag LOCUS_03570 4315 4112 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867951.1 protein_id gnl|my_center|LOCUS_03570 4604 5968 gene locus_tag LOCUS_03580 4604 5968 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_03580 6183 8123 gene locus_tag LOCUS_03590 6183 8123 CDS product 1,4-alpha-glucan branching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867884.1 protein_id gnl|my_center|LOCUS_03590 8204 8521 gene locus_tag LOCUS_03600 8204 8521 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250386.1 protein_id gnl|my_center|LOCUS_03600 8591 9385 gene locus_tag LOCUS_03610 8591 9385 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249694.1 protein_id gnl|my_center|LOCUS_03610 9511 10317 gene locus_tag LOCUS_03620 9511 10317 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867487.1 protein_id gnl|my_center|LOCUS_03620 10314 11060 gene locus_tag LOCUS_03630 10314 11060 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867487.1 protein_id gnl|my_center|LOCUS_03630 13551 11050 gene locus_tag LOCUS_03640 13551 11050 CDS product DUF5814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249521.1 protein_id gnl|my_center|LOCUS_03640 13847 13656 gene locus_tag LOCUS_03650 13847 13656 CDS product PCNA-inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249759.1 protein_id gnl|my_center|LOCUS_03650 14166 15974 gene locus_tag LOCUS_03660 gene glmS 14166 15974 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249760.1 protein_id gnl|my_center|LOCUS_03660 15985 18858 gene locus_tag LOCUS_03670 15985 18858 CDS product STT3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249761.1 protein_id gnl|my_center|LOCUS_03670 >Feature sequence014 <1 2726 gene locus_tag LOCUS_03680 <1 2726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250518.1:alanine--tRNA ligase 3547 2759 gene locus_tag LOCUS_03690 3547 2759 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868539.1 protein_id gnl|my_center|LOCUS_03690 3589 5331 gene locus_tag LOCUS_03700 3589 5331 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250525.1 protein_id gnl|my_center|LOCUS_03700 7026 5341 gene locus_tag LOCUS_03710 7026 5341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 7090 7611 gene locus_tag LOCUS_03720 7090 7611 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250531.1 protein_id gnl|my_center|LOCUS_03720 7595 8086 gene locus_tag LOCUS_03730 7595 8086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250532.1 protein_id gnl|my_center|LOCUS_03730 8210 8941 gene locus_tag LOCUS_03740 8210 8941 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250639.1 protein_id gnl|my_center|LOCUS_03740 9861 9073 gene locus_tag LOCUS_03750 9861 9073 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250637.1 protein_id gnl|my_center|LOCUS_03750 10675 9866 gene locus_tag LOCUS_03760 10675 9866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 11394 10708 gene locus_tag LOCUS_03770 11394 10708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 11900 11436 gene locus_tag LOCUS_03780 11900 11436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250634.1 protein_id gnl|my_center|LOCUS_03780 12471 12040 gene locus_tag LOCUS_03790 12471 12040 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251148.1 protein_id gnl|my_center|LOCUS_03790 13423 12527 gene locus_tag LOCUS_03800 13423 12527 CDS product thiamine-phosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868447.1 protein_id gnl|my_center|LOCUS_03800 13631 14557 gene locus_tag LOCUS_03810 gene pyrB 13631 14557 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251146.1 protein_id gnl|my_center|LOCUS_03810 14554 15009 gene locus_tag LOCUS_03820 gene pyrI 14554 15009 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868441.1 protein_id gnl|my_center|LOCUS_03820 15672 15085 gene locus_tag LOCUS_03830 15672 15085 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251144.1 protein_id gnl|my_center|LOCUS_03830 16512 15784 gene locus_tag LOCUS_03840 16512 15784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053379.1 protein_id gnl|my_center|LOCUS_03840 18235 16667 gene locus_tag LOCUS_03850 18235 16667 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146661.1 protein_id gnl|my_center|LOCUS_03850 >Feature sequence015 259 876 gene locus_tag LOCUS_03860 259 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867736.1 protein_id gnl|my_center|LOCUS_03860 917 1303 gene locus_tag LOCUS_03870 917 1303 CDS product DUF2240 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053860.1 protein_id gnl|my_center|LOCUS_03870 1339 1725 gene locus_tag LOCUS_03880 1339 1725 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867598.1 protein_id gnl|my_center|LOCUS_03880 1747 3102 gene locus_tag LOCUS_03890 gene dnaG 1747 3102 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250361.1 protein_id gnl|my_center|LOCUS_03890 3185 4900 gene locus_tag LOCUS_03900 3185 4900 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250359.1 protein_id gnl|my_center|LOCUS_03900 5195 4902 gene locus_tag LOCUS_03910 5195 4902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250941.1 protein_id gnl|my_center|LOCUS_03910 5322 6071 gene locus_tag LOCUS_03920 gene sufC 5322 6071 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249682.1 protein_id gnl|my_center|LOCUS_03920 6064 7392 gene locus_tag LOCUS_03930 6064 7392 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249681.1 protein_id gnl|my_center|LOCUS_03930 7639 8145 gene locus_tag LOCUS_03940 7639 8145 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867824.1 protein_id gnl|my_center|LOCUS_03940 8142 8396 gene locus_tag LOCUS_03950 8142 8396 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867825.1 protein_id gnl|my_center|LOCUS_03950 8393 8755 gene locus_tag LOCUS_03960 gene mnhG 8393 8755 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867826.1 protein_id gnl|my_center|LOCUS_03960 8752 9033 gene locus_tag LOCUS_03970 8752 9033 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250174.1 protein_id gnl|my_center|LOCUS_03970 9027 9740 gene locus_tag LOCUS_03980 9027 9740 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053840.1 protein_id gnl|my_center|LOCUS_03980 9733 10077 gene locus_tag LOCUS_03990 9733 10077 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867829.1 protein_id gnl|my_center|LOCUS_03990 10074 11558 gene locus_tag LOCUS_04000 10074 11558 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250171.1 protein_id gnl|my_center|LOCUS_04000 11555 13414 gene locus_tag LOCUS_04010 11555 13414 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250170.1 protein_id gnl|my_center|LOCUS_04010 13415 14308 gene locus_tag LOCUS_04020 13415 14308 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250169.1 protein_id gnl|my_center|LOCUS_04020 14331 14909 gene locus_tag LOCUS_04030 14331 14909 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053713.1 protein_id gnl|my_center|LOCUS_04030 14900 15412 gene locus_tag LOCUS_04040 14900 15412 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053712.1 protein_id gnl|my_center|LOCUS_04040 15423 16607 gene locus_tag LOCUS_04050 15423 16607 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250166.1 protein_id gnl|my_center|LOCUS_04050 16613 17236 gene locus_tag LOCUS_04060 gene nuoI 16613 17236 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053711.1 protein_id gnl|my_center|LOCUS_04060 <18378 17357 gene locus_tag LOCUS_04070 <18378 17357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250357.1:maltodextrin phosphorylase >Feature sequence016 73 2514 gene locus_tag LOCUS_04080 73 2514 CDS product tRNA(Met) cytidine acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249705.1 protein_id gnl|my_center|LOCUS_04080 2579 3088 gene locus_tag LOCUS_04090 2579 3088 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249706.1 protein_id gnl|my_center|LOCUS_04090 3085 3621 gene locus_tag LOCUS_04100 3085 3621 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867206.1 protein_id gnl|my_center|LOCUS_04100 3652 4563 gene locus_tag LOCUS_04110 3652 4563 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868678.1 protein_id gnl|my_center|LOCUS_04110 4756 5292 gene locus_tag LOCUS_04120 4756 5292 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250651.1 protein_id gnl|my_center|LOCUS_04120 5327 5887 gene locus_tag LOCUS_04130 5327 5887 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868803.1 protein_id gnl|my_center|LOCUS_04130 5887 6069 gene locus_tag LOCUS_04140 5887 6069 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868804.1 protein_id gnl|my_center|LOCUS_04140 6071 6616 gene locus_tag LOCUS_04150 6071 6616 CDS product GTP-dependent dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053746.1 protein_id gnl|my_center|LOCUS_04150 6606 6902 gene locus_tag LOCUS_04160 6606 6902 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250647.1 protein_id gnl|my_center|LOCUS_04160 6907 7080 gene locus_tag LOCUS_04170 6907 7080 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250646.1 protein_id gnl|my_center|LOCUS_04170 7298 7807 gene locus_tag LOCUS_04180 7298 7807 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868358.1 protein_id gnl|my_center|LOCUS_04180 7857 8438 gene locus_tag LOCUS_04190 7857 8438 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250624.1 protein_id gnl|my_center|LOCUS_04190 8566 8426 gene locus_tag LOCUS_04200 8566 8426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 8689 9660 gene locus_tag LOCUS_04210 gene twy1 8689 9660 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250622.1 protein_id gnl|my_center|LOCUS_04210 9761 11986 gene locus_tag LOCUS_04220 9761 11986 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755810.1 protein_id gnl|my_center|LOCUS_04220 11995 13089 gene locus_tag LOCUS_04230 11995 13089 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250620.1 protein_id gnl|my_center|LOCUS_04230 13082 13765 gene locus_tag LOCUS_04240 13082 13765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250619.1 protein_id gnl|my_center|LOCUS_04240 13813 14409 gene locus_tag LOCUS_04250 13813 14409 CDS product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867934.1 protein_id gnl|my_center|LOCUS_04250 14411 14845 gene locus_tag LOCUS_04260 14411 14845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 14826 15305 gene locus_tag LOCUS_04270 14826 15305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010885428.1 protein_id gnl|my_center|LOCUS_04270 15302 16702 gene locus_tag LOCUS_04280 15302 16702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867931.1 protein_id gnl|my_center|LOCUS_04280 >Feature sequence017 <1 639 gene locus_tag LOCUS_04290 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048053756.1:ATP-binding protein 2533 644 gene locus_tag LOCUS_04300 2533 644 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250999.1 protein_id gnl|my_center|LOCUS_04300 2968 2585 gene locus_tag LOCUS_04310 2968 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 3536 2886 gene locus_tag LOCUS_04320 3536 2886 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251001.1 protein_id gnl|my_center|LOCUS_04320 3592 3819 gene locus_tag LOCUS_04330 3592 3819 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251002.1 protein_id gnl|my_center|LOCUS_04330 3884 4513 gene locus_tag LOCUS_04340 3884 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251102.1 protein_id gnl|my_center|LOCUS_04340 5555 4488 gene locus_tag LOCUS_04350 5555 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 5657 5989 gene locus_tag LOCUS_04360 5657 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 6004 7050 gene locus_tag LOCUS_04370 6004 7050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 7047 7937 gene locus_tag LOCUS_04380 7047 7937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 7934 9640 gene locus_tag LOCUS_04390 7934 9640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 9645 10418 gene locus_tag LOCUS_04400 9645 10418 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249118.1 protein_id gnl|my_center|LOCUS_04400 10415 10822 gene locus_tag LOCUS_04410 10415 10822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250538.1 protein_id gnl|my_center|LOCUS_04410 10809 11477 gene locus_tag LOCUS_04420 10809 11477 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249116.1 protein_id gnl|my_center|LOCUS_04420 12854 11463 gene locus_tag LOCUS_04430 12854 11463 CDS product DUF2079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011012764.1 protein_id gnl|my_center|LOCUS_04430 13034 14284 gene locus_tag LOCUS_04440 13034 14284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 15993 14287 gene locus_tag LOCUS_04450 gene arcS 15993 14287 CDS product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251106.1 protein_id gnl|my_center|LOCUS_04450 16901 15996 gene locus_tag LOCUS_04460 16901 15996 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251107.1 protein_id gnl|my_center|LOCUS_04460 >Feature sequence018 936 280 gene locus_tag LOCUS_04470 gene radB 936 280 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251181.1 protein_id gnl|my_center|LOCUS_04470 1577 939 gene locus_tag LOCUS_04480 1577 939 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251182.1 protein_id gnl|my_center|LOCUS_04480 1732 2736 gene locus_tag LOCUS_04490 1732 2736 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249816.1 protein_id gnl|my_center|LOCUS_04490 2953 3102 gene locus_tag LOCUS_04500 2953 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 3952 3107 gene locus_tag LOCUS_04510 3952 3107 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868801.1 protein_id gnl|my_center|LOCUS_04510 5041 3974 gene locus_tag LOCUS_04520 5041 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 6185 5016 gene locus_tag LOCUS_04530 6185 5016 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053635.1 protein_id gnl|my_center|LOCUS_04530 6487 6182 gene locus_tag LOCUS_04540 6487 6182 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868800.1 protein_id gnl|my_center|LOCUS_04540 7050 6529 gene locus_tag LOCUS_04550 7050 6529 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871083.1 protein_id gnl|my_center|LOCUS_04550 9827 7080 gene locus_tag LOCUS_04560 9827 7080 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249966.1 protein_id gnl|my_center|LOCUS_04560 10020 10613 gene locus_tag LOCUS_04570 10020 10613 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251083.1 protein_id gnl|my_center|LOCUS_04570 10606 11175 gene locus_tag LOCUS_04580 10606 11175 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251082.1 protein_id gnl|my_center|LOCUS_04580 11435 11184 gene locus_tag LOCUS_04590 11435 11184 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251081.1 protein_id gnl|my_center|LOCUS_04590 12701 11550 gene locus_tag LOCUS_04600 12701 11550 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251228.1 protein_id gnl|my_center|LOCUS_04600 14069 12804 gene locus_tag LOCUS_04610 14069 12804 CDS product bifunctional L-myo-inositol-1-phosphate cytidylyltransferase/CDP-L-myo-inositol myo-inositolphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868152.1 protein_id gnl|my_center|LOCUS_04610 14169 14882 gene locus_tag LOCUS_04620 14169 14882 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867275.1 protein_id gnl|my_center|LOCUS_04620 15926 14907 gene locus_tag LOCUS_04630 gene gyaR 15926 14907 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249634.1 protein_id gnl|my_center|LOCUS_04630 16015 16845 gene locus_tag LOCUS_04640 16015 16845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 >Feature sequence019 185 895 gene locus_tag LOCUS_04650 185 895 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250338.1 protein_id gnl|my_center|LOCUS_04650 888 1094 gene locus_tag LOCUS_04660 888 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250339.1 protein_id gnl|my_center|LOCUS_04660 1162 1947 gene locus_tag LOCUS_04670 1162 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 1944 2159 gene locus_tag LOCUS_04680 1944 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 2934 2308 gene locus_tag LOCUS_04690 gene tmk 2934 2308 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250354.1 protein_id gnl|my_center|LOCUS_04690 3735 3028 gene locus_tag LOCUS_04700 3735 3028 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250355.1 protein_id gnl|my_center|LOCUS_04700 4831 3746 gene locus_tag LOCUS_04710 4831 3746 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867600.1 protein_id gnl|my_center|LOCUS_04710 4962 6011 gene locus_tag LOCUS_04720 gene tdh 4962 6011 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249867.1 protein_id gnl|my_center|LOCUS_04720 6146 8014 gene locus_tag LOCUS_04730 6146 8014 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250356.1 protein_id gnl|my_center|LOCUS_04730 8091 8336 gene locus_tag LOCUS_04740 8091 8336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 8477 9661 gene locus_tag LOCUS_04750 8477 9661 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251167.1 protein_id gnl|my_center|LOCUS_04750 9769 10617 gene locus_tag LOCUS_04760 9769 10617 CDS product DUF835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251166.1 protein_id gnl|my_center|LOCUS_04760 10711 11421 gene locus_tag LOCUS_04770 10711 11421 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867428.1 protein_id gnl|my_center|LOCUS_04770 12111 11365 gene locus_tag LOCUS_04780 12111 11365 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250224.1 protein_id gnl|my_center|LOCUS_04780 12373 12116 gene locus_tag LOCUS_04790 12373 12116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04790 12756 13436 gene locus_tag LOCUS_04800 12756 13436 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251230.1 protein_id gnl|my_center|LOCUS_04800 13433 13786 gene locus_tag LOCUS_04810 13433 13786 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251233.1 protein_id gnl|my_center|LOCUS_04810 15272 13776 gene locus_tag LOCUS_04820 15272 13776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868132.1 protein_id gnl|my_center|LOCUS_04820 16042 15281 gene locus_tag LOCUS_04830 16042 15281 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868133.1 protein_id gnl|my_center|LOCUS_04830 >Feature sequence020 525 46 gene locus_tag LOCUS_04840 525 46 CDS product PH1570 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250114.1 protein_id gnl|my_center|LOCUS_04840 1540 530 gene locus_tag LOCUS_04850 gene sppA 1540 530 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867714.1 protein_id gnl|my_center|LOCUS_04850 1602 2453 gene locus_tag LOCUS_04860 1602 2453 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867495.1 protein_id gnl|my_center|LOCUS_04860 2514 2750 gene locus_tag LOCUS_04870 2514 2750 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249927.1 protein_id gnl|my_center|LOCUS_04870 2762 2935 gene locus_tag LOCUS_04880 2762 2935 CDS product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249926.1 protein_id gnl|my_center|LOCUS_04880 4182 3124 gene locus_tag LOCUS_04890 4182 3124 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250141.1 protein_id gnl|my_center|LOCUS_04890 4618 4367 gene locus_tag LOCUS_04900 4618 4367 CDS product DUF504 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868176.1 protein_id gnl|my_center|LOCUS_04900 5317 4628 gene locus_tag LOCUS_04910 5317 4628 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249269.1 protein_id gnl|my_center|LOCUS_04910 5764 6060 gene locus_tag LOCUS_04920 5764 6060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 6067 6987 gene locus_tag LOCUS_04930 6067 6987 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053897.1 protein_id gnl|my_center|LOCUS_04930 7110 9227 gene locus_tag LOCUS_04940 gene metG 7110 9227 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250000.1 protein_id gnl|my_center|LOCUS_04940 9309 9689 gene locus_tag LOCUS_04950 9309 9689 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867195.1 protein_id gnl|my_center|LOCUS_04950 9714 10004 gene locus_tag LOCUS_04960 9714 10004 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250211.1 protein_id gnl|my_center|LOCUS_04960 10185 10634 gene locus_tag LOCUS_04970 10185 10634 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053714.1 protein_id gnl|my_center|LOCUS_04970 10724 11434 gene locus_tag LOCUS_04980 10724 11434 CDS product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209477179.1 protein_id gnl|my_center|LOCUS_04980 11447 11974 gene locus_tag LOCUS_04990 11447 11974 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867975.1 protein_id gnl|my_center|LOCUS_04990 12093 12377 gene locus_tag LOCUS_05000 12093 12377 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868833.1 protein_id gnl|my_center|LOCUS_05000 12381 12578 gene locus_tag LOCUS_05010 12381 12578 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250050.1 protein_id gnl|my_center|LOCUS_05010 12687 13514 gene locus_tag LOCUS_05020 12687 13514 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250051.1 protein_id gnl|my_center|LOCUS_05020 13511 13684 gene locus_tag LOCUS_05030 13511 13684 CDS product RNA-protein complex protein Nop10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867970.1 protein_id gnl|my_center|LOCUS_05030 13690 14472 gene locus_tag LOCUS_05040 13690 14472 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867971.1 protein_id gnl|my_center|LOCUS_05040 14521 15792 gene locus_tag LOCUS_05050 14521 15792 CDS product TIGR00375 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249838.1 protein_id gnl|my_center|LOCUS_05050 16110 15793 gene locus_tag LOCUS_05060 16110 15793 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868474.1 protein_id gnl|my_center|LOCUS_05060 16472 16086 gene locus_tag LOCUS_05070 16472 16086 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868473.1 protein_id gnl|my_center|LOCUS_05070 >Feature sequence021 1592 1224 gene locus_tag LOCUS_05080 1592 1224 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251036.1 protein_id gnl|my_center|LOCUS_05080 2049 1582 gene locus_tag LOCUS_05090 2049 1582 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867848.1 protein_id gnl|my_center|LOCUS_05090 2321 2046 gene locus_tag LOCUS_05100 2321 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251034.1 protein_id gnl|my_center|LOCUS_05100 2581 2318 gene locus_tag LOCUS_05110 2581 2318 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251033.1 protein_id gnl|my_center|LOCUS_05110 2928 2578 gene locus_tag LOCUS_05120 gene mnhG 2928 2578 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251032.1 protein_id gnl|my_center|LOCUS_05120 3224 2925 gene locus_tag LOCUS_05130 3224 2925 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146638.1 protein_id gnl|my_center|LOCUS_05130 3724 3221 gene locus_tag LOCUS_05140 3724 3221 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867852.1 protein_id gnl|my_center|LOCUS_05140 4531 4106 gene locus_tag LOCUS_05150 4531 4106 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867840.1 protein_id gnl|my_center|LOCUS_05150 5517 4528 gene locus_tag LOCUS_05160 5517 4528 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053771.1 protein_id gnl|my_center|LOCUS_05160 6809 5514 gene locus_tag LOCUS_05170 6809 5514 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867842.1 protein_id gnl|my_center|LOCUS_05170 7330 6806 gene locus_tag LOCUS_05180 7330 6806 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867843.1 protein_id gnl|my_center|LOCUS_05180 7797 7327 gene locus_tag LOCUS_05190 7797 7327 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251039.1 protein_id gnl|my_center|LOCUS_05190 8149 7802 gene locus_tag LOCUS_05200 8149 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053770.1 protein_id gnl|my_center|LOCUS_05200 9686 8151 gene locus_tag LOCUS_05210 9686 8151 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251037.1 protein_id gnl|my_center|LOCUS_05210 10045 9683 gene locus_tag LOCUS_05220 10045 9683 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251036.1 protein_id gnl|my_center|LOCUS_05220 10488 10042 gene locus_tag LOCUS_05230 10488 10042 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251035.1 protein_id gnl|my_center|LOCUS_05230 10777 10481 gene locus_tag LOCUS_05240 10777 10481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251034.1 protein_id gnl|my_center|LOCUS_05240 11040 10774 gene locus_tag LOCUS_05250 11040 10774 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251033.1 protein_id gnl|my_center|LOCUS_05250 11402 11037 gene locus_tag LOCUS_05260 gene mnhG 11402 11037 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251032.1 protein_id gnl|my_center|LOCUS_05260 11662 11399 gene locus_tag LOCUS_05270 11662 11399 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251031.1 protein_id gnl|my_center|LOCUS_05270 12159 11659 gene locus_tag LOCUS_05280 12159 11659 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867852.1 protein_id gnl|my_center|LOCUS_05280 12382 13749 gene locus_tag LOCUS_05290 12382 13749 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251119.1 protein_id gnl|my_center|LOCUS_05290 13810 14298 gene locus_tag LOCUS_05300 13810 14298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 14324 15628 gene locus_tag LOCUS_05310 14324 15628 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251120.1 protein_id