>Feature sequence001 776 1822 gene locus_tag LOCUS_00010 776 1822 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_00010 1837 3378 gene locus_tag LOCUS_00020 gene xylB 1837 3378 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_00020 3382 4179 gene locus_tag LOCUS_00030 3382 4179 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869899.1 protein_id gnl|my_center|LOCUS_00030 5542 4169 gene locus_tag LOCUS_00040 5542 4169 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_00040 6885 5677 gene locus_tag LOCUS_00050 6885 5677 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_00050 8508 6898 gene locus_tag LOCUS_00060 8508 6898 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869775.1 protein_id gnl|my_center|LOCUS_00060 9836 8505 gene locus_tag LOCUS_00070 9836 8505 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 protein_id gnl|my_center|LOCUS_00070 11102 9879 gene locus_tag LOCUS_00080 11102 9879 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_00080 12421 11114 gene locus_tag LOCUS_00090 12421 11114 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986541.1 protein_id gnl|my_center|LOCUS_00090 12732 12418 gene locus_tag LOCUS_00100 12732 12418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14560 12734 gene locus_tag LOCUS_00110 14560 12734 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869524.1 protein_id gnl|my_center|LOCUS_00110 15094 14570 gene locus_tag LOCUS_00120 15094 14570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15586 15164 gene locus_tag LOCUS_00130 15586 15164 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890737.1 protein_id gnl|my_center|LOCUS_00130 15873 15786 gene locus_tag LOCUS_t00010 15873 15786 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16076 16639 gene locus_tag LOCUS_00140 16076 16639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16678 18093 gene locus_tag LOCUS_00150 16678 18093 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_00150 19668 18433 gene locus_tag LOCUS_00160 19668 18433 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_00160 20642 19665 gene locus_tag LOCUS_00170 20642 19665 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941622.1 protein_id gnl|my_center|LOCUS_00170 22066 20702 gene locus_tag LOCUS_00180 22066 20702 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015371.1 protein_id gnl|my_center|LOCUS_00180 23631 22267 gene locus_tag LOCUS_00190 23631 22267 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015371.1 protein_id gnl|my_center|LOCUS_00190 24002 23796 gene locus_tag LOCUS_00200 24002 23796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 24231 24004 gene locus_tag LOCUS_00210 24231 24004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 24651 24271 gene locus_tag LOCUS_00220 gene gloA 24651 24271 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706456.1 protein_id gnl|my_center|LOCUS_00220 25900 24653 gene locus_tag LOCUS_00230 25900 24653 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086334.1 protein_id gnl|my_center|LOCUS_00230 26220 27674 gene locus_tag LOCUS_00240 26220 27674 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539284.1 protein_id gnl|my_center|LOCUS_00240 27971 29341 gene locus_tag LOCUS_00250 27971 29341 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893816.1 protein_id gnl|my_center|LOCUS_00250 30974 29454 gene locus_tag LOCUS_00260 30974 29454 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808163.1 protein_id gnl|my_center|LOCUS_00260 32820 31015 gene locus_tag LOCUS_00270 32820 31015 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877847.1 protein_id gnl|my_center|LOCUS_00270 34507 32846 gene locus_tag LOCUS_00280 34507 32846 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226410.1 protein_id gnl|my_center|LOCUS_00280 35342 34527 gene locus_tag LOCUS_00290 gene fabG 35342 34527 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099550.1 protein_id gnl|my_center|LOCUS_00290 36039 35362 gene locus_tag LOCUS_00300 36039 35362 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964844.1 protein_id gnl|my_center|LOCUS_00300 37491 36682 gene locus_tag LOCUS_00310 37491 36682 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892195.1 protein_id gnl|my_center|LOCUS_00310 38103 37594 gene locus_tag LOCUS_00320 38103 37594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 >Feature sequence002 148 945 gene locus_tag LOCUS_00330 gene proC 148 945 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_00330 1461 1189 gene locus_tag LOCUS_00340 1461 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 3394 1757 gene locus_tag LOCUS_00350 3394 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 5221 3803 gene locus_tag LOCUS_00360 5221 3803 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_00360 7260 5266 gene locus_tag LOCUS_00370 7260 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 8787 7309 gene locus_tag LOCUS_00380 gene ffh 8787 7309 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081977.1 protein_id gnl|my_center|LOCUS_00380 9041 8856 gene locus_tag LOCUS_00390 9041 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 9106 9573 gene locus_tag LOCUS_00400 9106 9573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 9585 10628 gene locus_tag LOCUS_00410 9585 10628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 11436 10867 gene locus_tag LOCUS_00420 11436 10867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 12338 11484 gene locus_tag LOCUS_00430 12338 11484 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869030.1 protein_id gnl|my_center|LOCUS_00430 13363 12344 gene locus_tag LOCUS_00440 13363 12344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00440 14274 13360 gene locus_tag LOCUS_00450 14274 13360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00450 15203 14271 gene locus_tag LOCUS_00460 gene arnC 15203 14271 CDS product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099176.1 protein_id gnl|my_center|LOCUS_00460 16130 15204 gene locus_tag LOCUS_00470 16130 15204 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259445.1 protein_id gnl|my_center|LOCUS_00470 17251 16127 gene locus_tag LOCUS_00480 gene arnB 17251 16127 CDS product UDP-4-amino-4-deoxy-L-arabinose aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703732.1 protein_id gnl|my_center|LOCUS_00480 18971 17349 gene locus_tag LOCUS_00490 18971 17349 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869035.1 protein_id gnl|my_center|LOCUS_00490 20638 18941 gene locus_tag LOCUS_00500 20638 18941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 22113 20839 gene locus_tag LOCUS_00510 22113 20839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 22909 22232 gene locus_tag LOCUS_00520 22909 22232 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974840.1 protein_id gnl|my_center|LOCUS_00520 24476 22947 gene locus_tag LOCUS_00530 24476 22947 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267898.1 protein_id gnl|my_center|LOCUS_00530 25157 25921 gene locus_tag LOCUS_00540 25157 25921 CDS product DUF2334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112786.1 protein_id gnl|my_center|LOCUS_00540 25912 27177 gene locus_tag LOCUS_00550 25912 27177 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219424.1 protein_id gnl|my_center|LOCUS_00550 27174 28181 gene locus_tag LOCUS_00560 27174 28181 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869831.1 protein_id gnl|my_center|LOCUS_00560 28186 29541 gene locus_tag LOCUS_00570 28186 29541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 29513 30841 gene locus_tag LOCUS_00580 gene atoC 29513 30841 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125298.1 protein_id gnl|my_center|LOCUS_00580 32223 31150 gene locus_tag LOCUS_00590 32223 31150 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00590 32452 32228 gene locus_tag LOCUS_00600 32452 32228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 >Feature sequence003 409 116 gene locus_tag LOCUS_00610 409 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 2070 610 gene locus_tag LOCUS_00620 2070 610 CDS product 4-hydroxyphenylacetate 3-hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878527.1 protein_id gnl|my_center|LOCUS_00620 2424 3662 gene locus_tag LOCUS_00630 2424 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 5586 3877 gene locus_tag LOCUS_00640 5586 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 7306 5624 gene locus_tag LOCUS_00650 7306 5624 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393418.1 protein_id gnl|my_center|LOCUS_00650 8075 7605 gene locus_tag LOCUS_00660 8075 7605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 9301 8219 gene locus_tag LOCUS_00670 9301 8219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 9501 10649 gene locus_tag LOCUS_00680 9501 10649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 10695 11645 gene locus_tag LOCUS_00690 10695 11645 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022353.1 protein_id gnl|my_center|LOCUS_00690 12267 11725 gene locus_tag LOCUS_00700 12267 11725 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964159.1 protein_id gnl|my_center|LOCUS_00700 12467 13678 gene locus_tag LOCUS_00710 12467 13678 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877945.1 protein_id gnl|my_center|LOCUS_00710 13699 14322 gene locus_tag LOCUS_00720 13699 14322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 14429 15592 gene locus_tag LOCUS_00730 14429 15592 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525387.1 protein_id gnl|my_center|LOCUS_00730 16596 15910 gene locus_tag LOCUS_00740 16596 15910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 16947 16759 gene locus_tag LOCUS_00750 16947 16759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 18235 17027 gene locus_tag LOCUS_00760 18235 17027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 20835 18283 gene locus_tag LOCUS_00770 gene mutS 20835 18283 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_00770 21227 20832 gene locus_tag LOCUS_00780 21227 20832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 22234 21452 gene locus_tag LOCUS_00790 gene fliR 22234 21452 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940492.1 protein_id gnl|my_center|LOCUS_00790 22500 22231 gene locus_tag LOCUS_00800 gene fliQ 22500 22231 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937354.1 protein_id gnl|my_center|LOCUS_00800 23268 22501 gene locus_tag LOCUS_00810 gene fliP 23268 22501 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_00810 23629 23249 gene locus_tag LOCUS_00820 23629 23249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 24219 23626 gene locus_tag LOCUS_00830 gene fliN 24219 23626 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937357.1 protein_id gnl|my_center|LOCUS_00830 25228 24230 gene locus_tag LOCUS_00840 gene fliM 25228 24230 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938209.1 protein_id gnl|my_center|LOCUS_00840 25789 25238 gene locus_tag LOCUS_00850 25789 25238 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793169.1 protein_id gnl|my_center|LOCUS_00850 26518 25799 gene locus_tag LOCUS_00860 26518 25799 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895795.1 protein_id gnl|my_center|LOCUS_00860 27312 26518 gene locus_tag LOCUS_00870 27312 26518 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986703.1 protein_id gnl|my_center|LOCUS_00870 28094 27315 gene locus_tag LOCUS_00880 28094 27315 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937361.1 protein_id gnl|my_center|LOCUS_00880 29824 28310 gene locus_tag LOCUS_00890 29824 28310 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938736.1 protein_id gnl|my_center|LOCUS_00890 30506 29838 gene locus_tag LOCUS_00900 30506 29838 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941085.1 protein_id gnl|my_center|LOCUS_00900 32010 30526 gene locus_tag LOCUS_00910 32010 30526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 >Feature sequence004 458 1051 gene locus_tag LOCUS_00920 458 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 1087 2301 gene locus_tag LOCUS_00930 1087 2301 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095472.1 protein_id gnl|my_center|LOCUS_00930 2361 3554 gene locus_tag LOCUS_00940 2361 3554 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047982.1 protein_id gnl|my_center|LOCUS_00940 3711 4331 gene locus_tag LOCUS_00950 gene accB 3711 4331 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921156.1 protein_id gnl|my_center|LOCUS_00950 4371 5840 gene locus_tag LOCUS_00960 4371 5840 CDS product carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039291.1 protein_id gnl|my_center|LOCUS_00960 5914 7206 gene locus_tag LOCUS_00970 5914 7206 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529505.1 protein_id gnl|my_center|LOCUS_00970 7354 7797 gene locus_tag LOCUS_00980 gene accB 7354 7797 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583401.1 protein_id gnl|my_center|LOCUS_00980 7794 9176 gene locus_tag LOCUS_00990 gene accC 7794 9176 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259259.1 protein_id gnl|my_center|LOCUS_00990 9217 11145 gene locus_tag LOCUS_01000 9217 11145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 11216 12028 gene locus_tag LOCUS_01010 11216 12028 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_01010 13790 12231 gene locus_tag LOCUS_01020 13790 12231 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978555.1 protein_id gnl|my_center|LOCUS_01020 15570 14044 gene locus_tag LOCUS_01030 15570 14044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 15886 16356 gene locus_tag LOCUS_01040 15886 16356 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069385.1 protein_id gnl|my_center|LOCUS_01040 16382 18259 gene locus_tag LOCUS_01050 16382 18259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 18447 19724 gene locus_tag LOCUS_01060 gene tilS 18447 19724 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434952.1 protein_id gnl|my_center|LOCUS_01060 19786 23118 gene locus_tag LOCUS_01070 gene mfd 19786 23118 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_01070 23084 24013 gene locus_tag LOCUS_01080 23084 24013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 24084 24854 gene locus_tag LOCUS_01090 24084 24854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 25005 25271 gene locus_tag LOCUS_01100 25005 25271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01100 25292 28066 gene locus_tag LOCUS_01110 gene uvrA 25292 28066 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_01110 >Feature sequence005 785 222 gene locus_tag LOCUS_01120 785 222 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876490.1 protein_id gnl|my_center|LOCUS_01120 1187 2665 gene locus_tag LOCUS_01130 gene lysS 1187 2665 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_01130 2770 3897 gene locus_tag LOCUS_01140 2770 3897 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_01140 3887 4576 gene locus_tag LOCUS_01150 gene lolD 3887 4576 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091168.1 protein_id gnl|my_center|LOCUS_01150 4557 6986 gene locus_tag LOCUS_01160 gene bamA 4557 6986 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_01160 7204 7749 gene locus_tag LOCUS_01170 7204 7749 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942907.1 protein_id gnl|my_center|LOCUS_01170 7758 8768 gene locus_tag LOCUS_01180 gene lpxD 7758 8768 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939642.1 protein_id gnl|my_center|LOCUS_01180 8755 9531 gene locus_tag LOCUS_01190 gene lpxA 8755 9531 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_01190 9528 10454 gene locus_tag LOCUS_01200 9528 10454 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_01200 10459 11535 gene locus_tag LOCUS_01210 gene lpxB 10459 11535 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_01210 11514 13292 gene locus_tag LOCUS_01220 gene msbA 11514 13292 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_01220 13381 14244 gene locus_tag LOCUS_01230 gene lpxK 13381 14244 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546103.1 protein_id gnl|my_center|LOCUS_01230 14216 14776 gene locus_tag LOCUS_01240 14216 14776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 14969 15769 gene locus_tag LOCUS_01250 14969 15769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 15922 15996 gene locus_tag LOCUS_t00020 15922 15996 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 16141 16965 gene locus_tag LOCUS_01260 16141 16965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 18582 16966 gene locus_tag LOCUS_01270 18582 16966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 18936 20168 gene locus_tag LOCUS_01280 18936 20168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 20170 21189 gene locus_tag LOCUS_01290 20170 21189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 22506 21289 gene locus_tag LOCUS_01300 22506 21289 CDS product 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791484.1 protein_id gnl|my_center|LOCUS_01300 24601 22730 gene locus_tag LOCUS_01310 24601 22730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 25028 26002 gene locus_tag LOCUS_01320 25028 26002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 26172 27131 gene locus_tag LOCUS_01330 26172 27131 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939162.1 protein_id gnl|my_center|LOCUS_01330 27505 27194 gene locus_tag LOCUS_01340 27505 27194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 >Feature sequence006 294 2033 gene locus_tag LOCUS_01350 gene recJ 294 2033 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_01350 2949 1981 gene locus_tag LOCUS_01360 2949 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 4448 2952 gene locus_tag LOCUS_01370 4448 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 5316 4453 gene locus_tag LOCUS_01380 5316 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 6433 5318 gene locus_tag LOCUS_01390 6433 5318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 6718 6906 gene locus_tag LOCUS_01400 6718 6906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 7058 7417 gene locus_tag LOCUS_01410 7058 7417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 7644 7829 gene locus_tag LOCUS_01420 7644 7829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 7848 10058 gene locus_tag LOCUS_01430 7848 10058 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_01430 10210 10398 gene locus_tag LOCUS_01440 10210 10398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 10401 11426 gene locus_tag LOCUS_01450 10401 11426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 11430 11651 gene locus_tag LOCUS_01460 11430 11651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 11554 11769 gene locus_tag LOCUS_01470 11554 11769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 11913 12944 gene locus_tag LOCUS_01480 11913 12944 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034325.1 protein_id gnl|my_center|LOCUS_01480 12941 13903 gene locus_tag LOCUS_01490 12941 13903 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_01490 14078 14320 gene locus_tag LOCUS_01500 14078 14320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 15306 14416 gene locus_tag LOCUS_01510 15306 14416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 15439 15627 gene locus_tag LOCUS_01520 15439 15627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 16626 16357 gene locus_tag LOCUS_01530 16626 16357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 17583 16792 gene locus_tag LOCUS_01540 17583 16792 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879451.1 protein_id gnl|my_center|LOCUS_01540 18373 17585 gene locus_tag LOCUS_01550 18373 17585 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879451.1 protein_id gnl|my_center|LOCUS_01550 19767 18370 gene locus_tag LOCUS_01560 19767 18370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 20020 19784 gene locus_tag LOCUS_01570 20020 19784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 21172 20039 gene locus_tag LOCUS_01580 21172 20039 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681414.1 protein_id gnl|my_center|LOCUS_01580 22476 21169 gene locus_tag LOCUS_01590 22476 21169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 23304 22639 gene locus_tag LOCUS_01600 23304 22639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 23719 23306 gene locus_tag LOCUS_01610 23719 23306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 24984 23731 gene locus_tag LOCUS_01620 24984 23731 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259419.1 protein_id gnl|my_center|LOCUS_01620 >Feature sequence007 1399 74 gene locus_tag LOCUS_01630 gene radA 1399 74 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940957.1 protein_id gnl|my_center|LOCUS_01630 3247 1553 gene locus_tag LOCUS_01640 gene gspE 3247 1553 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853744.1 protein_id gnl|my_center|LOCUS_01640 5262 3244 gene locus_tag LOCUS_01650 gene gspD 5262 3244 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940997.1 protein_id gnl|my_center|LOCUS_01650 6029 5259 gene locus_tag LOCUS_01660 6029 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 7540 6026 gene locus_tag LOCUS_01670 7540 6026 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942184.1 protein_id gnl|my_center|LOCUS_01670 8497 7658 gene locus_tag LOCUS_01680 8497 7658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 10530 8512 gene locus_tag LOCUS_01690 gene fusA 10530 8512 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_01690 12929 10506 gene locus_tag LOCUS_01700 12929 10506 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943552.1 protein_id gnl|my_center|LOCUS_01700 13728 12919 gene locus_tag LOCUS_01710 gene murI 13728 12919 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_01710 14229 15227 gene locus_tag LOCUS_01720 14229 15227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 15712 16515 gene locus_tag LOCUS_01730 15712 16515 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897311.1 protein_id gnl|my_center|LOCUS_01730 18375 17002 gene locus_tag LOCUS_01740 18375 17002 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_01740 18632 20098 gene locus_tag LOCUS_01750 gene acdAI 18632 20098 CDS product acetate--CoA ligase II subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867767.1 protein_id gnl|my_center|LOCUS_01750 20707 21141 gene locus_tag LOCUS_01760 20707 21141 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419785.1 protein_id gnl|my_center|LOCUS_01760 21517 21690 gene locus_tag LOCUS_01770 21517 21690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 23007 22219 gene locus_tag LOCUS_01780 23007 22219 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355989.1 protein_id gnl|my_center|LOCUS_01780 24419 23025 gene locus_tag LOCUS_01790 24419 23025 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867476.1 protein_id gnl|my_center|LOCUS_01790 >Feature sequence008 3167 123 gene locus_tag LOCUS_01800 3167 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 3332 4819 gene locus_tag LOCUS_01810 3332 4819 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941595.1 protein_id gnl|my_center|LOCUS_01810 5010 6245 gene locus_tag LOCUS_01820 5010 6245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 6480 7550 gene locus_tag LOCUS_01830 6480 7550 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812443.1 protein_id gnl|my_center|LOCUS_01830 7577 8449 gene locus_tag LOCUS_01840 7577 8449 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088705.1 protein_id gnl|my_center|LOCUS_01840 8460 8996 gene locus_tag LOCUS_01850 8460 8996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 9043 10251 gene locus_tag LOCUS_01860 9043 10251 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090552.1 protein_id gnl|my_center|LOCUS_01860 10277 11470 gene locus_tag LOCUS_01870 10277 11470 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223283.1 protein_id gnl|my_center|LOCUS_01870 11601 12386 gene locus_tag LOCUS_01880 11601 12386 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090654.1 protein_id gnl|my_center|LOCUS_01880 12374 13144 gene locus_tag LOCUS_01890 12374 13144 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090653.1 protein_id gnl|my_center|LOCUS_01890 13165 14967 gene locus_tag LOCUS_01900 13165 14967 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090652.1 protein_id gnl|my_center|LOCUS_01900 16942 15698 gene locus_tag LOCUS_01910 16942 15698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 18972 17620 gene locus_tag LOCUS_01920 18972 17620 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016234.1 protein_id gnl|my_center|LOCUS_01920 20672 18969 gene locus_tag LOCUS_01930 20672 18969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 21144 20719 gene locus_tag LOCUS_01940 21144 20719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 21349 21765 gene locus_tag LOCUS_01950 21349 21765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 22330 22959 gene locus_tag LOCUS_01960 22330 22959 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371795.1 protein_id gnl|my_center|LOCUS_01960 23215 24549 gene locus_tag LOCUS_01970 gene ltrA 23215 24549 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393716.1 protein_id gnl|my_center|LOCUS_01970 >Feature sequence009 2240 1269 gene locus_tag LOCUS_01980 2240 1269 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_01980 2815 2240 gene locus_tag LOCUS_01990 gene rsxA 2815 2240 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_01990 4212 2905 gene locus_tag LOCUS_02000 4212 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 4757 4395 gene locus_tag LOCUS_02010 gene atpE 4757 4395 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792634.1 protein_id gnl|my_center|LOCUS_02010 5109 6152 gene locus_tag LOCUS_02020 5109 6152 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941057.1 protein_id gnl|my_center|LOCUS_02020 6165 7046 gene locus_tag LOCUS_02030 6165 7046 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963925.1 protein_id gnl|my_center|LOCUS_02030 10153 7178 gene locus_tag LOCUS_02040 10153 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 10283 11659 gene locus_tag LOCUS_02050 10283 11659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 12751 11864 gene locus_tag LOCUS_02060 12751 11864 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_02060 13615 12752 gene locus_tag LOCUS_02070 13615 12752 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_02070 13703 13870 gene locus_tag LOCUS_02080 13703 13870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 14500 15084 gene locus_tag LOCUS_02090 14500 15084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 15107 16537 gene locus_tag LOCUS_02100 15107 16537 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_02100 17583 16765 gene locus_tag LOCUS_02110 17583 16765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 18114 17716 gene locus_tag LOCUS_02120 18114 17716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 18259 18119 gene locus_tag LOCUS_02130 18259 18119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 18715 18428 gene locus_tag LOCUS_02140 18715 18428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 19004 18762 gene locus_tag LOCUS_02150 19004 18762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 19422 19030 gene locus_tag LOCUS_02160 19422 19030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 20943 19585 gene locus_tag LOCUS_02170 gene orpR 20943 19585 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_02170 21101 22144 gene locus_tag LOCUS_02180 21101 22144 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815913.1 protein_id gnl|my_center|LOCUS_02180 22261 22545 gene locus_tag LOCUS_02190 22261 22545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 22549 22995 gene locus_tag LOCUS_02200 22549 22995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 23066 23425 gene locus_tag LOCUS_02210 23066 23425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02210 23792 24004 gene locus_tag LOCUS_02220 23792 24004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 >Feature sequence010 2139 946 gene locus_tag LOCUS_02230 2139 946 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250627.1 protein_id gnl|my_center|LOCUS_02230 3566 2136 gene locus_tag LOCUS_02240 gene gatB 3566 2136 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_02240 4987 3551 gene locus_tag LOCUS_02250 gene gatA 4987 3551 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546781.1 protein_id gnl|my_center|LOCUS_02250 5285 4998 gene locus_tag LOCUS_02260 gene gatC 5285 4998 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393506.1 protein_id gnl|my_center|LOCUS_02260 8058 5617 gene locus_tag LOCUS_02270 8058 5617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259586.1 protein_id gnl|my_center|LOCUS_02270 8792 8061 gene locus_tag LOCUS_02280 8792 8061 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000352.1 protein_id gnl|my_center|LOCUS_02280 9833 9039 gene locus_tag LOCUS_02290 9833 9039 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224329.1 protein_id gnl|my_center|LOCUS_02290 10872 10441 gene locus_tag LOCUS_02300 10872 10441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 11092 10838 gene locus_tag LOCUS_02310 11092 10838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 11285 11821 gene locus_tag LOCUS_02320 11285 11821 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865177.1 protein_id gnl|my_center|LOCUS_02320 11839 12252 gene locus_tag LOCUS_02330 gene speD 11839 12252 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081137.1 protein_id gnl|my_center|LOCUS_02330 12249 12716 gene locus_tag LOCUS_02340 12249 12716 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869814.1 protein_id gnl|my_center|LOCUS_02340 12732 13574 gene locus_tag LOCUS_02350 gene speE 12732 13574 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081139.1 protein_id gnl|my_center|LOCUS_02350 13574 14401 gene locus_tag LOCUS_02360 gene speB 13574 14401 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125998.1 protein_id gnl|my_center|LOCUS_02360 14686 14859 gene locus_tag LOCUS_02370 14686 14859 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937959.1 protein_id gnl|my_center|LOCUS_02370 14852 15670 gene locus_tag LOCUS_02380 14852 15670 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174269896.1 protein_id gnl|my_center|LOCUS_02380 18362 15945 gene locus_tag LOCUS_02390 gene lon 18362 15945 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943811.1 protein_id gnl|my_center|LOCUS_02390 18770 18372 gene locus_tag LOCUS_02400 18770 18372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 20787 19012 gene locus_tag LOCUS_02410 20787 19012 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096139.1 protein_id gnl|my_center|LOCUS_02410 21184 20852 gene locus_tag LOCUS_02420 21184 20852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 21798 21232 gene locus_tag LOCUS_02430 21798 21232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 23343 21799 gene locus_tag LOCUS_02440 23343 21799 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064214.1 protein_id gnl|my_center|LOCUS_02440 <23899 23368 gene locus_tag LOCUS_02450 <23899 23368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039293.1:carboxyl transferase domain-containing protein >Feature sequence011 319 990 gene locus_tag LOCUS_02460 319 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 1004 1984 gene locus_tag LOCUS_02470 1004 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 2464 3462 gene locus_tag LOCUS_02480 gene nagB 2464 3462 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963511.1 protein_id gnl|my_center|LOCUS_02480 4828 3569 gene locus_tag LOCUS_02490 4828 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 6250 4898 gene locus_tag LOCUS_02500 gene glmM 6250 4898 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_02500 10149 6352 gene locus_tag LOCUS_02510 10149 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 10890 11072 gene locus_tag LOCUS_02520 10890 11072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 12380 10995 gene locus_tag LOCUS_02530 12380 10995 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004347154.1 protein_id gnl|my_center|LOCUS_02530 12490 14406 gene locus_tag LOCUS_02540 12490 14406 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869226.1 protein_id gnl|my_center|LOCUS_02540 14557 14802 gene locus_tag LOCUS_02550 gene rpsP 14557 14802 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002940682.1 protein_id gnl|my_center|LOCUS_02550 14832 15065 gene locus_tag LOCUS_02560 14832 15065 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_02560 15066 15572 gene locus_tag LOCUS_02570 gene rimM 15066 15572 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_02570 15596 16312 gene locus_tag LOCUS_02580 gene trmD 15596 16312 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_02580 16325 16852 gene locus_tag LOCUS_02590 16325 16852 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941308.1 protein_id gnl|my_center|LOCUS_02590 16856 17197 gene locus_tag LOCUS_02600 gene rplS 16856 17197 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_02600 17203 17802 gene locus_tag LOCUS_02610 gene rnhB 17203 17802 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770967.1 protein_id gnl|my_center|LOCUS_02610 17783 18157 gene locus_tag LOCUS_02620 17783 18157 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438259.1 protein_id gnl|my_center|LOCUS_02620 18150 18584 gene locus_tag LOCUS_02630 18150 18584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 18795 19856 gene locus_tag LOCUS_02640 18795 19856 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942440.1 protein_id gnl|my_center|LOCUS_02640 19997 20644 gene locus_tag LOCUS_02650 19997 20644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 21899 20673 gene locus_tag LOCUS_02660 21899 20673 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_02660 22958 21912 gene locus_tag LOCUS_02670 22958 21912 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879449.1 protein_id gnl|my_center|LOCUS_02670 >Feature sequence012 1673 534 gene locus_tag LOCUS_02680 1673 534 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103930.1 protein_id gnl|my_center|LOCUS_02680 2629 1694 gene locus_tag LOCUS_02690 2629 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 3041 2583 gene locus_tag LOCUS_02700 3041 2583 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879802.1 protein_id gnl|my_center|LOCUS_02700 4883 3078 gene locus_tag LOCUS_02710 4883 3078 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773675.1 protein_id gnl|my_center|LOCUS_02710 5753 4899 gene locus_tag LOCUS_02720 5753 4899 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_02720 7390 5984 gene locus_tag LOCUS_02730 7390 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 8344 7412 gene locus_tag LOCUS_02740 8344 7412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 8857 8378 gene locus_tag LOCUS_02750 8857 8378 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878466.1 protein_id gnl|my_center|LOCUS_02750 10037 8874 gene locus_tag LOCUS_02760 10037 8874 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877713.1 protein_id gnl|my_center|LOCUS_02760 11186 10047 gene locus_tag LOCUS_02770 11186 10047 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064172.1 protein_id gnl|my_center|LOCUS_02770 11665 11210 gene locus_tag LOCUS_02780 11665 11210 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979867.1 protein_id gnl|my_center|LOCUS_02780 12942 11698 gene locus_tag LOCUS_02790 12942 11698 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047982.1 protein_id gnl|my_center|LOCUS_02790 14503 12974 gene locus_tag LOCUS_02800 14503 12974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 15552 14533 gene locus_tag LOCUS_02810 15552 14533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 16055 15600 gene locus_tag LOCUS_02820 16055 15600 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878465.1 protein_id gnl|my_center|LOCUS_02820 16581 16084 gene locus_tag LOCUS_02830 16581 16084 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979867.1 protein_id gnl|my_center|LOCUS_02830 17762 16596 gene locus_tag LOCUS_02840 17762 16596 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224426.1 protein_id gnl|my_center|LOCUS_02840 18923 17775 gene locus_tag LOCUS_02850 18923 17775 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064172.1 protein_id gnl|my_center|LOCUS_02850 20169 18985 gene locus_tag LOCUS_02860 20169 18985 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_02860 20993 20208 gene locus_tag LOCUS_02870 20993 20208 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048188.1 protein_id gnl|my_center|LOCUS_02870 21934 21044 gene locus_tag LOCUS_02880 21934 21044 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_02880 22587 21970 gene locus_tag LOCUS_02890 22587 21970 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742222.1 protein_id gnl|my_center|LOCUS_02890 >Feature sequence013 1252 563 gene locus_tag LOCUS_02900 1252 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 1665 1249 gene locus_tag LOCUS_02910 gene tolR 1665 1249 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932318.1 protein_id gnl|my_center|LOCUS_02910 2365 1652 gene locus_tag LOCUS_02920 gene tolQ 2365 1652 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_02920 3582 2605 gene locus_tag LOCUS_02930 3582 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 3875 4243 gene locus_tag LOCUS_02940 gene mraZ 3875 4243 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644614.1 protein_id gnl|my_center|LOCUS_02940 4292 5176 gene locus_tag LOCUS_02950 gene rsmH 4292 5176 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949033.1 protein_id gnl|my_center|LOCUS_02950 5200 5460 gene locus_tag LOCUS_02960 5200 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 5532 7142 gene locus_tag LOCUS_02970 5532 7142 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_02970 7148 8596 gene locus_tag LOCUS_02980 7148 8596 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943699.1 protein_id gnl|my_center|LOCUS_02980 8593 9504 gene locus_tag LOCUS_02990 8593 9504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02990 9440 9982 gene locus_tag LOCUS_03000 9440 9982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03000 9982 11061 gene locus_tag LOCUS_03010 gene mraY 9982 11061 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_03010 11068 11202 gene locus_tag LOCUS_03020 11068 11202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 11193 12503 gene locus_tag LOCUS_03030 gene murD 11193 12503 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_03030 12470 13591 gene locus_tag LOCUS_03040 gene ftsW 12470 13591 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_03040 13588 14649 gene locus_tag LOCUS_03050 gene murG 13588 14649 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545433.1 protein_id gnl|my_center|LOCUS_03050 14642 16012 gene locus_tag LOCUS_03060 gene murC 14642 16012 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_03060 