>Feature sequence001 2105 207 gene locus_tag LOCUS_0010 gene rqcH 2105 207 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867817.1 protein_id gnl|my_center|LOCUS_0010 2157 2420 gene locus_tag LOCUS_0020 2157 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0020 2950 2417 gene locus_tag LOCUS_0030 gene cobO 2950 2417 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942222.1 protein_id gnl|my_center|LOCUS_0030 4718 3054 gene locus_tag LOCUS_0040 gene thsB 4718 3054 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879727.1 protein_id gnl|my_center|LOCUS_0040 5816 4767 gene locus_tag LOCUS_0050 5816 4767 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877877.1 protein_id gnl|my_center|LOCUS_0050 5868 6374 gene locus_tag LOCUS_0060 gene endA 5868 6374 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868793.1 protein_id gnl|my_center|LOCUS_0060 6410 7204 gene locus_tag LOCUS_0070 6410 7204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0070 7236 8435 gene locus_tag LOCUS_0080 7236 8435 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870398.1 protein_id gnl|my_center|LOCUS_0080 8432 8779 gene locus_tag LOCUS_0090 8432 8779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0090 8799 9806 gene locus_tag LOCUS_0100 gene moaA 8799 9806 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251175.1 protein_id gnl|my_center|LOCUS_0100 9936 9748 gene locus_tag LOCUS_0110 9936 9748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0110 10025 10471 gene locus_tag LOCUS_0120 gene moaC 10025 10471 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978449.1 protein_id gnl|my_center|LOCUS_0120 10449 10973 gene locus_tag LOCUS_0130 10449 10973 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980400.1 protein_id gnl|my_center|LOCUS_0130 11017 12384 gene locus_tag LOCUS_0140 11017 12384 CDS product RuvB-like helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867485.1 protein_id gnl|my_center|LOCUS_0140 12422 12874 gene locus_tag LOCUS_0150 12422 12874 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870197.1 protein_id gnl|my_center|LOCUS_0150 12884 13138 gene locus_tag LOCUS_0160 12884 13138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0160 13171 13329 gene locus_tag LOCUS_0170 13171 13329 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979417.1 protein_id gnl|my_center|LOCUS_0170 13331 13591 gene locus_tag LOCUS_0180 13331 13591 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320031.1 protein_id gnl|my_center|LOCUS_0180 14066 13593 gene locus_tag LOCUS_0190 14066 13593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0190 14152 14532 gene locus_tag LOCUS_0200 14152 14532 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876368.1 protein_id gnl|my_center|LOCUS_0200 15022 14480 gene locus_tag LOCUS_0210 15022 14480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0210 15096 15962 gene locus_tag LOCUS_0220 15096 15962 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940941.1 protein_id gnl|my_center|LOCUS_0220 15959 16231 gene locus_tag LOCUS_0230 15959 16231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0230 16257 17405 gene locus_tag LOCUS_0240 16257 17405 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879620.1 protein_id gnl|my_center|LOCUS_0240 18102 17392 gene locus_tag LOCUS_0250 18102 17392 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249663.1 protein_id gnl|my_center|LOCUS_0250 18177 19817 gene locus_tag LOCUS_0260 18177 19817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0260 19826 20374 gene locus_tag LOCUS_0270 19826 20374 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146776.1 protein_id gnl|my_center|LOCUS_0270 20359 20742 gene locus_tag LOCUS_0280 20359 20742 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978945.1 protein_id gnl|my_center|LOCUS_0280 20759 22072 gene locus_tag LOCUS_0290 gene glyA 20759 22072 CDS product bifunctional serine hydroxymethyltransferase/L-allo-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871121.1 protein_id gnl|my_center|LOCUS_0290 22102 22425 gene locus_tag LOCUS_0300 22102 22425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0300 23175 22414 gene locus_tag LOCUS_0310 23175 22414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0310 >Feature sequence002 <1 1979 gene locus_tag LOCUS_0320 <1 1979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879160.1:vitamin B12-dependent ribonucleotide reductase 1957 2697 gene locus_tag LOCUS_0330 1957 2697 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318933.1 protein_id gnl|my_center|LOCUS_0330 2728 2958 gene locus_tag LOCUS_0340 2728 