gnl|my_center|LOCUS_05310 15716 16378 gene locus_tag LOCUS_05320 15716 16378 CDS product DUF257 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209474667.1 protein_id gnl|my_center|LOCUS_05320 >Feature sequence022 1416 232 gene locus_tag LOCUS_05330 gene porA 1416 232 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868478.1 protein_id gnl|my_center|LOCUS_05330 1744 1427 gene locus_tag LOCUS_05340 gene porD 1744 1427 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250932.1 protein_id gnl|my_center|LOCUS_05340 2735 1800 gene locus_tag LOCUS_05350 2735 1800 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250931.1 protein_id gnl|my_center|LOCUS_05350 3913 2741 gene locus_tag LOCUS_05360 3913 2741 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250930.1 protein_id gnl|my_center|LOCUS_05360 4240 3923 gene locus_tag LOCUS_05370 4240 3923 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250929.1 protein_id gnl|my_center|LOCUS_05370 4863 4306 gene locus_tag LOCUS_05380 4863 4306 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868483.1 protein_id gnl|my_center|LOCUS_05380 5122 6084 gene locus_tag LOCUS_05390 5122 6084 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250927.1 protein_id gnl|my_center|LOCUS_05390 7352 6081 gene locus_tag LOCUS_05400 gene hflX 7352 6081 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250926.1 protein_id gnl|my_center|LOCUS_05400 7604 9229 gene locus_tag LOCUS_05410 7604 9229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250925.1 protein_id gnl|my_center|LOCUS_05410 9308 9667 gene locus_tag LOCUS_05420 9308 9667 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250924.1 protein_id gnl|my_center|LOCUS_05420 10006 9668 gene locus_tag LOCUS_05430 10006 9668 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250923.1 protein_id gnl|my_center|LOCUS_05430 11337 10021 gene locus_tag LOCUS_05440 gene hisS 11337 10021 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250513.1 protein_id gnl|my_center|LOCUS_05440 11993 11385 gene locus_tag LOCUS_05450 11993 11385 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867324.1 protein_id gnl|my_center|LOCUS_05450 13477 12023 gene locus_tag LOCUS_05460 13477 12023 CDS product dolichyl-phosphate-mannose--protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209475414.1 protein_id gnl|my_center|LOCUS_05460 13598 15475 gene locus_tag LOCUS_05470 13598 15475 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868458.1 protein_id gnl|my_center|LOCUS_05470 16252 15527 gene locus_tag LOCUS_05480 16252 15527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088856129.1 protein_id gnl|my_center|LOCUS_05480 >Feature sequence023 349 1215 gene locus_tag LOCUS_05490 349 1215 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249729.1 protein_id gnl|my_center|LOCUS_05490 1233 2069 gene locus_tag LOCUS_05500 gene xerA 1233 2069 CDS product tyrosine recombinase XerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249728.1 protein_id gnl|my_center|LOCUS_05500 3459 2071 gene locus_tag LOCUS_05510 gene pfkC 3459 2071 CDS product ADP-specific phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249331.1 protein_id gnl|my_center|LOCUS_05510 4274 3666 gene locus_tag LOCUS_05520 4274 3666 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249325.1 protein_id gnl|my_center|LOCUS_05520 4384 5097 gene locus_tag LOCUS_05530 4384 5097 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249330.1 protein_id gnl|my_center|LOCUS_05530 5234 6565 gene locus_tag LOCUS_05540 5234 6565 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250162.1 protein_id gnl|my_center|LOCUS_05540 6697 8124 gene locus_tag LOCUS_05550 6697 8124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 8273 8656 gene locus_tag LOCUS_05560 8273 8656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05560 8746 8985 gene locus_tag LOCUS_05570 8746 8985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05570 8985 9218 gene locus_tag LOCUS_05580 8985 9218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05580 10850 9225 gene locus_tag LOCUS_05590 10850 9225 CDS product DUF4932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146715.1 protein_id gnl|my_center|LOCUS_05590 10953 11489 gene locus_tag LOCUS_05600 10953 11489 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250601.1 protein_id gnl|my_center|LOCUS_05600 12405 11476 gene locus_tag LOCUS_05610 12405 11476 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250600.1 protein_id gnl|my_center|LOCUS_05610 12534 12857 gene locus_tag LOCUS_05620 12534 12857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 13281 12847 gene locus_tag LOCUS_05630 13281 12847 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228850.1 protein_id gnl|my_center|LOCUS_05630 14337 13354 gene locus_tag LOCUS_05640 14337 13354 CDS product cell wall-binding repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249097.1 protein_id gnl|my_center|LOCUS_05640 14647 14571 gene locus_tag LOCUS_t00110 14647 14571 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15414 14791 gene locus_tag LOCUS_05650 15414 14791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250858.1 protein_id gnl|my_center|LOCUS_05650 15493 15569 gene locus_tag LOCUS_t00120 15493 15569 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence024 1996 2082 gene locus_tag LOCUS_t00130 1996 2082 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2104 2178 gene locus_tag LOCUS_t00140 2104 2178 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2230 2559 gene locus_tag LOCUS_05660 gene metG 2230 2559 CDS product methionine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867535.1 protein_id gnl|my_center|LOCUS_05660 2560 3390 gene locus_tag LOCUS_05670 gene speB 2560 3390 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 protein_id gnl|my_center|LOCUS_05670 3395 4525 gene locus_tag LOCUS_05680 gene thrC 3395 4525 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251155.1 protein_id gnl|my_center|LOCUS_05680 4978 4538 gene locus_tag LOCUS_05690 4978 4538 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147325.1 protein_id gnl|my_center|LOCUS_05690 6544 4985 gene locus_tag LOCUS_05700 6544 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251151.1 protein_id gnl|my_center|LOCUS_05700 6623 8044 gene locus_tag LOCUS_05710 6623 8044 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251254.1 protein_id gnl|my_center|LOCUS_05710 9135 8041 gene locus_tag LOCUS_05720 9135 8041 CDS product TRM11 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248963.1 protein_id gnl|my_center|LOCUS_05720 9315 10604 gene locus_tag LOCUS_05730 9315 10604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248964.1 protein_id gnl|my_center|LOCUS_05730 10570 10878 gene locus_tag LOCUS_05740 10570 10878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 10875 11273 gene locus_tag LOCUS_05750 10875 11273 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868534.1 protein_id gnl|my_center|LOCUS_05750 12270 11254 gene locus_tag LOCUS_05760 12270 11254 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251173.1 protein_id gnl|my_center|LOCUS_05760 13117 12236 gene locus_tag LOCUS_05770 13117 12236 CDS product DUF835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251174.1 protein_id gnl|my_center|LOCUS_05770 14103 13177 gene locus_tag LOCUS_05780 gene moaA 14103 13177 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251175.1 protein_id gnl|my_center|LOCUS_05780 14569 14165 gene locus_tag LOCUS_05790 14569 14165 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868143.1 protein_id gnl|my_center|LOCUS_05790 14787 15467 gene locus_tag LOCUS_05800 14787 15467 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249143.1 protein_id gnl|my_center|LOCUS_05800 <16111 15464 gene locus_tag LOCUS_05810 <16111 15464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249142.1:gamma-glutamyl-gamma-aminobutyrate hydrolase family protein >Feature sequence025 <1 1155 gene locus_tag LOCUS_05820 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250246.1:C1 family peptidase 1262 2134 gene locus_tag LOCUS_05830 1262 2134 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147080.1 protein_id gnl|my_center|LOCUS_05830 2149 2565 gene locus_tag LOCUS_05840 2149 2565 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147078.1 protein_id gnl|my_center|LOCUS_05840 2605 2907 gene locus_tag LOCUS_05850 2605 2907 CDS product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868107.1 protein_id gnl|my_center|LOCUS_05850 2913 4073 gene locus_tag LOCUS_05860 2913 4073 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250248.1 protein_id gnl|my_center|LOCUS_05860 4113 5180 gene locus_tag LOCUS_05870 4113 5180 CDS product DUF1464 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250249.1 protein_id gnl|my_center|LOCUS_05870 5234 6556 gene locus_tag LOCUS_05880 gene cdr 5234 6556 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250250.1 protein_id gnl|my_center|LOCUS_05880 7410 6583 gene locus_tag LOCUS_05890 7410 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251143.1 protein_id gnl|my_center|LOCUS_05890 7686 7411 gene locus_tag LOCUS_05900 7686 7411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250941.1 protein_id gnl|my_center|LOCUS_05900 8931 7753 gene locus_tag LOCUS_05910 8931 7753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250410.1 protein_id gnl|my_center|LOCUS_05910 10417 9221 gene locus_tag LOCUS_05920 10417 9221 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867356.1 protein_id gnl|my_center|LOCUS_05920 10647 11312 gene locus_tag LOCUS_05930 10647 11312 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867364.1 protein_id gnl|my_center|LOCUS_05930 11786 11325 gene locus_tag LOCUS_05940 11786 11325 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867840.1 protein_id gnl|my_center|LOCUS_05940 12755 11790 gene locus_tag LOCUS_05950 12755 11790 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939562.1 protein_id gnl|my_center|LOCUS_05950 13990 12752 gene locus_tag LOCUS_05960 13990 12752 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867842.1 protein_id gnl|my_center|LOCUS_05960 14535 13987 gene locus_tag LOCUS_05970 14535 13987 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867843.1 protein_id gnl|my_center|LOCUS_05970 14975 14532 gene locus_tag LOCUS_05980 14975 14532 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867844.1 protein_id gnl|my_center|LOCUS_05980 15318 14977 gene locus_tag LOCUS_05990 15318 14977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 >Feature sequence026 299 120 gene locus_tag LOCUS_06000 299 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 1018 284 gene locus_tag LOCUS_06010 gene mpgP 1018 284 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868346.1 protein_id gnl|my_center|LOCUS_06010 2208 1024 gene locus_tag LOCUS_06020 gene mpgS 2208 1024 CDS product mannosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868345.1 protein_id gnl|my_center|LOCUS_06020 3728 2331 gene locus_tag LOCUS_06030 3728 2331 CDS product ADP-specific glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250061.1 protein_id gnl|my_center|LOCUS_06030 4320 3754 gene locus_tag LOCUS_06040 gene pgiA 4320 3754 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250062.1 protein_id gnl|my_center|LOCUS_06040 4975 4394 gene locus_tag LOCUS_06050 4975 4394 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868689.1 protein_id gnl|my_center|LOCUS_06050 5157 4978 gene locus_tag LOCUS_06060 5157 4978 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250063.1 protein_id gnl|my_center|LOCUS_06060 5883 5218 gene locus_tag LOCUS_06070 5883 5218 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250064.1 protein_id gnl|my_center|LOCUS_06070 6745 5861 gene locus_tag LOCUS_06080 6745 5861 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250065.1 protein_id gnl|my_center|LOCUS_06080 7650 6811 gene locus_tag LOCUS_06090 7650 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 8094 7705 gene locus_tag LOCUS_06100 8094 7705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 9068 8091 gene locus_tag LOCUS_06110 9068 8091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 9311 10264 gene locus_tag LOCUS_06120 9311 10264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053704.1 protein_id gnl|my_center|LOCUS_06120 10289 11206 gene locus_tag LOCUS_06130 10289 11206 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146981.1 protein_id gnl|my_center|LOCUS_06130 11761 11186 gene locus_tag LOCUS_06140 gene mobA 11761 11186 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250952.1 protein_id gnl|my_center|LOCUS_06140 12886 11762 gene locus_tag LOCUS_06150 12886 11762 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250252.1 protein_id gnl|my_center|LOCUS_06150 13668 12883 gene locus_tag LOCUS_06160 13668 12883 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250526.1 protein_id gnl|my_center|LOCUS_06160 13767 14213 gene locus_tag LOCUS_06170 13767 14213 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867291.1 protein_id gnl|my_center|LOCUS_06170 14597 14421 gene locus_tag LOCUS_06180 14597 14421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 15406 14876 gene locus_tag LOCUS_06190 15406 14876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 >Feature sequence027 685 239 gene locus_tag LOCUS_06200 685 239 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868432.1 protein_id gnl|my_center|LOCUS_06200 1221 691 gene locus_tag LOCUS_06210 1221 691 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251225.1 protein_id gnl|my_center|LOCUS_06210 1840 1211 gene locus_tag LOCUS_06220 gene pyrF 1840 1211 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251226.1 protein_id gnl|my_center|LOCUS_06220 2448 1852 gene locus_tag LOCUS_06230 2448 1852 CDS product DUF4443 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251227.1 protein_id gnl|my_center|LOCUS_06230 2616 3698 gene locus_tag LOCUS_06240 2616 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 5844 3691 gene locus_tag LOCUS_06250 gene topA 5844 3691 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868544.1 protein_id gnl|my_center|LOCUS_06250 6769 5885 gene locus_tag LOCUS_06260 6769 5885 CDS product ADP-dependent ribose-1-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250979.1 protein_id gnl|my_center|LOCUS_06260 6899 7741 gene locus_tag LOCUS_06270 6899 7741 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251235.1 protein_id gnl|my_center|LOCUS_06270 8579 7821 gene locus_tag LOCUS_06280 8579 7821 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250149.1 protein_id gnl|my_center|LOCUS_06280 8920 8576 gene locus_tag LOCUS_06290 8920 8576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 9020 9835 gene locus_tag LOCUS_06300 9020 9835 CDS product GTP cyclohydrolase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249744.1 protein_id gnl|my_center|LOCUS_06300 10231 9824 gene locus_tag LOCUS_06310 10231 9824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06310 10535 10221 gene locus_tag LOCUS_06320 10535 10221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06320 10664 12082 gene locus_tag LOCUS_06330 10664 12082 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249650.1 protein_id gnl|my_center|LOCUS_06330 12087 13412 gene locus_tag LOCUS_06340 12087 13412 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249649.1 protein_id gnl|my_center|LOCUS_06340 13877 13434 gene locus_tag LOCUS_06350 13877 13434 CDS product COG2426 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249640.1 protein_id gnl|my_center|LOCUS_06350 14532 13894 gene locus_tag LOCUS_06360 14532 13894 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209478368.1 protein_id gnl|my_center|LOCUS_06360 14594 14920 gene locus_tag LOCUS_06370 14594 14920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 14869 15126 gene locus_tag LOCUS_06380 14869 15126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 >Feature sequence028 717 385 gene locus_tag LOCUS_06390 717 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251223.1 protein_id gnl|my_center|LOCUS_06390 1474 701 gene locus_tag LOCUS_06400 1474 701 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251222.1 protein_id gnl|my_center|LOCUS_06400 2725 1505 gene locus_tag LOCUS_06410 gene ftsZ 2725 1505 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251221.1 protein_id gnl|my_center|LOCUS_06410 2941 2747 gene locus_tag LOCUS_06420 2941 2747 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868406.1 protein_id gnl|my_center|LOCUS_06420 3146 3568 gene locus_tag LOCUS_06430 gene cgi121 3146 3568 CDS product KEOPS complex subunit Cgi121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251219.1 protein_id gnl|my_center|LOCUS_06430 3710 4885 gene locus_tag LOCUS_06440 3710 4885 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868404.1 protein_id gnl|my_center|LOCUS_06440 4901 5164 gene locus_tag LOCUS_06450 4901 5164 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251217.1 protein_id gnl|my_center|LOCUS_06450 5177 6379 gene locus_tag LOCUS_06460 5177 6379 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053896.1 protein_id gnl|my_center|LOCUS_06460 6369 6692 gene locus_tag LOCUS_06470 6369 6692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251215.1 protein_id gnl|my_center|LOCUS_06470 6851 7495 gene locus_tag LOCUS_06480 6851 7495 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250638.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06480 7467 7664 gene locus_tag LOCUS_06490 7467 7664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06490 7661 7972 gene locus_tag LOCUS_06500 7661 7972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 7965 9080 gene locus_tag LOCUS_06510 7965 9080 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440658.1 protein_id gnl|my_center|LOCUS_06510 9077 10132 gene locus_tag LOCUS_06520 9077 10132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 10852 10145 gene locus_tag LOCUS_06530 10852 10145 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867475.1 protein_id gnl|my_center|LOCUS_06530 12304 10886 gene locus_tag LOCUS_06540 12304 10886 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249895.1 protein_id gnl|my_center|LOCUS_06540 12513 13367 gene locus_tag LOCUS_06550 12513 13367 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250915.1 protein_id gnl|my_center|LOCUS_06550 13358 13888 gene locus_tag LOCUS_06560 13358 13888 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250914.1 protein_id gnl|my_center|LOCUS_06560 13921 14421 gene locus_tag LOCUS_06570 13921 14421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868123.1 protein_id gnl|my_center|LOCUS_06570 >Feature sequence029 491 646 gene locus_tag LOCUS_06580 491 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 739 1497 gene locus_tag LOCUS_06590 739 1497 CDS product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249272.1 protein_id gnl|my_center|LOCUS_06590 2112 1522 gene locus_tag LOCUS_06600 2112 1522 CDS product CPBP-Thermo-1 family intramembane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249394.1 protein_id gnl|my_center|LOCUS_06600 2956 2135 gene locus_tag LOCUS_06610 2956 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 4406 3018 gene locus_tag LOCUS_06620 4406 3018 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250239.1 protein_id gnl|my_center|LOCUS_06620 4502 5401 gene locus_tag LOCUS_06630 gene ftsY 4502 5401 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249604.1 protein_id gnl|my_center|LOCUS_06630 5952 5398 gene locus_tag LOCUS_06640 gene afpA 5952 5398 CDS product archaeoflavoprotein AfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064401.1 protein_id gnl|my_center|LOCUS_06640 6014 6460 gene locus_tag LOCUS_06650 6014 6460 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249473.1 protein_id gnl|my_center|LOCUS_06650 7035 6493 gene locus_tag LOCUS_06660 7035 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 9902 7245 gene locus_tag LOCUS_06670 9902 7245 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249476.1 protein_id gnl|my_center|LOCUS_06670 10068 11123 gene locus_tag LOCUS_06680 10068 11123 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053650.1 protein_id gnl|my_center|LOCUS_06680 12293 11124 gene locus_tag LOCUS_06690 12293 11124 CDS product cell wall-binding repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867621.1 protein_id gnl|my_center|LOCUS_06690 12709 13773 gene locus_tag LOCUS_06700 gene mtnA 12709 13773 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249511.1 protein_id gnl|my_center|LOCUS_06700 13836 14513 gene locus_tag LOCUS_06710 13836 14513 CDS product C2H2-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146961.1 protein_id gnl|my_center|LOCUS_06710 >Feature sequence030 78 755 gene locus_tag LOCUS_06720 gene pyrH 78 755 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249260.1 protein_id gnl|my_center|LOCUS_06720 1453 758 gene locus_tag LOCUS_06730 1453 758 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251184.1 protein_id gnl|my_center|LOCUS_06730 1573 2547 gene locus_tag LOCUS_06740 1573 2547 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250976.1 protein_id gnl|my_center|LOCUS_06740 2556 3353 gene locus_tag LOCUS_06750 2556 3353 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250977.1 protein_id gnl|my_center|LOCUS_06750 3340 4158 gene locus_tag LOCUS_06760 3340 4158 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250978.1 protein_id gnl|my_center|LOCUS_06760 4169 4903 gene locus_tag LOCUS_06770 gene mobB 4169 4903 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249885.1 protein_id gnl|my_center|LOCUS_06770 5905 5030 gene locus_tag LOCUS_06780 5905 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 7199 5988 gene locus_tag LOCUS_06790 7199 5988 CDS product CGP-CTERM-anchored Cys-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868446.1 protein_id gnl|my_center|LOCUS_06790 7318 8160 gene locus_tag LOCUS_06800 7318 8160 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867380.1 protein_id gnl|my_center|LOCUS_06800 8862 8161 gene locus_tag LOCUS_06810 8862 8161 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251251.1 protein_id gnl|my_center|LOCUS_06810 8939 9331 gene locus_tag LOCUS_06820 8939 9331 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250426.1 protein_id gnl|my_center|LOCUS_06820 9309 9881 gene locus_tag LOCUS_06830 9309 9881 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146540.1 protein_id gnl|my_center|LOCUS_06830 9874 10401 gene locus_tag LOCUS_06840 gene cyaB 9874 10401 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250130.1 protein_id gnl|my_center|LOCUS_06840 11040 10426 gene locus_tag LOCUS_06850 11040 10426 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_06850 11863 11051 gene locus_tag LOCUS_06860 11863 11051 CDS product DUF4392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249434.1 protein_id gnl|my_center|LOCUS_06860 12551 11865 gene locus_tag LOCUS_06870 12551 11865 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251191.1 protein_id gnl|my_center|LOCUS_06870 12648 13070 gene locus_tag LOCUS_06880 12648 13070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249897.1 protein_id gnl|my_center|LOCUS_06880 <14326 13138 gene locus_tag LOCUS_06890 <14326 13138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_158298054.1:Eco57I restriction-modification methylase domain-containing protein >Feature sequence031 92 17 gene locus_tag LOCUS_t00150 92 17 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 190 266 gene locus_tag LOCUS_t00160 190 266 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 274 351 gene locus_tag LOCUS_t00170 274 351 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 358 434 gene locus_tag LOCUS_t00180 358 434 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 545 754 gene locus_tag LOCUS_06900 545 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 732 980 gene locus_tag LOCUS_06910 732 980 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250035.1 protein_id gnl|my_center|LOCUS_06910 1001 4357 gene locus_tag LOCUS_06920 1001 4357 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867738.1 protein_id gnl|my_center|LOCUS_06920 4363 7080 gene locus_tag LOCUS_06930 4363 7080 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250033.1 protein_id gnl|my_center|LOCUS_06930 7082 8272 gene locus_tag LOCUS_06940 gene rpoA2 7082 8272 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867740.1 protein_id gnl|my_center|LOCUS_06940 8287 8592 gene locus_tag LOCUS_06950 8287 8592 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867741.1 protein_id gnl|my_center|LOCUS_06950 8592 9029 gene locus_tag LOCUS_06960 8592 9029 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250030.1 protein_id gnl|my_center|LOCUS_06960 9040 9483 gene locus_tag LOCUS_06970 9040 9483 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250029.1 protein_id gnl|my_center|LOCUS_06970 9488 10138 gene locus_tag LOCUS_06980 gene rpsG 9488 10138 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250028.1 protein_id gnl|my_center|LOCUS_06980 10365 12563 gene locus_tag LOCUS_06990 10365 12563 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249264.1 protein_id gnl|my_center|LOCUS_06990 13351 14244 gene locus_tag LOCUS_07000 13351 14244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 >Feature sequence032 51 2138 gene locus_tag LOCUS_07010 51 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 2779 2159 gene locus_tag LOCUS_07020 2779 2159 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868332.1 protein_id gnl|my_center|LOCUS_07020 3443 2757 gene locus_tag LOCUS_07030 3443 2757 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146909.1 protein_id gnl|my_center|LOCUS_07030 3682 3927 gene locus_tag LOCUS_07040 3682 3927 CDS product DUF131 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250763.1 protein_id gnl|my_center|LOCUS_07040 3928 5109 gene locus_tag LOCUS_07050 3928 5109 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868335.1 protein_id gnl|my_center|LOCUS_07050 5144 6298 gene locus_tag LOCUS_07060 gene mfnA 5144 6298 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250765.1 protein_id gnl|my_center|LOCUS_07060 6464 6288 gene locus_tag LOCUS_07070 6464 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07070 7149 6478 gene locus_tag LOCUS_07080 7149 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07080 7423 7776 gene locus_tag LOCUS_07090 7423 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 7779 8528 gene locus_tag LOCUS_07100 7779 8528 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867800.1 protein_id gnl|my_center|LOCUS_07100 8554 9381 gene locus_tag LOCUS_07110 8554 9381 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251059.1 protein_id gnl|my_center|LOCUS_07110 9846 9382 gene locus_tag LOCUS_07120 9846 9382 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868568.1 protein_id gnl|my_center|LOCUS_07120 10376 9828 gene locus_tag LOCUS_07130 10376 9828 CDS product DUF531 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868567.1 protein_id gnl|my_center|LOCUS_07130 10511 10810 gene locus_tag LOCUS_07140 10511 10810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250975.1 protein_id gnl|my_center|LOCUS_07140 12342 11443 gene locus_tag LOCUS_07150 12342 11443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 12878 12354 gene locus_tag LOCUS_07160 12878 12354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 13385 13900 gene locus_tag LOCUS_07170 gene tfe 13385 13900 CDS product transcription factor E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868546.1 protein_id gnl|my_center|LOCUS_07170 >Feature sequence033 93 710 gene locus_tag LOCUS_07180 gene psmB 93 710 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867872.1 protein_id gnl|my_center|LOCUS_07180 729 2675 gene locus_tag LOCUS_07190 729 2675 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250379.1 protein_id gnl|my_center|LOCUS_07190 2999 2676 gene locus_tag LOCUS_07200 2999 2676 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867180.1 protein_id gnl|my_center|LOCUS_07200 3093 3878 gene locus_tag LOCUS_07210 3093 3878 CDS product UbiA prenyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250275.1 protein_id gnl|my_center|LOCUS_07210 3889 4812 gene locus_tag LOCUS_07220 3889 4812 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249101.1 protein_id gnl|my_center|LOCUS_07220 4790 5932 gene locus_tag LOCUS_07230 4790 5932 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250274.1 protein_id gnl|my_center|LOCUS_07230 5982 6686 gene locus_tag LOCUS_07240 5982 6686 CDS product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067911.1 protein_id gnl|my_center|LOCUS_07240 6689 7336 gene locus_tag LOCUS_07250 6689 7336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868091.1 protein_id gnl|my_center|LOCUS_07250 7388 8206 gene locus_tag LOCUS_07260 7388 8206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249099.1 protein_id gnl|my_center|LOCUS_07260 8773 8207 gene locus_tag LOCUS_07270 gene pgsA 8773 8207 CDS product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249014.1 protein_id gnl|my_center|LOCUS_07270 9316 8783 gene locus_tag LOCUS_07280 9316 8783 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053622.1 protein_id gnl|my_center|LOCUS_07280 10920 9313 gene locus_tag LOCUS_07290 10920 9313 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249016.1 protein_id gnl|my_center|LOCUS_07290 10975 11739 gene locus_tag LOCUS_07300 10975 11739 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868692.1 protein_id gnl|my_center|LOCUS_07300 11761 12321 gene locus_tag LOCUS_07310 11761 12321 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868691.1 protein_id gnl|my_center|LOCUS_07310 13517 12324 gene locus_tag LOCUS_07320 13517 12324 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249178.1 protein_id gnl|my_center|LOCUS_07320 >Feature sequence034 110 757 gene locus_tag LOCUS_07330 110 757 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249977.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07330 1715 975 gene locus_tag LOCUS_07340 1715 975 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249661.1 protein_id gnl|my_center|LOCUS_07340 2601 1783 gene locus_tag LOCUS_07350 gene folP 2601 1783 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250112.1 protein_id gnl|my_center|LOCUS_07350 3562 2681 gene locus_tag LOCUS_07360 3562 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250143.1 protein_id gnl|my_center|LOCUS_07360 3704 7360 gene locus_tag LOCUS_07370 gene rgy 3704 7360 CDS product reverse gyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868381.1 protein_id gnl|my_center|LOCUS_07370 7633 8427 gene locus_tag LOCUS_07380 gene trmBL2 7633 8427 CDS product HTH-type transcriptional regulator TrmBL2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249426.1 protein_id gnl|my_center|LOCUS_07380 8680 8444 gene locus_tag LOCUS_07390 8680 8444 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146942.1 protein_id gnl|my_center|LOCUS_07390 8997 8677 gene locus_tag LOCUS_07400 8997 8677 CDS product Sjogren's syndrome/scleroderma autoantigen 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868383.1 protein_id gnl|my_center|LOCUS_07400 9728 9000 gene locus_tag LOCUS_07410 9728 9000 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249429.1 protein_id gnl|my_center|LOCUS_07410 9797 10330 gene locus_tag LOCUS_07420 9797 10330 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146583.1 protein_id gnl|my_center|LOCUS_07420 10647 11648 gene locus_tag LOCUS_07430 10647 11648 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249506.1 protein_id gnl|my_center|LOCUS_07430 11658 12656 gene locus_tag LOCUS_07440 11658 12656 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868647.1 protein_id gnl|my_center|LOCUS_07440 12668 13423 gene locus_tag LOCUS_07450 12668 13423 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249930.1 protein_id gnl|my_center|LOCUS_07450 >Feature sequence035 1556 366 gene locus_tag LOCUS_07460 1556 366 CDS product TIGR00529 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867137.1 protein_id gnl|my_center|LOCUS_07460 1787 4987 gene locus_tag LOCUS_07470 gene ileS 1787 4987 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250699.1 protein_id gnl|my_center|LOCUS_07470 5078 5257 gene locus_tag LOCUS_07480 5078 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 5257 6372 gene locus_tag LOCUS_07490 5257 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249598.1 protein_id gnl|my_center|LOCUS_07490 7884 6661 gene locus_tag LOCUS_07500 7884 6661 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083141.1 protein_id gnl|my_center|LOCUS_07500 9703 7877 gene locus_tag LOCUS_07510 9703 7877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 10392 9700 gene locus_tag LOCUS_07520 10392 9700 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878518.1 protein_id gnl|my_center|LOCUS_07520 10516 11355 gene locus_tag LOCUS_07530 10516 11355 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250984.1 protein_id gnl|my_center|LOCUS_07530 13256 11568 gene locus_tag LOCUS_07540 13256 11568 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251012.1 protein_id gnl|my_center|LOCUS_07540 >Feature sequence036 821 204 gene locus_tag LOCUS_07550 gene hisG 821 204 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249198.1 protein_id gnl|my_center|LOCUS_07550 1708 821 gene locus_tag LOCUS_07560 1708 821 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053641.1 protein_id gnl|my_center|LOCUS_07560 2713 1937 gene locus_tag LOCUS_07570 2713 1937 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249891.1 protein_id gnl|my_center|LOCUS_07570 3692 2718 gene locus_tag LOCUS_07580 3692 2718 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249890.1 protein_id gnl|my_center|LOCUS_07580 3772 3849 gene locus_tag LOCUS_t00190 3772 3849 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4905 3901 gene locus_tag LOCUS_07590 4905 3901 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250578.1 protein_id gnl|my_center|LOCUS_07590 5756 4902 gene locus_tag LOCUS_07600 5756 4902 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250577.1 protein_id gnl|my_center|LOCUS_07600 5927 6382 gene locus_tag LOCUS_07610 5927 6382 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250202.1 protein_id gnl|my_center|LOCUS_07610 6413 7849 gene locus_tag LOCUS_07620 6413 7849 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250203.1 protein_id gnl|my_center|LOCUS_07620 7846 8127 gene locus_tag LOCUS_07630 7846 8127 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868697.1 protein_id gnl|my_center|LOCUS_07630 8108 8710 gene locus_tag LOCUS_07640 8108 8710 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250205.1 protein_id gnl|my_center|LOCUS_07640 10017 8740 gene locus_tag LOCUS_07650 10017 8740 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249937.1 protein_id gnl|my_center|LOCUS_07650 10796 10053 gene locus_tag LOCUS_07660 10796 10053 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867271.1 protein_id gnl|my_center|LOCUS_07660 10892 11740 gene locus_tag LOCUS_07670 gene fba 10892 11740 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249940.1 protein_id gnl|my_center|LOCUS_07670 >Feature sequence037 2200 1250 gene locus_tag LOCUS_07680 gene arcC 2200 1250 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251108.1 protein_id gnl|my_center|LOCUS_07680 2412 2948 gene locus_tag LOCUS_07690 2412 2948 CDS product DUF3201 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251071.1 protein_id gnl|my_center|LOCUS_07690 2950 4104 gene locus_tag LOCUS_07700 2950 4104 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868893.1 protein_id gnl|my_center|LOCUS_07700 4104 5108 gene locus_tag LOCUS_07710 4104 5108 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868892.1 protein_id gnl|my_center|LOCUS_07710 5154 5990 gene locus_tag LOCUS_07720 5154 5990 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868033.1 protein_id gnl|my_center|LOCUS_07720 6967 5987 gene locus_tag LOCUS_07730 6967 5987 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251076.1 protein_id gnl|my_center|LOCUS_07730 7104 9065 gene locus_tag LOCUS_07740 gene gor 7104 9065 CDS product glyceraldehyde-3-phosphate:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251113.1 protein_id gnl|my_center|LOCUS_07740 9216 9893 gene locus_tag LOCUS_07750 gene tpiA 9216 9893 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251079.1 protein_id gnl|my_center|LOCUS_07750 10927 9962 gene locus_tag LOCUS_07760 10927 9962 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250772.1 protein_id gnl|my_center|LOCUS_07760 11054 11791 gene locus_tag LOCUS_07770 11054 11791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250775.1 protein_id gnl|my_center|LOCUS_07770 12276 11788 gene locus_tag LOCUS_07780 12276 11788 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146511.1 protein_id gnl|my_center|LOCUS_07780 13433 12291 gene locus_tag LOCUS_07790 13433 12291 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250771.1 protein_id gnl|my_center|LOCUS_07790 >Feature sequence038 1551 271 gene locus_tag LOCUS_07800 1551 271 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250842.1 protein_id gnl|my_center|LOCUS_07800 2373 1600 gene locus_tag LOCUS_07810 2373 1600 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250846.1 protein_id gnl|my_center|LOCUS_07810 3172 2822 gene locus_tag LOCUS_07820 3172 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 4104 3163 gene locus_tag LOCUS_07830 4104 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 4335 5057 gene locus_tag LOCUS_07840 4335 5057 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867248.1 protein_id gnl|my_center|LOCUS_07840 5067 5447 gene locus_tag LOCUS_07850 5067 5447 CDS product DUF473 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867249.1 protein_id gnl|my_center|LOCUS_07850 6199 5444 gene locus_tag LOCUS_07860 gene nucS 6199 5444 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250849.1 protein_id gnl|my_center|LOCUS_07860 6282 7475 gene locus_tag LOCUS_07870 gene gcvT 6282 7475 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250985.1 protein_id gnl|my_center|LOCUS_07870 8342 7479 gene locus_tag LOCUS_07880 8342 7479 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250986.1 protein_id gnl|my_center|LOCUS_07880 8433 9191 gene locus_tag LOCUS_07890 gene cobB 8433 9191 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249636.1 protein_id gnl|my_center|LOCUS_07890 9188 9583 gene locus_tag LOCUS_07900 9188 9583 CDS product DUF3783 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250025.1 protein_id gnl|my_center|LOCUS_07900 9618 10349 gene locus_tag LOCUS_07910 9618 10349 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867638.1 protein_id gnl|my_center|LOCUS_07910 10309 10875 gene locus_tag LOCUS_07920 10309 10875 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867637.1 protein_id gnl|my_center|LOCUS_07920 11177 11434 gene locus_tag LOCUS_07930 11177 11434 CDS product 50S ribosomal protein L35ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867507.1 protein_id gnl|my_center|LOCUS_07930 11489 12619 gene locus_tag LOCUS_07940 11489 12619 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146544.1 protein_id gnl|my_center|LOCUS_07940 13186 12611 gene locus_tag LOCUS_07950 13186 12611 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249797.1 protein_id gnl|my_center|LOCUS_07950 >Feature sequence039 53 493 gene locus_tag LOCUS_07960 gene pfdA 53 493 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249956.1 protein_id gnl|my_center|LOCUS_07960 1189 494 gene locus_tag LOCUS_07970 1189 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 1334 1119 gene locus_tag LOCUS_07980 1334 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 2281 1358 gene locus_tag LOCUS_07990 2281 1358 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249955.1 protein_id gnl|my_center|LOCUS_07990 2829 2419 gene locus_tag LOCUS_08000 2829 2419 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868486.1 protein_id gnl|my_center|LOCUS_08000 3988 2831 gene locus_tag LOCUS_08010 3988 2831 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249135.1 protein_id gnl|my_center|LOCUS_08010 5051 3999 gene locus_tag LOCUS_08020 5051 3999 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249136.1 protein_id gnl|my_center|LOCUS_08020 5214 5882 gene locus_tag LOCUS_08030 5214 5882 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249137.1 protein_id gnl|my_center|LOCUS_08030 6602 5922 gene locus_tag LOCUS_08040 6602 5922 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867184.1 protein_id gnl|my_center|LOCUS_08040 7864 6608 gene locus_tag LOCUS_08050 7864 6608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867185.1 protein_id gnl|my_center|LOCUS_08050 8024 9067 gene locus_tag LOCUS_08060 8024 9067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 9073 9579 gene locus_tag LOCUS_08070 9073 9579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 10541 9576 gene locus_tag LOCUS_08080 10541 9576 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249140.1 protein_id gnl|my_center|LOCUS_08080 10795 12042 gene locus_tag LOCUS_08090 10795 12042 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249141.1 protein_id gnl|my_center|LOCUS_08090 12764 12054 gene locus_tag LOCUS_08100 12764 12054 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883498.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence040 1290 934 gene locus_tag LOCUS_08110 gene pth2 1290 934 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251250.1 protein_id gnl|my_center|LOCUS_08110 3396 1345 gene locus_tag LOCUS_08120 3396 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867938.1 protein_id gnl|my_center|LOCUS_08120 4785 3469 gene locus_tag LOCUS_08130 gene aspS 4785 3469 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249447.1 protein_id gnl|my_center|LOCUS_08130 5288 4791 gene locus_tag LOCUS_08140 5288 4791 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868454.1 protein_id gnl|my_center|LOCUS_08140 5540 5617 gene locus_tag LOCUS_t00200 5540 5617 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5627 5704 gene locus_tag LOCUS_t00210 5627 5704 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6731 5730 gene locus_tag LOCUS_08150 gene amrS 6731 5730 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879767.1 protein_id gnl|my_center|LOCUS_08150 8741 6753 gene locus_tag LOCUS_08160 8741 6753 CDS product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011011610.1 protein_id gnl|my_center|LOCUS_08160 8844 10394 gene locus_tag LOCUS_08170 8844 10394 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250508.1 protein_id gnl|my_center|LOCUS_08170 10443 11777 gene locus_tag LOCUS_08180 10443 11777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 12492 11764 gene locus_tag LOCUS_08190 12492 11764 CDS product DUF2110 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250973.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence041 154 522 gene locus_tag LOCUS_08200 154 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08200 562 2307 gene locus_tag LOCUS_08210 gene tgtA 562 2307 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249711.1 protein_id gnl|my_center|LOCUS_08210 2340 3863 gene locus_tag LOCUS_08220 2340 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248987.1 protein_id gnl|my_center|LOCUS_08220 4099 4839 gene locus_tag LOCUS_08230 4099 4839 CDS product metallophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250443.1 protein_id gnl|my_center|LOCUS_08230 5043 4819 gene locus_tag LOCUS_08240 5043 4819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 5158 5442 gene locus_tag LOCUS_08250 5158 5442 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250146.1 protein_id gnl|my_center|LOCUS_08250 5452 5841 gene locus_tag LOCUS_08260 5452 5841 CDS product DUF555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250145.1 protein_id gnl|my_center|LOCUS_08260 6756 5860 gene locus_tag LOCUS_08270 6756 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 6874 8466 gene locus_tag LOCUS_08280 gene pyrG 6874 8466 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250144.1 protein_id gnl|my_center|LOCUS_08280 9377 8481 gene locus_tag LOCUS_08290 9377 8481 CDS product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053775.1 protein_id gnl|my_center|LOCUS_08290 12154 9458 gene locus_tag LOCUS_08300 12154 9458 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868798.1 protein_id gnl|my_center|LOCUS_08300 <12697 12151 gene locus_tag LOCUS_08310 <12697 12151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868797.1:hydrophobe/amphiphile efflux-3 (HAE3) family transporter >Feature sequence042 157 738 gene locus_tag LOCUS_08320 157 738 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251194.1 protein_id gnl|my_center|LOCUS_08320 827 1738 gene locus_tag LOCUS_08330 827 1738 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251195.1 protein_id gnl|my_center|LOCUS_08330 3094 1799 gene locus_tag LOCUS_08340 3094 1799 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062387703.1 protein_id gnl|my_center|LOCUS_08340 3306 4223 gene locus_tag LOCUS_08350 3306 4223 CDS product isoaspartyl peptidase/L-asparaginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251196.1 protein_id gnl|my_center|LOCUS_08350 4228 5388 gene locus_tag LOCUS_08360 4228 5388 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867337.1 protein_id gnl|my_center|LOCUS_08360 5420 6547 gene locus_tag LOCUS_08370 gene trm10 5420 6547 CDS product tRNA (guanine(9)-/adenine(9)-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249377.1 protein_id gnl|my_center|LOCUS_08370 7463 6567 gene locus_tag LOCUS_08380 gene map 7463 6567 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250134.1 protein_id gnl|my_center|LOCUS_08380 7651 9096 gene locus_tag LOCUS_08390 gene proS 7651 9096 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249505.1 protein_id gnl|my_center|LOCUS_08390 9199 10719 gene locus_tag LOCUS_08400 9199 10719 CDS product dihydropteroate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249274.1 protein_id gnl|my_center|LOCUS_08400 10771 12069 gene locus_tag LOCUS_08410 10771 12069 CDS product 2,3-phosphoglycerate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249990.1 protein_id gnl|my_center|LOCUS_08410 12062 12451 gene locus_tag LOCUS_08420 12062 12451 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248958.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence043 669 244 gene locus_tag LOCUS_08430 669 244 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250572.1 protein_id gnl|my_center|LOCUS_08430 6767 681 gene locus_tag LOCUS_08440 6767 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 7359 6865 gene locus_tag LOCUS_08450 7359 6865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250570.1 protein_id gnl|my_center|LOCUS_08450 8552 7509 gene locus_tag LOCUS_08460 8552 7509 CDS product lysyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250128.1 protein_id gnl|my_center|LOCUS_08460 9614 8616 gene locus_tag LOCUS_08470 9614 8616 CDS product TIGR01177 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249932.1 protein_id gnl|my_center|LOCUS_08470 9704 10933 gene locus_tag LOCUS_08480 9704 10933 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250018.1 protein_id gnl|my_center|LOCUS_08480 11955 10954 gene locus_tag LOCUS_08490 11955 10954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 >Feature sequence044 2799 553 gene locus_tag LOCUS_08500 2799 553 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932519.1 protein_id gnl|my_center|LOCUS_08500 3506 2796 gene locus_tag LOCUS_08510 3506 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 4581 3520 gene locus_tag LOCUS_08520 4581 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 4709 6097 gene locus_tag LOCUS_08530 4709 6097 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774915.1 protein_id gnl|my_center|LOCUS_08530 6107 7051 gene locus_tag LOCUS_08540 6107 7051 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257890.1 protein_id gnl|my_center|LOCUS_08540 7048 7896 gene locus_tag LOCUS_08550 7048 7896 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 protein_id gnl|my_center|LOCUS_08550 7896 8969 gene locus_tag LOCUS_08560 gene ugpC 7896 8969 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867305.1 protein_id gnl|my_center|LOCUS_08560 8981 9994 gene locus_tag LOCUS_08570 8981 9994 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868244.1 protein_id gnl|my_center|LOCUS_08570 11580 9985 gene locus_tag LOCUS_08580 11580 9985 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249504.1 protein_id gnl|my_center|LOCUS_08580 >Feature sequence045 832 182 gene locus_tag LOCUS_08590 832 182 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868159.1 protein_id gnl|my_center|LOCUS_08590 1586 1023 gene locus_tag LOCUS_08600 1586 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868493.1 protein_id gnl|my_center|LOCUS_08600 2360 1614 gene locus_tag LOCUS_08610 2360 1614 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249490.1 protein_id gnl|my_center|LOCUS_08610 2533 2363 gene locus_tag LOCUS_08620 2533 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146988.1 protein_id gnl|my_center|LOCUS_08620 2897 2565 gene locus_tag LOCUS_08630 2897 2565 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868495.1 protein_id gnl|my_center|LOCUS_08630 4361 3090 gene locus_tag LOCUS_08640 4361 3090 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249483.1 protein_id gnl|my_center|LOCUS_08640 4991 4545 gene locus_tag LOCUS_08650 4991 4545 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251016.1 protein_id gnl|my_center|LOCUS_08650 5416 4988 gene locus_tag LOCUS_08660 5416 4988 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251017.1 protein_id gnl|my_center|LOCUS_08660 5606 5397 gene locus_tag LOCUS_08670 5606 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251018.1 protein_id gnl|my_center|LOCUS_08670 6311 5658 gene locus_tag LOCUS_08680 6311 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08680 6937 6200 gene locus_tag LOCUS_08690 6937 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08690 7722 6937 gene locus_tag LOCUS_08700 gene hydD 7722 6937 CDS product NADPH-dependent hydrogenase/sulfhydrogenase 1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251020.1 protein_id gnl|my_center|LOCUS_08700 8584 7733 gene locus_tag LOCUS_08710 gene hydG 8584 7733 CDS product NADPH-dependent hydrogenase/sulfhydrogenase 1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867990.1 protein_id gnl|my_center|LOCUS_08710 9684 8581 gene locus_tag LOCUS_08720 gene hydB 9684 8581 CDS product NADPH-dependent hydrogenase/sulfhydrogenase 1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251022.1 protein_id gnl|my_center|LOCUS_08720 10072 11064 gene locus_tag LOCUS_08730 10072 11064 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251029.