16009 16845 gene locus_tag LOCUS_03070 gene murB 16009 16845 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943692.1 protein_id gnl|my_center|LOCUS_03070 16838 17614 gene locus_tag LOCUS_03080 16838 17614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 17622 18836 gene locus_tag LOCUS_03090 gene ftsA 17622 18836 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_03090 18856 20025 gene locus_tag LOCUS_03100 gene ftsZ 18856 20025 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943688.1 protein_id gnl|my_center|LOCUS_03100 20033 21139 gene locus_tag LOCUS_03110 gene alr 20033 21139 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_03110 21899 21234 gene locus_tag LOCUS_03120 21899 21234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 22470 21886 gene locus_tag LOCUS_03130 22470 21886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 >Feature sequence014 21 962 gene locus_tag LOCUS_03140 21 962 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545377.1 protein_id gnl|my_center|LOCUS_03140 1386 1937 gene locus_tag LOCUS_03150 1386 1937 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761981.1 protein_id gnl|my_center|LOCUS_03150 1948 3087 gene locus_tag LOCUS_03160 1948 3087 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_03160 3303 5312 gene locus_tag LOCUS_03170 gene fadJ 3303 5312 CDS product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072985.1 protein_id gnl|my_center|LOCUS_03170 5760 7046 gene locus_tag LOCUS_03180 5760 7046 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113524.1 protein_id gnl|my_center|LOCUS_03180 7356 8648 gene locus_tag LOCUS_03190 7356 8648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 8686 12558 gene locus_tag LOCUS_03200 8686 12558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 12843 13853 gene locus_tag LOCUS_03210 12843 13853 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237280.1 protein_id gnl|my_center|LOCUS_03210 13885 16287 gene locus_tag LOCUS_03220 13885 16287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 16317 18020 gene locus_tag LOCUS_03230 16317 18020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 18048 18611 gene locus_tag LOCUS_03240 18048 18611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 18725 19831 gene locus_tag LOCUS_03250 18725 19831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 22094 19929 gene locus_tag LOCUS_03260 gene lon 22094 19929 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256210.1 protein_id gnl|my_center|LOCUS_03260 >Feature sequence015 664 1146 gene locus_tag LOCUS_03270 664 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 2056 1115 gene locus_tag LOCUS_03280 gene miaA 2056 1115 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_03280 3768 2035 gene locus_tag LOCUS_03290 gene mutL 3768 2035 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583440.1 protein_id gnl|my_center|LOCUS_03290 5150 3771 gene locus_tag LOCUS_03300 5150 3771 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081585.1 protein_id gnl|my_center|LOCUS_03300 5372 5611 gene locus_tag LOCUS_03310 5372 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 5619 8669 gene locus_tag LOCUS_03320 5619 8669 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583653.1 protein_id gnl|my_center|LOCUS_03320 8673 8987 gene locus_tag LOCUS_03330 8673 8987 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546611.1 protein_id gnl|my_center|LOCUS_03330 8984 9325 gene locus_tag LOCUS_03340 8984 9325 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546363.1 protein_id gnl|my_center|LOCUS_03340 9322 12396 gene locus_tag LOCUS_03350 9322 12396 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583655.1 protein_id gnl|my_center|LOCUS_03350 12735 13724 gene locus_tag LOCUS_03360 12735 13724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 13849 14700 gene locus_tag LOCUS_03370 13849 14700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 15083 16351 gene locus_tag LOCUS_03380 15083 16351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 16366 17628 gene locus_tag LOCUS_03390 16366 17628 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259419.1 protein_id gnl|my_center|LOCUS_03390 17733 19136 gene locus_tag LOCUS_03400 17733 19136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 19253 19432 gene locus_tag LOCUS_03410 19253 19432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 19540 20142 gene locus_tag LOCUS_03420 19540 20142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 20490 21752 gene locus_tag LOCUS_03430 20490 21752 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480016.1 protein_id gnl|my_center|LOCUS_03430 >Feature sequence016 58 207 gene locus_tag LOCUS_03440 58 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 654 2522 gene locus_tag LOCUS_03450 654 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 5013 2755 gene locus_tag LOCUS_03460 5013 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 6034 5051 gene locus_tag LOCUS_03470 6034 5051 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584023.1 protein_id gnl|my_center|LOCUS_03470 7356 6097 gene locus_tag LOCUS_03480 7356 6097 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726689.1 protein_id gnl|my_center|LOCUS_03480 7750 7418 gene locus_tag LOCUS_03490 7750 7418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 8680 7865 gene locus_tag LOCUS_03500 8680 7865 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868662.1 protein_id gnl|my_center|LOCUS_03500 9168 8830 gene locus_tag LOCUS_03510 9168 8830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 10525 9419 gene locus_tag LOCUS_03520 10525 9419 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_03520 11198 10506 gene locus_tag LOCUS_03530 11198 10506 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919369.1 protein_id gnl|my_center|LOCUS_03530 11304 11122 gene locus_tag LOCUS_03540 11304 11122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 12143 11367 gene locus_tag LOCUS_03550 gene fabG 12143 11367 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_03550 13314 12175 gene locus_tag LOCUS_03560 13314 12175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 13699 13352 gene locus_tag LOCUS_03570 13699 13352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 14769 13696 gene locus_tag LOCUS_03580 14769 13696 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_03580 15553 14798 gene locus_tag LOCUS_03590 15553 14798 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 protein_id gnl|my_center|LOCUS_03590 16414 15668 gene locus_tag LOCUS_03600 16414 15668 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524570.1 protein_id gnl|my_center|LOCUS_03600 16553 16416 gene locus_tag LOCUS_03610 16553 16416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 17346 16543 gene locus_tag LOCUS_03620 17346 16543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 18397 17357 gene locus_tag LOCUS_03630 18397 17357 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_03630 19536 18394 gene locus_tag LOCUS_03640 19536 18394 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228417.1 protein_id gnl|my_center|LOCUS_03640 19797 20633 gene locus_tag LOCUS_03650 19797 20633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 >Feature sequence017 937 605 gene locus_tag LOCUS_03660 937 605 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244108.1 protein_id gnl|my_center|LOCUS_03660 1215 934 gene locus_tag LOCUS_03670 1215 934 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957712.1 protein_id gnl|my_center|LOCUS_03670 1705 1439 gene locus_tag LOCUS_03680 1705 1439 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860386.1 protein_id gnl|my_center|LOCUS_03680 1893 1705 gene locus_tag LOCUS_03690 1893 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 2449 2084 gene locus_tag LOCUS_03700 2449 2084 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_03700 2640 2464 gene locus_tag LOCUS_03710 2640 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 2890 2621 gene locus_tag LOCUS_03720 2890 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 4751 3522 gene locus_tag LOCUS_03730 4751 3522 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_03730 5381 5112 gene locus_tag LOCUS_03740 5381 5112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 5592 5374 gene locus_tag LOCUS_03750 5592 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 5930 5700 gene locus_tag LOCUS_03760 5930 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 6389 6054 gene locus_tag LOCUS_03770 6389 6054 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_03770 6687 6460 gene locus_tag LOCUS_03780 6687 6460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 7217 6972 gene locus_tag LOCUS_03790 7217 6972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 7308 7180 gene locus_tag LOCUS_03800 7308 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 9112 7715 gene locus_tag LOCUS_03810 9112 7715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 9361 9167 gene locus_tag LOCUS_03820 9361 9167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 9750 9529 gene locus_tag LOCUS_03830 9750 9529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 9999 9751 gene locus_tag LOCUS_03840 9999 9751 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022120.1 protein_id gnl|my_center|LOCUS_03840 11343 10261 gene locus_tag LOCUS_03850 11343 10261 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_03850 12431 11388 gene locus_tag LOCUS_03860 gene gmd 12431 11388 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_03860 13690 12752 gene locus_tag LOCUS_03870 13690 12752 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_03870 14830 13955 gene locus_tag LOCUS_03880 14830 13955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 16668 14932 gene locus_tag LOCUS_03890 16668 14932 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942628.1 protein_id gnl|my_center|LOCUS_03890 18058 16838 gene locus_tag LOCUS_03900 18058 16838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 18809 18219 gene locus_tag LOCUS_03910 18809 18219 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_03910 20605 19454 gene locus_tag LOCUS_03920 gene acdA 20605 19454 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_03920 >Feature sequence018 <1 744 gene locus_tag LOCUS_03930 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141077.1:bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase 2903 1677 gene locus_tag LOCUS_03940 gene icd 2903 1677 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868777.1 protein_id gnl|my_center|LOCUS_03940 4845 2932 gene locus_tag LOCUS_03950 4845 2932 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937705.1 protein_id gnl|my_center|LOCUS_03950 5599 4853 gene locus_tag LOCUS_03960 5599 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 7402 5615 gene locus_tag LOCUS_03970 gene aspS 7402 5615 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_03970 8655 7411 gene locus_tag LOCUS_03980 gene hisS 8655 7411 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942303.1 protein_id gnl|my_center|LOCUS_03980 9615 8737 gene locus_tag LOCUS_03990 9615 8737 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459741.1 protein_id gnl|my_center|LOCUS_03990 11272 9626 gene locus_tag LOCUS_04000 11272 9626 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456248.1 protein_id gnl|my_center|LOCUS_04000 11892 11497 gene locus_tag LOCUS_04010 11892 11497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 12191 13339 gene locus_tag LOCUS_04020 12191 13339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 13266 14030 gene locus_tag LOCUS_04030 13266 14030 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878178.1 protein_id gnl|my_center|LOCUS_04030 14053 14712 gene locus_tag LOCUS_04040 14053 14712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 14872 14690 gene locus_tag LOCUS_04050 14872 14690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 15223 14900 gene locus_tag LOCUS_04060 15223 14900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 15117 15527 gene locus_tag LOCUS_04070 15117 15527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 15497 16828 gene locus_tag LOCUS_04080 gene hemA 15497 16828 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938754.1 protein_id gnl|my_center|LOCUS_04080 16731 17633 gene locus_tag LOCUS_04090 gene hemC 16731 17633 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258453.1 protein_id gnl|my_center|LOCUS_04090 17719 19203 gene locus_tag LOCUS_04100 gene cobA 17719 19203 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_04100 19200 20390 gene locus_tag LOCUS_04110 gene ahbC 19200 20390 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938157.1 protein_id gnl|my_center|LOCUS_04110 >Feature sequence019 2378 1353 gene locus_tag LOCUS_04120 2378 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 3952 2807 gene locus_tag LOCUS_04130 3952 2807 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040775.1 protein_id gnl|my_center|LOCUS_04130 4854 4042 gene locus_tag LOCUS_04140 4854 4042 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022831.1 protein_id gnl|my_center|LOCUS_04140 6269 5139 gene locus_tag LOCUS_04150 gene asnA 6269 5139 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641196.1 protein_id gnl|my_center|LOCUS_04150 6849 7604 gene locus_tag LOCUS_04160 6849 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04160 7709 8392 gene locus_tag LOCUS_04170 7709 8392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 8392 9273 gene locus_tag LOCUS_04180 8392 9273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 9295 10653 gene locus_tag LOCUS_04190 9295 10653 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_04190 12557 10683 gene locus_tag LOCUS_04200 12557 10683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 12880 12554 gene locus_tag LOCUS_04210 12880 12554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 13649 13230 gene locus_tag LOCUS_04220 13649 13230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 14197 14033 gene locus_tag LOCUS_04230 14197 14033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 14581 14213 gene locus_tag LOCUS_04240 14581 14213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 14980 14651 gene locus_tag LOCUS_04250 14980 14651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 17426 15039 gene locus_tag LOCUS_04260 17426 15039 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900995.1 protein_id gnl|my_center|LOCUS_04260 17683 18312 gene locus_tag LOCUS_04270 17683 18312 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_04270 18309 18827 gene locus_tag LOCUS_04280 18309 18827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04280 18867 19217 gene locus_tag LOCUS_04290 18867 19217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04290 >Feature sequence020 <1 587 gene locus_tag LOCUS_04300 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792381.1:long-chain fatty acid--CoA ligase note possible pseudo, frameshifted 556 801 gene locus_tag LOCUS_04310 556 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04310 859 1626 gene locus_tag LOCUS_04320 859 1626 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879451.1 protein_id gnl|my_center|LOCUS_04320 2454 2020 gene locus_tag LOCUS_04330 gene vapC26 2454 2020 CDS product type II toxin-antitoxin system toxin ribonuclease C26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403047.1 protein_id gnl|my_center|LOCUS_04330 2663 2433 gene locus_tag LOCUS_04340 2663 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 3631 2738 gene locus_tag LOCUS_04350 3631 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 3878 3642 gene locus_tag LOCUS_04360 3878 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 4189 4410 gene locus_tag LOCUS_04370 4189 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 4407 4610 gene locus_tag LOCUS_04380 4407 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 5628 5218 gene locus_tag LOCUS_04390 5628 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 5833 5633 gene locus_tag LOCUS_04400 5833 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 7271 6246 gene locus_tag LOCUS_04410 gene mnmA 7271 6246 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583059.1 protein_id gnl|my_center|LOCUS_04410 8200 7268 gene locus_tag LOCUS_04420 8200 7268 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250632.1 protein_id gnl|my_center|LOCUS_04420 9558 8218 gene locus_tag LOCUS_04430 9558 8218 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_04430 10223 9495 gene locus_tag LOCUS_04440 10223 9495 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_04440 11449 10220 gene locus_tag LOCUS_04450 gene coaBC 11449 10220 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_04450 11853 11422 gene locus_tag LOCUS_04460 11853 11422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 12489 11866 gene locus_tag LOCUS_04470 12489 11866 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_04470 12749 13861 gene locus_tag LOCUS_04480 gene ald 12749 13861 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_04480 14457 15404 gene locus_tag LOCUS_04490 14457 15404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 15401 17296 gene locus_tag LOCUS_04500 gene metG 15401 17296 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939333.1 protein_id gnl|my_center|LOCUS_04500 17442 17792 gene locus_tag LOCUS_04510 17442 17792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 17785 18627 gene locus_tag LOCUS_04520 17785 18627 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942704.1 protein_id gnl|my_center|LOCUS_04520 >Feature sequence021 313 1077 gene locus_tag LOCUS_04530 gene cbiQ 313 1077 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545677.1 protein_id gnl|my_center|LOCUS_04530 1053 1796 gene locus_tag LOCUS_04540 1053 1796 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938355.1 protein_id gnl|my_center|LOCUS_04540 2251 1997 gene locus_tag LOCUS_04550 2251 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 2379 3173 gene locus_tag LOCUS_04560 2379 3173 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479789.1 protein_id gnl|my_center|LOCUS_04560 3211 4293 gene locus_tag LOCUS_04570 3211 4293 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057322.1 protein_id gnl|my_center|LOCUS_04570 4283 4594 gene locus_tag LOCUS_04580 4283 4594 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064812.1 protein_id gnl|my_center|LOCUS_04580 4587 4943 gene locus_tag LOCUS_04590 4587 4943 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869620.1 protein_id gnl|my_center|LOCUS_04590 4933 5739 gene locus_tag LOCUS_04600 4933 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 5856 6008 gene locus_tag LOCUS_04610 5856 6008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 6005 6766 gene locus_tag LOCUS_04620 6005 6766 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867167.1 protein_id gnl|my_center|LOCUS_04620 6763 7542 gene locus_tag LOCUS_04630 6763 7542 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013747453.1 protein_id gnl|my_center|LOCUS_04630 7529 10072 gene locus_tag LOCUS_04640 7529 10072 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970308.1 protein_id gnl|my_center|LOCUS_04640 10942 10094 gene locus_tag LOCUS_04650 10942 10094 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616091.1 protein_id gnl|my_center|LOCUS_04650 12581 11385 gene locus_tag LOCUS_04660 12581 11385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 14301 12859 gene locus_tag LOCUS_04670 14301 12859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 15512 14316 gene locus_tag LOCUS_04680 15512 14316 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879269.1 protein_id gnl|my_center|LOCUS_04680 16722 15526 gene locus_tag LOCUS_04690 16722 15526 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879269.1 protein_id gnl|my_center|LOCUS_04690 >Feature sequence022 712 29 gene locus_tag LOCUS_04700 712 29 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258849.1 protein_id gnl|my_center|LOCUS_04700 1063 722 gene locus_tag LOCUS_04710 1063 722 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251013.1 protein_id gnl|my_center|LOCUS_04710 1444 2727 gene locus_tag LOCUS_04720 1444 2727 CDS product coproporphyrinogen III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074137.1 protein_id gnl|my_center|LOCUS_04720 4358 3018 gene locus_tag LOCUS_04730 gene dnaA 4358 3018 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940678.1 protein_id gnl|my_center|LOCUS_04730 4818 5405 gene locus_tag LOCUS_04740 4818 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 5605 6816 gene locus_tag LOCUS_04750 gene mtaB 5605 6816 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_04750 6891 7763 gene locus_tag LOCUS_04760 6891 7763 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262449.1 protein_id gnl|my_center|LOCUS_04760 7946 8308 gene locus_tag LOCUS_04770 7946 8308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 8305 11190 gene locus_tag LOCUS_04780 8305 11190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 12244 11462 gene locus_tag LOCUS_04790 12244 11462 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476646.1 protein_id gnl|my_center|LOCUS_04790 12985 12257 gene locus_tag LOCUS_04800 12985 12257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 14858 12996 gene locus_tag LOCUS_04810 gene nuoF 14858 12996 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817338.1 protein_id gnl|my_center|LOCUS_04810 15338 14880 gene locus_tag LOCUS_04820 15338 14880 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869222.1 protein_id gnl|my_center|LOCUS_04820 16266 15340 gene locus_tag LOCUS_04830 gene porB 16266 15340 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496444.1 protein_id gnl|my_center|LOCUS_04830 17455 16277 gene locus_tag LOCUS_04840 17455 16277 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582673.1 protein_id gnl|my_center|LOCUS_04840 17753 17457 gene locus_tag LOCUS_04850 17753 17457 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868482.1 protein_id gnl|my_center|LOCUS_04850 18310 17759 gene locus_tag LOCUS_04860 18310 17759 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868483.1 protein_id gnl|my_center|LOCUS_04860 >Feature sequence023 207 476 gene locus_tag LOCUS_04870 207 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 473 910 gene locus_tag LOCUS_04880 473 910 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393815.1 protein_id gnl|my_center|LOCUS_04880 2274 922 gene locus_tag LOCUS_04890 2274 922 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_04890 4261 2267 gene locus_tag LOCUS_04900 4261 2267 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941439.1 protein_id gnl|my_center|LOCUS_04900 4835 4440 gene locus_tag LOCUS_04910 4835 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 5908 4883 gene locus_tag LOCUS_04920 5908 4883 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_04920 7941 5905 gene locus_tag LOCUS_04930 7941 5905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:complement(7540..7542),aa:Sec) note codon on position 134 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_04930 8796 7942 gene locus_tag LOCUS_04940 8796 7942 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546652.1 protein_id gnl|my_center|LOCUS_04940 11239 9941 gene locus_tag LOCUS_04950 11239 9941 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048438.1 protein_id gnl|my_center|LOCUS_04950 12841 11267 gene locus_tag LOCUS_04960 gene serA 12841 11267 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_04960 13082 13291 gene locus_tag LOCUS_04970 13082 13291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 14771 13308 gene locus_tag LOCUS_04980 14771 13308 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798834.1 protein_id gnl|my_center|LOCUS_04980 16156 14906 gene locus_tag LOCUS_04990 16156 14906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 18092 16200 gene locus_tag LOCUS_05000 18092 16200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 >Feature sequence024 1403 348 gene locus_tag LOCUS_05010 1403 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 2418 1390 gene locus_tag LOCUS_05020 gene trxB 2418 1390 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229015.1 protein_id gnl|my_center|LOCUS_05020 2703 2422 gene locus_tag LOCUS_05030 2703 2422 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870842.1 protein_id gnl|my_center|LOCUS_05030 3279 2869 gene locus_tag LOCUS_05040 3279 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 3616 3293 gene locus_tag LOCUS_05050 3616 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 4311 3613 gene locus_tag LOCUS_05060 4311 3613 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393839.1 protein_id gnl|my_center|LOCUS_05060 4841 4338 gene locus_tag LOCUS_05070 4841 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 5075 6172 gene locus_tag LOCUS_05080 5075 6172 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878758.1 protein_id gnl|my_center|LOCUS_05080 6371 7081 gene locus_tag LOCUS_05090 6371 7081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 7695 8339 gene locus_tag LOCUS_05100 7695 8339 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393814.1 protein_id gnl|my_center|LOCUS_05100 8336 9226 gene locus_tag LOCUS_05110 8336 9226 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545543.1 protein_id gnl|my_center|LOCUS_05110 9214 10146 gene locus_tag LOCUS_05120 9214 10146 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_05120 10128 11246 gene locus_tag LOCUS_05130 10128 11246 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_05130 11250 12368 gene locus_tag LOCUS_05140 11250 12368 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_05140 12369 13337 gene locus_tag LOCUS_05150 12369 13337 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943451.1 protein_id gnl|my_center|LOCUS_05150 15020 13536 gene locus_tag LOCUS_05160 15020 13536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 15453 16457 gene locus_tag LOCUS_05170 15453 16457 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941713.1 protein_id gnl|my_center|LOCUS_05170 16594 17556 gene locus_tag LOCUS_05180 gene fabK 16594 17556 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_05180 >Feature sequence025 162 86 gene locus_tag LOCUS_t00030 162 86 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 352 2070 gene locus_tag LOCUS_05190 352 2070 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228698.1 protein_id gnl|my_center|LOCUS_05190 3149 2505 gene locus_tag LOCUS_05200 3149 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 3983 3414 gene locus_tag LOCUS_05210 3983 3414 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_05210 4640 4128 gene locus_tag LOCUS_05220 4640 4128 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868874.1 protein_id gnl|my_center|LOCUS_05220 6689 4704 gene locus_tag LOCUS_05230 6689 4704 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023875.1 protein_id gnl|my_center|LOCUS_05230 8248 6908 gene locus_tag LOCUS_05240 8248 6908 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226490.1 protein_id gnl|my_center|LOCUS_05240 8457 8651 gene locus_tag LOCUS_05250 8457 8651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 9903 8728 gene locus_tag LOCUS_05260 9903 8728 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941722.1 protein_id gnl|my_center|LOCUS_05260 10007 10546 gene locus_tag LOCUS_05270 10007 10546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05270 10634 10996 gene locus_tag LOCUS_05280 10634 10996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05280 11027 11299 gene locus_tag LOCUS_05290 11027 11299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 11328 13175 gene locus_tag LOCUS_05300 11328 13175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 14543 13620 gene locus_tag LOCUS_05310 14543 13620 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707863.1 protein_id gnl|my_center|LOCUS_05310 17290 14675 gene locus_tag LOCUS_05320 17290 14675 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942226.1 protein_id gnl|my_center|LOCUS_05320 >Feature sequence026 429 3500 gene locus_tag LOCUS_05330 gene fdnG 429 3500 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941441.1 transl_except (pos:984..986,aa:Sec) note codon on position 186 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_05330 3504 4301 gene locus_tag LOCUS_05340 gene fdxH 3504 4301 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693893.1 protein_id gnl|my_center|LOCUS_05340 4291 4929 gene locus_tag LOCUS_05350 4291 4929 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880649.1 protein_id gnl|my_center|LOCUS_05350 6603 4966 gene locus_tag LOCUS_05360 6603 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 9848 6741 gene locus_tag LOCUS_05370 9848 6741 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_05370 10971 9865 gene locus_tag LOCUS_05380 10971 9865 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_05380 12408 10984 gene locus_tag LOCUS_05390 12408 10984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 12973 12401 gene locus_tag LOCUS_05400 12973 12401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 15560 13140 gene locus_tag LOCUS_05410 15560 13140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 17005 15719 gene locus_tag LOCUS_05420 17005 15719 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545699.1 protein_id gnl|my_center|LOCUS_05420 >Feature sequence027 1245 169 gene locus_tag LOCUS_05430 1245 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 3258 2668 gene locus_tag LOCUS_05440 3258 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 3893 3285 gene locus_tag LOCUS_05450 3893 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 5000 4398 gene locus_tag LOCUS_05460 5000 4398 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_05460 6582 5359 gene locus_tag LOCUS_05470 6582 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 8759 6621 gene locus_tag LOCUS_05480 8759 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 10606 8756 gene locus_tag LOCUS_05490 10606 8756 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517762.1 protein_id gnl|my_center|LOCUS_05490 11223 12242 gene locus_tag LOCUS_05500 gene aroF 11223 12242 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943764.1 protein_id gnl|my_center|LOCUS_05500 12469 12999 gene locus_tag LOCUS_05510 12469 12999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 12986 13252 gene locus_tag LOCUS_05520 12986 13252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 13294 13770 gene locus_tag LOCUS_05530 gene moaC 13294 13770 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393624.1 protein_id gnl|my_center|LOCUS_05530 14594 13980 gene locus_tag LOCUS_05540 gene tmk 14594 13980 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932982.1 protein_id gnl|my_center|LOCUS_05540 <17125 14591 gene locus_tag LOCUS_05550 <17125 14591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941243.1:pyruvate, phosphate dikinase >Feature sequence028 2253 1420 gene locus_tag LOCUS_05560 2253 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 3357 2395 gene locus_tag LOCUS_05570 3357 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 4160 3354 gene locus_tag LOCUS_05580 4160 3354 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038826.1 protein_id gnl|my_center|LOCUS_05580 5182 4157 gene locus_tag LOCUS_05590 5182 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 6320 5154 gene locus_tag LOCUS_05600 gene waaF 6320 5154 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_05600 6994 6632 gene locus_tag LOCUS_05610 6994 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 8939 7107 gene locus_tag LOCUS_05620 8939 7107 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_05620 9620 9330 gene locus_tag LOCUS_05630 9620 9330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 10094 9675 gene locus_tag LOCUS_05640 10094 9675 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867144.1 protein_id gnl|my_center|LOCUS_05640 10483 10085 gene locus_tag LOCUS_05650 10483 10085 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391729.1 protein_id gnl|my_center|LOCUS_05650 11749 10616 gene locus_tag LOCUS_05660 11749 10616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 12240 13271 gene locus_tag LOCUS_05670 gene hflK 12240 13271 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_05670 13264 14208 gene locus_tag LOCUS_05680 gene hflC 13264 14208 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_05680 14767 14375 gene locus_tag LOCUS_05690 14767 14375 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229267.1 protein_id gnl|my_center|LOCUS_05690 15000 14764 gene locus_tag LOCUS_05700 15000 14764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 15369 15190 gene locus_tag LOCUS_05710 15369 15190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 15504 15839 gene locus_tag LOCUS_05720 15504 15839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05720 17059 16283 gene locus_tag LOCUS_05730 17059 16283 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 protein_id gnl|my_center|LOCUS_05730 >Feature sequence029 896 800 gene locus_tag LOCUS_t00040 896 800 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 2033 3823 gene locus_tag LOCUS_05740 2033 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 3920 5677 gene locus_tag LOCUS_05750 3920 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 5884 6402 gene locus_tag LOCUS_05760 5884 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 6455 6640 gene locus_tag LOCUS_05770 6455 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 6756 7535 gene locus_tag LOCUS_05780 gene surE 6756 7535 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404579.1 protein_id gnl|my_center|LOCUS_05780 7525 8214 gene locus_tag LOCUS_05790 gene rnc 7525 8214 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557292.1 protein_id gnl|my_center|LOCUS_05790 8211 9230 gene locus_tag LOCUS_05800 8211 9230 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942867.1 protein_id gnl|my_center|LOCUS_05800 9227 11662 gene locus_tag LOCUS_05810 9227 11662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 11665 14409 gene locus_tag LOCUS_05820 11665 14409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 14411 15292 gene locus_tag LOCUS_05830 gene era 14411 15292 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 protein_id gnl|my_center|LOCUS_05830 15289 16638 gene locus_tag LOCUS_05840 gene der 15289 16638 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_05840 >Feature sequence030 109 2067 gene locus_tag LOCUS_05850 109 2067 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_05850 2115 2993 gene locus_tag LOCUS_05860 2115 2993 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227944.1 protein_id gnl|my_center|LOCUS_05860 3007 4077 gene locus_tag LOCUS_05870 3007 4077 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463596.1 protein_id gnl|my_center|LOCUS_05870 4096 4899 gene locus_tag LOCUS_05880 4096 4899 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_05880 5070 6326 gene locus_tag LOCUS_05890 5070 6326 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256967.1 protein_id gnl|my_center|LOCUS_05890 6550 7986 gene locus_tag LOCUS_05900 6550 7986 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_05900 8403 8633 gene locus_tag LOCUS_05910 8403 8633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 8641 9036 gene locus_tag LOCUS_05920 8641 9036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 9038 9745 gene locus_tag LOCUS_05930 9038 9745 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_05930 9787 10140 gene locus_tag LOCUS_05940 gene atpE 9787 10140 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792634.1 protein_id gnl|my_center|LOCUS_05940 10216 10446 gene locus_tag LOCUS_05950 10216 10446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 11222 10980 gene locus_tag LOCUS_05960 11222 10980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 13015 11270 gene locus_tag LOCUS_05970 gene flgK 13015 11270 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616092.1 protein_id gnl|my_center|LOCUS_05970 13439 13017 gene locus_tag LOCUS_05980 13439 13017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 13723 13445 gene locus_tag LOCUS_05990 13723 13445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 14076 13795 gene locus_tag LOCUS_06000 14076 13795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 15161 14073 gene locus_tag LOCUS_06010 15161 14073 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937822.1 protein_id gnl|my_center|LOCUS_06010 15865 15170 gene locus_tag LOCUS_06020 15865 15170 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545249.1 protein_id gnl|my_center|LOCUS_06020 <16793 15876 gene locus_tag LOCUS_06030 <16793 15876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211436.1:flagellar basal body P-ring formation chaperone FlgA >Feature sequence031 965 591 gene locus_tag LOCUS_06040 965 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 1441 1650 gene locus_tag LOCUS_06050 1441 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 1813 4311 gene locus_tag LOCUS_06060 1813 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 4347 5726 gene locus_tag LOCUS_06070 gene atoC 4347 5726 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125281.1 protein_id gnl|my_center|LOCUS_06070 6026 6301 gene locus_tag LOCUS_06080 6026 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 6396 6632 gene locus_tag LOCUS_06090 6396 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 7055 7942 gene locus_tag LOCUS_06100 7055 7942 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_06100 8262 8906 gene locus_tag LOCUS_06110 8262 8906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 8958 9536 gene locus_tag LOCUS_06120 8958 9536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 9694 9620 gene locus_tag LOCUS_t00050 9694 9620 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11803 9848 gene locus_tag LOCUS_06130 11803 9848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 12428 11808 gene locus_tag LOCUS_06140 12428 11808 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545344.1 protein_id gnl|my_center|LOCUS_06140 12735 12577 gene locus_tag LOCUS_06150 12735 12577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 12686 13120 gene locus_tag LOCUS_06160 12686 13120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 14115 13108 gene locus_tag LOCUS_06170 14115 13108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 15000 14134 gene locus_tag LOCUS_06180 15000 14134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 16212 15265 gene locus_tag LOCUS_06190 16212 15265 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879220.1 protein_id gnl|my_center|LOCUS_06190 16641 16234 gene locus_tag LOCUS_06200 16641 16234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 >Feature sequence032 67 621 gene locus_tag LOCUS_06210 67 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 615 1109 gene locus_tag LOCUS_06220 615 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 