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0340 3271 2930 gene locus_tag LOCUS_0350 3271 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0350 3478 3332 gene locus_tag LOCUS_0360 3478 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0360 5191 3602 gene locus_tag LOCUS_0370 5191 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0370 5275 5454 gene locus_tag LOCUS_0380 5275 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0380 5494 5817 gene locus_tag LOCUS_0390 5494 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0390 5901 6155 gene locus_tag LOCUS_0400 5901 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0400 6321 6109 gene locus_tag LOCUS_0410 6321 6109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0410 6373 6621 gene locus_tag LOCUS_0420 6373 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0420 6605 7726 gene locus_tag LOCUS_0430 6605 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0430 7765 9174 gene locus_tag LOCUS_0440 7765 9174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0440 9197 9499 gene locus_tag LOCUS_0450 9197 9499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0450 9496 9909 gene locus_tag LOCUS_0460 9496 9909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0460 10321 9890 gene locus_tag LOCUS_0470 10321 9890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0470 11038 10418 gene locus_tag LOCUS_0480 gene cdvB1/B2 11038 10418 CDS product cell division protein CdvB1/B2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979256.1 protein_id gnl|my_center|LOCUS_0480 11548 11099 gene locus_tag LOCUS_0490 11548 11099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0490 12726 11548 gene locus_tag LOCUS_0500 12726 11548 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250771.1 protein_id gnl|my_center|LOCUS_0500 12800 13435 gene locus_tag LOCUS_0510 12800 13435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0510 13449 14249 gene locus_tag LOCUS_0520 13449 14249 CDS product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250494.1 protein_id gnl|my_center|LOCUS_0520 14277 15257 gene locus_tag LOCUS_0530 14277 15257 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869671.1 protein_id gnl|my_center|LOCUS_0530 15254 15520 gene locus_tag LOCUS_0540 15254 15520 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867462.1 protein_id gnl|my_center|LOCUS_0540 15522 16235 gene locus_tag LOCUS_0550 15522 16235 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762841.1 protein_id gnl|my_center|LOCUS_0550 16240 16638 gene locus_tag LOCUS_0560 gene rpsS 16240 16638 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867460.1 protein_id gnl|my_center|LOCUS_0560 16674 17072 gene locus_tag LOCUS_0570 16674 17072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0570 17677 17069 gene locus_tag LOCUS_0580 17677 17069 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978426.1 protein_id gnl|my_center|LOCUS_0580 18979 17702 gene locus_tag LOCUS_0590 gene serS 18979 17702 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868451.1 protein_id gnl|my_center|LOCUS_0590 19200 18967 gene locus_tag LOCUS_0600 19200 18967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0600 >Feature sequence003 816 1307 gene locus_tag LOCUS_0610 816 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0610 1967 1245 gene locus_tag LOCUS_0620 1967 1245 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250440.1 protein_id gnl|my_center|LOCUS_0620 2467 1964 gene locus_tag LOCUS_0630 2467 1964 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065425.1 protein_id gnl|my_center|LOCUS_0630 2533 4101 gene locus_tag LOCUS_0640 2533 4101 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879889.1 protein_id gnl|my_center|LOCUS_0640 4341 4096 gene locus_tag LOCUS_0650 4341 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0650 4816 4403 gene locus_tag LOCUS_0660 4816 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0660 5630 4800 gene locus_tag LOCUS_0670 5630 4800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0670 5709 6317 gene locus_tag LOCUS_0680 5709 6317 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877750.1 protein_id gnl|my_center|LOCUS_0680 6325 7251 gene locus_tag LOCUS_0690 6325 7251 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 protein_id gnl|my_center|LOCUS_0690 9590 7248 gene locus_tag LOCUS_0700 gene ppsA 9590 7248 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846514.1 protein_id gnl|my_center|LOCUS_0700 9755 9922 gene locus_tag LOCUS_0710 9755 9922 CDS product DUF5679 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551122.1 protein_id gnl|my_center|LOCUS_0710 