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence046 471 1526 gene locus_tag LOCUS_08740 471 1526 CDS product DUF835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251137.1 protein_id gnl|my_center|LOCUS_08740 2354 1527 gene locus_tag LOCUS_08750 2354 1527 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250696.1 protein_id gnl|my_center|LOCUS_08750 2471 2995 gene locus_tag LOCUS_08760 2471 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 3001 4875 gene locus_tag LOCUS_08770 3001 4875 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545213.1 protein_id gnl|my_center|LOCUS_08770 4933 5265 gene locus_tag LOCUS_08780 4933 5265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 5615 5448 gene locus_tag LOCUS_08790 5615 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 5786 6049 gene locus_tag LOCUS_08800 gene moaD 5786 6049 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251068.1 protein_id gnl|my_center|LOCUS_08800 6051 6185 gene locus_tag LOCUS_08810 6051 6185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08810 6240 6749 gene locus_tag LOCUS_08820 6240 6749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08820 6761 7339 gene locus_tag LOCUS_08830 6761 7339 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053782.1 protein_id gnl|my_center|LOCUS_08830 7483 8319 gene locus_tag LOCUS_08840 7483 8319 CDS product DUF835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251166.1 protein_id gnl|my_center|LOCUS_08840 8337 10331 gene locus_tag LOCUS_08850 8337 10331 CDS product IGHMBP2 family helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249133.1 protein_id gnl|my_center|LOCUS_08850 10319 10900 gene locus_tag LOCUS_08860 10319 10900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251141.1 protein_id gnl|my_center|LOCUS_08860 11079 11330 gene locus_tag LOCUS_08870 11079 11330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08870 <11961 11327 gene locus_tag LOCUS_08880 <11961 11327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251135.1:phosphoglucosamine mutase >Feature sequence047 866 1765 gene locus_tag LOCUS_08890 866 1765 CDS product UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251204.1 protein_id gnl|my_center|LOCUS_08890 2477 1707 gene locus_tag LOCUS_08900 gene cas6 2477 1707 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251203.1 protein_id gnl|my_center|LOCUS_08900 2695 3894 gene locus_tag LOCUS_08910 2695 3894 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146504.1 protein_id gnl|my_center|LOCUS_08910 4260 5171 gene locus_tag LOCUS_08920 4260 5171 CDS product serine/threonine-protein kinase RIO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251200.1 protein_id gnl|my_center|LOCUS_08920 5217 5717 gene locus_tag LOCUS_08930 5217 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053787.1 protein_id gnl|my_center|LOCUS_08930 6647 5700 gene locus_tag LOCUS_08940 6647 5700 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251198.1 protein_id gnl|my_center|LOCUS_08940 6740 7570 gene locus_tag LOCUS_08950 gene udp 6740 7570 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250430.1 protein_id gnl|my_center|LOCUS_08950 7952 7865 gene locus_tag LOCUS_t00220 7952 7865 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8579 8013 gene locus_tag LOCUS_08960 8579 8013 CDS product DUF366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251187.1 protein_id gnl|my_center|LOCUS_08960 9052 8579 gene locus_tag LOCUS_08970 9052 8579 CDS product magnesium-dependent phosphatase-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251186.1 protein_id gnl|my_center|LOCUS_08970 10550 9066 gene locus_tag LOCUS_08980 10550 9066 CDS product DUF2139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251098.1 protein_id gnl|my_center|LOCUS_08980 11324 10611 gene locus_tag LOCUS_08990 gene queC 11324 10611 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251213.1 protein_id gnl|my_center|LOCUS_08990 <11960 11329 gene locus_tag LOCUS_09000 <11960 11329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048053788.1:dihydroorotate dehydrogenase >Feature sequence048 11 86 gene locus_tag LOCUS_t00230 11 86 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1361 96 gene locus_tag LOCUS_09010 1361 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 2316 1444 gene locus_tag LOCUS_09020 2316 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 3724 2378 gene locus_tag LOCUS_09030 3724 2378 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250240.1 protein_id gnl|my_center|LOCUS_09030 6298 3947 gene locus_tag LOCUS_09040 gene ppsA 6298 3947 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250243.1 protein_id gnl|my_center|LOCUS_09040 7853 6456 gene locus_tag LOCUS_09050 7853 6456 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867220.1 protein_id gnl|my_center|LOCUS_09050 8908 7835 gene locus_tag LOCUS_09060 8908 7835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 9884 8898 gene locus_tag LOCUS_09070 9884 8898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867218.1 protein_id gnl|my_center|LOCUS_09070 10543 9881 gene locus_tag LOCUS_09080 10543 9881 CDS product TrmB family transcriptional regulator sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867217.1 protein_id gnl|my_center|LOCUS_09080 >Feature sequence049 1821 376 gene locus_tag LOCUS_09090 gene gltA 1821 376 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598693.1 protein_id gnl|my_center|LOCUS_09090 2690 1818 gene locus_tag LOCUS_09100 2690 1818 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250277.1 protein_id gnl|my_center|LOCUS_09100 3618 2857 gene locus_tag LOCUS_09110 gene trmI 3618 2857 CDS product tRNA (adenine(57)-N(1)/adenine(58)-N(1))-methyltransferase TrmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867553.1 protein_id gnl|my_center|LOCUS_09110 4241 3624 gene locus_tag LOCUS_09120 4241 3624 CDS product DUF257 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867552.1 protein_id gnl|my_center|LOCUS_09120 4315 4623 gene locus_tag LOCUS_09130 4315 4623 CDS product signal recognition particle protein Srp19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146554.1 protein_id gnl|my_center|LOCUS_09130 4866 4624 gene locus_tag LOCUS_09140 4866 4624 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867550.1 protein_id gnl|my_center|LOCUS_09140 5208 7373 gene locus_tag LOCUS_09150 5208 7373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 7512 8513 gene locus_tag LOCUS_09160 7512 8513 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867867.1 protein_id gnl|my_center|LOCUS_09160 8525 9682 gene locus_tag LOCUS_09170 8525 9682 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867866.1 protein_id gnl|my_center|LOCUS_09170 9675 10652 gene locus_tag LOCUS_09180 9675 10652 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146644.1 protein_id gnl|my_center|LOCUS_09180 10663 11637 gene locus_tag LOCUS_09190 10663 11637 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867864.1 protein_id gnl|my_center|LOCUS_09190 >Feature sequence050 2173 3399 gene locus_tag LOCUS_09200 2173 3399 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868871.1 protein_id gnl|my_center|LOCUS_09200 3380 4129 gene locus_tag LOCUS_09210 3380 4129 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868872.1 protein_id gnl|my_center|LOCUS_09210 4784 4092 gene locus_tag LOCUS_09220 4784 4092 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249281.1 protein_id gnl|my_center|LOCUS_09220 6972 5914 gene locus_tag LOCUS_09230 6972 5914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598721.1 protein_id gnl|my_center|LOCUS_09230 7259 8164 gene locus_tag LOCUS_09240 7259 8164 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250758.1 protein_id gnl|my_center|LOCUS_09240 8187 9014 gene locus_tag LOCUS_09250 8187 9014 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868874.1 protein_id gnl|my_center|LOCUS_09250 10221 9007 gene locus_tag LOCUS_09260 10221 9007 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250558.1 protein_id gnl|my_center|LOCUS_09260 11100 10426 gene locus_tag LOCUS_09270 11100 10426 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251010.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence051 1052 843 gene locus_tag LOCUS_09280 1052 843 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250260.1 protein_id gnl|my_center|LOCUS_09280 1258 1049 gene locus_tag LOCUS_09290 1258 1049 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250261.1 protein_id gnl|my_center|LOCUS_09290 1687 1316 gene locus_tag LOCUS_09300 gene rpl7ae 1687 1316 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053845.1 protein_id gnl|my_center|LOCUS_09300 1827 2381 gene locus_tag LOCUS_09310 1827 2381 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249905.1 protein_id gnl|my_center|LOCUS_09310 3903 2392 gene locus_tag LOCUS_09320 3903 2392 CDS product AMP phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249307.1 protein_id gnl|my_center|LOCUS_09320 4238 3999 gene locus_tag LOCUS_09330 4238 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 4577 4332 gene locus_tag LOCUS_09340 4577 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 5356 4577 gene locus_tag LOCUS_09350 gene minD 5356 4577 CDS product cell division ATPase MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867687.1 protein_id gnl|my_center|LOCUS_09350 6468 5659 gene locus_tag LOCUS_09360 6468 5659 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867773.1 protein_id gnl|my_center|LOCUS_09360 7799 6468 gene locus_tag LOCUS_09370 7799 6468 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867774.1 protein_id gnl|my_center|LOCUS_09370 7907 8197 gene locus_tag LOCUS_09380 7907 8197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146769.1 protein_id gnl|my_center|LOCUS_09380 8202 9014 gene locus_tag LOCUS_09390 8202 9014 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249300.1 protein_id gnl|my_center|LOCUS_09390 9018 9344 gene locus_tag LOCUS_09400 9018 9344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249297.1 protein_id gnl|my_center|LOCUS_09400 9322 9714 gene locus_tag LOCUS_09410 9322 9714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249294.1 protein_id gnl|my_center|LOCUS_09410 10241 9759 gene locus_tag LOCUS_09420 10241 9759 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147315.1 protein_id gnl|my_center|LOCUS_09420 <11240 10266 gene locus_tag LOCUS_09430 <11240 10266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250097.1:phosphoglycerate kinase >Feature sequence052 2490 244 gene locus_tag LOCUS_09440 2490 244 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146523.1 protein_id gnl|my_center|LOCUS_09440 2605 3207 gene locus_tag LOCUS_09450 2605 3207 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868137.1 protein_id gnl|my_center|LOCUS_09450 3238 3420 gene locus_tag LOCUS_09460 3238 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 3571 3975 gene locus_tag LOCUS_09470 3571 3975 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867887.1 protein_id gnl|my_center|LOCUS_09470 4736 3993 gene locus_tag LOCUS_09480 gene wtpB 4736 3993 CDS product tungstate ABC transporter permease WtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867277.1 protein_id gnl|my_center|LOCUS_09480 5882 4833 gene locus_tag LOCUS_09490 gene wtpA 5882 4833 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248970.1 protein_id gnl|my_center|LOCUS_09490 6853 5963 gene locus_tag LOCUS_09500 6853 5963 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052273639.1 protein_id gnl|my_center|LOCUS_09500 7166 6927 gene locus_tag LOCUS_09510 7166 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249974.1 protein_id gnl|my_center|LOCUS_09510 7866 7953 gene locus_tag LOCUS_t00240 7866 7953 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8750 7974 gene locus_tag LOCUS_09520 8750 7974 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251208.1 protein_id gnl|my_center|LOCUS_09520 9130 8756 gene locus_tag LOCUS_09530 9130 8756 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251209.1 protein_id gnl|my_center|LOCUS_09530 9223 9744 gene locus_tag LOCUS_09540 9223 9744 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251207.1 protein_id gnl|my_center|LOCUS_09540 10106 9741 gene locus_tag LOCUS_09550 10106 9741 CDS product DUF2304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251206.1 protein_id gnl|my_center|LOCUS_09550 <11157 10112 gene locus_tag LOCUS_09560 <11157 10112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251205.1:HAD-IA family hydrolase >Feature sequence053 499 1656 gene locus_tag LOCUS_09570 499 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 1815 2774 gene locus_tag LOCUS_09580 1815 2774 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249654.1 protein_id gnl|my_center|LOCUS_09580 2891 3121 gene locus_tag LOCUS_09590 2891 3121 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868182.1 protein_id gnl|my_center|LOCUS_09590 3121 5136 gene locus_tag LOCUS_09600 gene feoB 3121 5136 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868183.1 protein_id gnl|my_center|LOCUS_09600 5153 5410 gene locus_tag LOCUS_09610 5153 5410 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249907.1 protein_id gnl|my_center|LOCUS_09610 5499 6740 gene locus_tag LOCUS_09620 5499 6740 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868078.1 protein_id gnl|my_center|LOCUS_09620 6801 7154 gene locus_tag LOCUS_09630 6801 7154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250521.1 protein_id gnl|my_center|LOCUS_09630 8059 7139 gene locus_tag LOCUS_09640 8059 7139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 8371 8060 gene locus_tag LOCUS_09650 8371 8060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 9370 8579 gene locus_tag LOCUS_09660 gene proC 9370 8579 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869320.1 protein_id gnl|my_center|LOCUS_09660 10392 9385 gene locus_tag LOCUS_09670 gene asd 10392 9385 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250394.1 protein_id gnl|my_center|LOCUS_09670 <10945 10392 gene locus_tag LOCUS_09680 <10945 10392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868155.1:threonine synthase >Feature sequence054 428 985 gene locus_tag LOCUS_09690 428 985 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249857.1 protein_id gnl|my_center|LOCUS_09690 1483 956 gene locus_tag LOCUS_09700 1483 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 2118 1480 gene locus_tag LOCUS_09710 2118 1480 CDS product DUF120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868498.1 protein_id gnl|my_center|LOCUS_09710 2218 3438 gene locus_tag LOCUS_09720 2218 3438 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250179.1 protein_id gnl|my_center|LOCUS_09720 4700 3567 gene locus_tag LOCUS_09730 gene wecB 4700 3567 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250181.1 protein_id gnl|my_center|LOCUS_09730 5983 4697 gene locus_tag LOCUS_09740 5983 4697 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062390429.1 protein_id gnl|my_center|LOCUS_09740 6270 7349 gene locus_tag LOCUS_09750 6270 7349 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250183.1 protein_id gnl|my_center|LOCUS_09750 7910 7350 gene locus_tag LOCUS_09760 7910 7350 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867670.1 protein_id gnl|my_center|LOCUS_09760 8188 7913 gene locus_tag LOCUS_09770 8188 7913 CDS product lipoate protein ligase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146571.1 protein_id gnl|my_center|LOCUS_09770 8279 10168 gene locus_tag LOCUS_09780 8279 10168 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250186.1 protein_id gnl|my_center|LOCUS_09780 10635 10864 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttccaataagactcttggagaattgaaat >Feature sequence055 511 1071 gene locus_tag LOCUS_09790 511 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250192.1 protein_id gnl|my_center|LOCUS_09790 1068 1304 gene locus_tag LOCUS_09800 1068 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 1371 2618 gene locus_tag LOCUS_09810 gene prf1 1371 2618 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250190.1 protein_id gnl|my_center|LOCUS_09810 3485 2598 gene locus_tag LOCUS_09820 3485 2598 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250188.1 protein_id gnl|my_center|LOCUS_09820 4864 3542 gene locus_tag LOCUS_09830 4864 3542 CDS product biotin--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053663.1 protein_id gnl|my_center|LOCUS_09830 5138 5992 gene locus_tag LOCUS_09840 5138 5992 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251185.1 protein_id gnl|my_center|LOCUS_09840 6489 6013 gene locus_tag LOCUS_09850 6489 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250158.1 protein_id gnl|my_center|LOCUS_09850 7551 6523 gene locus_tag LOCUS_09860 gene fen 7551 6523 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250232.1 protein_id gnl|my_center|LOCUS_09860 7731 9119 gene locus_tag LOCUS_09870 7731 9119 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249616.1 protein_id gnl|my_center|LOCUS_09870 9193 9891 gene locus_tag LOCUS_09880 9193 9891 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249618.1 protein_id gnl|my_center|LOCUS_09880 10208 9903 gene locus_tag LOCUS_09890 10208 9903 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249619.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence056 116 1519 gene locus_tag LOCUS_09900 116 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979925.1 protein_id gnl|my_center|LOCUS_09900 1842 1597 gene locus_tag LOCUS_09910 1842 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 2466 1852 gene locus_tag LOCUS_09920 2466 1852 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868634.1 protein_id gnl|my_center|LOCUS_09920 2776 2438 gene locus_tag LOCUS_09930 2776 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868635.1 protein_id gnl|my_center|LOCUS_09930 3418 2879 gene locus_tag LOCUS_09940 gene cysC 3418 2879 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868289.1 protein_id gnl|my_center|LOCUS_09940 3670 3455 gene locus_tag LOCUS_09950 3670 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 5181 3775 gene locus_tag LOCUS_09960 5181 3775 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249252.1 protein_id gnl|my_center|LOCUS_09960 6582 5251 gene locus_tag LOCUS_09970 gene purF 6582 5251 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249166.1 protein_id gnl|my_center|LOCUS_09970 6736 7431 gene locus_tag LOCUS_09980 6736 7431 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249165.1 protein_id gnl|my_center|LOCUS_09980 8535 7531 gene locus_tag LOCUS_09990 gene purM 8535 7531 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249163.1 protein_id gnl|my_center|LOCUS_09990 8934 10598 gene locus_tag LOCUS_10000 8934 10598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 >Feature sequence057 1744 782 gene locus_tag LOCUS_10010 1744 782 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868614.1 protein_id gnl|my_center|LOCUS_10010 2074 1754 gene locus_tag LOCUS_10020 2074 1754 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868615.1 protein_id gnl|my_center|LOCUS_10020 2437 3168 gene locus_tag LOCUS_10030 2437 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867544.1 protein_id gnl|my_center|LOCUS_10030 4409 3165 gene locus_tag LOCUS_10040 4409 3165 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249709.1 protein_id gnl|my_center|LOCUS_10040 4643 5935 gene locus_tag LOCUS_10050 gene asnS 4643 5935 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249710.1 protein_id gnl|my_center|LOCUS_10050 7347 6055 gene locus_tag LOCUS_10060 gene eno 7347 6055 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251056.1 protein_id gnl|my_center|LOCUS_10060 7465 8121 gene locus_tag LOCUS_10070 gene deoC 7465 8121 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_10070 8118 8405 gene locus_tag LOCUS_10080 8118 8405 CDS product family 4B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598724.1 protein_id gnl|my_center|LOCUS_10080 9021 8410 gene locus_tag LOCUS_10090 9021 8410 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251052.1 protein_id gnl|my_center|LOCUS_10090 10465 9128 gene locus_tag LOCUS_10100 10465 9128 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251051.1 protein_id gnl|my_center|LOCUS_10100 >Feature sequence058 1031 465 gene locus_tag LOCUS_10110 1031 465 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249087.1 protein_id gnl|my_center|LOCUS_10110 1150 1524 gene locus_tag LOCUS_10120 1150 1524 CDS product DUF356 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249084.1 protein_id gnl|my_center|LOCUS_10120 2062 1532 gene locus_tag LOCUS_10130 2062 1532 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146952.1 protein_id gnl|my_center|LOCUS_10130 2169 2636 gene locus_tag LOCUS_10140 2169 2636 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249080.1 protein_id gnl|my_center|LOCUS_10140 2720 3739 gene locus_tag LOCUS_10150 2720 3739 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868713.1 protein_id gnl|my_center|LOCUS_10150 3803 3880 gene locus_tag LOCUS_t00250 3803 3880 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4189 4854 gene locus_tag LOCUS_10160 4189 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867544.1 protein_id gnl|my_center|LOCUS_10160 6128 5016 gene locus_tag LOCUS_10170 6128 5016 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270496.1 protein_id gnl|my_center|LOCUS_10170 6245 6168 gene locus_tag LOCUS_t00260 6245 6168 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 6350 6437 gene locus_tag LOCUS_t00270 6350 6437 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7529 6774 gene locus_tag LOCUS_10180 7529 6774 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867402.1 protein_id gnl|my_center|LOCUS_10180 8338 7532 gene locus_tag LOCUS_10190 8338 7532 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867401.1 protein_id gnl|my_center|LOCUS_10190 8433 9473 gene locus_tag LOCUS_10200 8433 9473 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249740.1 protein_id gnl|my_center|LOCUS_10200 9500 9928 gene locus_tag LOCUS_10210 9500 9928 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867807.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence059 <1 1611 gene locus_tag LOCUS_10220 <1 1611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867901.1:NEW3 domain-containing protein 1613 2596 gene locus_tag LOCUS_10230 1613 2596 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867900.1 protein_id gnl|my_center|LOCUS_10230 5520 2635 gene locus_tag LOCUS_10240 5520 2635 CDS product intein-containing RctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870187.1 protein_id gnl|my_center|LOCUS_10240 6144 5671 gene locus_tag LOCUS_10250 6144 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868124.1 protein_id gnl|my_center|LOCUS_10250 6980 6075 gene locus_tag LOCUS_10260 6980 6075 CDS product tRNA (cytosine(49)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249315.1 protein_id gnl|my_center|LOCUS_10260 7415 6990 gene locus_tag LOCUS_10270 7415 6990 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867748.1 protein_id gnl|my_center|LOCUS_10270 7472 8329 gene locus_tag LOCUS_10280 gene panB 7472 8329 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249318.1 protein_id gnl|my_center|LOCUS_10280 9168 8326 gene locus_tag LOCUS_10290 9168 8326 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146703.1 protein_id gnl|my_center|LOCUS_10290 9487 9161 gene locus_tag LOCUS_10300 9487 9161 CDS product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250731.1 protein_id gnl|my_center|LOCUS_10300 9619 9532 gene locus_tag LOCUS_t00280 9619 9532 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9945 9637 gene locus_tag LOCUS_10310 gene rpsJ 9945 9637 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867802.1 protein_id gnl|my_center|LOCUS_10310 >Feature sequence060 302 1498 gene locus_tag LOCUS_10320 302 1498 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250233.1 protein_id gnl|my_center|LOCUS_10320 1508 2158 gene locus_tag LOCUS_10330 1508 2158 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249502.1 protein_id gnl|my_center|LOCUS_10330 4211 2262 gene locus_tag LOCUS_10340 gene rqcH 4211 2262 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867817.1 protein_id gnl|my_center|LOCUS_10340 5538 4192 gene locus_tag LOCUS_10350 5538 4192 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251170.1 protein_id gnl|my_center|LOCUS_10350 7131 5674 gene locus_tag LOCUS_10360 7131 5674 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251169.1 protein_id gnl|my_center|LOCUS_10360 8122 7145 gene locus_tag LOCUS_10370 8122 7145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 8247 8924 gene locus_tag LOCUS_10380 8247 8924 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249763.1 protein_id gnl|my_center|LOCUS_10380 8942 9721 gene locus_tag LOCUS_10390 8942 9721 CDS product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876426.