2263 1358 gene locus_tag LOCUS_06230 2263 1358 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926019.1 protein_id gnl|my_center|LOCUS_06230 2602 3138 gene locus_tag LOCUS_06240 2602 3138 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_06240 3153 3335 gene locus_tag LOCUS_06250 gene rpmF 3153 3335 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_06250 3339 4184 gene locus_tag LOCUS_06260 gene fabD 3339 4184 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017020093.1 protein_id gnl|my_center|LOCUS_06260 4181 4921 gene locus_tag LOCUS_06270 gene fabG 4181 4921 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 protein_id gnl|my_center|LOCUS_06270 4945 5178 gene locus_tag LOCUS_06280 gene acpP 4945 5178 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545237.1 protein_id gnl|my_center|LOCUS_06280 5187 6413 gene locus_tag LOCUS_06290 gene fabF 5187 6413 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_06290 6417 6860 gene locus_tag LOCUS_06300 gene rpiB 6417 6860 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_06300 6881 8122 gene locus_tag LOCUS_06310 6881 8122 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_06310 8125 8589 gene locus_tag LOCUS_06320 gene nrdR 8125 8589 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_06320 8586 9653 gene locus_tag LOCUS_06330 gene ribD 8586 9653 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_06330 9815 10450 gene locus_tag LOCUS_06340 9815 10450 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_06340 10462 11664 gene locus_tag LOCUS_06350 10462 11664 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_06350 11665 12141 gene locus_tag LOCUS_06360 gene ribE 11665 12141 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358088.1 protein_id gnl|my_center|LOCUS_06360 12155 12559 gene locus_tag LOCUS_06370 gene nusB 12155 12559 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460271.1 protein_id gnl|my_center|LOCUS_06370 12564 13109 gene locus_tag LOCUS_06380 12564 13109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 13106 14476 gene locus_tag LOCUS_06390 gene trkA 13106 14476 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 protein_id gnl|my_center|LOCUS_06390 14476 15918 gene locus_tag LOCUS_06400 14476 15918 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545413.1 protein_id gnl|my_center|LOCUS_06400 16616 15984 gene locus_tag LOCUS_06410 16616 15984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 >Feature sequence033 2684 2241 gene locus_tag LOCUS_06420 2684 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 3106 2684 gene locus_tag LOCUS_06430 3106 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 3745 3119 gene locus_tag LOCUS_06440 3745 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 4180 3758 gene locus_tag LOCUS_06450 4180 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 5234 4218 gene locus_tag LOCUS_06460 5234 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 5209 5835 gene locus_tag LOCUS_06470 5209 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 6566 6153 gene locus_tag LOCUS_06480 6566 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 7712 6804 gene locus_tag LOCUS_06490 7712 6804 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_06490 8560 7715 gene locus_tag LOCUS_06500 8560 7715 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546654.1 protein_id gnl|my_center|LOCUS_06500 9278 8736 gene locus_tag LOCUS_06510 gene rimI 9278 8736 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288446.1 protein_id gnl|my_center|LOCUS_06510 10078 9398 gene locus_tag LOCUS_06520 10078 9398 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071854933.1 protein_id gnl|my_center|LOCUS_06520 10563 10075 gene locus_tag LOCUS_06530 10563 10075 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002301684.1 protein_id gnl|my_center|LOCUS_06530 10973 10560 gene locus_tag LOCUS_06540 10973 10560 CDS product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942528.1 protein_id gnl|my_center|LOCUS_06540 11857 10988 gene locus_tag LOCUS_06550 gene rapZ 11857 10988 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942529.1 protein_id gnl|my_center|LOCUS_06550 13234 11954 gene locus_tag LOCUS_06560 gene thiC 13234 11954 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941266.1 protein_id gnl|my_center|LOCUS_06560 14259 13231 gene locus_tag LOCUS_06570 14259 13231 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173891.1 protein_id gnl|my_center|LOCUS_06570 15035 14259 gene locus_tag LOCUS_06580 15035 14259 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061316.1 protein_id gnl|my_center|LOCUS_06580 15421 15726 gene locus_tag LOCUS_06590 15421 15726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 >Feature sequence034 1362 130 gene locus_tag LOCUS_06600 1362 130 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037198907.1 protein_id gnl|my_center|LOCUS_06600 1498 2304 gene locus_tag LOCUS_06610 1498 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 2304 4430 gene locus_tag LOCUS_06620 2304 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 4427 5107 gene locus_tag LOCUS_06630 4427 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 5094 5456 gene locus_tag LOCUS_06640 5094 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 6183 5536 gene locus_tag LOCUS_06650 6183 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 6410 6174 gene locus_tag LOCUS_06660 6410 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 6539 7456 gene locus_tag LOCUS_06670 6539 7456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 7453 8148 gene locus_tag LOCUS_06680 7453 8148 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_06680 9128 8235 gene locus_tag LOCUS_06690 9128 8235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 10447 9137 gene locus_tag LOCUS_06700 10447 9137 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392504.1 protein_id gnl|my_center|LOCUS_06700 12101 10452 gene locus_tag LOCUS_06710 12101 10452 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392505.1 protein_id gnl|my_center|LOCUS_06710 13204 12098 gene locus_tag LOCUS_06720 13204 12098 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207036.1 protein_id gnl|my_center|LOCUS_06720 15234 13426 gene locus_tag LOCUS_06730 15234 13426 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080425.1 protein_id gnl|my_center|LOCUS_06730 15663 16400 gene locus_tag LOCUS_06740 15663 16400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 >Feature sequence035 113 769 gene locus_tag LOCUS_06750 113 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 1690 1034 gene locus_tag LOCUS_06760 1690 1034 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800040.1 protein_id gnl|my_center|LOCUS_06760 2487 2666 gene locus_tag LOCUS_06770 2487 2666 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360265.1 protein_id gnl|my_center|LOCUS_06770 2641 3891 gene locus_tag LOCUS_06780 2641 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 3920 5260 gene locus_tag LOCUS_06790 3920 5260 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228947.1 protein_id gnl|my_center|LOCUS_06790 6083 5385 gene locus_tag LOCUS_06800 6083 5385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 6288 6497 gene locus_tag LOCUS_06810 6288 6497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 7243 6554 gene locus_tag LOCUS_06820 gene cmk 7243 6554 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546614.1 protein_id gnl|my_center|LOCUS_06820 8484 7240 gene locus_tag LOCUS_06830 gene aroA 8484 7240 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880997.1 protein_id gnl|my_center|LOCUS_06830 9295 8468 gene locus_tag LOCUS_06840 9295 8468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 10386 9292 gene locus_tag LOCUS_06850 gene hisC 10386 9292 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_06850 11459 10383 gene locus_tag LOCUS_06860 gene pheA 11459 10383 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_06860 11593 11835 gene locus_tag LOCUS_06870 11593 11835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 11841 12122 gene locus_tag LOCUS_06880 11841 12122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 12361 12924 gene locus_tag LOCUS_06890 12361 12924 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881124.1 protein_id gnl|my_center|LOCUS_06890 12929 14482 gene locus_tag LOCUS_06900 gene rny 12929 14482 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_06900 14575 15762 gene locus_tag LOCUS_06910 gene tyrS 14575 15762 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546544.1 protein_id gnl|my_center|LOCUS_06910 >Feature sequence036 1046 138 gene locus_tag LOCUS_06920 gene secF 1046 138 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085009790.1 protein_id gnl|my_center|LOCUS_06920 2624 1056 gene locus_tag LOCUS_06930 gene secD 2624 1056 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943255.1 protein_id gnl|my_center|LOCUS_06930 2975 2658 gene locus_tag LOCUS_06940 gene yajC 2975 2658 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943256.1 protein_id gnl|my_center|LOCUS_06940 4083 2968 gene locus_tag LOCUS_06950 gene tgt 4083 2968 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_06950 5065 4058 gene locus_tag LOCUS_06960 gene queA 5065 4058 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770726.1 protein_id gnl|my_center|LOCUS_06960 5269 5072 gene locus_tag LOCUS_06970 5269 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 6323 5286 gene locus_tag LOCUS_06980 6323 5286 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_06980 6518 6441 gene locus_tag LOCUS_t00060 6518 6441 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 6607 6533 gene locus_tag LOCUS_t00070 6607 6533 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6906 6631 gene locus_tag LOCUS_06990 6906 6631 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943754.1 protein_id gnl|my_center|LOCUS_06990 9269 7005 gene locus_tag LOCUS_07000 gene lon 9269 7005 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942434.1 protein_id gnl|my_center|LOCUS_07000 10586 9333 gene locus_tag LOCUS_07010 gene clpX 10586 9333 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_07010 11199 10573 gene locus_tag LOCUS_07020 gene clpP 11199 10573 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925383.1 protein_id gnl|my_center|LOCUS_07020 12496 11165 gene locus_tag LOCUS_07030 gene tig 12496 11165 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942437.1 protein_id gnl|my_center|LOCUS_07030 13334 12576 gene locus_tag LOCUS_07040 13334 12576 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_07040 14179 13439 gene locus_tag LOCUS_07050 14179 13439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 15083 14349 gene locus_tag LOCUS_07060 15083 14349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 15664 15080 gene locus_tag LOCUS_07070 15664 15080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 16202 15666 gene locus_tag LOCUS_07080 16202 15666 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_07080 >Feature sequence037 <1 978 gene locus_tag LOCUS_07090 <1 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074212.1:polysaccharide deacetylase family protein 2007 1015 gene locus_tag LOCUS_07100 2007 1015 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045033.1 protein_id gnl|my_center|LOCUS_07100 4488 2092 gene locus_tag LOCUS_07110 4488 2092 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_07110 4669 4893 gene locus_tag LOCUS_07120 4669 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 4940 6637 gene locus_tag LOCUS_07130 gene ilvB 4940 6637 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545836.1 protein_id gnl|my_center|LOCUS_07130 6648 7145 gene locus_tag LOCUS_07140 gene ilvN 6648 7145 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_07140 7142 8158 gene locus_tag LOCUS_07150 gene ilvC 7142 8158 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942554.1 protein_id gnl|my_center|LOCUS_07150 8159 8767 gene locus_tag LOCUS_07160 8159 8767 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086577.1 protein_id gnl|my_center|LOCUS_07160 8770 9543 gene locus_tag LOCUS_07170 gene pssA 8770 9543 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_07170 9497 11050 gene locus_tag LOCUS_07180 9497 11050 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_07180 11479 12744 gene locus_tag LOCUS_07190 gene leuC 11479 12744 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545762.1 protein_id gnl|my_center|LOCUS_07190 12741 13235 gene locus_tag LOCUS_07200 gene leuD 12741 13235 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544917.1 protein_id gnl|my_center|LOCUS_07200 13232 14290 gene locus_tag LOCUS_07210 gene leuB 13232 14290 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880105.1 protein_id gnl|my_center|LOCUS_07210 14291 15289 gene locus_tag LOCUS_07220 14291 15289 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_07220 15446 16222 gene locus_tag LOCUS_07230 15446 16222 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869898.1 protein_id gnl|my_center|LOCUS_07230 >Feature sequence038 86 724 gene locus_tag LOCUS_07240 86 724 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460312.1 protein_id gnl|my_center|LOCUS_07240 2598 721 gene locus_tag LOCUS_07250 gene selB 2598 721 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_07250 2948 3571 gene locus_tag LOCUS_07260 2948 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 3799 4098 gene locus_tag LOCUS_07270 3799 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 5248 4091 gene locus_tag LOCUS_07280 5248 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 5738 5211 gene locus_tag LOCUS_07290 5738 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 6145 5738 gene locus_tag LOCUS_07300 6145 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 6362 6132 gene locus_tag LOCUS_07310 6362 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 6533 7003 gene locus_tag LOCUS_07320 6533 7003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 10225 7160 gene locus_tag LOCUS_07330 10225 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 10769 10362 gene locus_tag LOCUS_07340 10769 10362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 11941 10829 gene locus_tag LOCUS_07350 11941 10829 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080946.1 protein_id gnl|my_center|LOCUS_07350 13264 12329 gene locus_tag LOCUS_07360 13264 12329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 13836 13453 gene locus_tag LOCUS_07370 13836 13453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 14122 13925 gene locus_tag LOCUS_07380 14122 13925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 14905 14411 gene locus_tag LOCUS_07390 14905 14411 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943377.1 protein_id gnl|my_center|LOCUS_07390 15832 15176 gene locus_tag LOCUS_07400 15832 15176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879725.1 protein_id gnl|my_center|LOCUS_07400 >Feature sequence039 127 315 gene locus_tag LOCUS_07410 127 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 1752 373 gene locus_tag LOCUS_07420 1752 373 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_07420 2810 1749 gene locus_tag LOCUS_07430 2810 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 4950 2812 gene locus_tag LOCUS_07440 4950 2812 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924828.1 protein_id gnl|my_center|LOCUS_07440 6352 4994 gene locus_tag LOCUS_07450 6352 4994 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_07450 7556 6282 gene locus_tag LOCUS_07460 7556 6282 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_07460 9095 8001 gene locus_tag LOCUS_07470 9095 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 10574 9162 gene locus_tag LOCUS_07480 10574 9162 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879446.1 protein_id gnl|my_center|LOCUS_07480 10969 11733 gene locus_tag LOCUS_07490 10969 11733 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085820.1 protein_id gnl|my_center|LOCUS_07490 12548 11820 gene locus_tag LOCUS_07500 12548 11820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 15562 13046 gene locus_tag LOCUS_07510 15562 13046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 >Feature sequence040 722 180 gene locus_tag LOCUS_07520 722 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 1699 719 gene locus_tag LOCUS_07530 1699 719 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634619.1 protein_id gnl|my_center|LOCUS_07530 5337 1834 gene locus_tag LOCUS_07540 gene smc 5337 1834 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 protein_id gnl|my_center|LOCUS_07540 5597 5908 gene locus_tag LOCUS_07550 5597 5908 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941530.1 protein_id gnl|my_center|LOCUS_07550 5923 6261 gene locus_tag LOCUS_07560 5923 6261 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249719.1 protein_id gnl|my_center|LOCUS_07560 7003 6422 gene locus_tag LOCUS_07570 7003 6422 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228227.1 protein_id gnl|my_center|LOCUS_07570 7603 7277 gene locus_tag LOCUS_07580 7603 7277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 7605 7883 gene locus_tag LOCUS_07590 7605 7883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 9599 8160 gene locus_tag LOCUS_07600 9599 8160 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258188.1 protein_id gnl|my_center|LOCUS_07600 10857 9565 gene locus_tag LOCUS_07610 gene hisD 10857 9565 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220532.1 protein_id gnl|my_center|LOCUS_07610 12119 10854 gene locus_tag LOCUS_07620 gene murA 12119 10854 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_07620 12966 12112 gene locus_tag LOCUS_07630 gene prmC 12966 12112 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_07630 14033 12966 gene locus_tag LOCUS_07640 gene prfA 14033 12966 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_07640 14267 14043 gene locus_tag LOCUS_07650 gene rpmE 14267 14043 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_07650 15530 14283 gene locus_tag LOCUS_07660 gene rho 15530 14283 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_07660 15996 15688 gene locus_tag LOCUS_07670 15996 15688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 >Feature sequence041 2952 1600 gene locus_tag LOCUS_07680 2952 1600 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_07680 3837 5126 gene locus_tag LOCUS_07690 3837 5126 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731311.1 protein_id gnl|my_center|LOCUS_07690 5113 5838 gene locus_tag LOCUS_07700 5113 5838 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_07700 5828 7012 gene locus_tag LOCUS_07710 5828 7012 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_07710 7126 7728 gene locus_tag LOCUS_07720 7126 7728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 7810 9459 gene locus_tag LOCUS_07730 7810 9459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 10278 9628 gene locus_tag LOCUS_07740 10278 9628 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192781106.1 protein_id gnl|my_center|LOCUS_07740 11475 10978 gene locus_tag LOCUS_07750 11475 10978 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270458.1 protein_id gnl|my_center|LOCUS_07750 12676 11501 gene locus_tag LOCUS_07760 12676 11501 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224426.1 protein_id gnl|my_center|LOCUS_07760 13165 12689 gene locus_tag LOCUS_07770 13165 12689 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270458.1 protein_id gnl|my_center|LOCUS_07770 14323 13184 gene locus_tag LOCUS_07780 14323 13184 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064172.1 protein_id gnl|my_center|LOCUS_07780 15156 14587 gene locus_tag LOCUS_07790 gene gmhA 15156 14587 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390355.1 protein_id gnl|my_center|LOCUS_07790 15605 15324 gene locus_tag LOCUS_07800 15605 15324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 >Feature sequence042 1053 247 gene locus_tag LOCUS_07810 1053 247 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941804.1 protein_id gnl|my_center|LOCUS_07810 1688 1068 gene locus_tag LOCUS_07820 1688 1068 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902963.1 protein_id gnl|my_center|LOCUS_07820 2300 1692 gene locus_tag LOCUS_07830 2300 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 4152 2407 gene locus_tag LOCUS_07840 4152 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 5541 4513 gene locus_tag LOCUS_07850 5541 4513 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941806.1 protein_id gnl|my_center|LOCUS_07850 6152 5685 gene locus_tag LOCUS_07860 6152 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 6531 6142 gene locus_tag LOCUS_07870 6531 6142 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941071.1 protein_id gnl|my_center|LOCUS_07870 7397 6537 gene locus_tag LOCUS_07880 7397 6537 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_07880 7894 7394 gene locus_tag LOCUS_07890 7894 7394 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425085.1 protein_id gnl|my_center|LOCUS_07890 8644 8105 gene locus_tag LOCUS_07900 8644 8105 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941953.1 protein_id gnl|my_center|LOCUS_07900 11292 8725 gene locus_tag LOCUS_07910 11292 8725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 11480 11713 gene locus_tag LOCUS_07920 11480 11713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 12895 12101 gene locus_tag LOCUS_07930 12895 12101 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940643.1 protein_id gnl|my_center|LOCUS_07930 13521 12955 gene locus_tag LOCUS_07940 13521 12955 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545477.1 protein_id gnl|my_center|LOCUS_07940 13749 14789 gene locus_tag LOCUS_07950 13749 14789 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141484866.1 protein_id gnl|my_center|LOCUS_07950 >Feature sequence043 750 226 gene locus_tag LOCUS_07960 750 226 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880135.1 protein_id gnl|my_center|LOCUS_07960 1238 843 gene locus_tag LOCUS_07970 1238 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 1700 2464 gene locus_tag LOCUS_07980 1700 2464 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392933.1 protein_id gnl|my_center|LOCUS_07980 2555 3454 gene locus_tag LOCUS_07990 gene moaA 2555 3454 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_07990 3953 3462 gene locus_tag LOCUS_08000 3953 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 5515 4037 gene locus_tag LOCUS_08010 5515 4037 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249895.1 protein_id gnl|my_center|LOCUS_08010 5706 6218 gene locus_tag LOCUS_08020 gene hpt 5706 6218 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416006.1 protein_id gnl|my_center|LOCUS_08020 6222 7091 gene locus_tag LOCUS_08030 6222 7091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 7082 8101 gene locus_tag LOCUS_08040 7082 8101 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_08040 8103 8516 gene locus_tag LOCUS_08050 gene ruvX 8103 8516 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221192.1 protein_id gnl|my_center|LOCUS_08050 8712 8581 gene locus_tag LOCUS_08060 8712 8581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 8711 9508 gene locus_tag LOCUS_08070 8711 9508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 9697 10311 gene locus_tag LOCUS_08080 9697 10311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 10312 11745 gene locus_tag LOCUS_08090 10312 11745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 12250 11732 gene locus_tag LOCUS_08100 12250 11732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 12355 13320 gene locus_tag LOCUS_08110 gene waaC 12355 13320 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_08110 13308 14978 gene locus_tag LOCUS_08120 13308 14978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence044 729 11183 gene locus_tag LOCUS_08130 729 11183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 >Feature sequence045 297 836 gene locus_tag LOCUS_08140 297 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08140 1152 2846 gene locus_tag LOCUS_08150 1152 2846 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061055.1 protein_id gnl|my_center|LOCUS_08150 3077 5476 gene locus_tag LOCUS_08160 3077 5476 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 protein_id gnl|my_center|LOCUS_08160 6335 7087 gene locus_tag LOCUS_08170 6335 7087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 7084 7842 gene locus_tag LOCUS_08180 gene accD 7084 7842 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887858.1 protein_id gnl|my_center|LOCUS_08180 7833 8990 gene locus_tag LOCUS_08190 gene folC 7833 8990 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043123896.1 protein_id gnl|my_center|LOCUS_08190 8978 11047 gene locus_tag LOCUS_08200 gene lptD 8978 11047 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943003.1 protein_id gnl|my_center|LOCUS_08200 11092 11622 gene locus_tag LOCUS_08210 11092 11622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 12630 11551 gene locus_tag LOCUS_08220 12630 11551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 13381 12632 gene locus_tag LOCUS_08230 13381 12632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 14193 13378 gene locus_tag LOCUS_08240 14193 13378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 14519 14190 gene locus_tag LOCUS_08250 14519 14190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 >Feature sequence046 1218 2507 gene locus_tag LOCUS_08260 1218 2507 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940001.1 protein_id gnl|my_center|LOCUS_08260 2837 2634 gene locus_tag LOCUS_08270 2837 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 3429 4277 gene locus_tag LOCUS_08280 gene mpgP 3429 4277 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228324.1 protein_id gnl|my_center|LOCUS_08280 4270 5487 gene locus_tag LOCUS_08290 4270 5487 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_08290 5526 7025 gene locus_tag LOCUS_08300 gene glpA 5526 7025 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211491.1 protein_id gnl|my_center|LOCUS_08300 7117 8301 gene locus_tag LOCUS_08310 gene glpB 7117 8301 CDS product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259131.1 protein_id gnl|my_center|LOCUS_08310 8298 9566 gene locus_tag LOCUS_08320 gene glpC 8298 9566 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263142.1 protein_id gnl|my_center|LOCUS_08320 9505 11373 gene locus_tag LOCUS_08330 9505 11373 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582597.1 protein_id gnl|my_center|LOCUS_08330 11400 11723 gene locus_tag LOCUS_08340 11400 11723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 11890 13260 gene locus_tag LOCUS_08350 gene atoC 11890 13260 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125298.1 protein_id gnl|my_center|LOCUS_08350 <15127 13247 gene locus_tag LOCUS_08360 <15127 13247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870328.1:CHASE4 domain-containing protein >Feature sequence047 53 2083 gene locus_tag LOCUS_08370 53 2083 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461059.1 protein_id gnl|my_center|LOCUS_08370 5122 2729 gene locus_tag LOCUS_08380 5122 2729 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082594.1 protein_id gnl|my_center|LOCUS_08380 6033 5182 gene locus_tag LOCUS_08390 6033 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 6974 6105 gene locus_tag LOCUS_08400 6974 6105 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731590.1 protein_id gnl|my_center|LOCUS_08400 7451 11602 gene locus_tag LOCUS_08410 7451 11602 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924811.1 protein_id gnl|my_center|LOCUS_08410 11772 13076 gene locus_tag LOCUS_08420 11772 13076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 13333 13073 gene locus_tag LOCUS_08430 13333 13073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 14720 13350 gene locus_tag LOCUS_08440 14720 13350 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_08440 15056 14751 gene locus_tag LOCUS_08450 15056 14751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 >Feature sequence048 1009 557 gene locus_tag LOCUS_08460 1009 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 1183 2364 gene locus_tag LOCUS_08470 gene nifS 1183 2364 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_08470 2564 3529 gene locus_tag LOCUS_08480 2564 3529 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_08480 3611 4066 gene locus_tag LOCUS_08490 3611 4066 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878466.1 protein_id gnl|my_center|LOCUS_08490 4088 5224 gene locus_tag LOCUS_08500 4088 5224 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064172.1 protein_id gnl|my_center|LOCUS_08500 5236 6429 gene locus_tag LOCUS_08510 5236 6429 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877713.1 protein_id gnl|my_center|LOCUS_08510 6459 6929 gene locus_tag LOCUS_08520 6459 6929 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270458.1 protein_id gnl|my_center|LOCUS_08520 6997 7473 gene locus_tag LOCUS_08530 6997 7473 CDS product YiiD C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114565.1 protein_id gnl|my_center|LOCUS_08530 7584 9257 gene locus_tag LOCUS_08540 7584 9257 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228698.1 protein_id gnl|my_center|LOCUS_08540 10679 9528 gene locus_tag LOCUS_08550 10679 9528 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_08550 11926 10928 gene locus_tag LOCUS_08560 11926 10928 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225688.1 protein_id gnl|my_center|LOCUS_08560 12041 11919 gene locus_tag LOCUS_08570 12041 11919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 12290 13786 gene locus_tag LOCUS_08580 12290 13786 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926897.1 protein_id gnl|my_center|LOCUS_08580 13800 14957 gene locus_tag LOCUS_08590 13800 14957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence049 339 824 gene locus_tag LOCUS_08600 339 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1125 1406 gene locus_tag LOCUS_08610 1125 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 1420 2478 gene locus_tag LOCUS_08620 gene pilM 1420 2478 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_08620 2472 3005 gene locus_tag LOCUS_08630 2472 3005 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942674.1 protein_id gnl|my_center|LOCUS_08630 3014 3595 gene locus_tag LOCUS_08640 3014 3595 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942673.1 protein_id gnl|my_center|LOCUS_08640 3592 4116 gene locus_tag LOCUS_08650 3592 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 4118 5965 gene locus_tag LOCUS_08660 gene pilQ 4118 5965 CDS product type 4a pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114575.1 protein_id gnl|my_center|LOCUS_08660 5976 7154 gene locus_tag LOCUS_08670 5976 7154 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987090.1 protein_id gnl|my_center|LOCUS_08670 7269 7889 gene locus_tag LOCUS_08680 7269 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 7904 9718 gene locus_tag LOCUS_08690 gene ftsH 7904 9718 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_08690 9675 10898 gene locus_tag LOCUS_08700 gene folP 9675 10898 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582989.1 protein_id gnl|my_center|LOCUS_08700 10981 11433 gene locus_tag LOCUS_08710 gene tsaE 10981 11433 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722335.1 protein_id gnl|my_center|LOCUS_08710 11462 12697 gene locus_tag LOCUS_08720 11462 12697 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_08720 12690 14270 gene locus_tag LOCUS_08730 gene cimA 12690 14270 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942443.1 protein_id gnl|my_center|LOCUS_08730 14472 14729 gene locus_tag LOCUS_08740 14472 14729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 >Feature sequence050 129 755 gene locus_tag LOCUS_08750 129 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 1175 747 gene locus_tag LOCUS_08760 1175 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 1879 1448 gene locus_tag LOCUS_08770 1879 1448 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_08770 2428 1883 gene locus_tag LOCUS_08780 2428 1883 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869337.1 protein_id gnl|my_center|LOCUS_08780 3184 2438 gene locus_tag LOCUS_08790 3184 2438 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546413.1 protein_id gnl|my_center|LOCUS_08790 4251 3181 gene locus_tag LOCUS_08800 4251 3181 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545833.1 protein_id gnl|my_center|LOCUS_08800 4456 4241 gene locus_tag LOCUS_08810 4456 4241 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082295.1 protein_id gnl|my_center|LOCUS_08810 4666 5955 gene locus_tag LOCUS_08820 4666 5955 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878693.1 protein_id gnl|my_center|LOCUS_08820 7375 6005 gene locus_tag LOCUS_08830 7375 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 8446 7625 gene locus_tag LOCUS_08840 gene rsmA 8446 7625 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475602.1 protein_id gnl|my_center|LOCUS_08840 9504 8443 gene locus_tag LOCUS_08850 gene tsaD 9504 8443 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942510.1 protein_id gnl|my_center|LOCUS_08850 10934 9507 gene locus_tag LOCUS_08860 10934 9507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 11617 10931 gene locus_tag LOCUS_08870 11617 10931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 12774 11602 gene locus_tag LOCUS_08880 12774 11602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 13406 12870 gene locus_tag LOCUS_08890 gene pyrE 13406 12870 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942282.1 protein_id gnl|my_center|LOCUS_08890 14700 13399 gene locus_tag LOCUS_08900 gene purB 14700 13399 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942277.1 protein_id gnl|my_center|LOCUS_08900 >Feature sequence051 1168 581 gene locus_tag LOCUS_08910 1168 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 2195 1218 gene locus_tag LOCUS_08920 2195 1218 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_08920 3128 2211 gene locus_tag LOCUS_08930 3128 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 3482 3850 gene locus_tag LOCUS_08940 3482 3850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 5360 4437 gene locus_tag LOCUS_08950 5360 4437 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868277.1 protein_id gnl|my_center|LOCUS_08950 6884 5379 gene locus_tag LOCUS_08960 6884 5379 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060802.1 protein_id gnl|my_center|LOCUS_08960 9181 7220 gene locus_tag LOCUS_08970 9181 7220 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897930.1 protein_id gnl|my_center|LOCUS_08970 10019 9573 gene locus_tag LOCUS_08980 10019 9573 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_08980 11899 10592 gene locus_tag LOCUS_08990 11899 10592 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021591.1 protein_id gnl|my_center|LOCUS_08990 13734 12472 gene locus_tag LOCUS_09000 13734 12472 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023489.1 protein_id gnl|my_center|LOCUS_09000 14297 14034 gene locus_tag LOCUS_09010 14297 14034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 14551 14294 gene locus_tag LOCUS_09020 14551 14294 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140617.1 protein_id gnl|my_center|LOCUS_09020 14762 14556 gene locus_tag LOCUS_09030 14762 14556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 >Feature sequence052 396 572 gene locus_tag LOCUS_09040 396 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 583 819 gene locus_tag LOCUS_09050 583 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 816 971 gene locus_tag LOCUS_09060 816 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 1604 1038 gene locus_tag LOCUS_09070 1604 1038 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_09070 1769 2095 gene locus_tag LOCUS_09080 1769 2095 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391577.1 protein_id gnl|my_center|LOCUS_09080 2097 2711 gene locus_tag LOCUS_09090 gene recR 2097 2711 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225425.1 protein_id gnl|my_center|LOCUS_09090 2727 4010 gene locus_tag LOCUS_09100 2727 4010 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_09100 4166 5254 gene locus_tag LOCUS_09110 gene flgL 4166 5254 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_09110 5264 5701 gene locus_tag LOCUS_09120 gene fliW 5264 5701 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510650.1 protein_id gnl|my_center|LOCUS_09120 7767 6127 gene locus_tag LOCUS_09130 7767 6127 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947960.1 protein_id gnl|my_center|LOCUS_09130 8103 8297 gene locus_tag LOCUS_09140 8103 8297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 8318 9118 gene locus_tag LOCUS_09150 8318 9118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 9093 9947 gene locus_tag LOCUS_09160 gene nadC 9093 9947 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_09160 9934 10968 gene locus_tag LOCUS_09170 gene nadA 9934 10968 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389688.1 protein_id gnl|my_center|LOCUS_09170 10965 12590 gene locus_tag LOCUS_09180 gene nadB 10965 12590 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939096.1 protein_id gnl|my_center|LOCUS_09180 12839 13831 gene locus_tag LOCUS_09190 12839 13831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 13951 14712 gene locus_tag LOCUS_09200 13951 14712 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239224.1 protein_id gnl|my_center|LOCUS_09200 >Feature sequence053 1123 329 gene locus_tag LOCUS_09210 1123 329 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544947.1 protein_id gnl|my_center|LOCUS_09210 4286 1683 gene locus_tag LOCUS_09220 4286 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 5297 4491 gene locus_tag LOCUS_09230 5297 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 7492 5420 gene locus_tag LOCUS_09240 7492 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 8952 7549 gene locus_tag LOCUS_09250 8952 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 10202 8955 gene locus_tag LOCUS_09260 10202 8955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 11076 10921 gene locus_tag LOCUS_09270 11076 10921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 13071 11080 gene locus_tag LOCUS_09280 13071 11080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 13434 13658 gene locus_tag LOCUS_09290 13434 13658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 13782 13982 gene locus_tag LOCUS_09300 13782 13982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 13985 14320 gene locus_tag LOCUS_09310 13985 14320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 14535 14747 gene locus_tag LOCUS_09320 14535 14747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 >Feature sequence054 2227 1382 gene locus_tag LOCUS_09330 2227 1382 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942919.1 