10517 9939 gene locus_tag LOCUS_0720 10517 9939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0720 10577 10846 gene locus_tag LOCUS_0730 10577 10846 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876522.1 protein_id gnl|my_center|LOCUS_0730 12041 10827 gene locus_tag LOCUS_0740 12041 10827 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061074.1 protein_id gnl|my_center|LOCUS_0740 12119 13084 gene locus_tag LOCUS_0750 12119 13084 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762724.1 protein_id gnl|my_center|LOCUS_0750 >Feature sequence004 265 68 gene locus_tag LOCUS_0760 265 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0760 476 273 gene locus_tag LOCUS_0770 476 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0770 1296 463 gene locus_tag LOCUS_0780 gene rrp42 1296 463 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867735.1 protein_id gnl|my_center|LOCUS_0780 2009 1293 gene locus_tag LOCUS_0790 gene rrp41 2009 1293 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250585.1 protein_id gnl|my_center|LOCUS_0790 2691 1996 gene locus_tag LOCUS_0800 2691 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0800 3374 2688 gene locus_tag LOCUS_0810 3374 2688 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762590.1 protein_id gnl|my_center|LOCUS_0810 3454 4407 gene locus_tag LOCUS_0820 3454 4407 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065440.1 protein_id gnl|my_center|LOCUS_0820 4435 4836 gene locus_tag LOCUS_0830 4435 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0830 4875 5864 gene locus_tag LOCUS_0840 gene hisG 4875 5864 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545705.1 protein_id gnl|my_center|LOCUS_0840 5830 7119 gene locus_tag LOCUS_0850 gene hisD 5830 7119 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060775.1 protein_id gnl|my_center|LOCUS_0850 7101 8159 gene locus_tag LOCUS_0860 7101 8159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0860 8156 8725 gene locus_tag LOCUS_0870 gene hisB 8156 8725 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061060.1 protein_id gnl|my_center|LOCUS_0870 8722 9309 gene locus_tag LOCUS_0880 gene hisH 8722 9309 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020951.1 protein_id gnl|my_center|LOCUS_0880 9306 10046 gene locus_tag LOCUS_0890 gene hisA 9306 10046 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060911.1 protein_id gnl|my_center|LOCUS_0890 10015 10770 gene locus_tag LOCUS_0900 gene hisF 10015 10770 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_0900 10767 11102 gene locus_tag LOCUS_0910 gene hisI 10767 11102 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879442.1 protein_id gnl|my_center|LOCUS_0910 11149 11349 gene locus_tag LOCUS_0920 11149 11349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0920 11354 11659 gene locus_tag LOCUS_0930 11354 11659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0930 11818 12378 gene locus_tag LOCUS_0940 11818 12378 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250601.1 protein_id gnl|my_center|LOCUS_0940 13744 12368 gene locus_tag LOCUS_0950 13744 12368 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870075.1 protein_id gnl|my_center|LOCUS_0950 14757 13741 gene locus_tag LOCUS_0960 14757 13741 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871127.1 protein_id gnl|my_center|LOCUS_0960 <15778 14754 gene locus_tag LOCUS_0970 <15778 14754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870985.1:threonine synthase >Feature sequence005 1269 3353 gene locus_tag LOCUS_0980 1269 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0980 4122 3316 gene locus_tag LOCUS_0990 gene rpl4p 4122 3316 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869672.1 protein_id gnl|my_center|LOCUS_0990 4297 4133 gene locus_tag LOCUS_1000 4297 4133 CDS product 30S ribosomal protein S30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979284.1 protein_id gnl|my_center|LOCUS_1000 5125 4334 gene locus_tag LOCUS_1010 5125 4334 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870966.1 protein_id gnl|my_center|LOCUS_1010 6002 5112 gene locus_tag LOCUS_1020 6002 5112 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060992.1 protein_id gnl|my_center|LOCUS_1020 6055 7194 gene locus_tag LOCUS_1030 6055 7194 CDS product C/D box methylation guide ribonucleoprotein complex aNOP56 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156014546.1 protein_id gnl|my_center|LOCUS_1030 7184 7846 gene locus_tag LOCUS_1040 7184 7846 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846944.1 protein_id gnl|my_center|LOCUS_1040 8484 7840 gene locus_tag