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence061 301 107 gene locus_tag LOCUS_10400 301 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 336 2246 gene locus_tag LOCUS_10410 336 2246 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249735.1 protein_id gnl|my_center|LOCUS_10410 4291 2273 gene locus_tag LOCUS_10420 4291 2273 CDS product CGP-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249529.1 protein_id gnl|my_center|LOCUS_10420 5052 4447 gene locus_tag LOCUS_10430 5052 4447 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867942.1 protein_id gnl|my_center|LOCUS_10430 6145 5081 gene locus_tag LOCUS_10440 6145 5081 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_10440 7997 6156 gene locus_tag LOCUS_10450 7997 6156 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249526.1 protein_id gnl|my_center|LOCUS_10450 9643 8099 gene locus_tag LOCUS_10460 9643 8099 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249525.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence062 1088 1387 gene locus_tag LOCUS_10470 1088 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 2029 2976 gene locus_tag LOCUS_10480 gene argF 2029 2976 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_10480 3700 2993 gene locus_tag LOCUS_10490 3700 2993 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147220.1 protein_id gnl|my_center|LOCUS_10490 4646 3741 gene locus_tag LOCUS_10500 4646 3741 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250507.1 protein_id gnl|my_center|LOCUS_10500 4743 5342 gene locus_tag LOCUS_10510 4743 5342 CDS product regulator of amino acid metabolism, contains ACT domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147148.1 protein_id gnl|my_center|LOCUS_10510 5601 5326 gene locus_tag LOCUS_10520 5601 5326 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_10520 8210 5898 gene locus_tag LOCUS_10530 gene hypF 8210 5898 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250947.1 protein_id gnl|my_center|LOCUS_10530 8374 8685 gene locus_tag LOCUS_10540 gene cutA 8374 8685 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868105.1 protein_id gnl|my_center|LOCUS_10540 8695 9276 gene locus_tag LOCUS_10550 8695 9276 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146478.1 protein_id gnl|my_center|LOCUS_10550 9273 9968 gene locus_tag LOCUS_10560 9273 9968 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061278.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence063 1101 403 gene locus_tag LOCUS_10570 gene sfsA 1101 403 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249730.1 protein_id gnl|my_center|LOCUS_10570 1189 2235 gene locus_tag LOCUS_10580 1189 2235 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249732.1 protein_id gnl|my_center|LOCUS_10580 2505 2278 gene locus_tag LOCUS_10590 2505 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146969.1 protein_id gnl|my_center|LOCUS_10590 2608 2685 gene locus_tag LOCUS_t00290 2608 2685 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2785 4281 gene locus_tag LOCUS_10600 2785 4281 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250791.1 protein_id gnl|my_center|LOCUS_10600 4478 4714 gene locus_tag LOCUS_10610 4478 4714 CDS product antitoxin VapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146550.1 protein_id gnl|my_center|LOCUS_10610 4687 5058 gene locus_tag LOCUS_10620 4687 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 5389 5063 gene locus_tag LOCUS_10630 5389 5063 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868731.1 protein_id gnl|my_center|LOCUS_10630 6511 5399 gene locus_tag LOCUS_10640 6511 5399 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250787.1 protein_id gnl|my_center|LOCUS_10640 6576 7178 gene locus_tag LOCUS_10650 gene pcp 6576 7178 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250786.1 protein_id gnl|my_center|LOCUS_10650 7455 7153 gene locus_tag LOCUS_10660 7455 7153 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250777.1 protein_id gnl|my_center|LOCUS_10660 8071 7460 gene locus_tag LOCUS_10670 8071 7460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250776.1 protein_id gnl|my_center|LOCUS_10670 8936 8136 gene locus_tag LOCUS_10680 gene mtnP 8936 8136 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250433.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence064 1468 464 gene locus_tag LOCUS_10690 1468 464 CDS product phosphorylating glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249716.1 protein_id gnl|my_center|LOCUS_10690 3215 1551 gene locus_tag LOCUS_10700 gene thsB 3215 1551 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249629.1 protein_id gnl|my_center|LOCUS_10700 3421 4086 gene locus_tag LOCUS_10710 3421 4086 CDS product Kae1-associated kinase Bud32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249630.1 protein_id gnl|my_center|LOCUS_10710 4100 4657 gene locus_tag LOCUS_10720 4100 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 6361 4673 gene locus_tag LOCUS_10730 6361 4673 CDS product DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249633.1 protein_id gnl|my_center|LOCUS_10730 6822 6358 gene locus_tag LOCUS_10740 gene moaC 6822 6358 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249309.1 protein_id gnl|my_center|LOCUS_10740 6910 7239 gene locus_tag LOCUS_10750 6910 7239 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250876.1 protein_id gnl|my_center|LOCUS_10750 7317 8279 gene locus_tag LOCUS_10760 7317 8279 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867900.1 protein_id gnl|my_center|LOCUS_10760 8284 9204 gene locus_tag LOCUS_10770 8284 9204 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867902.1 protein_id gnl|my_center|LOCUS_10770 >Feature sequence065 433 206 gene locus_tag LOCUS_10780 gene rpl18a 433 206 CDS product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250273.1 protein_id gnl|my_center|LOCUS_10780 1125 439 gene locus_tag LOCUS_10790 1125 439 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868639.1 protein_id gnl|my_center|LOCUS_10790 1426 1154 gene locus_tag LOCUS_10800 1426 1154 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868638.1 protein_id gnl|my_center|LOCUS_10800 1588 1433 gene locus_tag LOCUS_10810 1588 1433 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250270.1 protein_id gnl|my_center|LOCUS_10810 2419 1751 gene locus_tag LOCUS_10820 2419 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 3803 2730 gene locus_tag LOCUS_10830 3803 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 4713 3796 gene locus_tag LOCUS_10840 4713 3796 CDS product DUF4855 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249397.1 protein_id gnl|my_center|LOCUS_10840 5479 4886 gene locus_tag LOCUS_10850 5479 4886 CDS product asparagine synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053718.1 protein_id gnl|my_center|LOCUS_10850 5820 5482 gene locus_tag LOCUS_10860 5820 5482 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146744.1 protein_id gnl|my_center|LOCUS_10860 6454 6002 gene locus_tag LOCUS_10870 6454 6002 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250227.1 protein_id gnl|my_center|LOCUS_10870 6871 6458 gene locus_tag LOCUS_10880 6871 6458 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250226.1 protein_id gnl|my_center|LOCUS_10880 7274 6906 gene locus_tag LOCUS_10890 7274 6906 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248986.1 protein_id gnl|my_center|LOCUS_10890 8143 7298 gene locus_tag LOCUS_10900 8143 7298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10900 9092 8106 gene locus_tag LOCUS_10910 9092 8106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10910 9857 9339 gene locus_tag LOCUS_10920 gene ndk 9857 9339 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250258.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence066 282 359 gene locus_tag LOCUS_t00300 282 359 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1299 814 gene locus_tag LOCUS_10930 1299 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 2669 1521 gene locus_tag LOCUS_10940 2669 1521 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249334.1 protein_id gnl|my_center|LOCUS_10940 3495 2695 gene locus_tag LOCUS_10950 3495 2695 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251246.1 protein_id gnl|my_center|LOCUS_10950 3568 5205 gene locus_tag LOCUS_10960 3568 5205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 5312 5890 gene locus_tag LOCUS_10970 5312 5890 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053721.1 protein_id gnl|my_center|LOCUS_10970 5900 6250 gene locus_tag LOCUS_10980 5900 6250 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250070.1 protein_id gnl|my_center|LOCUS_10980 6330 7118 gene locus_tag LOCUS_10990 6330 7118 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249754.1 protein_id gnl|my_center|LOCUS_10990 7115 7939 gene locus_tag LOCUS_11000 7115 7939 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249755.1 protein_id gnl|my_center|LOCUS_11000 8005 8808 gene locus_tag LOCUS_11010 8005 8808 CDS product diadenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249465.1 protein_id gnl|my_center|LOCUS_11010 9150 8872 gene locus_tag LOCUS_11020 9150 8872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053674.1 protein_id gnl|my_center|LOCUS_11020 9809 9162 gene locus_tag LOCUS_11030 9809 9162 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249615.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence067 496 44 gene locus_tag LOCUS_11040 496 44 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250236.1 protein_id gnl|my_center|LOCUS_11040 602 1765 gene locus_tag LOCUS_11050 602 1765 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250237.1 protein_id gnl|my_center|LOCUS_11050 2198 1758 gene locus_tag LOCUS_11060 2198 1758 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598730.1 protein_id gnl|my_center|LOCUS_11060 2389 2568 gene locus_tag LOCUS_11070 2389 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249069.1 protein_id gnl|my_center|LOCUS_11070 2565 4181 gene locus_tag LOCUS_11080 2565 4181 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249070.1 protein_id gnl|my_center|LOCUS_11080 4304 5752 gene locus_tag LOCUS_11090 4304 5752 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249074.1 protein_id gnl|my_center|LOCUS_11090 5745 6251 gene locus_tag LOCUS_11100 5745 6251 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867435.1 protein_id gnl|my_center|LOCUS_11100 6248 6529 gene locus_tag LOCUS_11110 6248 6529 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249076.1 protein_id gnl|my_center|LOCUS_11110 6519 7670 gene locus_tag LOCUS_11120 6519 7670 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249077.1 protein_id gnl|my_center|LOCUS_11120 7713 9056 gene locus_tag LOCUS_11130 7713 9056 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582603.1 protein_id gnl|my_center|LOCUS_11130 9149 9559 gene locus_tag LOCUS_11140 gene tnpA 9149 9559 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249883.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence068 <1 546 gene locus_tag LOCUS_11150 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250841.1:[protein ADP-ribosylglutamate] hydrolase 559 981 gene locus_tag LOCUS_11160 559 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 1014 2456 gene locus_tag LOCUS_11170 1014 2456 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250837.1 protein_id gnl|my_center|LOCUS_11170 3093 2524 gene locus_tag LOCUS_11180 3093 2524 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250834.1 protein_id gnl|my_center|LOCUS_11180 3405 3100 gene locus_tag LOCUS_11190 3405 3100 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250833.1 protein_id gnl|my_center|LOCUS_11190 4016 3432 gene locus_tag LOCUS_11200 4016 3432 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250832.1 protein_id gnl|my_center|LOCUS_11200 4756 4082 gene locus_tag LOCUS_11210 4756 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868679.1 protein_id gnl|my_center|LOCUS_11210 6471 4786 gene locus_tag LOCUS_11220 6471 4786 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053886.1 protein_id gnl|my_center|LOCUS_11220 7527 6601 gene locus_tag LOCUS_11230 7527 6601 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251091.1 protein_id gnl|my_center|LOCUS_11230 8494 7532 gene locus_tag LOCUS_11240 8494 7532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 9353 8415 gene locus_tag LOCUS_11250 9353 8415 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842263.1 protein_id gnl|my_center|LOCUS_11250 >Feature sequence069 334 942 gene locus_tag LOCUS_11260 334 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249130.1 protein_id gnl|my_center|LOCUS_11260 1024 1197 gene locus_tag LOCUS_11270 1024 1197 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088862262.1 protein_id gnl|my_center|LOCUS_11270 1208 1483 gene locus_tag LOCUS_11280 1208 1483 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867152.1 protein_id gnl|my_center|LOCUS_11280 2499 1489 gene locus_tag LOCUS_11290 2499 1489 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251247.1 protein_id gnl|my_center|LOCUS_11290 2810 2601 gene locus_tag LOCUS_11300 2810 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251086.1 protein_id gnl|my_center|LOCUS_11300 2893 4200 gene locus_tag LOCUS_11310 gene rlmD 2893 4200 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053885.1 protein_id gnl|my_center|LOCUS_11310 4268 4696 gene locus_tag LOCUS_11320 gene lrpA 4268 4696 CDS product HTH-type transcriptional regulator LrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867694.1 protein_id gnl|my_center|LOCUS_11320 4838 4915 gene locus_tag LOCUS_t00310 4838 4915 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5336 4920 gene locus_tag LOCUS_11330 5336 4920 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146774.1 protein_id gnl|my_center|LOCUS_11330 5465 6211 gene locus_tag LOCUS_11340 5465 6211 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249603.1 protein_id gnl|my_center|LOCUS_11340 6766 6155 gene locus_tag LOCUS_11350 6766 6155 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250285.1 protein_id gnl|my_center|LOCUS_11350 8962 6800 gene locus_tag LOCUS_11360 8962 6800 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868004.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence070 418 107 gene locus_tag LOCUS_11370 418 107 CDS product V-type ATP synthase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147203.1 protein_id gnl|my_center|LOCUS_11370 1556 528 gene locus_tag LOCUS_11380 1556 528 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250429.1 protein_id gnl|my_center|LOCUS_11380 2430 1738 gene locus_tag LOCUS_11390 2430 1738 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868887.1 protein_id gnl|my_center|LOCUS_11390 3949 2435 gene locus_tag LOCUS_11400 3949 2435 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868888.1 protein_id gnl|my_center|LOCUS_11400 4800 3946 gene locus_tag LOCUS_11410 4800 3946 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250544.1 protein_id gnl|my_center|LOCUS_11410 4959 6050 gene locus_tag LOCUS_11420 4959 6050 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_11420 6052 7350 gene locus_tag LOCUS_11430 6052 7350 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250913.1 protein_id gnl|my_center|LOCUS_11430 7420 7842 gene locus_tag LOCUS_11440 gene speD 7420 7842 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868894.1 protein_id gnl|my_center|LOCUS_11440 8262 7843 gene locus_tag LOCUS_11450 8262 7843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 9000 8275 gene locus_tag LOCUS_11460 9000 8275 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250541.1 protein_id gnl|my_center|LOCUS_11460 9157 9232 gene locus_tag LOCUS_t00320 9157 9232 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence071 2312 1488 gene locus_tag LOCUS_11470 gene rsmA 2312 1488 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249850.1 protein_id gnl|my_center|LOCUS_11470 2939 2322 gene locus_tag LOCUS_11480 2939 2322 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867500.1 protein_id gnl|my_center|LOCUS_11480 3383 3018 gene locus_tag LOCUS_11490 3383 3018 CDS product DNA-directed RNA polymerase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868224.1 protein_id gnl|my_center|LOCUS_11490 3683 3390 gene locus_tag LOCUS_11500 3683 3390 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249853.1 protein_id gnl|my_center|LOCUS_11500 4842 3640 gene locus_tag LOCUS_11510 4842 3640 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249854.1 protein_id gnl|my_center|LOCUS_11510 4886 5188 gene locus_tag LOCUS_11520 4886 5188 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249855.1 protein_id gnl|my_center|LOCUS_11520 5321 6640 gene locus_tag LOCUS_11530 gene gatD 5321 6640 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249859.1 protein_id gnl|my_center|LOCUS_11530 6646 8523 gene locus_tag LOCUS_11540 gene gatE 6646 8523 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249862.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence072 <1 587 gene locus_tag LOCUS_11550 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249801.1:RNA-guided endonuclease TnpB family protein 774 1367 gene locus_tag LOCUS_11560 774 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 2580 1369 gene locus_tag LOCUS_11570 gene hmgA 2580 1369 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249865.1 protein_id gnl|my_center|LOCUS_11570 3368 2601 gene locus_tag LOCUS_11580 3368 2601 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249866.1 protein_id gnl|my_center|LOCUS_11580 3782 3534 gene locus_tag LOCUS_11590 3782 3534 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146864.1 protein_id gnl|my_center|LOCUS_11590 3929 4336 gene locus_tag LOCUS_11600 3929 4336 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867231.1 protein_id gnl|my_center|LOCUS_11600 4342 5862 gene locus_tag LOCUS_11610 4342 5862 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146486.1 protein_id gnl|my_center|LOCUS_11610 6009 5863 gene locus_tag LOCUS_11620 6009 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 6240 7010 gene locus_tag LOCUS_11630 6240 7010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868476.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence073 318 1187 gene locus_tag LOCUS_11640 318 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 2547 1405 gene locus_tag LOCUS_11650 2547 1405 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249758.1 protein_id gnl|my_center|LOCUS_11650 2745 3335 gene locus_tag LOCUS_11660 2745 3335 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250120.1 protein_id gnl|my_center|LOCUS_11660 3339 3971 gene locus_tag LOCUS_11670 3339 3971 CDS product DUF2067 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867176.1 protein_id gnl|my_center|LOCUS_11670 3961 4248 gene locus_tag LOCUS_11680 3961 4248 CDS product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867175.1 protein_id gnl|my_center|LOCUS_11680 4285 4671 gene locus_tag LOCUS_11690 4285 4671 CDS product ribonuclease III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053838.1 protein_id gnl|my_center|LOCUS_11690 5482 4673 gene locus_tag LOCUS_11700 5482 4673 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250116.1 protein_id gnl|my_center|LOCUS_11700 7006 5525 gene locus_tag LOCUS_11710 7006 5525 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250133.1 protein_id gnl|my_center|LOCUS_11710 7330 7097 gene locus_tag LOCUS_11720 7330 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053807.1 protein_id gnl|my_center|LOCUS_11720 7435 7974 gene locus_tag LOCUS_11730 7435 7974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053664.1 protein_id gnl|my_center|LOCUS_11730 <8848 7958 gene locus_tag LOCUS_11740 <8848 7958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251252.1:tRNA pseudouridine(13) synthase TruD >Feature sequence074 368 1009 gene locus_tag LOCUS_11750 368 1009 CDS product DUF432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250891.1 protein_id gnl|my_center|LOCUS_11750 1012 2100 gene locus_tag LOCUS_11760 1012 2100 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250890.1 protein_id gnl|my_center|LOCUS_11760 4716 2116 gene locus_tag LOCUS_11770 4716 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 5213 6028 gene locus_tag LOCUS_11780 5213 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 6220 6017 gene locus_tag LOCUS_11790 6220 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 6918 6286 gene locus_tag LOCUS_11800 6918 6286 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250883.1 protein_id gnl|my_center|LOCUS_11800 7307 6915 gene locus_tag LOCUS_11810 7307 6915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 8351 7320 gene locus_tag LOCUS_11820 gene dph2 8351 7320 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250878.1 protein_id gnl|my_center|LOCUS_11820 >Feature sequence075 411 830 gene locus_tag LOCUS_11830 411 830 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251243.1 protein_id gnl|my_center|LOCUS_11830 901 1896 gene locus_tag LOCUS_11840 901 1896 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249612.1 protein_id gnl|my_center|LOCUS_11840 3167 1893 gene locus_tag LOCUS_11850 3167 1893 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250287.1 protein_id gnl|my_center|LOCUS_11850 3908 3168 gene locus_tag LOCUS_11860 3908 3168 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250288.1 protein_id gnl|my_center|LOCUS_11860 4071 3889 gene locus_tag LOCUS_11870 4071 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 4270 4073 gene locus_tag LOCUS_11880 4270 4073 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250290.1 protein_id gnl|my_center|LOCUS_11880 4561 4271 gene locus_tag LOCUS_11890 4561 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 4942 4562 gene locus_tag LOCUS_11900 4942 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 6309 5044 gene locus_tag LOCUS_11910 6309 5044 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251014.1 protein_id gnl|my_center|LOCUS_11910 6412 7575 gene locus_tag LOCUS_11920 6412 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250381.1 protein_id gnl|my_center|LOCUS_11920 7585 8379 gene locus_tag LOCUS_11930 gene dph5 7585 8379 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249061.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence076 87 395 gene locus_tag LOCUS_11940 87 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 425 988 gene locus_tag LOCUS_11950 425 988 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249693.1 protein_id gnl|my_center|LOCUS_11950 1421 999 gene locus_tag LOCUS_11960 1421 999 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868380.1 protein_id gnl|my_center|LOCUS_11960 1477 2013 gene locus_tag LOCUS_11970 1477 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249519.1 protein_id gnl|my_center|LOCUS_11970 2456 2025 gene locus_tag LOCUS_11980 2456 2025 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201060.1 protein_id gnl|my_center|LOCUS_11980 2985 2527 gene locus_tag LOCUS_11990 2985 2527 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249518.1 protein_id gnl|my_center|LOCUS_11990 3176 3036 gene locus_tag LOCUS_12000 3176 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 3293 3592 gene locus_tag LOCUS_12010 3293 3592 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249517.1 protein_id gnl|my_center|LOCUS_12010 4018 3581 gene locus_tag LOCUS_12020 4018 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12020 5495 4707 gene locus_tag LOCUS_12030 5495 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 6440 5553 gene locus_tag LOCUS_12040 6440 5553 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867986.1 protein_id gnl|my_center|LOCUS_12040 7306 6443 gene locus_tag LOCUS_12050 7306 6443 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867985.1 protein_id gnl|my_center|LOCUS_12050 8393 7341 gene locus_tag LOCUS_12060 8393 7341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence077 75 1208 gene locus_tag LOCUS_12070 75 1208 CDS product tungsten cofactor oxidoreductase radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755814.1 protein_id gnl|my_center|LOCUS_12070 1634 1236 gene locus_tag LOCUS_12080 1634 1236 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146785.1 protein_id gnl|my_center|LOCUS_12080 1773 2954 gene locus_tag LOCUS_12090 1773 2954 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065687.1 protein_id gnl|my_center|LOCUS_12090 2951 4285 gene locus_tag LOCUS_12100 2951 4285 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146783.1 protein_id gnl|my_center|LOCUS_12100 4290 5366 gene locus_tag LOCUS_12110 4290 5366 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146519.1 protein_id gnl|my_center|LOCUS_12110 5483 5686 gene locus_tag LOCUS_12120 5483 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 6270 5860 gene locus_tag LOCUS_12130 6270 5860 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250962.1 protein_id gnl|my_center|LOCUS_12130 6408 7121 gene locus_tag LOCUS_12140 6408 7121 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081657.1 protein_id gnl|my_center|LOCUS_12140 7118 8068 gene locus_tag LOCUS_12150 7118 8068 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081655.1 protein_id gnl|my_center|LOCUS_12150 8315 8097 gene locus_tag LOCUS_12160 8315 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence078 287 490 gene locus_tag LOCUS_12170 287 490 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146862.1 protein_id gnl|my_center|LOCUS_12170 1248 487 gene locus_tag LOCUS_12180 1248 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 1628 1245 gene locus_tag LOCUS_12190 1628 1245 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146588.1 protein_id gnl|my_center|LOCUS_12190 2877 1570 gene locus_tag LOCUS_12200 2877 1570 CDS product DUF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249748.1 protein_id gnl|my_center|LOCUS_12200 4019 2874 gene locus_tag LOCUS_12210 4019 2874 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249749.1 protein_id gnl|my_center|LOCUS_12210 5704 4016 gene locus_tag LOCUS_12220 gene top6B 5704 4016 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249750.1 protein_id gnl|my_center|LOCUS_12220 6345 5725 gene locus_tag LOCUS_12230 6345 5725 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867717.1 protein_id gnl|my_center|LOCUS_12230 7123 6332 gene locus_tag LOCUS_12240 7123 6332 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867716.1 protein_id gnl|my_center|LOCUS_12240 7509 7132 gene locus_tag LOCUS_12250 gene eif1A 7509 7132 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146587.1 protein_id gnl|my_center|LOCUS_12250 7657 7947 gene locus_tag LOCUS_12260 7657 7947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 8334 7951 gene locus_tag LOCUS_12270 8334 7951 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249910.