protein_id gnl|my_center|LOCUS_09330 2507 2851 gene locus_tag LOCUS_09340 2507 2851 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256377.1 protein_id gnl|my_center|LOCUS_09340 4086 2848 gene locus_tag LOCUS_09350 4086 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 5386 4286 gene locus_tag LOCUS_09360 gene dnaJ 5386 4286 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940501.1 protein_id gnl|my_center|LOCUS_09360 5577 5383 gene locus_tag LOCUS_09370 gene rpoZ 5577 5383 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942877.1 protein_id gnl|my_center|LOCUS_09370 7133 5844 gene locus_tag LOCUS_09380 7133 5844 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941850.1 protein_id gnl|my_center|LOCUS_09380 8184 7165 gene locus_tag LOCUS_09390 gene fbp 8184 7165 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939127.1 protein_id gnl|my_center|LOCUS_09390 9540 12890 gene locus_tag LOCUS_09400 9540 12890 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065207.1 protein_id gnl|my_center|LOCUS_09400 12913 13203 gene locus_tag LOCUS_09410 12913 13203 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583654.1 protein_id gnl|my_center|LOCUS_09410 13200 13559 gene locus_tag LOCUS_09420 13200 13559 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence055 670 134 gene locus_tag LOCUS_09430 670 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 1093 716 gene locus_tag LOCUS_09440 1093 716 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015574.1 protein_id gnl|my_center|LOCUS_09440 2590 1163 gene locus_tag LOCUS_09450 gene hutW 2590 1163 CDS product heme anaerobic degradation radical SAM methyltransferase ChuW/HutW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209066.1 protein_id gnl|my_center|LOCUS_09450 3585 2782 gene locus_tag LOCUS_09460 3585 2782 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693940.1 protein_id gnl|my_center|LOCUS_09460 4904 3618 gene locus_tag LOCUS_09470 4904 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 5551 4901 gene locus_tag LOCUS_09480 5551 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 5964 5548 gene locus_tag LOCUS_09490 5964 5548 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_09490 6532 5978 gene locus_tag LOCUS_09500 6532 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 7968 6583 gene locus_tag LOCUS_09510 7968 6583 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 protein_id gnl|my_center|LOCUS_09510 8735 7965 gene locus_tag LOCUS_09520 8735 7965 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881338.1 protein_id gnl|my_center|LOCUS_09520 9642 8797 gene locus_tag LOCUS_09530 9642 8797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 10841 9786 gene locus_tag LOCUS_09540 10841 9786 CDS product DUF4857 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939655.1 protein_id gnl|my_center|LOCUS_09540 12611 11724 gene locus_tag LOCUS_09550 12611 11724 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767082.1 protein_id gnl|my_center|LOCUS_09550 13636 12890 gene locus_tag LOCUS_09560 13636 12890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 13892 13653 gene locus_tag LOCUS_09570 13892 13653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 >Feature sequence056 1291 374 gene locus_tag LOCUS_09580 1291 374 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_09580 1533 2912 gene locus_tag LOCUS_09590 gene thrC 1533 2912 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791440.1 protein_id gnl|my_center|LOCUS_09590 2914 3510 gene locus_tag LOCUS_09600 2914 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 3530 4699 gene locus_tag LOCUS_09610 gene metK 3530 4699 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_09610 4699 5955 gene locus_tag LOCUS_09620 gene ahcY 4699 5955 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_09620 6274 7158 gene locus_tag LOCUS_09630 6274 7158 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_09630 7161 9005 gene locus_tag LOCUS_09640 gene dxs 7161 9005 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_09640 9002 9739 gene locus_tag LOCUS_09650 9002 9739 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544951.1 protein_id gnl|my_center|LOCUS_09650 9736 11367 gene locus_tag LOCUS_09660 gene ispH 9736 11367 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011417689.1 protein_id gnl|my_center|LOCUS_09660 11651 12217 gene locus_tag LOCUS_09670 11651 12217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 12257 13432 gene locus_tag LOCUS_09680 12257 13432 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207481.1 protein_id gnl|my_center|LOCUS_09680 13772 13894 gene locus_tag LOCUS_09690 13772 13894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 >Feature sequence057 333 1103 gene locus_tag LOCUS_09700 333 1103 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_09700 1100 1963 gene locus_tag LOCUS_09710 1100 1963 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_09710 2139 3395 gene locus_tag LOCUS_09720 gene dnaN 2139 3395 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_09720 3496 5922 gene locus_tag LOCUS_09730 gene gyrB 3496 5922 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995225.1 protein_id gnl|my_center|LOCUS_09730 5958 8390 gene locus_tag LOCUS_09740 gene gyrA 5958 8390 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723770.1 protein_id gnl|my_center|LOCUS_09740 8505 9224 gene locus_tag LOCUS_09750 8505 9224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 10138 9332 gene locus_tag LOCUS_09760 10138 9332 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942280.1 protein_id gnl|my_center|LOCUS_09760 13101 10141 gene locus_tag LOCUS_09770 13101 10141 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942279.1 protein_id gnl|my_center|LOCUS_09770 13771 13106 gene locus_tag LOCUS_09780 13771 13106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence058 532 858 gene locus_tag LOCUS_09790 532 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 862 1575 gene locus_tag LOCUS_09800 862 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 2010 1786 gene locus_tag LOCUS_09810 2010 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 2373 2146 gene locus_tag LOCUS_09820 2373 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 2522 3628 gene locus_tag LOCUS_09830 2522 3628 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965718.1 protein_id gnl|my_center|LOCUS_09830 3931 4308 gene locus_tag LOCUS_09840 3931 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 5148 4528 gene locus_tag LOCUS_09850 5148 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 5728 5336 gene locus_tag LOCUS_09860 5728 5336 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941941.1 protein_id gnl|my_center|LOCUS_09860 5948 5748 gene locus_tag LOCUS_09870 5948 5748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 6556 6044 gene locus_tag LOCUS_09880 6556 6044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 7881 6655 gene locus_tag LOCUS_09890 7881 6655 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227995.1 protein_id gnl|my_center|LOCUS_09890 9447 8743 gene locus_tag LOCUS_09900 9447 8743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 11450 9453 gene locus_tag LOCUS_09910 gene uvrB 11450 9453 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_09910 13734 11854 gene locus_tag LOCUS_09920 13734 11854 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_09920 >Feature sequence059 663 379 gene locus_tag LOCUS_09930 663 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 1150 1566 gene locus_tag LOCUS_09940 1150 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1559 2218 gene locus_tag LOCUS_09950 1559 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 2396 3550 gene locus_tag LOCUS_09960 2396 3550 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257896.1 protein_id gnl|my_center|LOCUS_09960 3625 4014 gene locus_tag LOCUS_09970 3625 4014 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_09970 4173 4087 gene locus_tag LOCUS_t00080 4173 4087 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4252 5187 gene locus_tag LOCUS_09980 4252 5187 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942133.1 protein_id gnl|my_center|LOCUS_09980 5184 5888 gene locus_tag LOCUS_09990 5184 5888 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883244.1 protein_id gnl|my_center|LOCUS_09990 7637 6036 gene locus_tag LOCUS_10000 7637 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 8306 7650 gene locus_tag LOCUS_10010 8306 7650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 9316 8873 gene locus_tag LOCUS_10020 9316 8873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 10865 9480 gene locus_tag LOCUS_10030 10865 9480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 11646 12359 gene locus_tag LOCUS_10040 11646 12359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 12731 12372 gene locus_tag LOCUS_10050 12731 12372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 13933 13223 gene locus_tag LOCUS_10060 13933 13223 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811089.1 protein_id gnl|my_center|LOCUS_10060 >Feature sequence060 75 1070 gene locus_tag LOCUS_10070 75 1070 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257103.1 protein_id gnl|my_center|LOCUS_10070 1067 2164 gene locus_tag LOCUS_10080 1067 2164 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_10080 2161 3273 gene locus_tag LOCUS_10090 2161 3273 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_10090 3296 3958 gene locus_tag LOCUS_10100 3296 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 3955 4521 gene locus_tag LOCUS_10110 3955 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 4521 5507 gene locus_tag LOCUS_10120 4521 5507 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926811.1 protein_id gnl|my_center|LOCUS_10120 6072 5479 gene locus_tag LOCUS_10130 6072 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 6173 7063 gene locus_tag LOCUS_10140 6173 7063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 7060 7983 gene locus_tag LOCUS_10150 7060 7983 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942605.1 protein_id gnl|my_center|LOCUS_10150 8982 8377 gene locus_tag LOCUS_10160 8982 8377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 10215 9496 gene locus_tag LOCUS_10170 10215 9496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 12232 10523 gene locus_tag LOCUS_10180 gene panP 12232 10523 CDS product putative pyridoxal-dependent aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071894.1 protein_id gnl|my_center|LOCUS_10180 12316 13155 gene locus_tag LOCUS_10190 gene rsmI 12316 13155 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546504.1 protein_id gnl|my_center|LOCUS_10190 13308 13571 gene locus_tag LOCUS_10200 13308 13571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence061 494 673 gene locus_tag LOCUS_10210 494 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 763 1902 gene locus_tag LOCUS_10220 763 1902 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065027.1 protein_id gnl|my_center|LOCUS_10220 3182 1911 gene locus_tag LOCUS_10230 3182 1911 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_10230 4104 3172 gene locus_tag LOCUS_10240 4104 3172 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_10240 4642 4088 gene locus_tag LOCUS_10250 gene pyrR 4642 4088 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172875.1 protein_id gnl|my_center|LOCUS_10250 5278 4652 gene locus_tag LOCUS_10260 gene lepB 5278 4652 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_10260 6339 5383 gene locus_tag LOCUS_10270 6339 5383 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029668.1 protein_id gnl|my_center|LOCUS_10270 7196 6324 gene locus_tag LOCUS_10280 gene rfbD 7196 6324 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023678.1 protein_id gnl|my_center|LOCUS_10280 8212 7193 gene locus_tag LOCUS_10290 gene rfbB 8212 7193 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_10290 8960 8229 gene locus_tag LOCUS_10300 8960 8229 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022168.1 protein_id gnl|my_center|LOCUS_10300 9829 9086 gene locus_tag LOCUS_10310 gene truA 9829 9086 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_10310 9877 10227 gene locus_tag LOCUS_10320 9877 10227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 11645 10386 gene locus_tag LOCUS_10330 11645 10386 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942239.1 protein_id gnl|my_center|LOCUS_10330 13732 11648 gene locus_tag LOCUS_10340 gene pnp 13732 11648 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545734.1 protein_id gnl|my_center|LOCUS_10340 >Feature sequence062 291 458 gene locus_tag LOCUS_10350 291 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 578 1579 gene locus_tag LOCUS_10360 578 1579 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878131.1 protein_id gnl|my_center|LOCUS_10360 1895 2806 gene locus_tag LOCUS_10370 1895 2806 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085668.1 protein_id gnl|my_center|LOCUS_10370 3256 2855 gene locus_tag LOCUS_10380 3256 2855 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974282.1 protein_id gnl|my_center|LOCUS_10380 4941 3745 gene locus_tag LOCUS_10390 4941 3745 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257342.1 protein_id gnl|my_center|LOCUS_10390 5354 5791 gene locus_tag LOCUS_10400 5354 5791 CDS product peptide chain release factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945928.1 protein_id gnl|my_center|LOCUS_10400 7438 6188 gene locus_tag LOCUS_10410 7438 6188 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868852.1 protein_id gnl|my_center|LOCUS_10410 7826 7901 gene locus_tag LOCUS_t00090 7826 7901 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8355 8086 gene locus_tag LOCUS_10420 8355 8086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 9218 8757 gene locus_tag LOCUS_10430 9218 8757 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_10430 9488 9327 gene locus_tag LOCUS_10440 9488 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 10238 9519 gene locus_tag LOCUS_10450 10238 9519 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_10450 11006 10257 gene locus_tag LOCUS_10460 11006 10257 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902529.1 protein_id gnl|my_center|LOCUS_10460 11235 11160 gene locus_tag LOCUS_t00100 11235 11160 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 13033 11264 gene locus_tag LOCUS_10470 13033 11264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 >Feature sequence063 1127 24 gene locus_tag LOCUS_10480 1127 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 2021 1302 gene locus_tag LOCUS_10490 2021 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 3218 2103 gene locus_tag LOCUS_10500 gene glf 3218 2103 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228271.1 protein_id gnl|my_center|LOCUS_10500 3636 4994 gene locus_tag LOCUS_10510 3636 4994 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226447.1 protein_id gnl|my_center|LOCUS_10510 6403 5084 gene locus_tag LOCUS_10520 6403 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 7778 6441 gene locus_tag LOCUS_10530 7778 6441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 9182 7854 gene locus_tag LOCUS_10540 9182 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 9420 10220 gene locus_tag LOCUS_10550 9420 10220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 10732 11877 gene locus_tag LOCUS_10560 gene norA 10732 11877 CDS product multidrug efflux MFS transporter NorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041274.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence064 1066 239 gene locus_tag LOCUS_10570 1066 239 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_10570 2049 1066 gene locus_tag LOCUS_10580 2049 1066 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_10580 3623 2046 gene locus_tag LOCUS_10590 3623 2046 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_10590 3967 6927 gene locus_tag LOCUS_10600 3967 6927 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943878.1 protein_id gnl|my_center|LOCUS_10600 6937 8226 gene locus_tag LOCUS_10610 6937 8226 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_10610 9850 8441 gene locus_tag LOCUS_10620 9850 8441 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_10620 10230 9952 gene locus_tag LOCUS_10630 10230 9952 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_10630 11015 10284 gene locus_tag LOCUS_10640 11015 10284 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056503.1 protein_id gnl|my_center|LOCUS_10640 11196 12380 gene locus_tag LOCUS_10650 11196 12380 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943373.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence065 275 823 gene locus_tag LOCUS_10660 275 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 827 1558 gene locus_tag LOCUS_10670 gene kdsB 827 1558 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545187.1 protein_id gnl|my_center|LOCUS_10670 1546 2787 gene locus_tag LOCUS_10680 1546 2787 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_10680 3260 3463 gene locus_tag LOCUS_10690 3260 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 4967 3678 gene locus_tag LOCUS_10700 4967 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 5129 7093 gene locus_tag LOCUS_10710 gene acs 5129 7093 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983589.1 protein_id gnl|my_center|LOCUS_10710 7191 7778 gene locus_tag LOCUS_10720 7191 7778 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742222.1 protein_id gnl|my_center|LOCUS_10720 7798 8568 gene locus_tag LOCUS_10730 7798 8568 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942026.1 protein_id gnl|my_center|LOCUS_10730 8605 9747 gene locus_tag LOCUS_10740 8605 9747 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064772.1 protein_id gnl|my_center|LOCUS_10740 9835 10617 gene locus_tag LOCUS_10750 9835 10617 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_10750 10635 11603 gene locus_tag LOCUS_10760 10635 11603 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence066 195 995 gene locus_tag LOCUS_10770 195 995 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941678.1 protein_id gnl|my_center|LOCUS_10770 2913 1054 gene locus_tag LOCUS_10780 2913 1054 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544993.1 protein_id gnl|my_center|LOCUS_10780 3853 2885 gene locus_tag LOCUS_10790 3853 2885 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644821.1 protein_id gnl|my_center|LOCUS_10790 4724 3810 gene locus_tag LOCUS_10800 4724 3810 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258828.1 protein_id gnl|my_center|LOCUS_10800 5116 7746 gene locus_tag LOCUS_10810 5116 7746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 7940 9856 gene locus_tag LOCUS_10820 7940 9856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 9889 11838 gene locus_tag LOCUS_10830 9889 11838 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201677.1 protein_id gnl|my_center|LOCUS_10830 11835 12758 gene locus_tag LOCUS_10840 gene queG 11835 12758 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480032.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence067 1481 366 gene locus_tag LOCUS_10850 1481 366 CDS product lmo2826 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990083.1 protein_id gnl|my_center|LOCUS_10850 2118 1474 gene locus_tag LOCUS_10860 2118 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 3788 2103 gene locus_tag LOCUS_10870 3788 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 4522 3773 gene locus_tag LOCUS_10880 4522 3773 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249615.1 protein_id gnl|my_center|LOCUS_10880 5535 4678 gene locus_tag LOCUS_10890 5535 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 6025 5528 gene locus_tag LOCUS_10900 6025 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 7528 6032 gene locus_tag LOCUS_10910 7528 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 8537 7539 gene locus_tag LOCUS_10920 8537 7539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 9291 8593 gene locus_tag LOCUS_10930 9291 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 9709 9347 gene locus_tag LOCUS_10940 9709 9347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 10166 9702 gene locus_tag LOCUS_10950 10166 9702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 10647 10198 gene locus_tag LOCUS_10960 gene gspG 10647 10198 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_10960 11886 10660 gene locus_tag LOCUS_10970 gene gspF 11886 10660 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940995.1 protein_id gnl|my_center|LOCUS_10970 12788 11898 gene locus_tag LOCUS_10980 12788 11898 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940694.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence068 203 279 gene locus_tag LOCUS_t00110 203 279 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 297 1313 gene locus_tag LOCUS_10990 gene rlmN 297 1313 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_10990 1310 2320 gene locus_tag LOCUS_11000 1310 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 2333 3205 gene locus_tag LOCUS_11010 2333 3205 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942094.1 protein_id gnl|my_center|LOCUS_11010 3323 3925 gene locus_tag LOCUS_11020 3323 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 4013 4792 gene locus_tag LOCUS_11030 4013 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 4802 5896 gene locus_tag LOCUS_11040 4802 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 7748 5877 gene locus_tag LOCUS_11050 gene mnmG 7748 5877 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546402.1 protein_id gnl|my_center|LOCUS_11050 8915 7935 gene locus_tag LOCUS_11060 8915 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 9997 8942 gene locus_tag LOCUS_11070 gene wecB 9997 8942 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_11070 10755 10234 gene locus_tag LOCUS_11080 10755 10234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 12423 10762 gene locus_tag LOCUS_11090 gene argS 12423 10762 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546374.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence069 <1 2698 gene locus_tag LOCUS_11100 <1 2698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930460.1:glycosyltransferase 2751 4040 gene locus_tag LOCUS_11110 2751 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 4037 6571 gene locus_tag LOCUS_11120 4037 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 6568 8427 gene locus_tag LOCUS_11130 6568 8427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 9714 8545 gene locus_tag LOCUS_11140 9714 8545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 10013 10705 gene locus_tag LOCUS_11150 10013 10705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 11020 12348 gene locus_tag LOCUS_11160 11020 12348 CDS product ISNCY-like element ISTde1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679811.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence070 1791 292 gene locus_tag LOCUS_11170 gene hflX 1791 292 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941674.1 protein_id gnl|my_center|LOCUS_11170 2423 1926 gene locus_tag LOCUS_11180 gene rfaH 2423 1926 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073081.1 protein_id gnl|my_center|LOCUS_11180 3551 2499 gene locus_tag LOCUS_11190 3551 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 4840 3548 gene locus_tag LOCUS_11200 4840 3548 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_11200 5411 6484 gene locus_tag LOCUS_11210 gene flhB 5411 6484 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392310.1 protein_id gnl|my_center|LOCUS_11210 6485 8554 gene locus_tag LOCUS_11220 gene flhA 6485 8554 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_11220 8544 9638 gene locus_tag LOCUS_11230 gene flhF 8544 9638 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965445.1 protein_id gnl|my_center|LOCUS_11230 9635 10531 gene locus_tag LOCUS_11240 9635 10531 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881781.1 protein_id gnl|my_center|LOCUS_11240 10509 11279 gene locus_tag LOCUS_11250 gene whiG 10509 11279 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_11250 11720 12109 gene locus_tag LOCUS_11260 11720 12109 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940486.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence071 719 1624 gene locus_tag LOCUS_11270 719 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11270 1621 1986 gene locus_tag LOCUS_11280 1621 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 3265 2468 gene locus_tag LOCUS_11290 gene larE 3265 2468 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080596.1 protein_id gnl|my_center|LOCUS_11290 4016 3249 gene locus_tag LOCUS_11300 gene larB 4016 3249 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080597.1 protein_id gnl|my_center|LOCUS_11300 5445 4273 gene locus_tag LOCUS_11310 gene larC 5445 4273 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_11310 6322 5660 gene locus_tag LOCUS_11320 6322 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 6460 8271 gene locus_tag LOCUS_11330 6460 8271 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114561.1 protein_id gnl|my_center|LOCUS_11330 11584 8384 gene locus_tag LOCUS_11340 gene carB 11584 8384 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence072 308 760 gene locus_tag LOCUS_11350 308 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 844 1782 gene locus_tag LOCUS_11360 gene meaB 844 1782 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_11360 1860 3593 gene locus_tag LOCUS_11370 1860 3593 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867965.1 protein_id gnl|my_center|LOCUS_11370 3622 4035 gene locus_tag LOCUS_11380 3622 4035 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846721.1 protein_id gnl|my_center|LOCUS_11380 4078 5685 gene locus_tag LOCUS_11390 4078 5685 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965213.1 protein_id gnl|my_center|LOCUS_11390 5747 6472 gene locus_tag LOCUS_11400 5747 6472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 6530 7858 gene locus_tag LOCUS_11410 6530 7858 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063670.1 protein_id gnl|my_center|LOCUS_11410 7892 8833 gene locus_tag LOCUS_11420 7892 8833 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903522.1 protein_id gnl|my_center|LOCUS_11420 8892 9689 gene locus_tag LOCUS_11430 8892 9689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 9714 10955 gene locus_tag LOCUS_11440 9714 10955 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461376.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence073 578 201 gene locus_tag LOCUS_11450 578 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 3184 938 gene locus_tag LOCUS_11460 3184 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 5727 3511 gene locus_tag LOCUS_11470 gene mrcB 5727 3511 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100154.1 protein_id gnl|my_center|LOCUS_11470 6493 6227 gene locus_tag LOCUS_11480 6493 6227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 6827 7480 gene locus_tag LOCUS_11490 6827 7480 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082103.1 protein_id gnl|my_center|LOCUS_11490 8926 7484 gene locus_tag LOCUS_11500 8926 7484 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546530.1 protein_id gnl|my_center|LOCUS_11500 9533 9129 gene locus_tag LOCUS_11510 9533 9129 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583624.1 protein_id gnl|my_center|LOCUS_11510 9688 11388 gene locus_tag LOCUS_11520 9688 11388 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_11520 >Feature sequence074 1366 164 gene locus_tag LOCUS_11530 1366 164 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087142.1 protein_id gnl|my_center|LOCUS_11530 2599 1451 gene locus_tag LOCUS_11540 2599 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 3396 2626 gene locus_tag LOCUS_11550 3396 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 3649 6816 gene locus_tag LOCUS_11560 3649 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 7331 8440 gene locus_tag LOCUS_11570 7331 8440 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877291.1 protein_id gnl|my_center|LOCUS_11570 8463 9659 gene locus_tag LOCUS_11580 8463 9659 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095742.1 protein_id gnl|my_center|LOCUS_11580 9692 10297 gene locus_tag LOCUS_11590 9692 10297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 10343 11524 gene locus_tag LOCUS_11600 10343 11524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence075 111 293 gene locus_tag LOCUS_11610 111 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 314 1132 gene locus_tag LOCUS_11620 314 1132 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846658.1 protein_id gnl|my_center|LOCUS_11620 1284 2834 gene locus_tag LOCUS_11630 1284 2834 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879425.1 protein_id gnl|my_center|LOCUS_11630 4229 3060 gene locus_tag LOCUS_11640 4229 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 5603 4230 gene locus_tag LOCUS_11650 5603 4230 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545342.1 protein_id gnl|my_center|LOCUS_11650 7061 5676 gene locus_tag LOCUS_11660 7061 5676 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066616.1 protein_id gnl|my_center|LOCUS_11660 7577 8344 gene locus_tag LOCUS_11670 gene cobB 7577 8344 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868319.1 protein_id gnl|my_center|LOCUS_11670 9035 8637 gene locus_tag LOCUS_11680 9035 8637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 >Feature sequence076 104 1744 gene locus_tag LOCUS_11690 104 1744 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261594.1 protein_id gnl|my_center|LOCUS_11690 2257 3366 gene locus_tag LOCUS_11700 2257 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 3440 4240 gene locus_tag LOCUS_11710 3440 4240 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600052.1 protein_id gnl|my_center|LOCUS_11710 4237 4674 gene locus_tag LOCUS_11720 4237 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 4658 5464 gene locus_tag LOCUS_11730 4658 5464 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974406.1 protein_id gnl|my_center|LOCUS_11730 5944 6135 gene locus_tag LOCUS_11740 5944 6135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 6132 6422 gene locus_tag LOCUS_11750 6132 6422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 6691 7380 gene locus_tag LOCUS_11760 6691 7380 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583790.1 protein_id gnl|my_center|LOCUS_11760 8174 7446 gene locus_tag LOCUS_11770 8174 7446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 8962 8225 gene locus_tag LOCUS_11780 8962 8225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 9803 8973 gene locus_tag LOCUS_11790 9803 8973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 10792 9800 gene locus_tag LOCUS_11800 10792 9800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 >Feature sequence077 1824 163 gene locus_tag LOCUS_11810 1824 163 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084529509.1 protein_id gnl|my_center|LOCUS_11810 3326 1890 gene locus_tag LOCUS_11820 3326 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 4971 3358 gene locus_tag LOCUS_11830 4971 3358 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957831.1 protein_id gnl|my_center|LOCUS_11830 6323 5166 gene locus_tag LOCUS_11840 6323 5166 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933143.1 protein_id gnl|my_center|LOCUS_11840 6568 8184 gene locus_tag LOCUS_11850 6568 8184 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980180.1 protein_id gnl|my_center|LOCUS_11850 8413 8694 gene locus_tag LOCUS_11860 8413 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 9704 8967 gene locus_tag LOCUS_11870 9704 8967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 9954 10235 gene locus_tag LOCUS_11880 9954 10235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 >Feature sequence078 1721 582 gene locus_tag LOCUS_11890 1721 582 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_11890 3039 1711 gene locus_tag LOCUS_11900 gene miaB 3039 1711 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942838.1 protein_id gnl|my_center|LOCUS_11900 3773 3333 gene locus_tag LOCUS_11910 3773 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 4057 3770 gene locus_tag LOCUS_11920 4057 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 4379 5671 gene locus_tag LOCUS_11930 gene asnS 4379 5671 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870400.1 protein_id gnl|my_center|LOCUS_11930 5784 5710 gene locus_tag LOCUS_t00120 5784 5710 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7490 5988 gene locus_tag LOCUS_11940 7490 5988 CDS product fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584080.1 protein_id gnl|my_center|LOCUS_11940 7796 7545 gene locus_tag LOCUS_11950 7796 7545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 9302 7938 gene locus_tag LOCUS_11960 9302 7938 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_11960 10314 10541 gene locus_tag LOCUS_11970 10314 10541 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312031.