LOCUS_1050 gene rnhB 8484 7840 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878125.1 protein_id gnl|my_center|LOCUS_1050 9016 8465 gene locus_tag LOCUS_1060 9016 8465 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876692.1 protein_id gnl|my_center|LOCUS_1060 9092 10237 gene locus_tag LOCUS_1070 9092 10237 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876814.1 protein_id gnl|my_center|LOCUS_1070 10816 10202 gene locus_tag LOCUS_1080 gene rrmJ 10816 10202 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870893.1 protein_id gnl|my_center|LOCUS_1080 11812 10838 gene locus_tag LOCUS_1090 11812 10838 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876518.1 protein_id gnl|my_center|LOCUS_1090 12063 11809 gene locus_tag LOCUS_1100 12063 11809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1100 <14466 12173 gene locus_tag LOCUS_1110 <14466 12173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978404.1:isoleucine--tRNA ligase >Feature sequence006 522 1820 gene locus_tag LOCUS_1120 522 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1120 1813 3249 gene locus_tag LOCUS_1130 1813 3249 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249650.1 protein_id gnl|my_center|LOCUS_1130 3246 4559 gene locus_tag LOCUS_1140 3246 4559 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249649.1 protein_id gnl|my_center|LOCUS_1140 5941 4556 gene locus_tag LOCUS_1150 5941 4556 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064354.1 protein_id gnl|my_center|LOCUS_1150 5998 6501 gene locus_tag LOCUS_1160 5998 6501 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250178.1 protein_id gnl|my_center|LOCUS_1160 6524 7462 gene locus_tag LOCUS_1170 6524 7462 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240546.1 protein_id gnl|my_center|LOCUS_1170 7748 7452 gene locus_tag LOCUS_1180 7748 7452 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022822.1 protein_id gnl|my_center|LOCUS_1180 8146 7724 gene locus_tag LOCUS_1190 gene trxA 8146 7724 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932522.1 protein_id gnl|my_center|LOCUS_1190 8203 8631 gene locus_tag LOCUS_1200 8203 8631 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522988.1 protein_id gnl|my_center|LOCUS_1200 10159 8633 gene locus_tag LOCUS_1210 gene guaA 10159 8633 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_1210 10688 10152 gene locus_tag LOCUS_1220 10688 10152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1220 11727 10705 gene locus_tag LOCUS_1230 11727 10705 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024146.1 protein_id gnl|my_center|LOCUS_1230 12022 11750 gene locus_tag LOCUS_1240 12022 11750 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763032.1 protein_id gnl|my_center|LOCUS_1240 12072 12368 gene locus_tag LOCUS_1250 12072 12368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1250 <12994 12358 gene locus_tag LOCUS_1260 <12994 12358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249171.1:pyridoxal 5'-phosphate synthase glutaminase subunit PdxT >Feature sequence007 751 425 gene locus_tag LOCUS_1270 751 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_1270 2414 798 gene locus_tag LOCUS_1280 gene metG 2414 798 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868104.1 protein_id gnl|my_center|LOCUS_1280 3621 2398 gene locus_tag LOCUS_1290 gene ahcY 3621 2398 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978302.1 protein_id gnl|my_center|LOCUS_1290 3716 4171 gene locus_tag LOCUS_1300 gene rplV 3716 4171 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064485.1 protein_id gnl|my_center|LOCUS_1300 4168 4797 gene locus_tag LOCUS_1310 4168 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_1310 4778 4984 gene locus_tag LOCUS_1320 4778 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1320 4981 5247 gene locus_tag LOCUS_1330 gene rnp1 4981 5247 CDS product ribonuclease P component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879410.1 protein_id gnl|my_center|LOCUS_1330 5232 5561 gene locus_tag LOCUS_1340 5232 5561 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867454.1 protein_id gnl|my_center|LOCUS_1340 5554 5991 gene locus_tag LOCUS_1350 5554 5991 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875655.1 protein_id gnl|my_center|LOCUS_1350 6029 6367 gene locus_tag LOCUS_1360 gene rplX 6029 6367 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250481.1 protein_id gnl|my_center|LOCUS_1360 6369 7073 gene locus_tag LOCUS_1370 6369 7073 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879406.1 protein_id gnl|my_center|LOCUS_1370 7070 7591 gene locus_tag LOCUS_1380 7070 