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence079 1257 136 gene locus_tag LOCUS_12280 1257 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1435 1316 gene locus_tag LOCUS_12290 1435 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 2727 1960 gene locus_tag LOCUS_12300 2727 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 3687 2908 gene locus_tag LOCUS_12310 3687 2908 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250424.1 protein_id gnl|my_center|LOCUS_12310 4688 3684 gene locus_tag LOCUS_12320 4688 3684 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250425.1 protein_id gnl|my_center|LOCUS_12320 5614 4742 gene locus_tag LOCUS_12330 5614 4742 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250428.1 protein_id gnl|my_center|LOCUS_12330 6298 5693 gene locus_tag LOCUS_12340 gene rpsB 6298 5693 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250447.1 protein_id gnl|my_center|LOCUS_12340 7336 6305 gene locus_tag LOCUS_12350 7336 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250448.1 protein_id gnl|my_center|LOCUS_12350 7523 7347 gene locus_tag LOCUS_12360 7523 7347 CDS product DNA-directed RNA polymerase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867659.1 protein_id gnl|my_center|LOCUS_12360 7622 7545 gene locus_tag LOCUS_t00330 7622 7545 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7835 7641 gene locus_tag LOCUS_12370 7835 7641 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867658.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence080 1769 84 gene locus_tag LOCUS_12380 1769 84 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250100.1 protein_id gnl|my_center|LOCUS_12380 4027 1874 gene locus_tag LOCUS_12390 4027 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250101.1 protein_id gnl|my_center|LOCUS_12390 4818 4030 gene locus_tag LOCUS_12400 4818 4030 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088854783.1 protein_id gnl|my_center|LOCUS_12400 5749 4811 gene locus_tag LOCUS_12410 5749 4811 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250103.1 protein_id gnl|my_center|LOCUS_12410 6042 6371 gene locus_tag LOCUS_12420 6042 6371 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084207606.1 protein_id gnl|my_center|LOCUS_12420 6340 6984 gene locus_tag LOCUS_12430 6340 6984 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868343.1 protein_id gnl|my_center|LOCUS_12430 7162 7085 gene locus_tag LOCUS_t00340 7162 7085 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 <8272 7265 gene locus_tag LOCUS_12440 <8272 7265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249503.1:pyridoxal phosphate-dependent aminotransferase >Feature sequence081 <1 576 gene locus_tag LOCUS_12450 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011761882.1:undecaprenyl-diphosphate phosphatase 573 1829 gene locus_tag LOCUS_12460 573 1829 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250139.1 protein_id gnl|my_center|LOCUS_12460 1832 2965 gene locus_tag LOCUS_12470 1832 2965 CDS product DUF835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250138.1 protein_id gnl|my_center|LOCUS_12470 4050 2941 gene locus_tag LOCUS_12480 gene hypD 4050 2941 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250950.1 protein_id gnl|my_center|LOCUS_12480 4277 4053 gene locus_tag LOCUS_12490 4277 4053 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868354.1 protein_id gnl|my_center|LOCUS_12490 5530 4361 gene locus_tag LOCUS_12500 5530 4361 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868558.1 protein_id gnl|my_center|LOCUS_12500 6032 5721 gene locus_tag LOCUS_12510 6032 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 6582 6668 gene locus_tag LOCUS_t00350 6582 6668 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6898 6677 gene locus_tag LOCUS_12520 6898 6677 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249884.1 protein_id gnl|my_center|LOCUS_12520 6967 7806 gene locus_tag LOCUS_12530 6967 7806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249881.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence082 <1 920 gene locus_tag LOCUS_12540 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250732.1:M20 family metallo-hydrolase 1291 2571 gene locus_tag LOCUS_12550 1291 2571 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250733.1 protein_id gnl|my_center|LOCUS_12550 2618 3361 gene locus_tag LOCUS_12560 2618 3361 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250735.1 protein_id gnl|my_center|LOCUS_12560 3608 3375 gene locus_tag LOCUS_12570 3608 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 4619 3618 gene locus_tag LOCUS_12580 gene acoB 4619 3618 CDS product acetoin:2,6-dichlorophenolindophenol oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198892.1 protein_id gnl|my_center|LOCUS_12580 5625 4621 gene locus_tag LOCUS_12590 gene pdhA 5625 4621 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_12590 6132 5692 gene locus_tag LOCUS_12600 6132 5692 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867668.1 protein_id gnl|my_center|LOCUS_12600 6446 6138 gene locus_tag LOCUS_12610 6446 6138 CDS product DUF6506 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966779.1 protein_id gnl|my_center|LOCUS_12610 6598 6479 gene locus_tag LOCUS_12620 6598 6479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 7616 6633 gene locus_tag LOCUS_12630 7616 6633 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_12630 7954 7604 gene locus_tag LOCUS_12640 7954 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 >Feature sequence083 1121 246 gene locus_tag LOCUS_12650 1121 246 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249565.1 protein_id gnl|my_center|LOCUS_12650 1350 2426 gene locus_tag LOCUS_12660 1350 2426 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867726.1 protein_id gnl|my_center|LOCUS_12660 3204 2476 gene locus_tag LOCUS_12670 3204 2476 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851426.1 protein_id gnl|my_center|LOCUS_12670 3337 4362 gene locus_tag LOCUS_12680 3337 4362 CDS product DUF3226 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249064.1 protein_id gnl|my_center|LOCUS_12680 6913 4592 gene locus_tag LOCUS_12690 6913 4592 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868838.1 protein_id gnl|my_center|LOCUS_12690 7798 6986 gene locus_tag LOCUS_12700 7798 6986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence084 505 726 gene locus_tag LOCUS_12710 505 726 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020854.1 protein_id gnl|my_center|LOCUS_12710 727 1371 gene locus_tag LOCUS_12720 727 1371 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020851.1 protein_id gnl|my_center|LOCUS_12720 2648 1374 gene locus_tag LOCUS_12730 2648 1374 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867692.1 protein_id gnl|my_center|LOCUS_12730 3136 2612 gene locus_tag LOCUS_12740 3136 2612 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867691.1 protein_id gnl|my_center|LOCUS_12740 3487 3903 gene locus_tag LOCUS_12750 gene hypA 3487 3903 CDS product hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250958.1 protein_id gnl|my_center|LOCUS_12750 3900 4655 gene locus_tag LOCUS_12760 3900 4655 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250957.1 protein_id gnl|my_center|LOCUS_12760 4672 5166 gene locus_tag LOCUS_12770 4672 5166 CDS product hydrogenase 3 maturation endopeptidase HyCI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250954.1 protein_id gnl|my_center|LOCUS_12770 5862 5143 gene locus_tag LOCUS_12780 5862 5143 CDS product electron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250160.1 protein_id gnl|my_center|LOCUS_12780 6509 5934 gene locus_tag LOCUS_12790 6509 5934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 <7855 6584 gene locus_tag LOCUS_12800 <7855 6584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048147345.1:ATP-dependent protease LonB >Feature sequence085 969 634 gene locus_tag LOCUS_12810 969 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1514 966 gene locus_tag LOCUS_12820 1514 966 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250005.1 protein_id gnl|my_center|LOCUS_12820 1600 1728 gene locus_tag LOCUS_12830 1600 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 1845 2147 gene locus_tag LOCUS_12840 1845 2147 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867536.1 protein_id gnl|my_center|LOCUS_12840 2838 2515 gene locus_tag LOCUS_12850 2838 2515 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249482.1 protein_id gnl|my_center|LOCUS_12850 3454 2900 gene locus_tag LOCUS_12860 3454 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 4077 3454 gene locus_tag LOCUS_12870 4077 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 4672 4070 gene locus_tag LOCUS_12880 4672 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 5349 4669 gene locus_tag LOCUS_12890 5349 4669 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249999.1 protein_id gnl|my_center|LOCUS_12890 5896 5549 gene locus_tag LOCUS_12900 5896 5549 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146718.1 protein_id gnl|my_center|LOCUS_12900 6049 5906 gene locus_tag LOCUS_12910 6049 5906 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249479.1 protein_id gnl|my_center|LOCUS_12910 6661 6146 gene locus_tag LOCUS_12920 6661 6146 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064432.1 protein_id gnl|my_center|LOCUS_12920 7115 6735 gene locus_tag LOCUS_12930 7115 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 7675 7142 gene locus_tag LOCUS_12940 7675 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence086 <1 1032 gene locus_tag LOCUS_12950 <1 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249801.1:RNA-guided endonuclease TnpB family protein 1417 1022 gene locus_tag LOCUS_12960 1417 1022 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053361.1 protein_id gnl|my_center|LOCUS_12960 2088 1414 gene locus_tag LOCUS_12970 2088 1414 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392690.1 protein_id gnl|my_center|LOCUS_12970 2370 2089 gene locus_tag LOCUS_12980 2370 2089 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393974.1 protein_id gnl|my_center|LOCUS_12980 3702 2398 gene locus_tag LOCUS_12990 gene rbcL 3702 2398 CDS product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146906.1 protein_id gnl|my_center|LOCUS_12990 4006 4209 gene locus_tag LOCUS_13000 gene hpkB 4006 4209 CDS product archaeal histone HpkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251239.1 protein_id gnl|my_center|LOCUS_13000 4759 4244 gene locus_tag LOCUS_13010 4759 4244 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251238.1 protein_id gnl|my_center|LOCUS_13010 5327 4764 gene locus_tag LOCUS_13020 5327 4764 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868739.1 protein_id gnl|my_center|LOCUS_13020 5384 5698 gene locus_tag LOCUS_13030 5384 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248968.1 protein_id gnl|my_center|LOCUS_13030 5701 6246 gene locus_tag LOCUS_13040 5701 6246 CDS product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248969.1 protein_id gnl|my_center|LOCUS_13040 >Feature sequence087 3941 564 gene locus_tag LOCUS_13050 3941 564 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250804.1 protein_id gnl|my_center|LOCUS_13050 4944 3883 gene locus_tag LOCUS_13060 4944 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868506.1 protein_id gnl|my_center|LOCUS_13060 6379 4955 gene locus_tag LOCUS_13070 6379 4955 CDS product DUF515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146991.1 protein_id gnl|my_center|LOCUS_13070 6471 6806 gene locus_tag LOCUS_13080 6471 6806 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250807.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence088 1192 2223 gene locus_tag LOCUS_13090 1192 2223 CDS product DUF5305 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250652.1 protein_id gnl|my_center|LOCUS_13090 2282 3052 gene locus_tag LOCUS_13100 2282 3052 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250894.1 protein_id gnl|my_center|LOCUS_13100 3052 3720 gene locus_tag LOCUS_13110 3052 3720 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250893.1 protein_id gnl|my_center|LOCUS_13110 4073 3780 gene locus_tag LOCUS_13120 4073 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 4297 4989 gene locus_tag LOCUS_13130 4297 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 5236 4967 gene locus_tag LOCUS_13140 5236 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 5235 6119 gene locus_tag LOCUS_13150 5235 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048151087.1 protein_id gnl|my_center|LOCUS_13150 >Feature sequence089 352 1635 gene locus_tag LOCUS_13160 352 1635 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867911.1 protein_id gnl|my_center|LOCUS_13160 1641 2339 gene locus_tag LOCUS_13170 gene upp 1641 2339 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867910.1 protein_id gnl|my_center|LOCUS_13170 2507 2986 gene locus_tag LOCUS_13180 2507 2986 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867179.1 protein_id gnl|my_center|LOCUS_13180 4053 2983 gene locus_tag LOCUS_13190 4053 2983 CDS product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146675.1 protein_id gnl|my_center|LOCUS_13190 4286 4579 gene locus_tag LOCUS_13200 4286 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 4651 5298 gene locus_tag LOCUS_13210 4651 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249695.1 protein_id gnl|my_center|LOCUS_13210 6098 5343 gene locus_tag LOCUS_13220 6098 5343 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249696.1 protein_id gnl|my_center|LOCUS_13220 6889 6095 gene locus_tag LOCUS_13230 6889 6095 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249697.1 protein_id gnl|my_center|LOCUS_13230 >Feature sequence090 1296 2120 gene locus_tag LOCUS_13240 1296 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 2107 2532 gene locus_tag LOCUS_13250 2107 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 2529 3482 gene locus_tag LOCUS_13260 2529 3482 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_13260 3503 4738 gene locus_tag LOCUS_13270 3503 4738 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250796.1 protein_id gnl|my_center|LOCUS_13270 4735 5160 gene locus_tag LOCUS_13280 4735 5160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 5194 5841 gene locus_tag LOCUS_13290 5194 5841 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250917.1 protein_id gnl|my_center|LOCUS_13290 5843 6757 gene locus_tag LOCUS_13300 5843 6757 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_13300 <7461 6800 gene locus_tag LOCUS_13310 <7461 6800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251109.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence091 247 1386 gene locus_tag LOCUS_13320 247 1386 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250022.1 protein_id gnl|my_center|LOCUS_13320 1412 2176 gene locus_tag LOCUS_13330 1412 2176 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868110.1 protein_id gnl|my_center|LOCUS_13330 2209 2400 gene locus_tag LOCUS_13340 2209 2400 CDS product antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249290.1 protein_id gnl|my_center|LOCUS_13340 2387 2764 gene locus_tag LOCUS_13350 2387 2764 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249289.1 protein_id gnl|my_center|LOCUS_13350 2769 3446 gene locus_tag LOCUS_13360 gene pxpB 2769 3446 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868109.1 protein_id gnl|my_center|LOCUS_13360 3443 3898 gene locus_tag LOCUS_13370 3443 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13370 3880 4431 gene locus_tag LOCUS_13380 3880 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13380 4606 5724 gene locus_tag LOCUS_13390 4606 5724 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958343.1 protein_id gnl|my_center|LOCUS_13390 6856 5729 gene locus_tag LOCUS_13400 6856 5729 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249523.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence092 <1 705 gene locus_tag LOCUS_13410 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249982.1:ribosome biogenesis/translation initiation ATPase RLI 767 1384 gene locus_tag LOCUS_13420 767 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 1359 1718 gene locus_tag LOCUS_13430 1359 1718 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868701.1 protein_id gnl|my_center|LOCUS_13430 2551 1715 gene locus_tag LOCUS_13440 2551 1715 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055428724.1 protein_id gnl|my_center|LOCUS_13440 3772 2570 gene locus_tag LOCUS_13450 3772 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250410.1 protein_id gnl|my_center|LOCUS_13450 3973 4800 gene locus_tag LOCUS_13460 3973 4800 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598716.1 protein_id gnl|my_center|LOCUS_13460 6341 4797 gene locus_tag LOCUS_13470 6341 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250127.1 protein_id gnl|my_center|LOCUS_13470 6738 6331 gene locus_tag LOCUS_13480 gene hjc 6738 6331 CDS product Holliday junction resolvase Hjc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250126.1 protein_id gnl|my_center|LOCUS_13480 6841 7245 gene locus_tag LOCUS_13490 gene gcvH 6841 7245 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146698.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence093 2824 3039 gene locus_tag LOCUS_13500 2824 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250658.1 protein_id gnl|my_center|LOCUS_13500 3039 3491 gene locus_tag LOCUS_13510 3039 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250657.1 protein_id gnl|my_center|LOCUS_13510 3605 4189 gene locus_tag LOCUS_13520 3605 4189 CDS product DUF1102 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879573.1 protein_id gnl|my_center|LOCUS_13520 4186 4722 gene locus_tag LOCUS_13530 4186 4722 CDS product DUF1102 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879572.1 protein_id gnl|my_center|LOCUS_13530 4797 5297 gene locus_tag LOCUS_13540 4797 5297 CDS product DUF1102 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879572.1 protein_id gnl|my_center|LOCUS_13540 5294 6367 gene locus_tag LOCUS_13550 5294 6367 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868600.1 protein_id gnl|my_center|LOCUS_13550 >Feature sequence094 1347 385 gene locus_tag LOCUS_13560 1347 385 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867172.1 protein_id gnl|my_center|LOCUS_13560 1688 1347 gene locus_tag LOCUS_13570 1688 1347 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 protein_id gnl|my_center|LOCUS_13570 1977 1681 gene locus_tag LOCUS_13580 1977 1681 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173559.1 protein_id gnl|my_center|LOCUS_13580 2871 1993 gene locus_tag LOCUS_13590 gene cbiB 2871 1993 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249814.1 protein_id gnl|my_center|LOCUS_13590 3605 2871 gene locus_tag LOCUS_13600 3605 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 3648 3896 gene locus_tag LOCUS_13610 3648 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249813.1 protein_id gnl|my_center|LOCUS_13610 3893 4534 gene locus_tag LOCUS_13620 3893 4534 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867728.1 protein_id gnl|my_center|LOCUS_13620 4602 5084 gene locus_tag LOCUS_13630 gene cobZ 4602 5084 CDS product alpha-ribazole phosphatase CobZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249809.1 protein_id gnl|my_center|LOCUS_13630 5222 5908 gene locus_tag LOCUS_13640 gene cobS 5222 5908 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867168.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence095 1399 8 gene locus_tag LOCUS_13650 1399 8 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868417.1 protein_id gnl|my_center|LOCUS_13650 1983 2882 gene locus_tag LOCUS_13660 1983 2882 CDS product 2-phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249989.1 protein_id gnl|my_center|LOCUS_13660 2879 3370 gene locus_tag LOCUS_13670 2879 3370 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_13670 4132 3497 gene locus_tag LOCUS_13680 4132 3497 CDS product DUF257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250559.1 protein_id gnl|my_center|LOCUS_13680 5092 4355 gene locus_tag LOCUS_13690 gene thyX 5092 4355 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249821.1 protein_id gnl|my_center|LOCUS_13690 5908 5222 gene locus_tag LOCUS_13700 5908 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 6425 6042 gene locus_tag LOCUS_13710 6425 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13710 6660 6394 gene locus_tag LOCUS_13720 6660 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13720 >Feature sequence096 341 670 gene locus_tag LOCUS_13730 341 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13730 1116 667 gene locus_tag LOCUS_13740 1116 667 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867538.1 protein_id gnl|my_center|LOCUS_13740 1781 1113 gene locus_tag LOCUS_13750 1781 1113 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146553.1 protein_id gnl|my_center|LOCUS_13750 2871 1786 gene locus_tag LOCUS_13760 2871 1786 CDS product DUF4157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251156.1 protein_id gnl|my_center|LOCUS_13760 3510 2908 gene locus_tag LOCUS_13770 gene psmB 3510 2908 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251157.1 protein_id gnl|my_center|LOCUS_13770 4242 3700 gene locus_tag LOCUS_13780 4242 3700 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867368.1 protein_id gnl|my_center|LOCUS_13780 4967 4305 gene locus_tag LOCUS_13790 4967 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 5358 5083 gene locus_tag LOCUS_13800 gene albA 5358 5083 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249515.1 protein_id gnl|my_center|LOCUS_13800 5561 6916 gene locus_tag LOCUS_13810 gene purB 5561 6916 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249516.1 protein_id gnl|my_center|LOCUS_13810 >Feature sequence097 867 385 gene locus_tag LOCUS_13820 867 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 2392 1022 gene locus_tag LOCUS_13830 gene glmM 2392 1022 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250059.1 protein_id gnl|my_center|LOCUS_13830 2794 2408 gene locus_tag LOCUS_13840 2794 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 4178 2796 gene locus_tag LOCUS_13850 4178 2796 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868347.1 protein_id gnl|my_center|LOCUS_13850 5348 4506 gene locus_tag LOCUS_13860 5348 4506 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966201.1 protein_id gnl|my_center|LOCUS_13860 5417 6451 gene locus_tag LOCUS_13870 5417 6451 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880717.1 protein_id gnl|my_center|LOCUS_13870 >Feature sequence098 1271 642 gene locus_tag LOCUS_13880 1271 642 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249568.1 protein_id gnl|my_center|LOCUS_13880 1469 1320 gene locus_tag LOCUS_13890 1469 1320 CDS product DNA-directed RNA polymerase subunit P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249567.1 protein_id gnl|my_center|LOCUS_13890 1776 1498 gene locus_tag LOCUS_13900 1776 1498 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249566.1 protein_id gnl|my_center|LOCUS_13900 2836 2027 gene locus_tag LOCUS_13910 gene rrp42 2836 2027 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250584.1 protein_id gnl|my_center|LOCUS_13910 3580 2840 gene locus_tag LOCUS_13920 gene rrp41 3580 2840 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867734.1 protein_id gnl|my_center|LOCUS_13920 4337 3564 gene locus_tag LOCUS_13930 gene rrp4 4337 3564 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250586.1 protein_id gnl|my_center|LOCUS_13930 5044 4334 gene locus_tag LOCUS_13940 5044 4334 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867732.1 protein_id gnl|my_center|LOCUS_13940 5840 5055 gene locus_tag LOCUS_13950 gene psmA 5840 5055 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867731.1 protein_id gnl|my_center|LOCUS_13950 6313 5951 gene locus_tag LOCUS_13960 6313 5951 CDS product ribonuclease P protein component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250718.1 protein_id gnl|my_center|LOCUS_13960 >Feature sequence099 502 302 gene locus_tag LOCUS_13970 502 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 780 1028 gene locus_tag LOCUS_13980 780 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250157.1 protein_id gnl|my_center|LOCUS_13980 1182 1009 gene locus_tag LOCUS_13990 1182 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1824 1351 gene locus_tag LOCUS_14000 1824 1351 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147291.1 protein_id gnl|my_center|LOCUS_14000 1995 2717 gene locus_tag LOCUS_14010 1995 2717 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868772.1 protein_id gnl|my_center|LOCUS_14010 2728 3504 gene locus_tag LOCUS_14020 2728 3504 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024284.1 protein_id gnl|my_center|LOCUS_14020 4928 3501 gene locus_tag LOCUS_14030 gene pyk 4928 3501 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868526.1 protein_id gnl|my_center|LOCUS_14030 5027 5227 gene locus_tag LOCUS_14040 5027 5227 CDS product TIGR04140 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250774.1 protein_id gnl|my_center|LOCUS_14040 5391 5224 gene locus_tag LOCUS_14050 5391 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 5572 5435 gene locus_tag LOCUS_14060 5572 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 6621 5575 gene locus_tag LOCUS_14070 6621 5575 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868238.