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence079 374 577 gene locus_tag LOCUS_11980 374 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 615 1751 gene locus_tag LOCUS_11990 615 1751 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879085.1 protein_id gnl|my_center|LOCUS_11990 2008 3144 gene locus_tag LOCUS_12000 2008 3144 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243008.1 protein_id gnl|my_center|LOCUS_12000 3160 4485 gene locus_tag LOCUS_12010 3160 4485 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901990.1 protein_id gnl|my_center|LOCUS_12010 4592 6049 gene locus_tag LOCUS_12020 gene abfD 4592 6049 CDS product 4-hydroxybutyryl-CoA dehydratase/vinylacetyl-CoA-Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_12020 6058 6360 gene locus_tag LOCUS_12030 6058 6360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 6662 6883 gene locus_tag LOCUS_12040 6662 6883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 6960 7247 gene locus_tag LOCUS_12050 6960 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 8016 7660 gene locus_tag LOCUS_12060 8016 7660 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546363.1 protein_id gnl|my_center|LOCUS_12060 8311 8009 gene locus_tag LOCUS_12070 8311 8009 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809266.1 protein_id gnl|my_center|LOCUS_12070 8487 9359 gene locus_tag LOCUS_12080 8487 9359 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816295.1 protein_id gnl|my_center|LOCUS_12080 10269 9928 gene locus_tag LOCUS_12090 10269 9928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 10421 10254 gene locus_tag LOCUS_12100 10421 10254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence080 227 1033 gene locus_tag LOCUS_12110 227 1033 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878847.1 protein_id gnl|my_center|LOCUS_12110 1115 1636 gene locus_tag LOCUS_12120 1115 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1633 3399 gene locus_tag LOCUS_12130 1633 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 5097 3490 gene locus_tag LOCUS_12140 5097 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 6532 5201 gene locus_tag LOCUS_12150 gene trmFO 6532 5201 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392541.1 protein_id gnl|my_center|LOCUS_12150 8852 6507 gene locus_tag LOCUS_12160 gene topA 8852 6507 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_12160 9997 8852 gene locus_tag LOCUS_12170 gene dprA 9997 8852 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_12170 10099 10172 gene locus_tag LOCUS_t00130 10099 10172 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 10180 10255 gene locus_tag LOCUS_t00140 10180 10255 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence081 357 1784 gene locus_tag LOCUS_12180 gene xseA 357 1784 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546335.1 protein_id gnl|my_center|LOCUS_12180 1781 2020 gene locus_tag LOCUS_12190 1781 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 2113 3255 gene locus_tag LOCUS_12200 2113 3255 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108945.1 protein_id gnl|my_center|LOCUS_12200 3252 3866 gene locus_tag LOCUS_12210 gene yihA 3252 3866 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709878.1 protein_id gnl|my_center|LOCUS_12210 5549 4080 gene locus_tag LOCUS_12220 gene nifS 5549 4080 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_12220 5944 5669 gene locus_tag LOCUS_12230 5944 5669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 6321 5926 gene locus_tag LOCUS_12240 6321 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 7033 6431 gene locus_tag LOCUS_12250 gene lpoB 7033 6431 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172966546.1 protein_id gnl|my_center|LOCUS_12250 7493 7053 gene locus_tag LOCUS_12260 7493 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 8909 7509 gene locus_tag LOCUS_12270 8909 7509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 9875 8922 gene locus_tag LOCUS_12280 9875 8922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 10446 9904 gene locus_tag LOCUS_12290 10446 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 >Feature sequence082 2039 321 gene locus_tag LOCUS_12300 2039 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 2798 2127 gene locus_tag LOCUS_12310 2798 2127 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973830.1 protein_id gnl|my_center|LOCUS_12310 3544 2792 gene locus_tag LOCUS_12320 3544 2792 CDS product thioesterase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964340.1 protein_id gnl|my_center|LOCUS_12320 4668 3925 gene locus_tag LOCUS_12330 4668 3925 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447223.1 protein_id gnl|my_center|LOCUS_12330 <10421 4744 gene locus_tag LOCUS_12340 <10421 4744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000503026.1:non-ribosomal peptide synthetase >Feature sequence083 1501 3066 gene locus_tag LOCUS_12350 1501 3066 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941270.1 protein_id gnl|my_center|LOCUS_12350 3343 3600 gene locus_tag LOCUS_12360 3343 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 4302 3547 gene locus_tag LOCUS_12370 gene trpA 4302 3547 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537932.1 protein_id gnl|my_center|LOCUS_12370 5450 4299 gene locus_tag LOCUS_12380 gene trpB 5450 4299 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082734.1 protein_id gnl|my_center|LOCUS_12380 6016 5447 gene locus_tag LOCUS_12390 6016 5447 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_12390 6774 6007 gene locus_tag LOCUS_12400 gene trpC 6774 6007 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 protein_id gnl|my_center|LOCUS_12400 7753 6749 gene locus_tag LOCUS_12410 gene trpD 7753 6749 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869732.1 protein_id gnl|my_center|LOCUS_12410 8328 7756 gene locus_tag LOCUS_12420 8328 7756 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880323.1 protein_id gnl|my_center|LOCUS_12420 9713 8325 gene locus_tag LOCUS_12430 gene trpE 9713 8325 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_12430 10047 10208 gene locus_tag LOCUS_12440 10047 10208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 >Feature sequence084 1582 98 gene locus_tag LOCUS_12450 1582 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1935 2010 gene locus_tag LOCUS_t00150 1935 2010 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2847 2398 gene locus_tag LOCUS_12460 2847 2398 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933604.1 protein_id gnl|my_center|LOCUS_12460 3078 2920 gene locus_tag LOCUS_12470 3078 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 3014 3664 gene locus_tag LOCUS_12480 3014 3664 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_12480 3672 4937 gene locus_tag LOCUS_12490 3672 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 4934 6550 gene locus_tag LOCUS_12500 4934 6550 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_12500 6552 7328 gene locus_tag LOCUS_12510 6552 7328 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546705.1 protein_id gnl|my_center|LOCUS_12510 7357 9543 gene locus_tag LOCUS_12520 7357 9543 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_12520 9536 10108 gene locus_tag LOCUS_12530 9536 10108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 >Feature sequence085 919 179 gene locus_tag LOCUS_12540 919 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1515 1664 gene locus_tag LOCUS_12550 1515 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1775 2488 gene locus_tag LOCUS_12560 1775 2488 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731358.1 protein_id gnl|my_center|LOCUS_12560 2640 2849 gene locus_tag LOCUS_12570 2640 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 2983 7131 gene locus_tag LOCUS_12580 2983 7131 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924811.1 protein_id gnl|my_center|LOCUS_12580 7133 8203 gene locus_tag LOCUS_12590 7133 8203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_12590 9087 8347 gene locus_tag LOCUS_12600 9087 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 9332 9150 gene locus_tag LOCUS_12610 9332 9150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence086 1072 350 gene locus_tag LOCUS_12620 gene hisA 1072 350 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545163.1 protein_id gnl|my_center|LOCUS_12620 1329 1075 gene locus_tag LOCUS_12630 1329 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 1907 1326 gene locus_tag LOCUS_12640 gene hisB 1907 1326 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879953.1 protein_id gnl|my_center|LOCUS_12640 4576 1907 gene locus_tag LOCUS_12650 gene alaS 4576 1907 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545089.1 protein_id gnl|my_center|LOCUS_12650 4773 4576 gene locus_tag LOCUS_12660 4773 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 6162 4990 gene locus_tag LOCUS_12670 6162 4990 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_12670 7193 6162 gene locus_tag LOCUS_12680 gene recA 7193 6162 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088499.1 protein_id gnl|my_center|LOCUS_12680 7749 7180 gene locus_tag LOCUS_12690 gene thpR 7749 7180 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583814.1 protein_id gnl|my_center|LOCUS_12690 8815 7715 gene locus_tag LOCUS_12700 8815 7715 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081038.1 protein_id gnl|my_center|LOCUS_12700 9261 8812 gene locus_tag LOCUS_12710 9261 8812 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932028.1 protein_id gnl|my_center|LOCUS_12710 9787 9272 gene locus_tag LOCUS_12720 9787 9272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 >Feature sequence087 327 31 gene locus_tag LOCUS_12730 327 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 750 1787 gene locus_tag LOCUS_12740 gene purM 750 1787 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_12740 1801 2454 gene locus_tag LOCUS_12750 gene purN 1801 2454 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_12750 2424 2900 gene locus_tag LOCUS_12760 2424 2900 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234960.1 protein_id gnl|my_center|LOCUS_12760 2897 4138 gene locus_tag LOCUS_12770 2897 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 4323 4901 gene locus_tag LOCUS_12780 4323 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 4898 5323 gene locus_tag LOCUS_12790 4898 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 5619 5386 gene locus_tag LOCUS_12800 5619 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 6256 5579 gene locus_tag LOCUS_12810 6256 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12810 7839 6595 gene locus_tag LOCUS_12820 7839 6595 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944609.1 protein_id gnl|my_center|LOCUS_12820 8796 7903 gene locus_tag LOCUS_12830 8796 7903 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783522.1 protein_id gnl|my_center|LOCUS_12830 9170 9892 gene locus_tag LOCUS_12840 9170 9892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence088 287 2305 gene locus_tag LOCUS_12850 287 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 2538 3587 gene locus_tag LOCUS_12860 2538 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 3637 4404 gene locus_tag LOCUS_12870 3637 4404 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203060.1 protein_id gnl|my_center|LOCUS_12870 5391 5630 gene locus_tag LOCUS_12880 5391 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 5620 6042 gene locus_tag LOCUS_12890 5620 6042 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391721.1 protein_id gnl|my_center|LOCUS_12890 6786 7076 gene locus_tag LOCUS_12900 6786 7076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 7057 7332 gene locus_tag LOCUS_12910 7057 7332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 7611 7853 gene locus_tag LOCUS_12920 7611 7853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 7850 8287 gene locus_tag LOCUS_12930 7850 8287 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404325.1 protein_id gnl|my_center|LOCUS_12930 8398 8676 gene locus_tag LOCUS_12940 8398 8676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 9232 9480 gene locus_tag LOCUS_12950 9232 9480 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106005636.1 protein_id gnl|my_center|LOCUS_12950 9461 9859 gene locus_tag LOCUS_12960 9461 9859 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393562.1 protein_id gnl|my_center|LOCUS_12960 >Feature sequence089 542 784 gene locus_tag LOCUS_12970 542 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 797 3127 gene locus_tag LOCUS_12980 797 3127 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940968.1 protein_id gnl|my_center|LOCUS_12980 3192 3746 gene locus_tag LOCUS_12990 3192 3746 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_12990 3753 3890 gene locus_tag LOCUS_13000 3753 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 3911 5779 gene locus_tag LOCUS_13010 3911 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 6041 6370 gene locus_tag LOCUS_13020 6041 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 6592 7098 gene locus_tag LOCUS_13030 6592 7098 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425085.1 protein_id gnl|my_center|LOCUS_13030 7095 7955 gene locus_tag LOCUS_13040 7095 7955 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_13040 7958 8347 gene locus_tag LOCUS_13050 7958 8347 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941071.1 protein_id gnl|my_center|LOCUS_13050 8337 8795 gene locus_tag LOCUS_13060 8337 8795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 8938 9966 gene locus_tag LOCUS_13070 8938 9966 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941806.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence090 376 2457 gene locus_tag LOCUS_13080 gene fusA 376 2457 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_13080 2447 2881 gene locus_tag LOCUS_13090 2447 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 2878 3363 gene locus_tag LOCUS_13100 gene mog 2878 3363 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943343.1 protein_id gnl|my_center|LOCUS_13100 3438 4889 gene locus_tag LOCUS_13110 3438 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 5479 4943 gene locus_tag LOCUS_13120 gene scpB 5479 4943 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259764.1 protein_id gnl|my_center|LOCUS_13120 6180 5479 gene locus_tag LOCUS_13130 6180 5479 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545170.1 protein_id gnl|my_center|LOCUS_13130 7182 6190 gene locus_tag LOCUS_13140 gene trpS 7182 6190 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942477.1 protein_id gnl|my_center|LOCUS_13140 7810 7196 gene locus_tag LOCUS_13150 7810 7196 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869499.1 protein_id gnl|my_center|LOCUS_13150 9016 8201 gene locus_tag LOCUS_13160 9016 8201 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892481.1 protein_id gnl|my_center|LOCUS_13160 9834 9013 gene locus_tag LOCUS_13170 gene cobB 9834 9013 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240270.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence091 1394 939 gene locus_tag LOCUS_13180 gene rplO 1394 939 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_13180 1577 1395 gene locus_tag LOCUS_13190 gene rpmD 1577 1395 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720933.1 protein_id gnl|my_center|LOCUS_13190 2099 1581 gene locus_tag LOCUS_13200 gene rpsE 2099 1581 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943469.1 protein_id gnl|my_center|LOCUS_13200 2480 2115 gene locus_tag LOCUS_13210 gene rplR 2480 2115 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_13210 3058 2501 gene locus_tag LOCUS_13220 gene rplF 3058 2501 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546082.1 protein_id gnl|my_center|LOCUS_13220 3444 3052 gene locus_tag LOCUS_13230 gene rpsH 3444 3052 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545222.1 protein_id gnl|my_center|LOCUS_13230 3645 3460 gene locus_tag LOCUS_13240 3645 3460 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583358.1 protein_id gnl|my_center|LOCUS_13240 4195 3656 gene locus_tag LOCUS_13250 gene rplE 4195 3656 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_13250 4536 4207 gene locus_tag LOCUS_13260 gene rplX 4536 4207 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_13260 4917 4549 gene locus_tag LOCUS_13270 gene rplN 4917 4549 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538009.1 protein_id gnl|my_center|LOCUS_13270 5241 4948 gene locus_tag LOCUS_13280 5241 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 5389 5189 gene locus_tag LOCUS_13290 5389 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 5801 5376 gene locus_tag LOCUS_13300 gene rplP 5801 5376 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545254.1 protein_id gnl|my_center|LOCUS_13300 6463 5816 gene locus_tag LOCUS_13310 gene rpsC 6463 5816 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393931.1 protein_id gnl|my_center|LOCUS_13310 6805 6473 gene locus_tag LOCUS_13320 gene rplV 6805 6473 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943481.1 protein_id gnl|my_center|LOCUS_13320 7095 6808 gene locus_tag LOCUS_13330 gene rpsS 7095 6808 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943482.1 protein_id gnl|my_center|LOCUS_13330 7920 7099 gene locus_tag LOCUS_13340 gene rplB 7920 7099 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393934.1 protein_id gnl|my_center|LOCUS_13340 8214 7924 gene locus_tag LOCUS_13350 8214 7924 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_13350 8834 8211 gene locus_tag LOCUS_13360 gene rplD 8834 8211 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_13360 9466 8837 gene locus_tag LOCUS_13370 gene rplC 9466 8837 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943486.1 protein_id gnl|my_center|LOCUS_13370 9793 9485 gene locus_tag LOCUS_13380 gene rpsJ 9793 9485 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_13380 >Feature sequence092 2 3322 gene locus_tag LOCUS_13390 2 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 3679 5598 gene locus_tag LOCUS_13400 3679 5598 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_13400 5710 7122 gene locus_tag LOCUS_13410 gene gltX 5710 7122 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941876.1 protein_id gnl|my_center|LOCUS_13410 7119 7640 gene locus_tag LOCUS_13420 7119 7640 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251052.1 protein_id gnl|my_center|LOCUS_13420 7612 8235 gene locus_tag LOCUS_13430 7612 8235 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_13430 8351 8494 gene locus_tag LOCUS_13440 8351 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 9476 8643 gene locus_tag LOCUS_13450 9476 8643 CDS product monoacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726751.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence093 311 580 gene locus_tag LOCUS_13460 311 580 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391712.1 protein_id gnl|my_center|LOCUS_13460 1765 1001 gene locus_tag LOCUS_13470 1765 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 2163 2945 gene locus_tag LOCUS_13480 2163 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 3569 2850 gene locus_tag LOCUS_13490 3569 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 4121 3708 gene locus_tag LOCUS_13500 gene accB 4121 3708 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545496.1 protein_id gnl|my_center|LOCUS_13500 4685 4122 gene locus_tag LOCUS_13510 gene efp 4685 4122 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_13510 6147 5083 gene locus_tag LOCUS_13520 6147 5083 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942664.1 protein_id gnl|my_center|LOCUS_13520 6574 6128 gene locus_tag LOCUS_13530 gene aroQ 6574 6128 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393049.1 protein_id gnl|my_center|LOCUS_13530 7080 6571 gene locus_tag LOCUS_13540 7080 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 8617 7058 gene locus_tag LOCUS_13550 8617 7058 CDS product bifunctional shikimate kinase/3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052140.1 protein_id gnl|my_center|LOCUS_13550 9747 8614 gene locus_tag LOCUS_13560 gene aroC 9747 8614 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583418.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence094 1992 1324 gene locus_tag LOCUS_13570 1992 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 4340 2697 gene locus_tag LOCUS_13580 gene groL 4340 2697 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545192.1 protein_id gnl|my_center|LOCUS_13580 4650 4363 gene locus_tag LOCUS_13590 gene groES 4650 4363 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_13590 5353 5277 gene locus_tag LOCUS_t00160 5353 5277 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6156 5365 gene locus_tag LOCUS_13600 6156 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 7225 6209 gene locus_tag LOCUS_13610 7225 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878828.1 protein_id gnl|my_center|LOCUS_13610 7480 9540 gene locus_tag LOCUS_13620 7480 9540 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257258.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence095 2000 1506 gene locus_tag LOCUS_13630 2000 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 2268 2546 gene locus_tag LOCUS_13640 2268 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 4908 4090 gene locus_tag LOCUS_13650 4908 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 6105 5218 gene locus_tag LOCUS_13660 6105 5218 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206791.1 protein_id gnl|my_center|LOCUS_13660 6612 6133 gene locus_tag LOCUS_13670 6612 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 7320 6661 gene locus_tag LOCUS_13680 gene deoC 7320 6661 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836882.1 protein_id gnl|my_center|LOCUS_13680 8302 7337 gene locus_tag LOCUS_13690 gene rbsK 8302 7337 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761960.1 protein_id gnl|my_center|LOCUS_13690 8501 8950 gene locus_tag LOCUS_13700 8501 8950 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546571.1 protein_id gnl|my_center|LOCUS_13700 9201 9434 gene locus_tag LOCUS_13710 9201 9434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 9407 9559 gene locus_tag LOCUS_13720 9407 9559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 >Feature sequence096 119 496 gene locus_tag LOCUS_13730 119 496 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974282.1 protein_id gnl|my_center|LOCUS_13730 522 824 gene locus_tag LOCUS_13740 522 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 811 1149 gene locus_tag LOCUS_13750 811 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1150 1821 gene locus_tag LOCUS_13760 gene atpB 1150 1821 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082076.1 protein_id gnl|my_center|LOCUS_13760 1832 3040 gene locus_tag LOCUS_13770 1832 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 3077 3325 gene locus_tag LOCUS_13780 3077 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 3340 3768 gene locus_tag LOCUS_13790 3340 3768 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940784.1 protein_id gnl|my_center|LOCUS_13790 3765 4343 gene locus_tag LOCUS_13800 gene atpF 3765 4343 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545851.1 protein_id gnl|my_center|LOCUS_13800 4340 4882 gene locus_tag LOCUS_13810 4340 4882 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425856.1 protein_id gnl|my_center|LOCUS_13810 4889 6403 gene locus_tag LOCUS_13820 gene atpA 4889 6403 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940787.1 protein_id gnl|my_center|LOCUS_13820 6413 7273 gene locus_tag LOCUS_13830 gene atpG 6413 7273 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940788.1 protein_id gnl|my_center|LOCUS_13830 7297 8703 gene locus_tag LOCUS_13840 gene atpD 7297 8703 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_13840 8719 9132 gene locus_tag LOCUS_13850 8719 9132 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence097 <1 2131 gene locus_tag LOCUS_13860 <1 2131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391787.1:S-layer homology domain-containing protein 2397 3356 gene locus_tag LOCUS_13870 2397 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 3536 5800 gene locus_tag LOCUS_13880 3536 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 5996 6532 gene locus_tag LOCUS_13890 5996 6532 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044348005.1 protein_id gnl|my_center|LOCUS_13890 6682 7257 gene locus_tag LOCUS_13900 6682 7257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 7254 7631 gene locus_tag LOCUS_13910 7254 7631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 8348 8827 gene locus_tag LOCUS_13920 gene tsaA 8348 8827 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868101.1 protein_id gnl|my_center|LOCUS_13920 9311 8997 gene locus_tag LOCUS_13930 9311 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence098 280 471 gene locus_tag LOCUS_13940 280 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940932.1 protein_id gnl|my_center|LOCUS_13940 802 930 gene locus_tag LOCUS_13950 802 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 1853 1059 gene locus_tag LOCUS_13960 1853 1059 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545987.1 protein_id gnl|my_center|LOCUS_13960 3359 1866 gene locus_tag LOCUS_13970 gene glpK 3359 1866 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_13970 3996 3451 gene locus_tag LOCUS_13980 3996 3451 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_13980 4651 4280 gene locus_tag LOCUS_13990 4651 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 4992 4621 gene locus_tag LOCUS_14000 gene fliS 4992 4621 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080180.1 protein_id gnl|my_center|LOCUS_14000 5135 6472 gene locus_tag LOCUS_14010 5135 6472 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938066.1 protein_id gnl|my_center|LOCUS_14010 7840 6677 gene locus_tag LOCUS_14020 7840 6677 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_14020 8433 7864 gene locus_tag LOCUS_14030 gene coaD 8433 7864 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583503.1 protein_id gnl|my_center|LOCUS_14030 8792 8367 gene locus_tag LOCUS_14040 gene rsmD 8792 8367 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence099 1882 170 gene locus_tag LOCUS_14050 1882 170 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879591.1 protein_id gnl|my_center|LOCUS_14050 2735 1935 gene locus_tag LOCUS_14060 2735 1935 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_14060 3601 2993 gene locus_tag LOCUS_14070 3601 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 3987 5411 gene locus_tag LOCUS_14080 3987 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 5428 6645 gene locus_tag LOCUS_14090 5428 6645 CDS product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373755.1 protein_id gnl|my_center|LOCUS_14090 6817 8055 gene locus_tag LOCUS_14100 6817 8055 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813994.1 protein_id gnl|my_center|LOCUS_14100 8818 8078 gene locus_tag LOCUS_14110 8818 8078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 >Feature sequence100 417 1154 gene locus_tag LOCUS_14120 417 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1461 2252 gene locus_tag LOCUS_14130 1461 2252 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123954.1 protein_id gnl|my_center|LOCUS_14130 2440 2748 gene locus_tag LOCUS_14140 2440 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 2873 4027 gene locus_tag LOCUS_14150 2873 4027 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486144.1 protein_id gnl|my_center|LOCUS_14150 4147 4572 gene locus_tag LOCUS_14160 gene arfB 4147 4572 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090218.1 protein_id gnl|my_center|LOCUS_14160 4634 5164 gene locus_tag LOCUS_14170 4634 5164 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021158.1 protein_id gnl|my_center|LOCUS_14170 5742 5170 gene locus_tag LOCUS_14180 5742 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 6160 6582 gene locus_tag LOCUS_14190 6160 6582 CDS product DUF2914 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044869.1 protein_id gnl|my_center|LOCUS_14190 6995 7324 gene locus_tag LOCUS_14200 6995 7324 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405056.1 protein_id gnl|my_center|LOCUS_14200 7395 8816 gene locus_tag LOCUS_14210 7395 8816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence101 411 172 gene locus_tag LOCUS_14220 411 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 1034 408 gene locus_tag LOCUS_14230 gene rpoE 1034 408 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420724.1 protein_id gnl|my_center|LOCUS_14230 2536 1034 gene locus_tag LOCUS_14240 gene gcvPB 2536 1034 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583868.1 protein_id gnl|my_center|LOCUS_14240 3816 2515 gene locus_tag LOCUS_14250 gene gcvPA 3816 2515 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_14250 4206 3817 gene locus_tag LOCUS_14260 gene gcvH 4206 3817 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964219.1 protein_id gnl|my_center|LOCUS_14260 5302 4223 gene locus_tag LOCUS_14270 gene gcvT 5302 4223 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398598.1 protein_id gnl|my_center|LOCUS_14270 6155 5313 gene locus_tag LOCUS_14280 6155 5313 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941524.1 protein_id gnl|my_center|LOCUS_14280 6813 6145 gene locus_tag LOCUS_14290 6813 6145 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941525.1 protein_id gnl|my_center|LOCUS_14290 7661 6810 gene locus_tag LOCUS_14300 gene folD 7661 6810 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941526.1 protein_id gnl|my_center|LOCUS_14300 8763 7702 gene locus_tag LOCUS_14310 8763 7702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 >Feature sequence102 450 941 gene locus_tag LOCUS_14320 gene ahbB 450 941 CDS product siroheme decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064915.1 protein_id gnl|my_center|LOCUS_14320 956 2233 gene locus_tag LOCUS_14330 gene hemL 956 2233 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880497.1 protein_id gnl|my_center|LOCUS_14330 4655 2223 gene locus_tag LOCUS_14340 gene lon 4655 2223 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_14340 6182 4824 gene locus_tag LOCUS_14350 6182 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 7697 7023 gene locus_tag LOCUS_14360 gene tsaB 7697 7023 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640977.1 protein_id gnl|my_center|LOCUS_14360 8774 7701 gene locus_tag LOCUS_14370 gene rseP 8774 7701 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545838.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence103 98 235 gene locus_tag LOCUS_14380 98 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1320 643 gene locus_tag LOCUS_14390 1320 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 1493 2098 gene locus_tag LOCUS_14400 1493 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 2310 3881 gene locus_tag LOCUS_14410 gene purH 2310 3881 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_14410 3892 5181 gene locus_tag LOCUS_14420 gene purD 3892 5181 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_14420 5178 5669 gene locus_tag LOCUS_14430 gene purE 5178 5669 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147124.1 protein_id gnl|my_center|LOCUS_14430 5663 6262 gene locus_tag LOCUS_14440 5663 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 6340 6759 gene locus_tag LOCUS_14450 6340 6759 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279177.1 protein_id gnl|my_center|LOCUS_14450 6887 7729 gene locus_tag LOCUS_14460 6887 7729 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206432.1 protein_id gnl|my_center|LOCUS_14460 7783 9030 gene locus_tag LOCUS_14470 7783 9030 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_14470 >Feature sequence104 973 437 gene locus_tag LOCUS_14480 973 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 1140 2582 gene locus_tag LOCUS_14490 gene pyk 1140 2582 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249466.1 protein_id gnl|my_center|LOCUS_14490 5609 3084 gene locus_tag LOCUS_14500 5609 3084 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928482.1 protein_id gnl|my_center|LOCUS_14500 7082 5769 gene locus_tag LOCUS_14510 7082 5769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 8776 7544 gene locus_tag LOCUS_14520 8776 7544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence105 665 165 gene locus_tag LOCUS_14530 665 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 2233 653 gene locus_tag LOCUS_14540 2233 653 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_14540 3578 2226 gene locus_tag LOCUS_14550 3578 2226 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_14550 5768 3582 gene locus_tag LOCUS_14560 5768 3582 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_14560 6550 5789 gene locus_tag LOCUS_14570 gene lpxC 6550 5789 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859351.1 protein_id gnl|my_center|LOCUS_14570 6745 7416 gene locus_tag LOCUS_14580 gene pgeF 6745 7416 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940760.1 protein_id gnl|my_center|LOCUS_14580 7386 7997 gene locus_tag LOCUS_14590 gene coaE 7386 7997 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 protein_id gnl|my_center|LOCUS_14590 <9174 8521 gene locus_tag LOCUS_14600 <9174 8521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965594.1:PLP-dependent aminotransferase family protein >Feature sequence106 2760 205 gene locus_tag LOCUS_14610 gene polA 2760 205 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_14610 3708 2797 gene locus_tag LOCUS_14620 3708 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 4355 3708 gene locus_tag LOCUS_14630 4355 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 5710 4352 gene locus_tag LOCUS_14640 5710 4352 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391671.1 protein_id gnl|my_center|LOCUS_14640 5855 5685 gene locus_tag LOCUS_14650 5855 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 6865 5852 gene locus_tag LOCUS_14660 gene amrS 6865 5852 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 protein_id gnl|my_center|LOCUS_14660 8533 6875 gene locus_tag LOCUS_14670 gene ilvD 8533 6875 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940628.1 protein_id gnl|my_center|LOCUS_14670 >Feature sequence107 1296 211 gene locus_tag LOCUS_14680 1296 211 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940825.1 protein_id gnl|my_center|LOCUS_14680 1696 1313 gene locus_tag LOCUS_14690 1696 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 2256 1945 gene locus_tag LOCUS_14700 2256 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 4305 2380 gene locus_tag LOCUS_14710 4305 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 5325 4378 gene locus_tag LOCUS_14720 5325 4378 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942288.1 protein_id gnl|my_center|LOCUS_14720 8114 5487 gene locus_tag LOCUS_14730 8114 5487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 8974 8120 gene locus_tag LOCUS_14740 8974 8120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence108 2312 1440 gene locus_tag LOCUS_14750 gene lipA 2312 1440 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_14750 3064 2378 gene locus_tag LOCUS_14760 gene lipB 3064 2378 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405264.1 protein_id gnl|my_center|LOCUS_14760 3846 3097 gene locus_tag LOCUS_14770 3846 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 5201 3930 gene locus_tag LOCUS_14780 5201 3930 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_14780 5770 5252 gene locus_tag LOCUS_14790 5770 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 6992 5844 gene locus_tag LOCUS_14800 6992 5844 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083842.1 protein_id gnl|my_center|LOCUS_14800 8198 7020 gene locus_tag LOCUS_14810 8198 7020 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897303.1 protein_id gnl|my_center|LOCUS_14810 <9098 8305 gene locus_tag LOCUS_14820 <9098 8305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949165.1:dihydrolipoyl dehydrogenase >Feature sequence109 2248 1346 gene locus_tag LOCUS_14830 2248 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 3016 3255 gene locus_tag LOCUS_14840 3016 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 3550 3332 gene locus_tag LOCUS_14850 3550 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 4450 4689 gene locus_tag LOCUS_14860 4450 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 4984 4766 gene locus_tag LOCUS_14870 4984 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 6000 5029 gene locus_tag LOCUS_14880 6000 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 7997 7011 gene locus_tag LOCUS_14890 7997 7011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 8773 8024 gene locus_tag LOCUS_14900 8773 8024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 >Feature sequence110 719 399 gene locus_tag LOCUS_14910 gene rsfS 719 399 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_14910 1349 720 gene locus_tag LOCUS_14920 gene nadD 1349 720 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943828.1 protein_id gnl|my_center|LOCUS_14920 2599 1346 gene locus_tag LOCUS_14930 2599 1346 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545857.1 protein_id gnl|my_center|LOCUS_14930 3741 2599 gene locus_tag LOCUS_14940 gene proB 3741 2599 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_14940 4917 3892 gene locus_tag LOCUS_14950 4917 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 5178 4921 gene locus_tag LOCUS_14960 gene rpmA 5178 4921 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943850.1 protein_id gnl|my_center|LOCUS_14960 5501 5181 gene locus_tag LOCUS_14970 gene rplU 5501 5181 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229668.1 protein_id gnl|my_center|LOCUS_14970 5875 7308 gene locus_tag LOCUS_14980 5875 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence111 1051 77 gene locus_tag LOCUS_14990 1051 77 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975792.1 protein_id gnl|my_center|LOCUS_14990 2941 1199 gene locus_tag LOCUS_15000 2941 1199 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940408.1 protein_id gnl|my_center|LOCUS_15000 3257 5002 gene locus_tag LOCUS_15010 3257 5002 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942831.1 protein_id gnl|my_center|LOCUS_15010 4999 6162 gene locus_tag LOCUS_15020 4999 6162 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942830.1 protein_id gnl|my_center|LOCUS_15020 7830 6319 gene locus_tag LOCUS_15030 7830 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208108.1 protein_id gnl|my_center|LOCUS_15030 8622 7834 gene locus_tag LOCUS_15040 8622 7834 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence112 24 569 gene locus_tag LOCUS_15050 24 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 842 3472 gene locus_tag LOCUS_15060 gene secA 842 3472 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942693.1 protein_id gnl|my_center|LOCUS_15060 3469 4677 gene locus_tag LOCUS_15070 gene argJ 3469 4677 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546755.1 protein_id gnl|my_center|LOCUS_15070 5898 4810 gene locus_tag LOCUS_15080 5898 4810 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938320.1 protein_id gnl|my_center|LOCUS_15080 6646 5888 gene locus_tag LOCUS_15090 gene sufC 6646 5888 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876773.1 protein_id gnl|my_center|LOCUS_15090 6811 7392 gene locus_tag LOCUS_15100 6811 7392 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870005.1 protein_id gnl|my_center|LOCUS_15100 8181 7399 gene locus_tag LOCUS_15110 8181 7399 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061125.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence113 370 3018 gene locus_tag LOCUS_15120 370 3018 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_15120 3005 3724 gene locus_tag LOCUS_15130 3005 3724 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249938.1 protein_id gnl|my_center|LOCUS_15130 5080 3833 gene locus_tag LOCUS_15140 5080 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 6375 5098 gene locus_tag LOCUS_15150 6375 5098 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037226281.1 protein_id gnl|my_center|LOCUS_15150 7751 6465 gene locus_tag LOCUS_15160 7751 6465 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021506.1 protein_id gnl|my_center|LOCUS_15160 7878 8813 gene locus_tag LOCUS_15170 7878 8813 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence114 294 94 gene locus_tag LOCUS_15180 294 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1523 864 gene locus_tag LOCUS_15190 1523 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 2959 1535 gene locus_tag LOCUS_15200 2959 1535 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706379.1 protein_id gnl|my_center|LOCUS_15200 3696 2974 gene locus_tag LOCUS_15210 3696 2974 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812756.1 protein_id gnl|my_center|LOCUS_15210 5291 4233 gene locus_tag LOCUS_15220 5291 4233 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_15220 6096 7436 gene locus_tag LOCUS_15230 6096 7436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 8592 7651 gene locus_tag LOCUS_15240 8592 7651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence115 772 1797 gene locus_tag LOCUS_15250 772 1797 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972787.1 protein_id gnl|my_center|LOCUS_15250 1891 2403 gene locus_tag LOCUS_15260 1891 2403 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243030.1 protein_id gnl|my_center|LOCUS_15260 2408 3709 gene locus_tag LOCUS_15270 2408 3709 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 protein_id gnl|my_center|LOCUS_15270 3722 4501 gene locus_tag LOCUS_15280 3722 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 4581 5336 gene locus_tag LOCUS_15290 gene fabG 4581 5336 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_15290 5671 7803 gene locus_tag LOCUS_15300 5671 7803 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086230.1 protein_id gnl|my_center|LOCUS_15300 7807 8214 gene locus_tag LOCUS_15310 7807 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence116 303 1235 gene locus_tag LOCUS_15320 gene rpsB 303 1235 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942566.1 protein_id gnl|my_center|LOCUS_15320 1258 1857 gene locus_tag LOCUS_15330 gene tsf 1258 1857 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392547.1 protein_id gnl|my_center|LOCUS_15330 1809 2591 gene locus_tag LOCUS_15340 gene pyrH 1809 2591 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880427.1 protein_id gnl|my_center|LOCUS_15340 2569 3126 gene locus_tag LOCUS_15350 gene frr 2569 3126 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942563.1 protein_id gnl|my_center|LOCUS_15350 3901 3191 gene locus_tag LOCUS_15360 gene pyrF 3901 3191 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_15360 4476 3880 gene locus_tag LOCUS_15370 gene gmk 4476 3880 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082205.1 protein_id gnl|my_center|LOCUS_15370 4810 4526 gene locus_tag LOCUS_15380 4810 4526 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938198.1 protein_id gnl|my_center|LOCUS_15380 5739 4876 gene locus_tag LOCUS_15390 5739 4876 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_15390 6257 5724 gene locus_tag LOCUS_15400 6257 5724 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544933.1 protein_id gnl|my_center|LOCUS_15400 7269 6250 gene locus_tag LOCUS_15410 gene rfaE1 7269 6250 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546729.1 protein_id gnl|my_center|LOCUS_15410 8481 7273 gene locus_tag LOCUS_15420 8481 7273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 >Feature sequence117 <1 510 gene locus_tag LOCUS_15430 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113718.1:glycosyltransferase 530 940 gene locus_tag LOCUS_15440 530 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 955 1230 gene locus_tag LOCUS_15450 955 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1663 2670 gene locus_tag LOCUS_15460 1663 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 2893 3264 gene locus_tag LOCUS_15470 2893 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 3438 4808 gene locus_tag LOCUS_15480 3438 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 4827 5294 gene locus_tag LOCUS_15490 gene tadA 4827 5294 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693256.1 protein_id gnl|my_center|LOCUS_15490 5294 5386 gene locus_tag LOCUS_t00170 5294 5386 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5394 5486 gene locus_tag LOCUS_t00180 5394 5486 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5827 7431 gene locus_tag LOCUS_15500 5827 7431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 7496 8473 gene locus_tag LOCUS_15510 7496 8473 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258100.