7591 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762516.1 protein_id gnl|my_center|LOCUS_1380 7588 7749 gene locus_tag LOCUS_1390 7588 7749 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250478.1 protein_id gnl|my_center|LOCUS_1390 7754 8146 gene locus_tag LOCUS_1400 7754 8146 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060728.1 protein_id gnl|my_center|LOCUS_1400 8109 8681 gene locus_tag LOCUS_1410 8109 8681 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319356.1 protein_id gnl|my_center|LOCUS_1410 8675 9049 gene locus_tag LOCUS_1420 8675 9049 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867446.1 protein_id gnl|my_center|LOCUS_1420 9060 9479 gene locus_tag LOCUS_1430 9060 9479 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875663.1 protein_id gnl|my_center|LOCUS_1430 9476 10051 gene locus_tag LOCUS_1440 9476 10051 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250473.1 protein_id gnl|my_center|LOCUS_1440 10048 10668 gene locus_tag LOCUS_1450 10048 10668 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763044.1 protein_id gnl|my_center|LOCUS_1450 10665 11129 gene locus_tag LOCUS_1460 10665 11129 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250471.1 protein_id gnl|my_center|LOCUS_1460 11183 11605 gene locus_tag LOCUS_1470 11183 11605 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867441.1 protein_id gnl|my_center|LOCUS_1470 >Feature sequence008 384 55 gene locus_tag LOCUS_1480 384 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1480 1641 682 gene locus_tag LOCUS_1490 1641 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1490 1703 2371 gene locus_tag LOCUS_1500 1703 2371 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546873.1 protein_id gnl|my_center|LOCUS_1500 3081 2368 gene locus_tag LOCUS_1510 3081 2368 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763194.1 protein_id gnl|my_center|LOCUS_1510 4150 3146 gene locus_tag LOCUS_1520 4150 3146 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846776.1 protein_id gnl|my_center|LOCUS_1520 4908 4147 gene locus_tag LOCUS_1530 gene cobS 4908 4147 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020977.1 protein_id gnl|my_center|LOCUS_1530 5941 4892 gene locus_tag LOCUS_1540 5941 4892 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016795.1 protein_id gnl|my_center|LOCUS_1540 6492 5938 gene locus_tag LOCUS_1550 6492 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1550 7592 6489 gene locus_tag LOCUS_1560 gene cbiS 7592 6489 CDS product bifunctional adenosylcobinamide hydrolase/alpha-ribazole phosphatase CbiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763104.1 protein_id gnl|my_center|LOCUS_1560 8662 7595 gene locus_tag LOCUS_1570 8662 7595 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980223.1 protein_id gnl|my_center|LOCUS_1570 8783 9232 gene locus_tag LOCUS_1580 8783 9232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1580 9363 9286 gene locus_tag LOCUS_t0010 9363 9286 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 9459 9797 gene locus_tag LOCUS_1590 9459 9797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1590 10236 9766 gene locus_tag LOCUS_1600 10236 9766 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868429.1 protein_id gnl|my_center|LOCUS_1600 11483 10236 gene locus_tag LOCUS_1610 11483 10236 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868871.1 protein_id gnl|my_center|LOCUS_1610 12019 11480 gene locus_tag LOCUS_1620 12019 11480 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876850.1 protein_id gnl|my_center|LOCUS_1620 >Feature sequence009 238 894 gene locus_tag LOCUS_1630 238 894 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980489.1 protein_id gnl|my_center|LOCUS_1630 907 1386 gene locus_tag LOCUS_1640 907 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1640 1453 2388 gene locus_tag LOCUS_1650 1453 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1650 2385 3452 gene locus_tag LOCUS_1660 2385 3452 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868029.1 protein_id gnl|my_center|LOCUS_1660 3515 4144 gene locus_tag LOCUS_1670 3515 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1670 5257 4112 gene locus_tag LOCUS_1680 5257 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1680 5786 5289 gene locus_tag LOCUS_1690 gene leuD 5786 5289 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_1690 7069 5783 gene locus_tag LOCUS_1700 gene hacA 7069 5783 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876998.1 protein_id gnl|my_center|LOCUS_1700 7987 7091 gene locus_tag LOCUS_1710 gene speE 7987 7091 