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence100 272 514 gene locus_tag LOCUS_14080 272 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 511 1095 gene locus_tag LOCUS_14090 511 1095 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250047.1 protein_id gnl|my_center|LOCUS_14090 1299 2927 gene locus_tag LOCUS_14100 gene thsB 1299 2927 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867141.1 protein_id gnl|my_center|LOCUS_14100 3276 3046 gene locus_tag LOCUS_14110 3276 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068578131.1 protein_id gnl|my_center|LOCUS_14110 3565 5022 gene locus_tag LOCUS_14120 gene guaB 3565 5022 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249149.1 protein_id gnl|my_center|LOCUS_14120 5095 6516 gene locus_tag LOCUS_14130 gene ppcA 5095 6516 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867139.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence101 752 18 gene locus_tag LOCUS_14140 752 18 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249698.1 protein_id gnl|my_center|LOCUS_14140 849 1370 gene locus_tag LOCUS_14150 849 1370 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867279.1 protein_id gnl|my_center|LOCUS_14150 1926 1408 gene locus_tag LOCUS_14160 1926 1408 CDS product molybdopterin-guanine dinucleotide biosynthesis protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249700.1 protein_id gnl|my_center|LOCUS_14160 2237 3490 gene locus_tag LOCUS_14170 2237 3490 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053195.1 protein_id gnl|my_center|LOCUS_14170 5489 3582 gene locus_tag LOCUS_14180 5489 3582 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249703.1 protein_id gnl|my_center|LOCUS_14180 5673 6647 gene locus_tag LOCUS_14190 5673 6647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878943.1 protein_id gnl|my_center|LOCUS_14190 >Feature sequence102 405 2267 gene locus_tag LOCUS_14200 gene for 405 2267 CDS product tungsten-containing formaldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868317.1 protein_id gnl|my_center|LOCUS_14200 2431 2661 gene locus_tag LOCUS_14210 2431 2661 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146579.1 protein_id gnl|my_center|LOCUS_14210 3420 2674 gene locus_tag LOCUS_14220 3420 2674 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250970.1 protein_id gnl|my_center|LOCUS_14220 4457 3417 gene locus_tag LOCUS_14230 4457 3417 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869579.1 protein_id gnl|my_center|LOCUS_14230 5578 4466 gene locus_tag LOCUS_14240 5578 4466 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868127.1 protein_id gnl|my_center|LOCUS_14240 6261 5575 gene locus_tag LOCUS_14250 6261 5575 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868126.1 protein_id gnl|my_center|LOCUS_14250 6400 6801 gene locus_tag LOCUS_14260 6400 6801 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250966.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence103 13 144 gene locus_tag LOCUS_14270 13 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1134 478 gene locus_tag LOCUS_14280 1134 478 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249969.1 protein_id gnl|my_center|LOCUS_14280 1483 1097 gene locus_tag LOCUS_14290 1483 1097 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_14290 1779 1480 gene locus_tag LOCUS_14300 1779 1480 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259332.1 protein_id gnl|my_center|LOCUS_14300 5332 1796 gene locus_tag LOCUS_14310 gene smc 5332 1796 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053701.1 protein_id gnl|my_center|LOCUS_14310 6291 5434 gene locus_tag LOCUS_14320 6291 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence104 1988 171 gene locus_tag LOCUS_14330 gene aor 1988 171 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250017.1 protein_id gnl|my_center|LOCUS_14330 4180 2123 gene locus_tag LOCUS_14340 4180 2123 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146750.1 protein_id gnl|my_center|LOCUS_14340 4529 4182 gene locus_tag LOCUS_14350 4529 4182 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868054.1 protein_id gnl|my_center|LOCUS_14350 5394 4600 gene locus_tag LOCUS_14360 5394 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 5288 5563 gene locus_tag LOCUS_14370 5288 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 6175 5696 gene locus_tag LOCUS_14380 6175 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence105 3092 207 gene locus_tag LOCUS_14390 gene leuS 3092 207 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250412.1 protein_id gnl|my_center|LOCUS_14390 3293 4891 gene locus_tag LOCUS_14400 3293 4891 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868194.1 protein_id gnl|my_center|LOCUS_14400 5959 4877 gene locus_tag LOCUS_14410 5959 4877 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250406.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence106 1866 115 gene locus_tag LOCUS_14420 1866 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250219.1 protein_id gnl|my_center|LOCUS_14420 1982 3445 gene locus_tag LOCUS_14430 1982 3445 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250220.1 protein_id gnl|my_center|LOCUS_14430 3651 3442 gene locus_tag LOCUS_14440 3651 3442 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250221.1 protein_id gnl|my_center|LOCUS_14440 3838 4338 gene locus_tag LOCUS_14450 3838 4338 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867730.1 protein_id gnl|my_center|LOCUS_14450 4386 5432 gene locus_tag LOCUS_14460 4386 5432 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249713.1 protein_id gnl|my_center|LOCUS_14460 5801 6280 gene locus_tag LOCUS_14470 5801 6280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14470 >Feature sequence107 153 335 gene locus_tag LOCUS_14480 153 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 625 1062 gene locus_tag LOCUS_14490 625 1062 CDS product CGGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870086.1 protein_id gnl|my_center|LOCUS_14490 1174 2442 gene locus_tag LOCUS_14500 1174 2442 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249958.1 protein_id gnl|my_center|LOCUS_14500 3247 2429 gene locus_tag LOCUS_14510 3247 2429 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249686.1 protein_id gnl|my_center|LOCUS_14510 3438 4208 gene locus_tag LOCUS_14520 3438 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251176.1 protein_id gnl|my_center|LOCUS_14520 4162 5598 gene locus_tag LOCUS_14530 4162 5598 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146488.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence108 361 8 gene locus_tag LOCUS_14540 361 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 855 1250 gene locus_tag LOCUS_14550 855 1250 CDS product UPF0146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250727.1 protein_id gnl|my_center|LOCUS_14550 1386 2738 gene locus_tag LOCUS_14560 gene glmM 1386 2738 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250728.1 protein_id gnl|my_center|LOCUS_14560 3552 2740 gene locus_tag LOCUS_14570 3552 2740 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250729.1 protein_id gnl|my_center|LOCUS_14570 3853 5739 gene locus_tag LOCUS_14580 3853 5739 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250730.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence109 300 1352 gene locus_tag LOCUS_14590 300 1352 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393776.1 protein_id gnl|my_center|LOCUS_14590 2538 1369 gene locus_tag LOCUS_14600 2538 1369 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250510.1 protein_id gnl|my_center|LOCUS_14600 2839 4032 gene locus_tag LOCUS_14610 2839 4032 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249461.1 protein_id gnl|my_center|LOCUS_14610 4528 4007 gene locus_tag LOCUS_14620 gene cyaB 4528 4007 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249462.1 protein_id gnl|my_center|LOCUS_14620 5011 4529 gene locus_tag LOCUS_14630 5011 4529 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868086.1 protein_id gnl|my_center|LOCUS_14630 5546 4989 gene locus_tag LOCUS_14640 5546 4989 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868085.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence110 <1 707 gene locus_tag LOCUS_14650 <1 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868164.1:phosphate ABC transporter permease subunit PstC 694 1527 gene locus_tag LOCUS_14660 gene pstA 694 1527 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868165.1 protein_id gnl|my_center|LOCUS_14660 1524 2288 gene locus_tag LOCUS_14670 1524 2288 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146811.1 protein_id gnl|my_center|LOCUS_14670 2285 2887 gene locus_tag LOCUS_14680 2285 2887 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250821.1 protein_id gnl|my_center|LOCUS_14680 4207 3056 gene locus_tag LOCUS_14690 4207 3056 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250825.1 protein_id gnl|my_center|LOCUS_14690 4383 4802 gene locus_tag LOCUS_14700 4383 4802 CDS product Tfx family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251101.1 protein_id gnl|my_center|LOCUS_14700 5456 4782 gene locus_tag LOCUS_14710 5456 4782 CDS product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251100.1 protein_id gnl|my_center|LOCUS_14710 5793 5449 gene locus_tag LOCUS_14720 5793 5449 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251099.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence111 3118 458 gene locus_tag LOCUS_14730 3118 458 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250225.1 protein_id gnl|my_center|LOCUS_14730 3338 3132 gene locus_tag LOCUS_14740 3338 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 3256 5298 gene locus_tag LOCUS_14750 3256 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 5386 5823 gene locus_tag LOCUS_14760 5386 5823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 >Feature sequence112 <1 644 gene locus_tag LOCUS_14770 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868255.1:MFS transporter 666 1316 gene locus_tag LOCUS_14780 666 1316 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867952.1 protein_id gnl|my_center|LOCUS_14780 1649 1311 gene locus_tag LOCUS_14790 1649 1311 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249458.1 protein_id gnl|my_center|LOCUS_14790 1796 3166 gene locus_tag LOCUS_14800 1796 3166 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146589.1 protein_id gnl|my_center|LOCUS_14800 3172 4497 gene locus_tag LOCUS_14810 3172 4497 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249454.1 protein_id gnl|my_center|LOCUS_14810 4651 4502 gene locus_tag LOCUS_14820 4651 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 4767 5183 gene locus_tag LOCUS_14830 gene nikR 4767 5183 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250390.1 protein_id gnl|my_center|LOCUS_14830 5228 5304 gene locus_tag LOCUS_t00360 5228 5304 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence113 712 2457 gene locus_tag LOCUS_14840 712 2457 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036303.1 protein_id gnl|my_center|LOCUS_14840 2468 2980 gene locus_tag LOCUS_14850 2468 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 3035 3604 gene locus_tag LOCUS_14860 gene thpR 3035 3604 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250689.1 protein_id gnl|my_center|LOCUS_14860 4870 3581 gene locus_tag LOCUS_14870 4870 3581 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868644.1 protein_id gnl|my_center|LOCUS_14870 5023 5340 gene locus_tag LOCUS_14880 5023 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14880 >Feature sequence114 1012 809 gene locus_tag LOCUS_14890 1012 809 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250038.1 protein_id gnl|my_center|LOCUS_14890 1727 1032 gene locus_tag LOCUS_14900 gene surR 1727 1032 CDS product transcriptional regulator SurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250037.1 protein_id gnl|my_center|LOCUS_14900 1870 2544 gene locus_tag LOCUS_14910 1870 2544 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250036.1 protein_id gnl|my_center|LOCUS_14910 3588 2578 gene locus_tag LOCUS_14920 3588 2578 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249622.1 protein_id gnl|my_center|LOCUS_14920 3734 4183 gene locus_tag LOCUS_14930 3734 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867816.1 protein_id gnl|my_center|LOCUS_14930 4358 5158 gene locus_tag LOCUS_14940 4358 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence115 <1 725 gene locus_tag LOCUS_14950 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966125.1:ribosomal protein S18-alanine N-acetyltransferase 967 1821 gene locus_tag LOCUS_14960 967 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020615.1 protein_id gnl|my_center|LOCUS_14960 2099 1797 gene locus_tag LOCUS_14970 2099 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 2564 2433 gene locus_tag LOCUS_14980 2564 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 2721 4118 gene locus_tag LOCUS_14990 2721 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 4128 5054 gene locus_tag LOCUS_15000 4128 5054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence116 765 2120 gene locus_tag LOCUS_15010 gene gcvPA 765 2120 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250331.1 protein_id gnl|my_center|LOCUS_15010 2113 3612 gene locus_tag LOCUS_15020 gene gcvPB 2113 3612 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868896.1 protein_id gnl|my_center|LOCUS_15020 3709 4596 gene locus_tag LOCUS_15030 3709 4596 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582485.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence117 143 2200 gene locus_tag LOCUS_15040 143 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 2214 3371 gene locus_tag LOCUS_15050 2214 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 3387 3569 gene locus_tag LOCUS_15060 3387 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 3571 5379 gene locus_tag LOCUS_15070 3571 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 >Feature sequence118 1150 1650 gene locus_tag LOCUS_15080 1150 1650 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868645.1 protein_id gnl|my_center|LOCUS_15080 1670 2860 gene locus_tag LOCUS_15090 1670 2860 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249496.1 protein_id gnl|my_center|LOCUS_15090 3946 2876 gene locus_tag LOCUS_15100 3946 2876 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249915.1 protein_id gnl|my_center|LOCUS_15100 5167 4040 gene locus_tag LOCUS_15110 5167 4040 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868007.1 protein_id gnl|my_center|LOCUS_15110 5365 5174 gene locus_tag LOCUS_15120 5365 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence119 21 98 gene locus_tag LOCUS_t00370 21 98 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 594 130 gene locus_tag LOCUS_15130 594 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15130 686 1195 gene locus_tag LOCUS_15140 gene rimI 686 1195 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868792.1 protein_id gnl|my_center|LOCUS_15140 1205 1717 gene locus_tag LOCUS_15150 gene endA 1205 1717 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868793.1 protein_id gnl|my_center|LOCUS_15150 2376 1714 gene locus_tag LOCUS_15160 2376 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146928.1 protein_id gnl|my_center|LOCUS_15160 2672 2379 gene locus_tag LOCUS_15170 2672 2379 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868360.1 protein_id gnl|my_center|LOCUS_15170 3654 2662 gene locus_tag LOCUS_15180 3654 2662 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249945.1 protein_id gnl|my_center|LOCUS_15180 3933 3664 gene locus_tag LOCUS_15190 3933 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249944.1 protein_id gnl|my_center|LOCUS_15190 <5328 4140 gene locus_tag LOCUS_15200 <5328 4140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868362.1:carbon starvation protein A >Feature sequence120 1014 244 gene locus_tag LOCUS_15210 1014 244 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250096.1 protein_id gnl|my_center|LOCUS_15210 1993 1019 gene locus_tag LOCUS_15220 1993 1019 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867784.1 protein_id gnl|my_center|LOCUS_15220 2450 1986 gene locus_tag LOCUS_15230 2450 1986 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250094.1 protein_id gnl|my_center|LOCUS_15230 2640 3248 gene locus_tag LOCUS_15240 2640 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 3296 3727 gene locus_tag LOCUS_15250 3296 3727 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250093.1 protein_id gnl|my_center|LOCUS_15250 3693 4433 gene locus_tag LOCUS_15260 3693 4433 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250092.1 protein_id gnl|my_center|LOCUS_15260 4993 4430 gene locus_tag LOCUS_15270 4993 4430 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250407.1 protein_id gnl|my_center|LOCUS_15270 >Feature sequence121 1007 729 gene locus_tag LOCUS_15280 1007 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1892 1170 gene locus_tag LOCUS_15290 1892 1170 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868387.1 protein_id gnl|my_center|LOCUS_15290 2892 1885 gene locus_tag LOCUS_15300 2892 1885 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868388.1 protein_id gnl|my_center|LOCUS_15300 2979 4247 gene locus_tag LOCUS_15310 2979 4247 CDS product acyl-CoA--6-aminopenicillanic acid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332932.1 protein_id gnl|my_center|LOCUS_15310 4298 5026 gene locus_tag LOCUS_15320 4298 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 >Feature sequence122 23 1999 gene locus_tag LOCUS_15330 23 1999 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250548.1 protein_id gnl|my_center|LOCUS_15330 2014 2499 gene locus_tag LOCUS_15340 2014 2499 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250549.1 protein_id gnl|my_center|LOCUS_15340 2533 3144 gene locus_tag LOCUS_15350 2533 3144 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250550.1 protein_id gnl|my_center|LOCUS_15350 3150 4262 gene locus_tag LOCUS_15360 3150 4262 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868882.1 protein_id gnl|my_center|LOCUS_15360 4259 4567 gene locus_tag LOCUS_15370 4259 4567 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868881.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence123 2784 1960 gene locus_tag LOCUS_15380 2784 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249845.1 protein_id gnl|my_center|LOCUS_15380 3833 2784 gene locus_tag LOCUS_15390 gene amrS 3833 2784 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_15390 4290 3844 gene locus_tag LOCUS_15400 4290 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 4487 4275 gene locus_tag LOCUS_15410 4487 4275 CDS product antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867995.1 protein_id gnl|my_center|LOCUS_15410 <5183 4552 gene locus_tag LOCUS_15420 <5183 4552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249643.1:ABC transporter permease >Feature sequence124 324 656 gene locus_tag LOCUS_15430 324 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868635.1 protein_id gnl|my_center|LOCUS_15430 625 1230 gene locus_tag LOCUS_15440 625 1230 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868634.1 protein_id gnl|my_center|LOCUS_15440 1223 4171 gene locus_tag LOCUS_15450 1223 4171 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879204.1 protein_id gnl|my_center|LOCUS_15450 4162 4830 gene locus_tag LOCUS_15460 4162 4830 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879203.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence125 230 439 gene locus_tag LOCUS_15470 230 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 559 1710 gene locus_tag LOCUS_15480 gene dgoD 559 1710 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199088.1 protein_id gnl|my_center|LOCUS_15480 2708 1713 gene locus_tag LOCUS_15490 2708 1713 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030183075.1 protein_id gnl|my_center|LOCUS_15490 2792 3559 gene locus_tag LOCUS_15500 2792 3559 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_15500 3678 4331 gene locus_tag LOCUS_15510 gene eda 3678 4331 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence126 331 1167 gene locus_tag LOCUS_15520 331 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1219 1890 gene locus_tag LOCUS_15530 1219 1890 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870305.1 protein_id gnl|my_center|LOCUS_15530 1887 2423 gene locus_tag LOCUS_15540 1887 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 2416 3468 gene locus_tag LOCUS_15550 2416 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 3465 4601 gene locus_tag LOCUS_15560 3465 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 >Feature sequence127 <1 599 gene locus_tag LOCUS_15570 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868584.1:proton-conducting transporter membrane subunit 1504 689 gene locus_tag LOCUS_15580 1504 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811766.1 protein_id gnl|my_center|LOCUS_15580 1875 2834 gene locus_tag LOCUS_15590 1875 2834 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158098.1 protein_id gnl|my_center|LOCUS_15590 2836 3930 gene locus_tag LOCUS_15600 gene thiI 2836 3930 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496669.1 protein_id gnl|my_center|LOCUS_15600 3966 4487 gene locus_tag LOCUS_15610 3966 4487 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250949.1 protein_id gnl|my_center|LOCUS_15610 4700 4894 gene locus_tag LOCUS_15620 4700 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 >Feature sequence128 152 1000 gene locus_tag LOCUS_15630 152 1000 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879265.1 protein_id gnl|my_center|LOCUS_15630 1006 1983 gene locus_tag LOCUS_15640 1006 1983 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879266.1 protein_id gnl|my_center|LOCUS_15640 1976 2968 gene locus_tag LOCUS_15650 1976 2968 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879267.1 protein_id gnl|my_center|LOCUS_15650 3417 2953 gene locus_tag LOCUS_15660 3417 2953 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868429.1 protein_id gnl|my_center|LOCUS_15660 3622 4350 gene locus_tag LOCUS_15670 3622 4350 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249243.1 protein_id gnl|my_center|LOCUS_15670 4608 4739 gene locus_tag LOCUS_15680 4608 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence129 <1 1586 gene locus_tag LOCUS_15690 <1 1586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249997.1:DNRLRE domain-containing protein 1737 3164 gene locus_tag LOCUS_15700 gene cysS 1737 3164 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249399.1 protein_id gnl|my_center|LOCUS_15700 3449 3237 gene locus_tag LOCUS_15710 3449 3237 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251015.1 protein_id gnl|my_center|LOCUS_15710 4890 3613 gene locus_tag LOCUS_15720 4890 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence130 141 599 gene locus_tag LOCUS_15730 141 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 892 710 gene locus_tag LOCUS_15740 892 710 CDS product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146944.1 protein_id gnl|my_center|LOCUS_15740 999 1559 gene locus_tag LOCUS_15750 999 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250197.1 protein_id gnl|my_center|LOCUS_15750 2807 1575 gene locus_tag LOCUS_15760 2807 1575 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250198.1 protein_id gnl|my_center|LOCUS_15760 3243 2851 gene locus_tag LOCUS_15770 3243 2851 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250199.1 protein_id gnl|my_center|LOCUS_15770 4414 3254 gene locus_tag LOCUS_15780 4414 3254 CDS product aconitase X catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250200.1 protein_id gnl|my_center|LOCUS_15780 4525 4602 gene locus_tag LOCUS_t00380 4525 4602 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4944 4597 gene locus_tag LOCUS_15790 4944 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence131 1302 43 gene locus_tag LOCUS_15800 gene gdhA 1302 43 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_15800 1712 2227 gene locus_tag LOCUS_15810 1712 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 2224 2499 gene locus_tag LOCUS_15820 2224 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 2501 2731 gene locus_tag LOCUS_15830 2501 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 3177 2728 gene locus_tag LOCUS_15840 3177 2728 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249832.1 protein_id gnl|my_center|LOCUS_15840 4460 3180 gene locus_tag LOCUS_15850 4460 3180 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249831.1 protein_id gnl|my_center|LOCUS_15850 >Feature sequence132 452 204 gene locus_tag LOCUS_15860 452 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146592.1 protein_id gnl|my_center|LOCUS_15860 1244 510 gene locus_tag LOCUS_15870 gene serK 1244 510 CDS product L-serine kinase SerK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249333.1 protein_id gnl|my_center|LOCUS_15870 1419 2801 gene locus_tag LOCUS_15880 1419 2801 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249879.1 protein_id gnl|my_center|LOCUS_15880 3588 2788 gene locus_tag LOCUS_15890 gene truA 3588 2788 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249878.1 protein_id gnl|my_center|LOCUS_15890 4383 3970 gene locus_tag LOCUS_15900 4383 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 >Feature sequence133 310 756 gene locus_tag LOCUS_15910 310 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 1435 764 gene locus_tag LOCUS_15920 gene purQ 1435 764 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249156.1 protein_id gnl|my_center|LOCUS_15920 1682 1437 gene locus_tag LOCUS_15930 gene purS 1682 1437 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147194.1 protein_id gnl|my_center|LOCUS_15930 2829 1693 gene locus_tag LOCUS_15940 2829 1693 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249158.1 protein_id gnl|my_center|LOCUS_15940 4126 2831 gene locus_tag LOCUS_15950 gene purD 4126 2831 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249159.1 protein_id gnl|my_center|LOCUS_15950 4233 4664 gene locus_tag LOCUS_15960 gene purE 4233 4664 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870121.