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence118 1222 293 gene locus_tag LOCUS_15520 1222 293 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907889.1 protein_id gnl|my_center|LOCUS_15520 1776 1357 gene locus_tag LOCUS_15530 1776 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 2749 4440 gene locus_tag LOCUS_15540 gene polX 2749 4440 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880919.1 protein_id gnl|my_center|LOCUS_15540 4582 5523 gene locus_tag LOCUS_15550 4582 5523 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877602.1 protein_id gnl|my_center|LOCUS_15550 5523 5966 gene locus_tag LOCUS_15560 5523 5966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 5933 6631 gene locus_tag LOCUS_15570 5933 6631 CDS product UbiA-like polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205587.1 protein_id gnl|my_center|LOCUS_15570 6628 7221 gene locus_tag LOCUS_15580 6628 7221 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173927.1 protein_id gnl|my_center|LOCUS_15580 7214 7933 gene locus_tag LOCUS_15590 gene ubiE 7214 7933 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764422.1 protein_id gnl|my_center|LOCUS_15590 7917 8630 gene locus_tag LOCUS_15600 7917 8630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 >Feature sequence119 661 1482 gene locus_tag LOCUS_15610 661 1482 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039072.1 protein_id gnl|my_center|LOCUS_15610 1472 3178 gene locus_tag LOCUS_15620 1472 3178 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681003.1 protein_id gnl|my_center|LOCUS_15620 3191 4564 gene locus_tag LOCUS_15630 3191 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 4616 6175 gene locus_tag LOCUS_15640 4616 6175 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 protein_id gnl|my_center|LOCUS_15640 7217 6207 gene locus_tag LOCUS_15650 gene gap 7217 6207 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937869.1 protein_id gnl|my_center|LOCUS_15650 7791 7228 gene locus_tag LOCUS_15660 7791 7228 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937870.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence120 350 132 gene locus_tag LOCUS_15670 350 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 1350 1099 gene locus_tag LOCUS_15680 1350 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1641 1859 gene locus_tag LOCUS_15690 1641 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 1954 2697 gene locus_tag LOCUS_15700 1954 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 3178 3008 gene locus_tag LOCUS_15710 3178 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 4513 3386 gene locus_tag LOCUS_15720 gene mnmE 4513 3386 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898860.1 protein_id gnl|my_center|LOCUS_15720 5409 4693 gene locus_tag LOCUS_15730 5409 4693 CDS product Jag N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432936.1 protein_id gnl|my_center|LOCUS_15730 7022 5427 gene locus_tag LOCUS_15740 gene yidC 7022 5427 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_15740 7595 7239 gene locus_tag LOCUS_15750 gene rnpA 7595 7239 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429302.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence121 589 374 gene locus_tag LOCUS_15760 589 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 784 632 gene locus_tag LOCUS_15770 784 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 909 984 gene locus_tag LOCUS_t00190 909 984 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1006 1476 gene locus_tag LOCUS_15780 1006 1476 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392560.1 protein_id gnl|my_center|LOCUS_15780 1487 2728 gene locus_tag LOCUS_15790 gene nusA 1487 2728 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942231.1 protein_id gnl|my_center|LOCUS_15790 2787 3284 gene locus_tag LOCUS_15800 2787 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 3281 5908 gene locus_tag LOCUS_15810 gene infB 3281 5908 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942233.1 protein_id gnl|my_center|LOCUS_15810 5908 6192 gene locus_tag LOCUS_15820 5908 6192 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047972.1 protein_id gnl|my_center|LOCUS_15820 6189 6551 gene locus_tag LOCUS_15830 gene rbfA 6189 6551 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545236.1 protein_id gnl|my_center|LOCUS_15830 6532 7461 gene locus_tag LOCUS_15840 6532 7461 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082036.1 protein_id gnl|my_center|LOCUS_15840 7443 8345 gene locus_tag LOCUS_15850 gene truB 7443 8345 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942236.1 protein_id gnl|my_center|LOCUS_15850 >Feature sequence122 553 1341 gene locus_tag LOCUS_15860 gene fabG 553 1341 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_15860 1567 2319 gene locus_tag LOCUS_15870 gene fabG 1567 2319 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_15870 2375 4186 gene locus_tag LOCUS_15880 2375 4186 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114561.1 protein_id gnl|my_center|LOCUS_15880 4410 5198 gene locus_tag LOCUS_15890 4410 5198 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_15890 5221 6066 gene locus_tag LOCUS_15900 5221 6066 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173325.1 protein_id gnl|my_center|LOCUS_15900 6103 6882 gene locus_tag LOCUS_15910 6103 6882 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889459.1 protein_id gnl|my_center|LOCUS_15910 6931 8238 gene locus_tag LOCUS_15920 6931 8238 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459192.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence123 304 23 gene locus_tag LOCUS_15930 304 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 1047 445 gene locus_tag LOCUS_15940 1047 445 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358516.1 protein_id gnl|my_center|LOCUS_15940 1479 1228 gene locus_tag LOCUS_15950 1479 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 3549 1552 gene locus_tag LOCUS_15960 3549 1552 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319085.1 protein_id gnl|my_center|LOCUS_15960 3778 5160 gene locus_tag LOCUS_15970 3778 5160 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258069.1 protein_id gnl|my_center|LOCUS_15970 5184 5840 gene locus_tag LOCUS_15980 5184 5840 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086982.1 protein_id gnl|my_center|LOCUS_15980 5920 6945 gene locus_tag LOCUS_15990 5920 6945 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_15990 7056 7970 gene locus_tag LOCUS_16000 7056 7970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence124 1097 117 gene locus_tag LOCUS_16010 1097 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16010 3003 1465 gene locus_tag LOCUS_16020 gene guaA 3003 1465 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_16020 3192 3013 gene locus_tag LOCUS_16030 3192 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 3470 3219 gene locus_tag LOCUS_16040 3470 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 4906 3461 gene locus_tag LOCUS_16050 gene purF 4906 3461 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_16050 6114 4927 gene locus_tag LOCUS_16060 6114 4927 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546563.1 protein_id gnl|my_center|LOCUS_16060 6944 6114 gene locus_tag LOCUS_16070 gene dapF 6944 6114 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_16070 <8158 7380 gene locus_tag LOCUS_16080 <8158 7380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545052.1:ABC transporter permease >Feature sequence125 742 278 gene locus_tag LOCUS_16090 742 278 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938921.1 protein_id gnl|my_center|LOCUS_16090 1266 739 gene locus_tag LOCUS_16100 gene raiA 1266 739 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_16100 2710 1313 gene locus_tag LOCUS_16110 gene rpoN 2710 1313 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_16110 3454 2723 gene locus_tag LOCUS_16120 gene lptB 3454 2723 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942533.1 protein_id gnl|my_center|LOCUS_16120 3948 3442 gene locus_tag LOCUS_16130 3948 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 4441 3914 gene locus_tag LOCUS_16140 4441 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 4934 4431 gene locus_tag LOCUS_16150 4934 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 5743 4931 gene locus_tag LOCUS_16160 gene kdsA 5743 4931 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_16160 7368 5740 gene locus_tag LOCUS_16170 7368 5740 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942540.1 protein_id gnl|my_center|LOCUS_16170 7749 7979 gene locus_tag LOCUS_16180 7749 7979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence126 543 58 gene locus_tag LOCUS_16190 543 58 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675552.1 protein_id gnl|my_center|LOCUS_16190 3267 1375 gene locus_tag LOCUS_16200 3267 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 3806 3988 gene locus_tag LOCUS_16210 3806 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 5080 4004 gene locus_tag LOCUS_16220 5080 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 6541 5195 gene locus_tag LOCUS_16230 6541 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 8105 6543 gene locus_tag LOCUS_16240 8105 6543 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876295.1 protein_id gnl|my_center|LOCUS_16240 >Feature sequence127 2 1309 gene locus_tag LOCUS_16250 2 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 1363 2190 gene locus_tag LOCUS_16260 1363 2190 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077221.1 protein_id gnl|my_center|LOCUS_16260 2304 3032 gene locus_tag LOCUS_16270 2304 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 3029 3298 gene locus_tag LOCUS_16280 3029 3298 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942527.1 protein_id gnl|my_center|LOCUS_16280 3295 5067 gene locus_tag LOCUS_16290 gene ptsP 3295 5067 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_16290 5105 6496 gene locus_tag LOCUS_16300 5105 6496 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941561.1 protein_id gnl|my_center|LOCUS_16300 6503 7372 gene locus_tag LOCUS_16310 gene sppA 6503 7372 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682856.1 protein_id gnl|my_center|LOCUS_16310 7400 7975 gene locus_tag LOCUS_16320 7400 7975 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027668.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence128 2214 487 gene locus_tag LOCUS_16330 gene iorA 2214 487 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942384.1 protein_id gnl|my_center|LOCUS_16330 2496 2651 gene locus_tag LOCUS_16340 2496 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 2641 3942 gene locus_tag LOCUS_16350 2641 3942 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867476.1 protein_id gnl|my_center|LOCUS_16350 3964 4866 gene locus_tag LOCUS_16360 gene cysK 3964 4866 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_16360 5217 6695 gene locus_tag LOCUS_16370 5217 6695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 6874 7893 gene locus_tag LOCUS_16380 6874 7893 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546047.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence129 640 2271 gene locus_tag LOCUS_16390 640 2271 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869802.1 protein_id gnl|my_center|LOCUS_16390 2272 3483 gene locus_tag LOCUS_16400 2272 3483 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545964.1 protein_id gnl|my_center|LOCUS_16400 3486 4232 gene locus_tag LOCUS_16410 3486 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 4229 5611 gene locus_tag LOCUS_16420 4229 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 5623 6000 gene locus_tag LOCUS_16430 5623 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 5997 6422 gene locus_tag LOCUS_16440 5997 6422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 6406 7935 gene locus_tag LOCUS_16450 gene mshL 6406 7935 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545709.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence130 288 1634 gene locus_tag LOCUS_16460 gene lpdA 288 1634 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083198.1 protein_id gnl|my_center|LOCUS_16460 1705 2085 gene locus_tag LOCUS_16470 gene hisI 1705 2085 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937424.1 protein_id gnl|my_center|LOCUS_16470 2082 2951 gene locus_tag LOCUS_16480 gene hisG 2082 2951 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942177.1 protein_id gnl|my_center|LOCUS_16480 2954 3700 gene locus_tag LOCUS_16490 gene map 2954 3700 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393915.1 protein_id gnl|my_center|LOCUS_16490 4393 3920 gene locus_tag LOCUS_16500 gene greA 4393 3920 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948324.1 protein_id gnl|my_center|LOCUS_16500 4586 5389 gene locus_tag LOCUS_16510 gene panB 4586 5389 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942349.1 protein_id gnl|my_center|LOCUS_16510 5402 6253 gene locus_tag LOCUS_16520 gene panC 5402 6253 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080408.1 protein_id gnl|my_center|LOCUS_16520 7241 6573 gene locus_tag LOCUS_16530 gene hypB 7241 6573 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356857.1 protein_id gnl|my_center|LOCUS_16530 7591 7241 gene locus_tag LOCUS_16540 gene hypA 7591 7241 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089670.1 protein_id gnl|my_center|LOCUS_16540 >Feature sequence131 1078 137 gene locus_tag LOCUS_16550 1078 137 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359341.1 protein_id gnl|my_center|LOCUS_16550 1435 2124 gene locus_tag LOCUS_16560 1435 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 2549 3466 gene locus_tag LOCUS_16570 2549 3466 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791450.1 protein_id gnl|my_center|LOCUS_16570 5000 4026 gene locus_tag LOCUS_16580 5000 4026 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973127.1 protein_id gnl|my_center|LOCUS_16580 6232 5021 gene locus_tag LOCUS_16590 6232 5021 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583067.1 protein_id gnl|my_center|LOCUS_16590 <7885 6236 gene locus_tag LOCUS_16600 <7885 6236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257951.1:SDR family NAD(P)-dependent oxidoreductase >Feature sequence132 1956 613 gene locus_tag LOCUS_16610 1956 613 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_16610 3334 1961 gene locus_tag LOCUS_16620 3334 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 4665 3478 gene locus_tag LOCUS_16630 gene galK 4665 3478 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_16630 5398 4658 gene locus_tag LOCUS_16640 5398 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 7437 5485 gene locus_tag LOCUS_16650 7437 5485 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021363.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence133 1157 120 gene locus_tag LOCUS_16660 gene hrcA 1157 120 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_16660 1709 2164 gene locus_tag LOCUS_16670 1709 2164 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879168.1 protein_id gnl|my_center|LOCUS_16670 2203 2400 gene locus_tag LOCUS_16680 2203 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 3746 2445 gene locus_tag LOCUS_16690 3746 2445 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942699.1 protein_id gnl|my_center|LOCUS_16690 4237 3743 gene locus_tag LOCUS_16700 4237 3743 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942698.1 protein_id gnl|my_center|LOCUS_16700 5802 4747 gene locus_tag LOCUS_16710 5802 4747 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942697.1 protein_id gnl|my_center|LOCUS_16710 6353 5922 gene locus_tag LOCUS_16720 6353 5922 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_16720 7671 6370 gene locus_tag LOCUS_16730 7671 6370 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942382.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence134 1238 1702 gene locus_tag LOCUS_16740 1238 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 1785 3281 gene locus_tag LOCUS_16750 1785 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 3464 3922 gene locus_tag LOCUS_16760 3464 3922 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_16760 5290 4178 gene locus_tag LOCUS_16770 5290 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 5523 5287 gene locus_tag LOCUS_16780 gene hfq 5523 5287 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942642.1 protein_id gnl|my_center|LOCUS_16780 5699 7708 gene locus_tag LOCUS_16790 gene ligA 5699 7708 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545963.1 protein_id gnl|my_center|LOCUS_16790 >Feature sequence135 993 211 gene locus_tag LOCUS_16800 993 211 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846972.1 protein_id gnl|my_center|LOCUS_16800 1795 1022 gene locus_tag LOCUS_16810 1795 1022 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462069.1 protein_id gnl|my_center|LOCUS_16810 2863 1811 gene locus_tag LOCUS_16820 2863 1811 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047756.1 protein_id gnl|my_center|LOCUS_16820 3858 2881 gene locus_tag LOCUS_16830 3858 2881 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815527.1 protein_id gnl|my_center|LOCUS_16830 4864 3905 gene locus_tag LOCUS_16840 gene pdhA 4864 3905 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_16840 5458 7419 gene locus_tag LOCUS_16850 5458 7419 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986282.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence136 1206 340 gene locus_tag LOCUS_16860 1206 340 CDS product ARMT1-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582978.1 protein_id gnl|my_center|LOCUS_16860 2090 1257 gene locus_tag LOCUS_16870 2090 1257 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545002.1 protein_id gnl|my_center|LOCUS_16870 2306 2977 gene locus_tag LOCUS_16880 2306 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 3021 3869 gene locus_tag LOCUS_16890 3021 3869 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_16890 3880 4887 gene locus_tag LOCUS_16900 3880 4887 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_16900 4902 5663 gene locus_tag LOCUS_16910 4902 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 6381 5740 gene locus_tag LOCUS_16920 6381 5740 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942171.1 protein_id gnl|my_center|LOCUS_16920 6626 6414 gene locus_tag LOCUS_16930 6626 6414 CDS product DUF6485 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584058.1 protein_id gnl|my_center|LOCUS_16930 6882 7592 gene locus_tag LOCUS_16940 gene rlmB 6882 7592 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942108.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence137 401 1267 gene locus_tag LOCUS_16950 401 1267 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090656.1 protein_id gnl|my_center|LOCUS_16950 1271 2347 gene locus_tag LOCUS_16960 1271 2347 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090655.1 protein_id gnl|my_center|LOCUS_16960 2353 3183 gene locus_tag LOCUS_16970 2353 3183 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090654.1 protein_id gnl|my_center|LOCUS_16970 3185 3952 gene locus_tag LOCUS_16980 3185 3952 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090653.1 protein_id gnl|my_center|LOCUS_16980 4034 5233 gene locus_tag LOCUS_16990 4034 5233 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966119.1 protein_id gnl|my_center|LOCUS_16990 5545 7371 gene locus_tag LOCUS_17000 5545 7371 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090652.1 protein_id gnl|my_center|LOCUS_17000 7663 7451 gene locus_tag LOCUS_17010 7663 7451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 >Feature sequence138 429 1430 gene locus_tag LOCUS_17020 429 1430 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869831.1 protein_id gnl|my_center|LOCUS_17020 2147 1416 gene locus_tag LOCUS_17030 2147 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 2608 2976 gene locus_tag LOCUS_17040 2608 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 5797 3176 gene locus_tag LOCUS_17050 gene clpB 5797 3176 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365367.1 protein_id gnl|my_center|LOCUS_17050 >Feature sequence139 2377 482 gene locus_tag LOCUS_17060 2377 482 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 protein_id gnl|my_center|LOCUS_17060 2958 2425 gene locus_tag LOCUS_17070 gene cobO 2958 2425 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392864.1 protein_id gnl|my_center|LOCUS_17070 6253 3002 gene locus_tag LOCUS_17080 6253 3002 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_17080 6986 6246 gene locus_tag LOCUS_17090 6986 6246 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238605.1 protein_id gnl|my_center|LOCUS_17090 7268 7089 gene locus_tag LOCUS_17100 7268 7089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 >Feature sequence140 766 329 gene locus_tag LOCUS_17110 766 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 1831 893 gene locus_tag LOCUS_17120 1831 893 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_17120 5262 1828 gene locus_tag LOCUS_17130 gene dnaE 5262 1828 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_17130 6740 5277 gene locus_tag LOCUS_17140 gene guaB 6740 5277 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_17140 7519 6755 gene locus_tag LOCUS_17150 gene sppA 7519 6755 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545082.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence141 145 1143 gene locus_tag LOCUS_17160 gene gctA 145 1143 CDS product glutaconate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902658.1 protein_id gnl|my_center|LOCUS_17160 1136 1906 gene locus_tag LOCUS_17170 1136 1906 CDS product glutaconate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272325.1 protein_id gnl|my_center|LOCUS_17170 1932 3074 gene locus_tag LOCUS_17180 1932 3074 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064172.1 protein_id gnl|my_center|LOCUS_17180 3086 4252 gene locus_tag LOCUS_17190 3086 4252 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877713.1 protein_id gnl|my_center|LOCUS_17190 4263 4733 gene locus_tag LOCUS_17200 4263 4733 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270458.1 protein_id gnl|my_center|LOCUS_17200 4765 5235 gene locus_tag LOCUS_17210 4765 5235 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270458.1 protein_id gnl|my_center|LOCUS_17210 5334 6422 gene locus_tag LOCUS_17220 gene dctP 5334 6422 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_17220 6572 7081 gene locus_tag LOCUS_17230 6572 7081 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243030.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence142 1617 202 gene locus_tag LOCUS_17240 1617 202 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867476.1 protein_id gnl|my_center|LOCUS_17240 3025 1751 gene locus_tag LOCUS_17250 3025 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 3558 3022 gene locus_tag LOCUS_17260 3558 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 4579 3539 gene locus_tag LOCUS_17270 4579 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 5396 4623 gene locus_tag LOCUS_17280 5396 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 6998 6042 gene locus_tag LOCUS_17290 6998 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence143 215 1708 gene locus_tag LOCUS_17300 215 1708 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_17300 1720 2877 gene locus_tag LOCUS_17310 1720 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 3028 3267 gene locus_tag LOCUS_17320 3028 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 3264 5123 gene locus_tag LOCUS_17330 3264 5123 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146458.1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence144 2134 50 gene locus_tag LOCUS_17340 gene prsK 2134 50 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942586.1 protein_id gnl|my_center|LOCUS_17340 2481 3038 gene locus_tag LOCUS_17350 2481 3038 CDS product PEP-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942588.1 protein_id gnl|my_center|LOCUS_17350 3253 3861 gene locus_tag LOCUS_17360 3253 3861 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_17360 4039 4425 gene locus_tag LOCUS_17370 4039 4425 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870252.1 protein_id gnl|my_center|LOCUS_17370 7141 4745 gene locus_tag LOCUS_17380 7141 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence145 174 599 gene locus_tag LOCUS_17390 174 599 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545896.1 protein_id gnl|my_center|LOCUS_17390 730 2274 gene locus_tag LOCUS_17400 730 2274 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941216.1 protein_id gnl|my_center|LOCUS_17400 3143 2271 gene locus_tag LOCUS_17410 3143 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064248.1 protein_id gnl|my_center|LOCUS_17410 3743 3414 gene locus_tag LOCUS_17420 3743 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 5831 3963 gene locus_tag LOCUS_17430 5831 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 5951 6181 gene locus_tag LOCUS_17440 5951 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 <7244 6472 gene locus_tag LOCUS_17450 <7244 6472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073976.1:retention module-containing protein >Feature sequence146 1034 381 gene locus_tag LOCUS_17460 1034 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 2052 1027 gene locus_tag LOCUS_17470 gene fliG 2052 1027 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937619.1 protein_id gnl|my_center|LOCUS_17470 3674 2052 gene locus_tag LOCUS_17480 gene fliF 3674 2052 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941078.1 protein_id gnl|my_center|LOCUS_17480 3958 3671 gene locus_tag LOCUS_17490 3958 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 4362 3958 gene locus_tag LOCUS_17500 gene flgC 4362 3958 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_17500 4763 4362 gene locus_tag LOCUS_17510 gene flgB 4763 4362 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546345.1 protein_id gnl|my_center|LOCUS_17510 6155 4824 gene locus_tag LOCUS_17520 gene flbD 6155 4824 CDS product sigma-54-dependent transcriptional regulator FlbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918793.1 protein_id gnl|my_center|LOCUS_17520 6877 6161 gene locus_tag LOCUS_17530 6877 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence147 2139 289 gene locus_tag LOCUS_17540 gene recD 2139 289 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942182.1 protein_id gnl|my_center|LOCUS_17540 5741 2154 gene locus_tag LOCUS_17550 gene recB 5741 2154 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942181.1 protein_id gnl|my_center|LOCUS_17550 <7228 5738 gene locus_tag LOCUS_17560 <7228 5738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932746.1:exodeoxyribonuclease V subunit gamma >Feature sequence148 353 841 gene locus_tag LOCUS_17570 353 841 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583986.1 protein_id gnl|my_center|LOCUS_17570 877 1305 gene locus_tag LOCUS_17580 877 1305 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_17580 1302 1634 gene locus_tag LOCUS_17590 1302 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 1597 2475 gene locus_tag LOCUS_17600 gene lipA 1597 2475 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_17600 2472 3638 gene locus_tag LOCUS_17610 2472 3638 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938190.1 protein_id gnl|my_center|LOCUS_17610 3652 4983 gene locus_tag LOCUS_17620 3652 4983 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942336.1 protein_id gnl|my_center|LOCUS_17620 4973 5755 gene locus_tag LOCUS_17630 4973 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 5773 6981 gene locus_tag LOCUS_17640 5773 6981 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence149 422 595 gene locus_tag LOCUS_17650 422 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 781 1221 gene locus_tag LOCUS_17660 781 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 1269 1604 gene locus_tag LOCUS_17670 1269 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 2007 2678 gene locus_tag LOCUS_17680 2007 2678 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_17680 2682 3224 gene locus_tag LOCUS_17690 2682 3224 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_17690 3534 4349 gene locus_tag LOCUS_17700 3534 4349 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_17700 4616 5617 gene locus_tag LOCUS_17710 4616 5617 CDS product YhdH/YhfP family quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087998.1 protein_id gnl|my_center|LOCUS_17710 >Feature sequence150 634 1623 gene locus_tag LOCUS_17720 634 1623 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941622.1 protein_id gnl|my_center|LOCUS_17720 1708 1977 gene locus_tag LOCUS_17730 1708 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 2293 2206 gene locus_tag LOCUS_t00200 2293 2206 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2735 2412 gene locus_tag LOCUS_17740 2735 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 2973 3272 gene locus_tag LOCUS_17750 2973 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 3617 4783 gene locus_tag LOCUS_17760 3617 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 5423 4866 gene locus_tag LOCUS_17770 5423 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 6855 5509 gene locus_tag LOCUS_17780 6855 5509 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545411.1 protein_id gnl|my_center|LOCUS_17780 >Feature sequence151 447 145 gene locus_tag LOCUS_17790 447 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 757 1485 gene locus_tag LOCUS_17800 gene radC 757 1485 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016743.1 protein_id gnl|my_center|LOCUS_17800 1637 1939 gene locus_tag LOCUS_17810 1637 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17810 1967 3898 gene locus_tag LOCUS_17820 1967 3898 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584070.1 protein_id gnl|my_center|LOCUS_17820 5899 4022 gene locus_tag LOCUS_17830 5899 4022 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878377.1 protein_id gnl|my_center|LOCUS_17830 6807 6145 gene locus_tag LOCUS_17840 6807 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 >Feature sequence152 1379 288 gene locus_tag LOCUS_17850 gene rodA 1379 288 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_17850 3174 1351 gene locus_tag LOCUS_17860 gene mrdA 3174 1351 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_17860 3637 3164 gene locus_tag LOCUS_17870 3637 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 4436 3618 gene locus_tag LOCUS_17880 gene mreC 4436 3618 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_17880 5473 4436 gene locus_tag LOCUS_17890 5473 4436 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_17890 5731 6759 gene locus_tag LOCUS_17900 5731 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 6964 6647 gene locus_tag LOCUS_17910 6964 6647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence153 2 1987 gene locus_tag LOCUS_17920 2 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:353..355,aa:Sec) note codon on position 118 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_17920 2063 2944 gene locus_tag LOCUS_17930 2063 2944 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393681.1 protein_id gnl|my_center|LOCUS_17930 2955 3425 gene locus_tag LOCUS_17940 2955 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 3454 3594 gene locus_tag LOCUS_17950 3454 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 3860 4516 gene locus_tag LOCUS_17960 3860 4516 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010204183.1 protein_id gnl|my_center|LOCUS_17960 5012 6358 gene locus_tag LOCUS_17970 5012 6358 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392943.1 protein_id gnl|my_center|LOCUS_17970 <7100 6547 gene locus_tag LOCUS_17980 <7100 6547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230959.1:phosphoenolpyruvate carboxykinase (GTP) >Feature sequence154 1017 223 gene locus_tag LOCUS_17990 1017 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 2394 1291 gene locus_tag LOCUS_18000 2394 1291 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224333.1 protein_id gnl|my_center|LOCUS_18000 3535 2534 gene locus_tag LOCUS_18010 3535 2534 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878041.1 protein_id gnl|my_center|LOCUS_18010 3742 5064 gene locus_tag LOCUS_18020 3742 5064 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939339.1 protein_id gnl|my_center|LOCUS_18020 5129 5797 gene locus_tag LOCUS_18030 5129 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 6682 5888 gene locus_tag LOCUS_18040 6682 5888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence155 254 778 gene locus_tag LOCUS_18050 254 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 914 1951 gene locus_tag LOCUS_18060 914 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 2133 3371 gene locus_tag LOCUS_18070 2133 3371 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815636.1 protein_id gnl|my_center|LOCUS_18070 3926 4780 gene locus_tag LOCUS_18080 3926 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 4794 5756 gene locus_tag LOCUS_18090 4794 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 5791 6681 gene locus_tag LOCUS_18100 5791 6681 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947156.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence156 85 4215 gene locus_tag LOCUS_18110 gene rpoB 85 4215 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943493.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence157 1543 191 gene locus_tag LOCUS_18120 1543 191 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023751.1 protein_id gnl|my_center|LOCUS_18120 2878 1559 gene locus_tag LOCUS_18130 2878 1559 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 protein_id gnl|my_center|LOCUS_18130 3841 2954 gene locus_tag LOCUS_18140 3841 2954 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339386.1 protein_id gnl|my_center|LOCUS_18140 4186 4755 gene locus_tag LOCUS_18150 4186 4755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 4877 5029 gene locus_tag LOCUS_18160 4877 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 6248 5202 gene locus_tag LOCUS_18170 6248 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 <6939 6255 gene locus_tag LOCUS_18180 <6939 6255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398544.1:SNF2-related protein >Feature sequence158 1134 100 gene locus_tag LOCUS_18190 1134 100 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942993.1 protein_id gnl|my_center|LOCUS_18190 1294 1367 gene locus_tag LOCUS_t00210 1294 1367 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1375 1452 gene locus_tag LOCUS_t00220 1375 1452 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1515 1865 gene locus_tag LOCUS_18200 1515 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 1886 2458 gene locus_tag LOCUS_18210 1886 2458 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768286.1 protein_id gnl|my_center|LOCUS_18210 2532 4235 gene locus_tag LOCUS_18220 gene pilB 2532 4235 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_18220 4250 5350 gene locus_tag LOCUS_18230 4250 5350 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_18230 5354 6547 gene locus_tag LOCUS_18240 5354 6547 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence159 1 600 gene locus_tag LOCUS_18250 1 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 743 1042 gene locus_tag LOCUS_18260 743 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1822 2121 gene locus_tag LOCUS_18270 1822 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 2418 3362 gene locus_tag LOCUS_18280 2418 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 3388 4752 gene locus_tag LOCUS_18290 gene selA 3388 4752 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545074.1 protein_id gnl|my_center|LOCUS_18290 4742 5647 gene locus_tag LOCUS_18300 4742 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 5632 6591 gene locus_tag LOCUS_18310 5632 6591 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence160 583 104 gene locus_tag LOCUS_18320 583 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 1577 825 gene locus_tag LOCUS_18330 1577 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 3006 1681 gene locus_tag LOCUS_18340 3006 1681 CDS product DUF3887 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582879.1 protein_id gnl|my_center|LOCUS_18340 4684 3467 gene locus_tag LOCUS_18350 4684 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 5916 4681 gene locus_tag LOCUS_18360 5916 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 6405 6148 gene locus_tag LOCUS_18370 6405 6148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 >Feature sequence161 1509 1838 gene locus_tag LOCUS_18380 1509 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 2966 2565 gene locus_tag LOCUS_18390 2966 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 3955 5007 gene locus_tag LOCUS_18400 3955 5007 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_18400 5262 5903 gene locus_tag LOCUS_18410 5262 5903 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878079.1 protein_id gnl|my_center|LOCUS_18410 6405 5890 gene locus_tag LOCUS_18420 6405 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 >Feature sequence162 370 1017 gene locus_tag LOCUS_18430 370 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 1031 1705 gene locus_tag LOCUS_18440 1031 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18440 1968 2795 gene locus_tag LOCUS_18450 1968 2795 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584092.1 protein_id gnl|my_center|LOCUS_18450 2797 3588 gene locus_tag LOCUS_18460 gene fldI 2797 3588 CDS product phenyllactyl-CoA dehydratase activase FldI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357618.1 protein_id gnl|my_center|LOCUS_18460 3661 4830 gene locus_tag LOCUS_18470 3661 4830 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359361.1 protein_id gnl|my_center|LOCUS_18470 4811 4999 gene locus_tag LOCUS_18480 4811 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 5001 6389 gene locus_tag LOCUS_18490 5001 6389 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460239.1 protein_id gnl|my_center|LOCUS_18490 >Feature sequence163 2338 1241 gene locus_tag LOCUS_18500 2338 1241 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945303.1 protein_id gnl|my_center|LOCUS_18500 3439 2342 gene locus_tag LOCUS_18510 3439 2342 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461481.1 protein_id gnl|my_center|LOCUS_18510 4621 3659 gene locus_tag LOCUS_18520 4621 3659 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942736.1 protein_id gnl|my_center|LOCUS_18520 5447 4614 gene locus_tag LOCUS_18530 5447 4614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 6351 5449 gene locus_tag LOCUS_18540 6351 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 >Feature sequence164 1847 345 gene locus_tag LOCUS_18550 1847 345 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_18550 3783 2062 gene locus_tag LOCUS_18560 3783 2062 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892286.1 protein_id gnl|my_center|LOCUS_18560 4133 3804 gene locus_tag LOCUS_18570 4133 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 4875 4156 gene locus_tag LOCUS_18580 4875 4156 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065212.1 protein_id gnl|my_center|LOCUS_18580 6302 4899 gene locus_tag LOCUS_18590 6302 4899 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815636.1 protein_id gnl|my_center|LOCUS_18590 >Feature sequence165 1917 172 gene locus_tag LOCUS_18600 1917 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 2685 2053 gene locus_tag LOCUS_18610 2685 2053 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249655.1 protein_id gnl|my_center|LOCUS_18610 2920 4662 gene locus_tag LOCUS_18620 2920 4662 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_18620 6093 4705 gene locus_tag LOCUS_18630 6093 4705 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence166 312 1634 gene locus_tag LOCUS_18640 312 1634 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877874.1 protein_id gnl|my_center|LOCUS_18640 2185 2595 gene locus_tag LOCUS_18650 2185 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 2595 4082 gene locus_tag LOCUS_18660 2595 4082 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_18660 4079 4915 gene locus_tag LOCUS_18670 gene ispE 4079 4915 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966185.1 protein_id gnl|my_center|LOCUS_18670 4919 5185 gene locus_tag LOCUS_18680 gene spoVG 4919 5185 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_18680 5235 5308 gene locus_tag LOCUS_t00230 5235 5308 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5330 6277 gene locus_tag LOCUS_18690 5330 6277 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_18690 >Feature sequence167 2830 1829 gene locus_tag LOCUS_18700 gene ahbD 2830 1829 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_18700 3801 2830 gene locus_tag LOCUS_18710 gene hemB 3801 2830 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546067.1 protein_id gnl|my_center|LOCUS_18710 4412 4062 gene locus_tag LOCUS_18720 4412 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 4473 5627 gene locus_tag LOCUS_18730 4473 5627 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151296.1 protein_id gnl|my_center|LOCUS_18730 <6531 5882 gene locus_tag LOCUS_18740 <6531 5882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002208568.1:UDP-2,3-diacylglucosamine diphosphatase >Feature sequence168 1862 216 gene locus_tag LOCUS_18750 1862 216 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142835.1 protein_id gnl|my_center|LOCUS_18750 2128 2916 gene locus_tag LOCUS_18760 2128 2916 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762836.1 protein_id gnl|my_center|LOCUS_18760 3029 4822 gene locus_tag LOCUS_18770 3029 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 5405 5097 gene locus_tag LOCUS_18780 5405 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 6351 5686 gene locus_tag LOCUS_18790 6351 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 >Feature sequence169 950 45 gene locus_tag LOCUS_18800 gene pheS 950 45 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_18800 1298 951 gene locus_tag LOCUS_18810 gene rplT 1298 951 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880587.1 protein_id gnl|my_center|LOCUS_18810 1508 1314 gene locus_tag LOCUS_18820 gene rpmI 1508 1314 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057993.1 protein_id gnl|my_center|LOCUS_18820 1979 1521 gene locus_tag LOCUS_18830 gene infC 1979 1521 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942163.1 protein_id gnl|my_center|LOCUS_18830 4211 2331 gene locus_tag LOCUS_18840 gene thrS 4211 2331 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360261.1 protein_id gnl|my_center|LOCUS_18840 4308 4234 gene locus_tag LOCUS_t00240 4308 4234 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5168 4746 gene locus_tag LOCUS_18850 5168 4746 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958096.1 protein_id gnl|my_center|LOCUS_18850 5373 5134 gene locus_tag LOCUS_18860 5373 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 5810 6244 gene locus_tag LOCUS_18870 gene paaI 5810 6244 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391943.1 protein_id gnl|my_center|LOCUS_18870 >Feature sequence170 136 348 gene locus_tag LOCUS_18880 136 348 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878572.1 protein_id gnl|my_center|LOCUS_18880 584 919 gene locus_tag LOCUS_18890 584 919 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545820.1 protein_id gnl|my_center|LOCUS_18890 898 1218 gene locus_tag LOCUS_18900 898 1218 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546474.1 protein_id gnl|my_center|LOCUS_18900 1335 2372 gene locus_tag LOCUS_18910 1335 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458925.1 protein_id gnl|my_center|LOCUS_18910 2951 5638 gene locus_tag LOCUS_18920 2951 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 5712 6134 gene locus_tag LOCUS_18930 5712 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 >Feature sequence171 <1 865 gene locus_tag LOCUS_18940 <1 865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228677.1:long-chain fatty acid--CoA ligase 862 1605 gene locus_tag LOCUS_18950 862 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 2648 2334 gene locus_tag LOCUS_18960 2648 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 3067 2813 gene locus_tag LOCUS_18970 3067 2813 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142654.1 protein_id gnl|my_center|LOCUS_18970 3527 3387 gene locus_tag LOCUS_18980 3527 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 4335 3637 gene locus_tag LOCUS_18990 gene radC 4335 3637 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546157.1 protein_id gnl|my_center|LOCUS_18990 5734 4319 gene locus_tag LOCUS_19000 5734 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence172 3294 139 gene locus_tag LOCUS_19010 3294 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 5727 4012 gene locus_tag LOCUS_19020 gene uvrC 5727 4012 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_19020 >Feature sequence173 214 972 gene locus_tag LOCUS_19030 214 972 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680996.1 protein_id gnl|my_center|LOCUS_19030 999 3518 gene locus_tag LOCUS_19040 999 3518 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249244.1 protein_id gnl|my_center|LOCUS_19040 3532 4584 gene locus_tag LOCUS_19050 3532 4584 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_19050 4608 5456 gene locus_tag LOCUS_19060 4608 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 >Feature sequence174 398 1567 gene locus_tag LOCUS_19070 398 1567 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871084.1 protein_id gnl|my_center|LOCUS_19070 1913 3379 gene locus_tag LOCUS_19080 1913 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038124.1 protein_id gnl|my_center|LOCUS_19080 3861 3403 gene locus_tag LOCUS_19090 gene smpB 3861 3403 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545050.1 protein_id gnl|my_center|LOCUS_19090 4261 3824 gene locus_tag LOCUS_19100 4261 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 5213 4485 gene locus_tag LOCUS_19110 5213 4485 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942096.1 protein_id gnl|my_center|LOCUS_19110 5592 5996 gene locus_tag LOCUS_19120 5592 5996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 >Feature sequence175 747 1694 gene locus_tag LOCUS_19130 747 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 3602 1737 gene locus_tag LOCUS_19140 3602 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 3754 4731 gene locus_tag LOCUS_19150 gene ispG 3754 4731 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861462.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence176 371 1027 gene locus_tag LOCUS_19160 gene phoU 371 1027 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_19160 1088 1789 gene locus_tag LOCUS_19170 1088 1789 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082164.1 protein_id gnl|my_center|LOCUS_19170 1728 3602 gene locus_tag LOCUS_19180 gene phoR 1728 3602 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_19180 4769 3630 gene locus_tag LOCUS_19190 4769 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 5590 4868 gene locus_tag LOCUS_19200 5590 4868 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064452.1 protein_id gnl|my_center|LOCUS_19200 5933 5577 gene locus_tag LOCUS_19210 5933 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 >Feature sequence177 92 1702 gene locus_tag LOCUS_19220 92 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 1744 2511 gene locus_tag LOCUS_19230 1744 2511 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880557.1 protein_id gnl|my_center|LOCUS_19230 2536 3294 gene locus_tag LOCUS_19240 2536 3294 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674568.1 protein_id gnl|my_center|LOCUS_19240 3690 4193 gene locus_tag LOCUS_19250 gene nuoE 3690 4193 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817340.1 protein_id gnl|my_center|LOCUS_19250 4205 4585 gene locus_tag LOCUS_19260 4205 4585 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence178 476 778 gene locus_tag LOCUS_19270 476 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 766 1122 gene locus_tag LOCUS_19280 766 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 1380 1802 gene locus_tag LOCUS_19290 1380 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19290 1854 2045 gene locus_tag LOCUS_19300 1854 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 2092 2688 gene locus_tag LOCUS_19310 2092 2688 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599821.1 protein_id gnl|my_center|LOCUS_19310 3386 2841 gene locus_tag LOCUS_19320 3386 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 3534 4280 gene locus_tag LOCUS_19330 3534 4280 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578368.1 protein_id gnl|my_center|LOCUS_19330 >Feature sequence179 63 689 gene locus_tag LOCUS_19340 63 689 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761795.1 protein_id gnl|my_center|LOCUS_19340 692 1351 gene locus_tag LOCUS_19350 gene queC 692 1351 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533307.1 protein_id gnl|my_center|LOCUS_19350 1348 2148 gene locus_tag LOCUS_19360 gene queF 1348 2148 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771341.1 protein_id gnl|my_center|LOCUS_19360 3200 2190 gene locus_tag LOCUS_19370 3200 2190 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165476103.1 protein_id gnl|my_center|LOCUS_19370 4783 3209 gene locus_tag LOCUS_19380 4783 3209 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_19380 4930 5571 gene locus_tag LOCUS_19390 4930 5571 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546862.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence180 2058 190 gene locus_tag LOCUS_19400 2058 190 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944022.1 protein_id gnl|my_center|LOCUS_19400 3269 2058 gene locus_tag LOCUS_19410 3269 2058 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627649.1 protein_id gnl|my_center|LOCUS_19410 5282 3345 gene locus_tag LOCUS_19420 gene dnaK 5282 3345 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_19420 5901 5284 gene locus_tag LOCUS_19430 5901 5284 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069332711.1 protein_id gnl|my_center|LOCUS_19430 >Feature sequence181 524 859 gene locus_tag LOCUS_19440 524 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 844 1857 gene locus_tag LOCUS_19450 gene holA 844 1857 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392113.1 protein_id gnl|my_center|LOCUS_19450 2134 1868 gene locus_tag LOCUS_19460 gene rpsT 2134 1868 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942846.1 protein_id gnl|my_center|LOCUS_19460 2322 2753 gene locus_tag LOCUS_19470 gene pilE 2322 2753 CDS product type 4a pilus minor pilin PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094721.1 protein_id gnl|my_center|LOCUS_19470 2755 3729 gene locus_tag LOCUS_19480 gene galE 2755 3729 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964738.1 protein_id gnl|my_center|LOCUS_19480 3967 4521 gene locus_tag LOCUS_19490 3967 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 5628 4498 gene locus_tag LOCUS_19500 5628 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence182 662 1906 gene locus_tag LOCUS_19510 662 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 2038 2307 gene locus_tag LOCUS_19520 2038 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 2906 3919 gene locus_tag LOCUS_19530 2906 3919 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_19530 4240 4073 gene locus_tag LOCUS_19540 4240 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 4761 4357 gene locus_tag LOCUS_19550 4761 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 5068 4811 gene locus_tag LOCUS_19560 5068 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 >Feature sequence183 635 2098 gene locus_tag LOCUS_19570 635 2098 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022225.1 protein_id gnl|my_center|LOCUS_19570 2246 2629 gene locus_tag LOCUS_19580 2246 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 2639 3241 gene locus_tag LOCUS_19590 2639 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 3558 3995 gene locus_tag LOCUS_19600 3558 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 4013 5530 gene locus_tag LOCUS_19610 4013 5530 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950408.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence184 677 357 gene locus_tag LOCUS_19620 677 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 1239 2777 gene locus_tag LOCUS_19630 1239 2777 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228885.1 protein_id gnl|my_center|LOCUS_19630 3090 4550 gene locus_tag LOCUS_19640 gene putP 3090 4550 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886399.1 protein_id gnl|my_center|LOCUS_19640 4663 5409 gene locus_tag LOCUS_19650 4663 5409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 5422 5679 gene locus_tag LOCUS_19660 5422 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 >Feature sequence185 <1 975 gene locus_tag LOCUS_19670 <1 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461380.1:CaiB/BaiF CoA-transferase family protein 998 2455 gene locus_tag LOCUS_19680 998 2455 CDS product hydroxymethylglutaryl-CoA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_19680 2469 3677 gene locus_tag LOCUS_19690 2469 3677 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 protein_id gnl|my_center|LOCUS_19690 3701 4150 gene locus_tag LOCUS_19700 3701 4150 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086612.1 protein_id gnl|my_center|LOCUS_19700 4160 4591 gene locus_tag LOCUS_19710 4160 4591 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034360.1 protein_id gnl|my_center|LOCUS_19710 4722 5630 gene locus_tag LOCUS_19720 4722 5630 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876665.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence186 2653 578 gene locus_tag LOCUS_19730 gene glyS 2653 578 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941242.1 protein_id gnl|my_center|LOCUS_19730 3525 2650 gene locus_tag LOCUS_19740 gene glyQ 3525 2650 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392140.1 protein_id gnl|my_center|LOCUS_19740 4282 3539 gene locus_tag LOCUS_19750 4282 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 5628 4288 gene locus_tag LOCUS_19760 gene mgtE 5628 4288 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784864.1 protein_id gnl|my_center|LOCUS_19760 >Feature sequence187 1054 485 gene locus_tag LOCUS_19770 1054 485 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_19770 1382 1777 gene locus_tag LOCUS_19780 1382 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 1804 2073 gene locus_tag LOCUS_19790 1804 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 2647 3168 gene locus_tag LOCUS_19800 2647 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 3241 4317 gene locus_tag LOCUS_19810 3241 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 4453 5445 gene locus_tag LOCUS_19820 4453 5445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 >Feature sequence188 370 2394 gene locus_tag LOCUS_19830 370 2394 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405097.1 protein_id gnl|my_center|LOCUS_19830 2506 3684 gene locus_tag LOCUS_19840 gene fadA 2506 3684 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704164.1 protein_id gnl|my_center|LOCUS_19840 <5789 4409 gene locus_tag LOCUS_19850 <5789 4409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941589.1:Rne/Rng family ribonuclease >Feature sequence189 55 1455 gene locus_tag LOCUS_19860 55 1455 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890213.1 protein_id gnl|my_center|LOCUS_19860 1615 1881 gene locus_tag LOCUS_19870 1615 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 2233 2454 gene locus_tag LOCUS_19880 2233 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 2468 4357 gene locus_tag LOCUS_19890 2468 4357 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391701.1 protein_id gnl|my_center|LOCUS_19890 4369 4671 gene locus_tag LOCUS_19900 4369 4671 CDS product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762698.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence190 940 2763 gene locus_tag LOCUS_19910 940 2763 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391933.1 protein_id gnl|my_center|LOCUS_19910 2877 3296 gene locus_tag LOCUS_19920 gene rnhA 2877 3296 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084134.1 protein_id gnl|my_center|LOCUS_19920 4268 3282 gene locus_tag LOCUS_19930 4268 3282 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881003.1 protein_id gnl|my_center|LOCUS_19930 5548 4265 gene locus_tag LOCUS_19940 gene rimO 5548 4265 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_19940 >Feature sequence191 422 174 gene locus_tag LOCUS_19950 422 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 1164 412 gene locus_tag LOCUS_19960 1164 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 2199 1240 gene locus_tag LOCUS_19970 2199 1240 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254587.1 protein_id gnl|my_center|LOCUS_19970 2856 2200 gene locus_tag LOCUS_19980 2856 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 3125 2853 gene locus_tag LOCUS_19990 3125 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 3275 5419 gene locus_tag LOCUS_20000 gene priA 3275 5419 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940804.1 protein_id gnl|my_center|LOCUS_20000 >Feature sequence192 627 202 gene locus_tag LOCUS_20010 627 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 1502 729 gene locus_tag LOCUS_20020 1502 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 2128 1670 gene locus_tag LOCUS_20030 2128 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 4586 2853 gene locus_tag LOCUS_20040 4586 2853 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 protein_id gnl|my_center|LOCUS_20040 4884 5279 gene locus_tag LOCUS_20050 4884 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 >Feature sequence193 177 1157 gene locus_tag LOCUS_20060 177 1157 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_20060 1154 1729 gene locus_tag LOCUS_20070 gene rsxG 1154 1729 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339119.1 protein_id gnl|my_center|LOCUS_20070 1716 2309 gene locus_tag LOCUS_20080 1716 2309 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082951.1 protein_id gnl|my_center|LOCUS_20080 2473 3324 gene locus_tag LOCUS_20090 2473 3324 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932161.1 protein_id gnl|my_center|LOCUS_20090 3325 4728 gene locus_tag LOCUS_20100 gene gltA 3325 4728 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272418.1 protein_id gnl|my_center|LOCUS_20100 4765 5121 gene locus_tag LOCUS_20110 4765 5121 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583275.1 protein_id gnl|my_center|LOCUS_20110 >Feature sequence194 780 163 gene locus_tag LOCUS_20120 780 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 1683 817 gene locus_tag LOCUS_20130 1683 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 2881 1856 gene locus_tag LOCUS_20140 gene ruvB 2881 1856 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723536.1 protein_id gnl|my_center|LOCUS_20140 3465 2878 gene locus_tag LOCUS_20150 gene ruvA 3465 2878 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460360.1 protein_id gnl|my_center|LOCUS_20150 3950 3462 gene locus_tag LOCUS_20160 gene ruvC 3950 3462 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941736.1 protein_id gnl|my_center|LOCUS_20160 4699 3947 gene locus_tag LOCUS_20170 4699 3947 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_20170 5128 5021 gene locus_tag LOCUS_r00010 5128 5021 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence195 981 463 gene locus_tag LOCUS_20180 981 463 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682427.1 protein_id gnl|my_center|LOCUS_20180 1351 2712 gene locus_tag LOCUS_20190 1351 2712 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023751.1 protein_id gnl|my_center|LOCUS_20190 2902 3117 gene locus_tag LOCUS_20200 2902 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 3261 3410 gene locus_tag LOCUS_20210 3261 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 3560 4612 gene locus_tag LOCUS_20220 3560 4612 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868007.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence196 299 799 gene locus_tag LOCUS_20230 gene def 299 799 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_20230 796 1728 gene locus_tag LOCUS_20240 gene fmt 796 1728 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546616.1 protein_id gnl|my_center|LOCUS_20240 1788 2447 gene locus_tag LOCUS_20250 gene rpe 1788 2447 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_20250 2744 4264 gene locus_tag LOCUS_20260 2744 4264 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924857.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence197 418 1062 gene locus_tag LOCUS_20270 418 1062 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_20270 1069 1284 gene locus_tag LOCUS_20280 gene infA 1069 1284 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040194.1 protein_id gnl|my_center|LOCUS_20280 1419 1787 gene locus_tag LOCUS_20290 gene rpsM 1419 1787 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_20290 1804 2196 gene locus_tag LOCUS_20300 gene rpsK 1804 2196 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_20300 2223 2849 gene locus_tag LOCUS_20310 gene rpsD 2223 2849 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_20310 2866 3903 gene locus_tag LOCUS_20320 2866 3903 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_20320 3914 4294 gene locus_tag LOCUS_20330 3914 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 4328 5110 gene locus_tag LOCUS_20340 4328 5110 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024221.1 protein_id gnl|my_center|LOCUS_20340 >Feature sequence198 890 471 gene locus_tag LOCUS_20350 890 471 CDS product type II toxin-antitoxin system toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073053.1 protein_id gnl|my_center|LOCUS_20350 1278 883 gene locus_tag LOCUS_20360 1278 883 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065983.1 protein_id gnl|my_center|LOCUS_20360 2836 1787 gene locus_tag LOCUS_20370 2836 1787 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502152.1 protein_id gnl|my_center|LOCUS_20370 3603 4754 gene locus_tag LOCUS_20380 3603 4754 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_20380 >Feature sequence199 315 1109 gene locus_tag LOCUS_20390 gene lgt 315 1109 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545160.1 protein_id gnl|my_center|LOCUS_20390 1113 3014 gene locus_tag LOCUS_20400 1113 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 3196 4038 gene locus_tag LOCUS_20410 3196 4038 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359074.1 protein_id gnl|my_center|LOCUS_20410 4035 4784 gene locus_tag LOCUS_20420 4035 4784 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_20420 >Feature sequence200 886 62 gene locus_tag LOCUS_20430 886 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 2300 1125 gene locus_tag LOCUS_20440 2300 1125 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245114.1 protein_id gnl|my_center|LOCUS_20440 3472 2324 gene locus_tag LOCUS_20450 gene acdA 3472 2324 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242719.1 protein_id gnl|my_center|LOCUS_20450 4066 3602 gene locus_tag LOCUS_20460 4066 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 4905 4081 gene locus_tag LOCUS_20470 4905 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 >Feature sequence201 2157 166 gene locus_tag LOCUS_20480 2157 166 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_20480 2774 2175 gene locus_tag LOCUS_20490 gene pth 2774 2175 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226727.1 protein_id gnl|my_center|LOCUS_20490 3148 4431 gene locus_tag LOCUS_20500 3148 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 4500 5033 gene locus_tag LOCUS_20510 4500 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 >Feature sequence202 513 998 gene locus_tag LOCUS_20520 513 998 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810219.1 protein_id gnl|my_center|LOCUS_20520 1029 2018 gene locus_tag LOCUS_20530 1029 2018 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235014.1 protein_id gnl|my_center|LOCUS_20530 2005 2679 gene locus_tag LOCUS_20540 gene ispD 2005 2679 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_20540 2664 3155 gene locus_tag LOCUS_20550 gene ispF 2664 3155 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963756.1 protein_id gnl|my_center|LOCUS_20550 3179 4609 gene locus_tag LOCUS_20560 gene cysS 3179 4609 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546384.1 protein_id gnl|my_center|LOCUS_20560 >Feature sequence203 154 807 gene locus_tag LOCUS_20570 154 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 804 2741 gene locus_tag LOCUS_20580 804 2741 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950408.1 protein_id gnl|my_center|LOCUS_20580 2753 3181 gene locus_tag LOCUS_20590 2753 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 4898 3201 gene locus_tag LOCUS_20600 4898 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 >Feature sequence204 1089 430 gene locus_tag LOCUS_20610 1089 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 1496 1086 gene locus_tag LOCUS_20620 1496 1086 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141388.1 protein_id gnl|my_center|LOCUS_20620 2101 1487 gene locus_tag LOCUS_20630 2101 1487 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141387.1 protein_id gnl|my_center|LOCUS_20630 2829 3560 gene locus_tag LOCUS_20640 2829 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 3719 4516 gene locus_tag LOCUS_20650 3719 4516 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944018.1 protein_id gnl|my_center|LOCUS_20650 4938 4585 gene locus_tag LOCUS_20660 4938 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence205 209 943 gene locus_tag LOCUS_20670 209 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 1049 1495 gene locus_tag LOCUS_20680 1049 1495 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930868.1 protein_id gnl|my_center|LOCUS_20680 1642 1857 gene locus_tag LOCUS_20690 1642 1857 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053694.1 protein_id gnl|my_center|LOCUS_20690 1881 2108 gene locus_tag LOCUS_20700 1881 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 2105 3871 gene locus_tag LOCUS_20710 2105 3871 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869281.1 protein_id gnl|my_center|LOCUS_20710 3873 4343 gene locus_tag LOCUS_20720 3873 4343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 4350 4541 gene locus_tag LOCUS_20730 4350 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 4555 4740 gene locus_tag LOCUS_20740 4555 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence206 258 815 gene locus_tag LOCUS_20750 258 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20750 890 1486 gene locus_tag LOCUS_20760 890 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 3078 1597 gene locus_tag LOCUS_20770 3078 1597 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870120.1 protein_id gnl|my_center|LOCUS_20770 3397 4746 gene locus_tag LOCUS_20780 3397 4746 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_20780 >Feature sequence207 349 215 gene locus_tag LOCUS_20790 349 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 1241 351 gene locus_tag LOCUS_20800 1241 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 1855 1211 gene locus_tag LOCUS_20810 1855 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 2369 1950 gene locus_tag LOCUS_20820 2369 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 3317 2412 gene locus_tag LOCUS_20830 3317 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 4663 3401 gene locus_tag LOCUS_20840 4663 3401 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259419.1 protein_id gnl|my_center|LOCUS_20840 >Feature sequence208 872 2686 gene locus_tag LOCUS_20850 872 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 3360 4004 gene locus_tag LOCUS_20860 3360 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence209 80 5 gene locus_tag LOCUS_t00250 80 5 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 990 544 gene locus_tag LOCUS_20870 990 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 4120 1007 gene locus_tag LOCUS_20880 4120 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 4587 4141 gene locus_tag LOCUS_20890 4587 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence210 179 60 gene locus_tag LOCUS_20900 179 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 1945 419 gene locus_tag LOCUS_20910 gene murJ 1945 419 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816533.1 protein_id gnl|my_center|LOCUS_20910 2543 2085 gene locus_tag LOCUS_20920 2543 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 2816 2607 gene locus_tag LOCUS_20930 2816 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 3100 3954 gene locus_tag LOCUS_20940 3100 3954 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence211 1429 119 gene locus_tag LOCUS_20950 gene hslU 1429 119 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_20950 1959 1426 gene locus_tag LOCUS_20960 gene hslV 1959 1426 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081403.1 protein_id gnl|my_center|LOCUS_20960 2831 1956 gene locus_tag LOCUS_20970 gene xerC 2831 1956 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_20970 3031 3171 gene locus_tag LOCUS_20980 3031 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 3308 3646 gene locus_tag LOCUS_20990 3308 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 4250 3609 gene locus_tag LOCUS_21000 4250 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 4841 4350 gene locus_tag LOCUS_21010 4841 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 >Feature sequence212 1373 3418 gene locus_tag LOCUS_21020 1373 3418 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877847.1 protein_id gnl|my_center|LOCUS_21020 3762 4577 gene locus_tag LOCUS_21030 3762 4577 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229653.1 protein_id gnl|my_center|LOCUS_21030 4783 4649 gene locus_tag LOCUS_21040 4783 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 >Feature sequence213 537 1217 gene locus_tag LOCUS_21050 537 1217 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867423.1 protein_id gnl|my_center|LOCUS_21050 1325 2236 gene locus_tag LOCUS_21060 1325 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 2344 3549 gene locus_tag LOCUS_21070 2344 3549 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082320.1 protein_id gnl|my_center|LOCUS_21070 3652 4761 gene locus_tag LOCUS_21080 3652 4761 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_21080 >Feature sequence214 268 462 gene locus_tag LOCUS_21090 268 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 419 817 gene locus_tag LOCUS_21100 419 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21100 777 1232 gene locus_tag LOCUS_21110 777 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21110 2288 1302 gene locus_tag LOCUS_21120 2288 1302 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583008.1 protein_id gnl|my_center|LOCUS_21120 2841 2686 gene locus_tag LOCUS_21130 2841 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 3819 3025 gene locus_tag LOCUS_21140 3819 3025 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705555.1 protein_id gnl|my_center|LOCUS_21140 4375 3941 gene locus_tag LOCUS_21150 4375 3941 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017285767.1 protein_id gnl|my_center|LOCUS_21150 4629 4372 gene locus_tag LOCUS_21160 4629 4372 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141708.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence215 341 541 gene locus_tag LOCUS_21170 341 541 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129735.1 protein_id gnl|my_center|LOCUS_21170 674 874 gene locus_tag LOCUS_21180 674 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 1144 2253 gene locus_tag LOCUS_21190 gene hadC 1144 2253 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_21190 2253 3494 gene locus_tag LOCUS_21200 2253 3494 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence216 >Feature sequence217 184 1344 gene locus_tag LOCUS_21210 184 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 1360 1824 gene locus_tag LOCUS_21220 1360 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 1867 2736 gene locus_tag LOCUS_21230 1867 2736 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_21230 2806 4740 gene locus_tag LOCUS_21240 2806 4740 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_21240 >Feature sequence218 3002 3562 gene locus_tag LOCUS_21250 3002 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 4586 3714 gene locus_tag LOCUS_21260 4586 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 >Feature sequence219 509 1984 gene locus_tag LOCUS_21270 509 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 3374 2283 gene locus_tag LOCUS_21280 gene ychF 3374 2283 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242727.1 protein_id gnl|my_center|LOCUS_21280 4218 3724 gene locus_tag LOCUS_21290 4218 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 4684 4235 gene locus_tag LOCUS_21300 4684 4235 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545911.1 protein_id gnl|my_center|LOCUS_21300 >Feature sequence220 1158 145 gene locus_tag LOCUS_21310 1158 145 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114421.1 protein_id gnl|my_center|LOCUS_21310 1990 1244 gene locus_tag LOCUS_21320 1990 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 2930 2034 gene locus_tag LOCUS_21330 2930 2034 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206179.1 protein_id gnl|my_center|LOCUS_21330 3394 2963 gene locus_tag LOCUS_21340 3394 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 4693 3647 gene locus_tag LOCUS_21350 4693 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 >Feature sequence221 870 2096 gene locus_tag LOCUS_21360 870 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 2513 4156 gene locus_tag LOCUS_21370 2513 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 >Feature sequence222 874 530 gene locus_tag LOCUS_21380 874 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 1286 1017 gene locus_tag LOCUS_21390 1286 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 1521 2342 gene locus_tag LOCUS_21400 1521 2342 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868851.1 protein_id gnl|my_center|LOCUS_21400 2604 2389 gene locus_tag LOCUS_21410 2604 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 2489 3322 gene locus_tag LOCUS_21420 gene pstC 2489 3322 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791822.1 protein_id gnl|my_center|LOCUS_21420 3319 4245 gene locus_tag LOCUS_21430 gene pstA 3319 4245 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939749.1 protein_id gnl|my_center|LOCUS_21430 >Feature sequence223 354 566 gene locus_tag LOCUS_21440 354 566 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 protein_id gnl|my_center|LOCUS_21440 1872 664 gene locus_tag LOCUS_21450 1872 664 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 protein_id gnl|my_center|LOCUS_21450 3171 1939 gene locus_tag LOCUS_21460 3171 1939 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879310.1 protein_id gnl|my_center|LOCUS_21460 4613 3168 gene locus_tag LOCUS_21470 4613 3168 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879310.1 protein_id gnl|my_center|LOCUS_21470 >Feature sequence224 879 115 gene locus_tag LOCUS_21480 879 115 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206877.1 protein_id gnl|my_center|LOCUS_21480 2708 996 gene locus_tag LOCUS_21490 gene rpoD 2708 996 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_21490 4447 2705 gene locus_tag LOCUS_21500 gene dnaG 4447 2705 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943711.1 protein_id gnl|my_center|LOCUS_21500 >Feature sequence225 <1 1655 gene locus_tag LOCUS_21510 <1 1655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943492.1:DNA-directed RNA polymerase subunit beta' 1735 2106 gene locus_tag LOCUS_21520 gene rpsL 1735 2106 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_21520 2118 2591 gene locus_tag LOCUS_21530 gene rpsG 2118 2591 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385326.1 protein_id gnl|my_center|LOCUS_21530 >Feature sequence226 297 223 gene locus_tag LOCUS_t00260 297 223 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1137 391 gene locus_tag LOCUS_21540 1137 391 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443456.1 protein_id gnl|my_center|LOCUS_21540 1936 1124 gene locus_tag LOCUS_21550 1936 1124 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944016.1 protein_id gnl|my_center|LOCUS_21550 2682 1924 gene locus_tag LOCUS_21560 2682 1924 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944017.1 protein_id gnl|my_center|LOCUS_21560 2868 3371 gene locus_tag LOCUS_21570 gene mobB 2868 3371 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888886.1 protein_id gnl|my_center|LOCUS_21570 3476 4630 gene locus_tag LOCUS_21580 gene rlmI 3476 4630 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097247.