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence134 563 336 gene locus_tag LOCUS_15970 563 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 1212 646 gene locus_tag LOCUS_15980 1212 646 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249145.1 protein_id gnl|my_center|LOCUS_15980 1646 1209 gene locus_tag LOCUS_15990 1646 1209 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249146.1 protein_id gnl|my_center|LOCUS_15990 1839 1648 gene locus_tag LOCUS_16000 1839 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 2815 1892 gene locus_tag LOCUS_16010 gene guaA 2815 1892 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249148.1 protein_id gnl|my_center|LOCUS_16010 3870 2869 gene locus_tag LOCUS_16020 3870 2869 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147266.1 protein_id gnl|my_center|LOCUS_16020 4353 3937 gene locus_tag LOCUS_16030 4353 3937 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146813.1 protein_id gnl|my_center|LOCUS_16030 4577 4350 gene locus_tag LOCUS_16040 4577 4350 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146815.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence135 <1 986 gene locus_tag LOCUS_16050 <1 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250732.1:M20 family metallo-hydrolase 989 1696 gene locus_tag LOCUS_16060 989 1696 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391583.1 protein_id gnl|my_center|LOCUS_16060 1698 2225 gene locus_tag LOCUS_16070 1698 2225 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964727.1 protein_id gnl|my_center|LOCUS_16070 2194 2493 gene locus_tag LOCUS_16080 2194 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 2528 2953 gene locus_tag LOCUS_16090 2528 2953 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249707.1 protein_id gnl|my_center|LOCUS_16090 3554 2988 gene locus_tag LOCUS_16100 3554 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 <4717 3683 gene locus_tag LOCUS_16110 <4717 3683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389386.1:Stk1 family PASTA domain-containing Ser/Thr kinase >Feature sequence136 317 129 gene locus_tag LOCUS_16120 317 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146562.1 protein_id gnl|my_center|LOCUS_16120 1375 473 gene locus_tag LOCUS_16130 1375 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147069.1 protein_id gnl|my_center|LOCUS_16130 1539 2573 gene locus_tag LOCUS_16140 gene wtpC 1539 2573 CDS product tungstate ABC transporter ATP-binding protein WtpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867278.1 protein_id gnl|my_center|LOCUS_16140 2669 3793 gene locus_tag LOCUS_16150 2669 3793 CDS product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053677.1 protein_id gnl|my_center|LOCUS_16150 4434 3790 gene locus_tag LOCUS_16160 4434 3790 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867232.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence137 2193 1261 gene locus_tag LOCUS_16170 2193 1261 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868720.1 protein_id gnl|my_center|LOCUS_16170 3211 2171 gene locus_tag LOCUS_16180 3211 2171 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868721.1 protein_id gnl|my_center|LOCUS_16180 4661 3204 gene locus_tag LOCUS_16190 4661 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence138 1111 524 gene locus_tag LOCUS_16200 gene udg 1111 524 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053779.1 protein_id gnl|my_center|LOCUS_16200 1469 1080 gene locus_tag LOCUS_16210 1469 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867810.1 protein_id gnl|my_center|LOCUS_16210 1639 3384 gene locus_tag LOCUS_16220 1639 3384 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251095.1 protein_id gnl|my_center|LOCUS_16220 3397 3678 gene locus_tag LOCUS_16230 3397 3678 CDS product DUF3213 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146619.1 protein_id gnl|my_center|LOCUS_16230 3896 3675 gene locus_tag LOCUS_16240 3896 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 4229 4005 gene locus_tag LOCUS_16250 4229 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence139 131 466 gene locus_tag LOCUS_16260 131 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 471 1151 gene locus_tag LOCUS_16270 gene rpiA 471 1151 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250377.1 protein_id gnl|my_center|LOCUS_16270 1203 1373 gene locus_tag LOCUS_16280 1203 1373 CDS product preprotein translocase subunit Sec61beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250902.1 protein_id gnl|my_center|LOCUS_16280 2167 1508 gene locus_tag LOCUS_16290 2167 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146525.1 protein_id gnl|my_center|LOCUS_16290 2391 2963 gene locus_tag LOCUS_16300 gene engB 2391 2963 CDS product GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250904.1 protein_id gnl|my_center|LOCUS_16300 4037 2967 gene locus_tag LOCUS_16310 gene radA 4037 2967 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146514.1 protein_id gnl|my_center|LOCUS_16310 >Feature sequence140 1583 948 gene locus_tag LOCUS_16320 1583 948 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251025.1 protein_id gnl|my_center|LOCUS_16320 2683 1661 gene locus_tag LOCUS_16330 2683 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 3333 2779 gene locus_tag LOCUS_16340 3333 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence141 436 209 gene locus_tag LOCUS_16350 436 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 1459 632 gene locus_tag LOCUS_16360 1459 632 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249998.1 protein_id gnl|my_center|LOCUS_16360 2222 1464 gene locus_tag LOCUS_16370 2222 1464 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868711.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence142 1459 146 gene locus_tag LOCUS_16380 1459 146 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249801.1 protein_id gnl|my_center|LOCUS_16380 1611 1456 gene locus_tag LOCUS_16390 1611 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1878 1708 gene locus_tag LOCUS_16400 1878 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 2172 2008 gene locus_tag LOCUS_16410 2172 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 2814 2257 gene locus_tag LOCUS_16420 gene rfbC 2814 2257 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_16420 3271 2825 gene locus_tag LOCUS_16430 3271 2825 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877824.1 protein_id gnl|my_center|LOCUS_16430 3450 3268 gene locus_tag LOCUS_16440 3450 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 3982 3581 gene locus_tag LOCUS_16450 3982 3581 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868296.1 protein_id gnl|my_center|LOCUS_16450 4186 3983 gene locus_tag LOCUS_16460 4186 3983 CDS product DUF2281 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868295.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence143 312 1313 gene locus_tag LOCUS_16470 312 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 1462 2181 gene locus_tag LOCUS_16480 1462 2181 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017120.1 protein_id gnl|my_center|LOCUS_16480 2300 2884 gene locus_tag LOCUS_16490 2300 2884 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867981.1 protein_id gnl|my_center|LOCUS_16490 2959 3405 gene locus_tag LOCUS_16500 2959 3405 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250402.1 protein_id gnl|my_center|LOCUS_16500 3402 4034 gene locus_tag LOCUS_16510 3402 4034 CDS product Ribonuclease P protein component 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250401.1 protein_id gnl|my_center|LOCUS_16510 4210 4031 gene locus_tag LOCUS_16520 4210 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 >Feature sequence144 881 1426 gene locus_tag LOCUS_16530 881 1426 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249493.1 protein_id gnl|my_center|LOCUS_16530 1438 2739 gene locus_tag LOCUS_16540 gene tiaS 1438 2739 CDS product tRNA(Ile2) 2-agmatinylcytidine synthetase TiaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249508.1 protein_id gnl|my_center|LOCUS_16540 2892 3290 gene locus_tag LOCUS_16550 2892 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 3331 4083 gene locus_tag LOCUS_16560 3331 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 >Feature sequence145 299 1177 gene locus_tag LOCUS_16570 299 1177 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015758.1 protein_id gnl|my_center|LOCUS_16570 1178 1738 gene locus_tag LOCUS_16580 1178 1738 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925129.1 protein_id gnl|my_center|LOCUS_16580 1728 2492 gene locus_tag LOCUS_16590 1728 2492 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_16590 2527 3840 gene locus_tag LOCUS_16600 2527 3840 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869430.1 protein_id gnl|my_center|LOCUS_16600 >Feature sequence146 2499 1309 gene locus_tag LOCUS_16610 2499 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867758.1 protein_id gnl|my_center|LOCUS_16610 3071 2559 gene locus_tag LOCUS_16620 3071 2559 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250569.1 protein_id gnl|my_center|LOCUS_16620 3204 3128 gene locus_tag LOCUS_t00390 3204 3128 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4000 3347 gene locus_tag LOCUS_16630 4000 3347 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053836.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence147 737 1201 gene locus_tag LOCUS_16640 gene nuoE 737 1201 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_16640 1194 3002 gene locus_tag LOCUS_16650 gene nuoF 1194 3002 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence148 219 1343 gene locus_tag LOCUS_16660 gene fni 219 1343 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250421.1 protein_id gnl|my_center|LOCUS_16660 1483 2808 gene locus_tag LOCUS_16670 1483 2808 CDS product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146740.1 protein_id gnl|my_center|LOCUS_16670 2813 3838 gene locus_tag LOCUS_16680 2813 3838 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250419.1 protein_id gnl|my_center|LOCUS_16680 >Feature sequence149 <1 807 gene locus_tag LOCUS_16690 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066467.1:anaerobic carbon-monoxide dehydrogenase catalytic subunit 887 1693 gene locus_tag LOCUS_16700 887 1693 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460477.1 protein_id gnl|my_center|LOCUS_16700 1694 1888 gene locus_tag LOCUS_16710 1694 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence150 791 195 gene locus_tag LOCUS_16720 791 195 CDS product TasA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250769.1 protein_id gnl|my_center|LOCUS_16720 2058 1063 gene locus_tag LOCUS_16730 2058 1063 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250662.1 protein_id gnl|my_center|LOCUS_16730 2516 2094 gene locus_tag LOCUS_16740 2516 2094 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250661.1 protein_id gnl|my_center|LOCUS_16740 2907 2506 gene locus_tag LOCUS_16750 2907 2506 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250660.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence151 1614 472 gene locus_tag LOCUS_16760 1614 472 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868852.1 protein_id gnl|my_center|LOCUS_16760 1824 1976 gene locus_tag LOCUS_16770 1824 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 2136 3509 gene locus_tag LOCUS_16780 2136 3509 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004069588.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence152 151 1170 gene locus_tag LOCUS_16790 gene rtcA 151 1170 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250566.1 protein_id gnl|my_center|LOCUS_16790 1288 2856 gene locus_tag LOCUS_16800 1288 2856 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250573.1 protein_id gnl|my_center|LOCUS_16800 2867 3259 gene locus_tag LOCUS_16810 2867 3259 CDS product OadG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250574.1 protein_id gnl|my_center|LOCUS_16810 >Feature sequence153 1 369 gene locus_tag LOCUS_16820 1 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 366 833 gene locus_tag LOCUS_16830 366 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 910 3366 gene locus_tag LOCUS_16840 910 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 >Feature sequence154 <1 832 gene locus_tag LOCUS_16850 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388070.1:NADH-quinone oxidoreductase subunit H 835 2463 gene locus_tag LOCUS_16860 835 2463 CDS product hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868591.1 protein_id gnl|my_center|LOCUS_16860 2451 2969 gene locus_tag LOCUS_16870 2451 2969 CDS product formate hydrogenlyase complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393672.1 protein_id gnl|my_center|LOCUS_16870 2962 3543 gene locus_tag LOCUS_16880 2962 3543 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388074.1 protein_id gnl|my_center|LOCUS_16880 >Feature sequence155 1187 375 gene locus_tag LOCUS_16890 1187 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868328.1 protein_id gnl|my_center|LOCUS_16890 1332 2321 gene locus_tag LOCUS_16900 1332 2321 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_16900 3319 2318 gene locus_tag LOCUS_16910 3319 2318 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193384984.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence156 1467 934 gene locus_tag LOCUS_16920 1467 934 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867323.1 protein_id gnl|my_center|LOCUS_16920 2666 1464 gene locus_tag LOCUS_16930 2666 1464 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251048.1 protein_id gnl|my_center|LOCUS_16930 2729 3223 gene locus_tag LOCUS_16940 2729 3223 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251047.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence157 196 1053 gene locus_tag LOCUS_16950 196 1053 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146582.1 protein_id gnl|my_center|LOCUS_16950 1059 2072 gene locus_tag LOCUS_16960 1059 2072 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868074.1 protein_id gnl|my_center|LOCUS_16960 2234 3373 gene locus_tag LOCUS_16970 2234 3373 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249959.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence158 728 138 gene locus_tag LOCUS_16980 gene hisH 728 138 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249201.1 protein_id gnl|my_center|LOCUS_16980 2906 1911 gene locus_tag LOCUS_16990 2906 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 >Feature sequence159 274 453 gene locus_tag LOCUS_17000 274 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 2611 686 gene locus_tag LOCUS_17010 2611 686 CDS product CGP-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146626.1 protein_id gnl|my_center|LOCUS_17010 2753 3295 gene locus_tag LOCUS_17020 2753 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068320206.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence160 103 618 gene locus_tag LOCUS_17030 103 618 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249996.1 protein_id gnl|my_center|LOCUS_17030 624 1310 gene locus_tag LOCUS_17040 624 1310 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249459.1 protein_id gnl|my_center|LOCUS_17040 2297 1329 gene locus_tag LOCUS_17050 gene corA 2297 1329 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249460.1 protein_id gnl|my_center|LOCUS_17050 3137 2307 gene locus_tag LOCUS_17060 3137 2307 CDS product 7,8-dihydropterin-6-methyl-4-(beta-D-ribofuranosyl)-aminobenzene-5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869799.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence161 <1 767 gene locus_tag LOCUS_17070 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249652.1:ATP-binding protein 803 1126 gene locus_tag LOCUS_17080 803 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 1375 1121 gene locus_tag LOCUS_17090 1375 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 1736 1608 gene locus_tag LOCUS_17100 1736 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 3322 1880 gene locus_tag LOCUS_17110 3322 1880 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937687.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence162 438 1307 gene locus_tag LOCUS_17120 438 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 2921 1290 gene locus_tag LOCUS_17130 2921 1290 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005602533.1 protein_id gnl|my_center|LOCUS_17130 3066 2914 gene locus_tag LOCUS_17140 3066 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence163 1787 1506 gene locus_tag LOCUS_17150 1787 1506 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249719.1 protein_id gnl|my_center|LOCUS_17150 2310 1780 gene locus_tag LOCUS_17160 2310 1780 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249720.1 protein_id gnl|my_center|LOCUS_17160 <3195 2395 gene locus_tag LOCUS_17170 <3195 2395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867676.1:glycine--tRNA ligase >Feature sequence164 252 2279 gene locus_tag LOCUS_17180 252 2279 CDS product DUF5693 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391758.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence165 535 939 gene locus_tag LOCUS_17190 gene sepF 535 939 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250582.1 protein_id gnl|my_center|LOCUS_17190 1008 1610 gene locus_tag LOCUS_17200 1008 1610 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868148.1 protein_id gnl|my_center|LOCUS_17200 1907 1605 gene locus_tag LOCUS_17210 gene pbp11 1907 1605 CDS product tRNA-binding protein Pbp11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250561.1 protein_id gnl|my_center|LOCUS_17210 2581 1913 gene locus_tag LOCUS_17220 2581 1913 CDS product DUF257 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868214.1 protein_id gnl|my_center|LOCUS_17220 3071 2634 gene locus_tag LOCUS_17230 3071 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence166 2938 1427 gene locus_tag LOCUS_17240 2938 1427 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249872.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence167 103 231 gene locus_tag LOCUS_17250 103 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 273 827 gene locus_tag LOCUS_17260 273 827 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868122.1 protein_id gnl|my_center|LOCUS_17260 859 2157 gene locus_tag LOCUS_17270 gene pfkC 859 2157 CDS product ADP-specific phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249331.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence168 1414 56 gene locus_tag LOCUS_17280 1414 56 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888077.1 protein_id gnl|my_center|LOCUS_17280 2563 1547 gene locus_tag LOCUS_17290 2563 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence169 421 1380 gene locus_tag LOCUS_17300 gene meaB 421 1380 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_17300 1377 1775 gene locus_tag LOCUS_17310 gene mce 1377 1775 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_17310 1904 2356 gene locus_tag LOCUS_17320 1904 2356 CDS product DUF835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249967.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence170 1689 2579 gene locus_tag LOCUS_17330 1689 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251189.1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence171 1510 110 gene locus_tag LOCUS_17340 1510 110 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868821.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence172 1033 404 gene locus_tag LOCUS_17350 1033 404 CDS product IS607-like element ISTko1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249606.1 protein_id gnl|my_center|LOCUS_17350 1331 2653 gene locus_tag LOCUS_17360 1331 2653 CDS product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146740.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence173 243 64 gene locus_tag LOCUS_17370 243 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 394 588 gene locus_tag LOCUS_17380 394 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 2241 1054 gene locus_tag LOCUS_17390 2241 1054 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081432771.1 protein_id gnl|my_center|LOCUS_17390 2521 2390 gene locus_tag LOCUS_17400 2521 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 2694 2518 gene locus_tag LOCUS_17410 2694 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence174 251 463 gene locus_tag LOCUS_17420 251 463 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053680.1 protein_id gnl|my_center|LOCUS_17420 464 691 gene locus_tag LOCUS_17430 464 691 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249666.1 protein_id gnl|my_center|LOCUS_17430 >Feature sequence175 <1 1127 gene locus_tag LOCUS_17440 <1 1127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460067.1:UxaA family hydrolase 1143 2102 gene locus_tag LOCUS_17450 1143 2102 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence176 186 662 gene locus_tag LOCUS_17460 186 662 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250801.1 protein_id gnl|my_center|LOCUS_17460 1599 691 gene locus_tag LOCUS_17470 1599 691 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053754.1 protein_id gnl|my_center|LOCUS_17470 <2657 1605 gene locus_tag LOCUS_17480 <2657 1605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868504.1:type II secretion system F family protein >Feature sequence177 781 626 gene locus_tag LOCUS_17490 781 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 961 2046 gene locus_tag LOCUS_17500 961 2046 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146822.1 protein_id gnl|my_center|LOCUS_17500 >Feature sequence178 348 124 gene locus_tag LOCUS_17510 348 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 474 623 gene locus_tag LOCUS_17520 474 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 636 1010 gene locus_tag LOCUS_17530 636 1010 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_17530 1105 1725 gene locus_tag LOCUS_17540 1105 1725 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860823.1 protein_id gnl|my_center|LOCUS_17540 1798 2283 gene locus_tag LOCUS_17550 1798 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17550 >Feature sequence179 189 2519 gene locus_tag LOCUS_17560 189 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence180 243 1130 gene locus_tag LOCUS_17570 243 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249481.1 protein_id gnl|my_center|LOCUS_17570