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence227 1289 3 gene locus_tag LOCUS_21590 gene eno 1289 3 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_21590 1947 1321 gene locus_tag LOCUS_21600 1947 1321 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924852.1 protein_id gnl|my_center|LOCUS_21600 4411 1937 gene locus_tag LOCUS_21610 gene plsB 4411 1937 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262810.1 protein_id gnl|my_center|LOCUS_21610 >Feature sequence228 <1 525 gene locus_tag LOCUS_21620 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_131193009.1:non-ribosomal peptide synthetase note possible pseudo, internal stop codon, frameshifted >Feature sequence229 286 1524 gene locus_tag LOCUS_21630 286 1524 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878808.1 protein_id gnl|my_center|LOCUS_21630 1641 2138 gene locus_tag LOCUS_21640 1641 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 2313 3065 gene locus_tag LOCUS_21650 2313 3065 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065257.1 protein_id gnl|my_center|LOCUS_21650 4131 3427 gene locus_tag LOCUS_21660 4131 3427 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367246.1 protein_id gnl|my_center|LOCUS_21660 >Feature sequence230 11 979 gene locus_tag LOCUS_21670 11 979 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545286.1 protein_id gnl|my_center|LOCUS_21670 976 1419 gene locus_tag LOCUS_21680 gene ybeY 976 1419 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942921.1 protein_id gnl|my_center|LOCUS_21680 1475 2251 gene locus_tag LOCUS_21690 1475 2251 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802593.1 protein_id gnl|my_center|LOCUS_21690 2343 2717 gene locus_tag LOCUS_21700 gene queD 2343 2717 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942365.1 protein_id gnl|my_center|LOCUS_21700 2719 3495 gene locus_tag LOCUS_21710 gene folE2 2719 3495 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_21710 3485 4522 gene locus_tag LOCUS_21720 3485 4522 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_21720 >Feature sequence231 186 968 gene locus_tag LOCUS_21730 186 968 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020339.1 protein_id gnl|my_center|LOCUS_21730 965 2002 gene locus_tag LOCUS_21740 gene wtpC 965 2002 CDS product tungstate ABC transporter ATP-binding protein WtpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867278.1 protein_id gnl|my_center|LOCUS_21740 2738 2067 gene locus_tag LOCUS_21750 2738 2067 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143203.1 protein_id gnl|my_center|LOCUS_21750 3435 2740 gene locus_tag LOCUS_21760 3435 2740 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392265.1 protein_id gnl|my_center|LOCUS_21760 4051 4542 gene locus_tag LOCUS_21770 4051 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 >Feature sequence232 595 1551 gene locus_tag LOCUS_21780 595 1551 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021942.1 protein_id gnl|my_center|LOCUS_21780 1548 3866 gene locus_tag LOCUS_21790 1548 3866 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_21790 4520 3918 gene locus_tag LOCUS_21800 4520 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 >Feature sequence233 146 1003 gene locus_tag LOCUS_21810 146 1003 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_21810 1000 2637 gene locus_tag LOCUS_21820 gene recN 1000 2637 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583410.1 protein_id gnl|my_center|LOCUS_21820 2826 3275 gene locus_tag LOCUS_21830 2826 3275 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546022.1 protein_id gnl|my_center|LOCUS_21830 >Feature sequence234 1474 821 gene locus_tag LOCUS_21840 gene elyC 1474 821 CDS product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457224.1 protein_id gnl|my_center|LOCUS_21840 2677 1736 gene locus_tag LOCUS_21850 2677 1736 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228479.1 protein_id gnl|my_center|LOCUS_21850 4344 2707 gene locus_tag LOCUS_21860 4344 2707 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584072.1 protein_id gnl|my_center|LOCUS_21860 >Feature sequence235 324 1088 gene locus_tag LOCUS_21870 gene rpoH 324 1088 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941316.1 protein_id gnl|my_center|LOCUS_21870 2457 1126 gene locus_tag LOCUS_21880 gene dnaB 2457 1126 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391682.1 protein_id gnl|my_center|LOCUS_21880 2906 2460 gene locus_tag LOCUS_21890 gene rplI 2906 2460 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_21890 3478 2903 gene locus_tag LOCUS_21900 3478 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 4082 3825 gene locus_tag LOCUS_21910 4082 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 4450 4082 gene locus_tag LOCUS_21920 gene rpsF 4450 4082 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941326.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence236 1060 1992 gene locus_tag LOCUS_21930 1060 1992 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080469.1 protein_id gnl|my_center|LOCUS_21930 2143 3789 gene locus_tag LOCUS_21940 2143 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 3786 4430 gene locus_tag LOCUS_21950 3786 4430 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_21950 >Feature sequence237 1091 123 gene locus_tag LOCUS_21960 1091 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 3645 1123 gene locus_tag LOCUS_21970 3645 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 4137 3799 gene locus_tag LOCUS_21980 4137 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 >Feature sequence238 568 83 gene locus_tag LOCUS_21990 568 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 1736 705 gene locus_tag LOCUS_22000 gene argC 1736 705 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_22000 2138 1743 gene locus_tag LOCUS_22010 gene rpsI 2138 1743 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162424.1 protein_id gnl|my_center|LOCUS_22010 2583 2155 gene locus_tag LOCUS_22020 gene rplM 2583 2155 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583377.1 protein_id gnl|my_center|LOCUS_22020 2718 3989 gene locus_tag LOCUS_22030 gene serS 2718 3989 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940715.1 protein_id gnl|my_center|LOCUS_22030 4002 4089 gene locus_tag LOCUS_t00270 4002 4089 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4123 4215 gene locus_tag LOCUS_t00280 4123 4215 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence239 124 1257 gene locus_tag LOCUS_22040 124 1257 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_22040 1324 2583 gene locus_tag LOCUS_22050 1324 2583 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938700.1 protein_id gnl|my_center|LOCUS_22050 3090 2572 gene locus_tag LOCUS_22060 3090 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 3944 3180 gene locus_tag LOCUS_22070 3944 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 4452 3937 gene locus_tag LOCUS_22080 4452 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 >Feature sequence240 145 435 gene locus_tag LOCUS_22090 145 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 438 863 gene locus_tag LOCUS_22100 438 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 871 1641 gene locus_tag LOCUS_22110 871 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 1638 1916 gene locus_tag LOCUS_22120 1638 1916 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811967.1 protein_id gnl|my_center|LOCUS_22120 3194 1959 gene locus_tag LOCUS_22130 3194 1959 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086334.1 protein_id gnl|my_center|LOCUS_22130 3952 3206 gene locus_tag LOCUS_22140 3952 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 >Feature sequence241 2152 281 gene locus_tag LOCUS_22150 2152 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 3527 2322 gene locus_tag LOCUS_22160 gene rlmD 3527 2322 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268593.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence242 321 115 gene locus_tag LOCUS_22170 321 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 215 1291 gene locus_tag LOCUS_22180 gene yedE 215 1291 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392953.1 protein_id gnl|my_center|LOCUS_22180 1293 1856 gene locus_tag LOCUS_22190 1293 1856 CDS product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545577.1 protein_id gnl|my_center|LOCUS_22190 1951 2859 gene locus_tag LOCUS_22200 1951 2859 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392951.1 protein_id gnl|my_center|LOCUS_22200 2951 3172 gene locus_tag LOCUS_22210 2951 3172 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392950.1 protein_id gnl|my_center|LOCUS_22210 >Feature sequence243 619 1338 gene locus_tag LOCUS_22220 619 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 3206 2457 gene locus_tag LOCUS_22230 3206 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 3428 3604 gene locus_tag LOCUS_22240 3428 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 3829 4323 gene locus_tag LOCUS_22250 3829 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 >Feature sequence244 947 1393 gene locus_tag LOCUS_22260 947 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 2672 1713 gene locus_tag LOCUS_22270 2672 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 2919 3236 gene locus_tag LOCUS_22280 gene sugE 2919 3236 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123025.1 protein_id gnl|my_center|LOCUS_22280 3467 3664 gene locus_tag LOCUS_22290 3467 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 3675 4082 gene locus_tag LOCUS_22300 3675 4082 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence245 678 1784 gene locus_tag LOCUS_22310 678 1784 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519616.1 protein_id gnl|my_center|LOCUS_22310 2572 1841 gene locus_tag LOCUS_22320 2572 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 3691 2744 gene locus_tag LOCUS_22330 3691 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence246 80 373 gene locus_tag LOCUS_22340 80 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 377 742 gene locus_tag LOCUS_22350 377 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 1726 1406 gene locus_tag LOCUS_22360 1726 1406 CDS product TRL-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182479.1 protein_id gnl|my_center|LOCUS_22360 3988 2765 gene locus_tag LOCUS_22370 3988 2765 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_22370 4365 4290 gene locus_tag LOCUS_t00290 4365 4290 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence247 1101 796 gene locus_tag LOCUS_22380 1101 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 1426 1091 gene locus_tag LOCUS_22390 1426 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 1696 2061 gene locus_tag LOCUS_22400 1696 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 2039 3058 gene locus_tag LOCUS_22410 2039 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 >Feature sequence248 1910 39 gene locus_tag LOCUS_22420 1910 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 2441 2292 gene locus_tag LOCUS_22430 2441 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 3189 3386 gene locus_tag LOCUS_22440 3189 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 3402 3521 gene locus_tag LOCUS_22450 3402 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 3686 3919 gene locus_tag LOCUS_22460 3686 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 3924 4154 gene locus_tag LOCUS_22470 3924 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 >Feature sequence249 258 1583 gene locus_tag LOCUS_22480 gene glnA 258 1583 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545065.1 protein_id gnl|my_center|LOCUS_22480 1600 2823 gene locus_tag LOCUS_22490 1600 2823 CDS product asparagine synthetase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250501.1 protein_id gnl|my_center|LOCUS_22490 3637 2858 gene locus_tag LOCUS_22500 gene hisF 3637 2858 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937595.1 protein_id gnl|my_center|LOCUS_22500 4241 3627 gene locus_tag LOCUS_22510 gene hisH 4241 3627 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937594.1 protein_id gnl|my_center|LOCUS_22510 >Feature sequence250 3 170 gene locus_tag LOCUS_22520 3 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 167 916 gene locus_tag LOCUS_22530 167 916 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879714.1 protein_id gnl|my_center|LOCUS_22530 913 1440 gene locus_tag LOCUS_22540 gene folK 913 1440 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809749.1 protein_id gnl|my_center|LOCUS_22540 1397 2869 gene locus_tag LOCUS_22550 1397 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 3207 3584 gene locus_tag LOCUS_22560 3207 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 3586 4137 gene locus_tag LOCUS_22570 gene pgsA 3586 4137 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939132.1 protein_id gnl|my_center|LOCUS_22570 >Feature sequence251 2362 83 gene locus_tag LOCUS_22580 2362 83 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296458.1 protein_id gnl|my_center|LOCUS_22580 2855 2415 gene locus_tag LOCUS_22590 2855 2415 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475872.1 protein_id gnl|my_center|LOCUS_22590 3058 2855 gene locus_tag LOCUS_22600 gene rpsU 3058 2855 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943714.1 protein_id gnl|my_center|LOCUS_22600 3217 4113 gene locus_tag LOCUS_22610 3217 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 4116 4247 gene locus_tag LOCUS_22620 4116 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 >Feature sequence252 2364 934 gene locus_tag LOCUS_22630 2364 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 2462 3667 gene locus_tag LOCUS_22640 2462 3667 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence253 1037 399 gene locus_tag LOCUS_22650 1037 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 1096 1575 gene locus_tag LOCUS_22660 1096 1575 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107679.1 protein_id gnl|my_center|LOCUS_22660 3156 1621 gene locus_tag LOCUS_22670 3156 1621 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878630.1 protein_id gnl|my_center|LOCUS_22670 3822 3391 gene locus_tag LOCUS_22680 3822 3391 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403909.1 protein_id gnl|my_center|LOCUS_22680 >Feature sequence254 1755 187 gene locus_tag LOCUS_22690 1755 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 4056 1756 gene locus_tag LOCUS_22700 4056 1756 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943755.1 protein_id gnl|my_center|LOCUS_22700 >Feature sequence255 1115 282 gene locus_tag LOCUS_22710 1115 282 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065531.1 protein_id gnl|my_center|LOCUS_22710 2145 1156 gene locus_tag LOCUS_22720 gene hisC 2145 1156 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152940674.1 protein_id gnl|my_center|LOCUS_22720 3245 2139 gene locus_tag LOCUS_22730 3245 2139 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146565.1 protein_id gnl|my_center|LOCUS_22730 3701 4108 gene locus_tag LOCUS_22740 3701 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 >Feature sequence256 3911 2406 gene locus_tag LOCUS_22750 3911 2406 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185142.1 protein_id gnl|my_center|LOCUS_22750 >Feature sequence257 1335 229 gene locus_tag LOCUS_22760 gene dcyD 1335 229 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365903.1 protein_id gnl|my_center|LOCUS_22760 2693 1335 gene locus_tag LOCUS_22770 2693 1335 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073788.1 protein_id gnl|my_center|LOCUS_22770 3614 2715 gene locus_tag LOCUS_22780 3614 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 >Feature sequence258 1894 614 gene locus_tag LOCUS_22790 1894 614 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877874.1 protein_id gnl|my_center|LOCUS_22790 2822 1998 gene locus_tag LOCUS_22800 2822 1998 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249654.1 protein_id gnl|my_center|LOCUS_22800 <4158 3584 gene locus_tag LOCUS_22810 <4158 3584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387873.1:prepilin-type N-terminal cleavage/methylation domain-containing protein >Feature sequence259 106 489 gene locus_tag LOCUS_22820 106 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 550 2157 gene locus_tag LOCUS_22830 550 2157 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892286.1 protein_id gnl|my_center|LOCUS_22830 2338 3600 gene locus_tag LOCUS_22840 2338 3600 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064343.1 protein_id gnl|my_center|LOCUS_22840 >Feature sequence260 534 1106 gene locus_tag LOCUS_22850 534 1106 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391492.1 protein_id gnl|my_center|LOCUS_22850 1647 2144 gene locus_tag LOCUS_22860 1647 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 2397 2690 gene locus_tag LOCUS_22870 2397 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 3948 2863 gene locus_tag LOCUS_22880 gene serC 3948 2863 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_22880 >Feature sequence261 376 1002 gene locus_tag LOCUS_22890 376 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 1006 1410 gene locus_tag LOCUS_22900 1006 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 1424 2653 gene locus_tag LOCUS_22910 1424 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 >Feature sequence262 239 3037 gene locus_tag LOCUS_22920 gene ileS 239 3037 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_22920 3073 3531 gene locus_tag LOCUS_22930 gene lspA 3073 3531 CDS product lipoprotein signal peptidase LspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642181.1 protein_id gnl|my_center|LOCUS_22930 >Feature sequence263 1555 1782 gene locus_tag LOCUS_22940 1555 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 1906 2205 gene locus_tag LOCUS_22950 1906 2205 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971059.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence264 1105 665 gene locus_tag LOCUS_22960 1105 665 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_22960 1991 1122 gene locus_tag LOCUS_22970 gene rpoH 1991 1122 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388865.1 protein_id gnl|my_center|LOCUS_22970 2152 3687 gene locus_tag LOCUS_22980 2152 3687 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941675.1 protein_id gnl|my_center|LOCUS_22980 >Feature sequence265 857 1459 gene locus_tag LOCUS_22990 857 1459 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_22990 1500 2981 gene locus_tag LOCUS_23000 gene lcfB 1500 2981 CDS product long-chain-fatty-acid--CoA ligase LcfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244686.1 protein_id gnl|my_center|LOCUS_23000 3107 3889 gene locus_tag LOCUS_23010 3107 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 >Feature sequence266 747 25 gene locus_tag LOCUS_23020 747 25 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966337.1 protein_id gnl|my_center|LOCUS_23020 1817 744 gene locus_tag LOCUS_23030 1817 744 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966338.1 protein_id gnl|my_center|LOCUS_23030 3213 2077 gene locus_tag LOCUS_23040 3213 2077 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081178.1 protein_id gnl|my_center|LOCUS_23040 <3919 3206 gene locus_tag LOCUS_23050 <3919 3206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081181.1:alkaline phosphatase family protein >Feature sequence267 1002 88 gene locus_tag LOCUS_23060 gene selD 1002 88 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_23060 2565 1612 gene locus_tag LOCUS_23070 2565 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 2913 2740 gene locus_tag LOCUS_23080 2913 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 3217 3011 gene locus_tag LOCUS_23090 3217 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 3745 3302 gene locus_tag LOCUS_23100 3745 3302 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_23100 >Feature sequence268 153 494 gene locus_tag LOCUS_23110 153 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 568 2151 gene locus_tag LOCUS_23120 568 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 2214 2831 gene locus_tag LOCUS_23130 gene cobC 2214 2831 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914029.1 protein_id gnl|my_center|LOCUS_23130 2988 3836 gene locus_tag LOCUS_23140 2988 3836 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073501.1 protein_id gnl|my_center|LOCUS_23140 >Feature sequence269 1384 656 gene locus_tag LOCUS_23150 1384 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 3684 1321 gene locus_tag LOCUS_23160 gene pheT 3684 1321 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_23160 >Feature sequence270 189 1937 gene locus_tag LOCUS_23170 189 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 1954 3798 gene locus_tag LOCUS_23180 1954 3798 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094018.1 protein_id gnl|my_center|LOCUS_23180 >Feature sequence271 <1 837 gene locus_tag LOCUS_23190 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001130104.1:ATP-binding protein 876 1199 gene locus_tag LOCUS_23200 876 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 1199 2092 gene locus_tag LOCUS_23210 1199 2092 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943212.1 protein_id gnl|my_center|LOCUS_23210 2079 3368 gene locus_tag LOCUS_23220 2079 3368 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188702.1 protein_id gnl|my_center|LOCUS_23220 >Feature sequence272 624 749 gene locus_tag LOCUS_23230 624 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 897 1301 gene locus_tag LOCUS_23240 897 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 1274 1594 gene locus_tag LOCUS_23250 1274 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 1692 2276 gene locus_tag LOCUS_23260 1692 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 2251 2451 gene locus_tag LOCUS_23270 2251 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 2582 3244 gene locus_tag LOCUS_23280 gene cas4 2582 3244 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879370.1 protein_id gnl|my_center|LOCUS_23280 3398 >3854 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttatgatgggacatccactaaaacaaggattgaaac >Feature sequence273 1589 252 gene locus_tag LOCUS_23290 1589 252 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002097553.1 protein_id gnl|my_center|LOCUS_23290 3345 1717 gene locus_tag LOCUS_23300 3345 1717 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261594.1 protein_id gnl|my_center|LOCUS_23300 >Feature sequence274 277 1284 gene locus_tag LOCUS_23310 277 1284 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_23310 2321 1272 gene locus_tag LOCUS_23320 2321 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 3540 2716 gene locus_tag LOCUS_23330 3540 2716 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731225.1 protein_id gnl|my_center|LOCUS_23330 >Feature sequence275 149 604 gene locus_tag LOCUS_23340 149 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 675 1250 gene locus_tag LOCUS_23350 675 1250 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879195.1 protein_id gnl|my_center|LOCUS_23350 1231 1533 gene locus_tag LOCUS_23360 1231 1533 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846653.1 protein_id gnl|my_center|LOCUS_23360 1541 2740 gene locus_tag LOCUS_23370 1541 2740 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250930.1 protein_id gnl|my_center|LOCUS_23370 2752 3654 gene locus_tag LOCUS_23380 gene porB 2752 3654 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762255.1 protein_id gnl|my_center|LOCUS_23380 >Feature sequence276 136 1284 gene locus_tag LOCUS_23390 gene acdA 136 1284 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_23390 1297 2472 gene locus_tag LOCUS_23400 1297 2472 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245114.1 protein_id gnl|my_center|LOCUS_23400 2497 2937 gene locus_tag LOCUS_23410 2497 2937 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029784.1 protein_id gnl|my_center|LOCUS_23410 2952 3347 gene locus_tag LOCUS_23420 2952 3347 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_23420 >Feature sequence277 565 1668 gene locus_tag LOCUS_23430 565 1668 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_23430 1668 2591 gene locus_tag LOCUS_23440 1668 2591 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880377.1 protein_id gnl|my_center|LOCUS_23440 2578 3525 gene locus_tag LOCUS_23450 gene dusB 2578 3525 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941670.1 protein_id gnl|my_center|LOCUS_23450 >Feature sequence278 405 2270 gene locus_tag LOCUS_23460 405 2270 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970940.1 protein_id gnl|my_center|LOCUS_23460 2383 3312 gene locus_tag LOCUS_23470 2383 3312 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085927.1 protein_id gnl|my_center|LOCUS_23470 >Feature sequence279 194 1165 gene locus_tag LOCUS_23480 194 1165 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_23480 2140 1280 gene locus_tag LOCUS_23490 2140 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 3663 2248 gene locus_tag LOCUS_23500 3663 2248 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249895.1 protein_id gnl|my_center|LOCUS_23500 >Feature sequence280 1055 465 gene locus_tag LOCUS_23510 1055 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 1416 2837 gene locus_tag LOCUS_23520 1416 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 2839 3546 gene locus_tag LOCUS_23530 2839 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 >Feature sequence281 1212 124 gene locus_tag LOCUS_23540 1212 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 2717 1680 gene locus_tag LOCUS_23550 2717 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 3371 2955 gene locus_tag LOCUS_23560 3371 2955 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081009.1 protein_id gnl|my_center|LOCUS_23560 >Feature sequence282 174 1391 gene locus_tag LOCUS_23570 174 1391 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868852.1 protein_id gnl|my_center|LOCUS_23570 1407 1781 gene locus_tag LOCUS_23580 1407 1781 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937449.1 protein_id gnl|my_center|LOCUS_23580 1789 2643 gene locus_tag LOCUS_23590 1789 2643 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_23590 2630 3319 gene locus_tag LOCUS_23600 2630 3319 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259746.1 protein_id gnl|my_center|LOCUS_23600 >Feature sequence283 407 24 gene locus_tag LOCUS_23610 gene rplL 407 24 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943494.1 protein_id gnl|my_center|LOCUS_23610 944 420 gene locus_tag LOCUS_23620 gene rplJ 944 420 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943495.1 protein_id gnl|my_center|LOCUS_23620 1775 1071 gene locus_tag LOCUS_23630 gene rplA 1775 1071 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_23630 2215 1790 gene locus_tag LOCUS_23640 gene rplK 2215 1790 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940184.1 protein_id gnl|my_center|LOCUS_23640 2762 2232 gene locus_tag LOCUS_23650 gene nusG 2762 2232 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_23650 2951 2769 gene locus_tag LOCUS_23660 2951 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 3050 2974 gene locus_tag LOCUS_t00300 3050 2974 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence284 619 140 gene locus_tag LOCUS_23670 619 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 1746 916 gene locus_tag LOCUS_23680 1746 916 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_23680 2540 1788 gene locus_tag LOCUS_23690 2540 1788 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_23690 3368 2547 gene locus_tag LOCUS_23700 3368 2547 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876243.1 protein_id gnl|my_center|LOCUS_23700 >Feature sequence285 388 2199 gene locus_tag LOCUS_23710 388 2199 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_23710 3311 2472 gene locus_tag LOCUS_23720 3311 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 >Feature sequence286 338 1150 gene locus_tag LOCUS_23730 338 1150 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022831.1 protein_id gnl|my_center|LOCUS_23730 1703 2023 gene locus_tag LOCUS_23740 1703 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 2151 2336 gene locus_tag LOCUS_23750 2151 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 2326 2847 gene locus_tag LOCUS_23760 2326 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 2926 3216 gene locus_tag LOCUS_23770 2926 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 >Feature sequence287 716 126 gene locus_tag LOCUS_23780 716 126 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_23780 1447 713 gene locus_tag LOCUS_23790 gene rph 1447 713 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942439.1 protein_id gnl|my_center|LOCUS_23790 2123 1989 gene locus_tag LOCUS_23800 2123 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 2161 3177 gene locus_tag LOCUS_23810 2161 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 >Feature sequence288 1655 294 gene locus_tag LOCUS_23820 1655 294 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_23820 <3429 1671 gene locus_tag LOCUS_23830 <3429 1671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_188106780.1:PAS domain S-box protein note possible pseudo, internal stop codon >Feature sequence289 953 420 gene locus_tag LOCUS_23840 953 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 1735 1028 gene locus_tag LOCUS_23850 1735 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:complement(1481..1483),aa:Sec) note codon on position 85 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_23850 2262 1768 gene locus_tag LOCUS_23860 2262 1768 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876457.1 protein_id gnl|my_center|LOCUS_23860 3104 2277 gene locus_tag LOCUS_23870 3104 2277 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870308.1 protein_id gnl|my_center|LOCUS_23870 >Feature sequence290 907 293 gene locus_tag LOCUS_23880 gene cbiM 907 293 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938357.1 protein_id gnl|my_center|LOCUS_23880 1673 915 gene locus_tag LOCUS_23890 1673 915 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546093.1 protein_id gnl|my_center|LOCUS_23890 1940 2410 gene locus_tag LOCUS_23900 1940 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 3109 2660 gene locus_tag LOCUS_23910 3109 2660 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785477.1 protein_id gnl|my_center|LOCUS_23910 >Feature sequence291 62 2185 gene locus_tag LOCUS_23920 62 2185 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_23920 2300 2857 gene locus_tag LOCUS_23930 2300 2857 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023653.1 protein_id gnl|my_center|LOCUS_23930 >Feature sequence292 706 1590 gene locus_tag LOCUS_23940 gene pdxS 706 1590 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258093.1 protein_id gnl|my_center|LOCUS_23940 1591 1935 gene locus_tag LOCUS_23950 1591 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23950 1959 2216 gene locus_tag LOCUS_23960 1959 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23960 <3193 2432 gene locus_tag LOCUS_23970 <3193 2432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938201.1:tetratricopeptide repeat protein >Feature sequence293 855 349 gene locus_tag LOCUS_23980 855 349 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975654.1 protein_id gnl|my_center|LOCUS_23980 1300 890 gene locus_tag LOCUS_23990 1300 890 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207691809.1 protein_id gnl|my_center|LOCUS_23990 1763 1320 gene locus_tag LOCUS_24000 1763 1320 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922319.1 protein_id gnl|my_center|LOCUS_24000 2088 2891 gene locus_tag LOCUS_24010 2088 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence294 1244 2296 gene locus_tag LOCUS_24020 1244 2296 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546236.1 protein_id gnl|my_center|LOCUS_24020 2583 2398 gene locus_tag LOCUS_24030 2583 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 >Feature sequence295 369 2015 gene locus_tag LOCUS_24040 369 2015 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392775.1 protein_id gnl|my_center|LOCUS_24040 2386 2964 gene locus_tag LOCUS_24050 2386 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 >Feature sequence296 <1 890 gene locus_tag LOCUS_24060 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081951.1:FAD:protein FMN transferase 2292 1135 gene locus_tag LOCUS_24070 2292 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 2932 2369 gene locus_tag LOCUS_24080 2932 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 >Feature sequence297 223 309 gene locus_tag LOCUS_t00310 223 309 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2692 563 gene locus_tag LOCUS_24090 2692 563 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_24090 >Feature sequence298 1340 216 gene locus_tag LOCUS_24100 1340 216 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_24100 2151 1342 gene locus_tag LOCUS_24110 2151 1342 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583559.1 protein_id gnl|my_center|LOCUS_24110 2867 2148 gene locus_tag LOCUS_24120 gene uppS 2867 2148 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655860.1 protein_id gnl|my_center|LOCUS_24120 >Feature sequence299 422 1741 gene locus_tag LOCUS_24130 422 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 <3040 1851 gene locus_tag LOCUS_24140 <3040 1851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120624.1:alkaline phosphatase D family protein >Feature sequence300 1179 424 gene locus_tag LOCUS_24150 1179 424 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720577.1 protein_id gnl|my_center|LOCUS_24150 1279 2448 gene locus_tag LOCUS_24160 1279 2448 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869387.1 protein_id gnl|my_center|LOCUS_24160 2780 2460 gene locus_tag LOCUS_24170 2780 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 2967 2767 gene locus_tag LOCUS_24180 2967 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 >Feature sequence301 107 808 gene locus_tag LOCUS_24190 107 808 CDS product START domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104390.1 protein_id gnl|my_center|LOCUS_24190 2774 1062 gene locus_tag LOCUS_24200 2774 1062 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414744.1 protein_id gnl|my_center|LOCUS_24200 >Feature sequence302 351 2273 gene locus_tag LOCUS_24210 gene rnr 351 2273 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942131.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence303 226 1560 gene locus_tag LOCUS_24220 gene accC 226 1560 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583402.1 protein_id gnl|my_center|LOCUS_24220 1608 2777 gene locus_tag LOCUS_24230 gene norA 1608 2777 CDS product multidrug efflux MFS transporter NorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041274.1 protein_id gnl|my_center|LOCUS_24230 >Feature sequence304 <1 1375 gene locus_tag LOCUS_24240 <1 1375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014877518.1:acyl-CoA synthetase 1562 1972 gene locus_tag LOCUS_24250 1562 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 1902 2261 gene locus_tag LOCUS_24260 1902 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 >Feature sequence305 1484 354 gene locus_tag LOCUS_24270 1484 354 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249414.1 protein_id gnl|my_center|LOCUS_24270 2844 1855 gene locus_tag LOCUS_24280 2844 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 >Feature sequence306 346 1356 gene locus_tag LOCUS_24290 346 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 2422 1448 gene locus_tag LOCUS_24300 2422 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 2717 2463 gene locus_tag LOCUS_24310 2717 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 >Feature sequence307 804 79 gene locus_tag LOCUS_24320 804 79 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062281989.1 protein_id gnl|my_center|LOCUS_24320 2020 797 gene locus_tag LOCUS_24330 2020 797 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392801.1 protein_id gnl|my_center|LOCUS_24330 >Feature sequence308 349 2325 gene locus_tag LOCUS_24340 349 2325 CDS product siderophore amonabactin TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705839.1 protein_id gnl|my_center|LOCUS_24340 >Feature sequence309 326 1411 gene locus_tag LOCUS_24350 326 1411 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986862.1 protein_id gnl|my_center|LOCUS_24350 1424 1897 gene locus_tag LOCUS_24360 1424 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270476.1 protein_id gnl|my_center|LOCUS_24360 2324 2506 gene locus_tag LOCUS_24370 2324 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 >Feature sequence310 133 357 gene locus_tag LOCUS_24380 133 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 380 2659 gene locus_tag LOCUS_24390 gene metE 380 2659 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404021.1 protein_id gnl|my_center|LOCUS_24390 >Feature sequence311 279 1544 gene locus_tag LOCUS_24400 279 1544 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_24400 1551 1997 gene locus_tag LOCUS_24410 1551 1997 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496977.1 protein_id gnl|my_center|LOCUS_24410 2104 2259 gene locus_tag LOCUS_24420 2104 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 >Feature sequence312 1120 2244 gene locus_tag LOCUS_24430 1120 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 2465 2632 gene locus_tag LOCUS_24440 2465 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 >Feature sequence313 118 1089 gene locus_tag LOCUS_24450 118 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 1210 2136 gene locus_tag LOCUS_24460 1210 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 2515 2216 gene locus_tag LOCUS_24470 2515 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 >Feature sequence314 1168 116 gene locus_tag LOCUS_24480 1168 116 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225238.1 protein_id gnl|my_center|LOCUS_24480 2523 1336 gene locus_tag LOCUS_24490 2523 1336 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582733.1 protein_id gnl|my_center|LOCUS_24490 >Feature sequence315 <1 1114 gene locus_tag LOCUS_24500 <1 1114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228378.1:DUF1156 domain-containing protein 1115 1639 gene locus_tag LOCUS_24510 1115 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 1845 2240 gene locus_tag LOCUS_24520 1845 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 >Feature sequence316 282 46 gene locus_tag LOCUS_24530 282 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 963 733 gene locus_tag LOCUS_24540 963 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 2046 1807 gene locus_tag LOCUS_24550 2046 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 2188 2015 gene locus_tag LOCUS_24560 2188 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 >Feature sequence317 1046 375 gene locus_tag LOCUS_24570 1046 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 1489 1803 gene locus_tag LOCUS_24580 1489 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 2275 1829 gene locus_tag LOCUS_24590 2275 1829 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392208.1 protein_id gnl|my_center|LOCUS_24590 >Feature sequence318 266 1786 gene locus_tag LOCUS_24600 266 1786 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583645.1 protein_id gnl|my_center|LOCUS_24600 2267 2037 gene locus_tag LOCUS_24610 2267 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610