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546275.1 protein_id gnl|my_center|LOCUS_1710 8382 7987 gene locus_tag LOCUS_1720 gene speD 8382 7987 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081137.1 protein_id gnl|my_center|LOCUS_1720 8681 9568 gene locus_tag LOCUS_1730 gene pstC 8681 9568 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868164.1 protein_id gnl|my_center|LOCUS_1730 9565 10383 gene locus_tag LOCUS_1740 gene pstA 9565 10383 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870526.1 protein_id gnl|my_center|LOCUS_1740 10388 11143 gene locus_tag LOCUS_1750 10388 11143 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250819.1 protein_id gnl|my_center|LOCUS_1750 >Feature sequence010 <1 1228 gene locus_tag LOCUS_1760 <1 1228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256688.1:putative hydroxymethylpyrimidine transporter CytX 1225 2583 gene locus_tag LOCUS_1770 1225 2583 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868207.1 protein_id gnl|my_center|LOCUS_1770 3657 2569 gene locus_tag LOCUS_1780 3657 2569 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066039.1 protein_id gnl|my_center|LOCUS_1780 4569 4027 gene locus_tag LOCUS_1790 4569 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1790 5017 4571 gene locus_tag LOCUS_1800 5017 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1800 5221 5144 gene locus_tag LOCUS_t0020 5221 5144 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6510 5245 gene locus_tag LOCUS_1810 6510 5245 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966033.1 protein_id gnl|my_center|LOCUS_1810 7027 6497 gene locus_tag LOCUS_1820 7027 6497 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_1820 7069 7944 gene locus_tag LOCUS_1830 7069 7944 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978942.1 protein_id gnl|my_center|LOCUS_1830 7991 8908 gene locus_tag LOCUS_1840 gene rnz 7991 8908 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061333.1 protein_id gnl|my_center|LOCUS_1840 8968 10233 gene locus_tag LOCUS_1850 8968 10233 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762726.1 protein_id gnl|my_center|LOCUS_1850 >Feature sequence011 164 421 gene locus_tag LOCUS_1860 164 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1860 418 1248 gene locus_tag LOCUS_1870 418 1248 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066246.1 protein_id gnl|my_center|LOCUS_1870 1354 2481 gene locus_tag LOCUS_1880 1354 2481 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023661.1 protein_id gnl|my_center|LOCUS_1880 2545 4053 gene locus_tag LOCUS_1890 gene glpK 2545 4053 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_1890 4057 5211 gene locus_tag LOCUS_1900 4057 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1900 5208 5861 gene locus_tag LOCUS_1910 gene sdhB 5208 5861 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878185.1 protein_id gnl|my_center|LOCUS_1910 5852 6763 gene locus_tag LOCUS_1920 5852 6763 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878312.1 protein_id gnl|my_center|LOCUS_1920 6833 7948 gene locus_tag LOCUS_1930 6833 7948 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763625.1 protein_id gnl|my_center|LOCUS_1930 7975 8811 gene locus_tag LOCUS_1940 7975 8811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1940 9750 8926 gene locus_tag LOCUS_1950 9750 8926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1950 10259 9825 gene locus_tag LOCUS_1960 10259 9825 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979870.1 protein_id gnl|my_center|LOCUS_1960 10483 10256 gene locus_tag LOCUS_1970 10483 10256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1970 10836 10761 gene locus_tag LOCUS_t0030 10836 10761 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence012 468 1877 gene locus_tag LOCUS_1980 468 1877 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_1980 1855 2499 gene locus_tag LOCUS_1990 1855 2499 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250555.1 protein_id gnl|my_center|LOCUS_1990 2489 2617 gene locus_tag LOCUS_2000 2489 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2000 2673 2987 gene locus_tag LOCUS_2010 2673 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2010 3201 2992 gene locus_tag LOCUS_2020 3201 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2020 3668 3201 gene locus_tag LOCUS_2030 gene pyrI 3668 3201 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060913.1 protein_id gnl|my_center|LOCUS_2030 3722 4648 gene locus_tag LOCUS_2040 gene pyrB 3722 4648 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251146.1 protein_id gnl|my_center|LOCUS_2040 6856 4649 gene locus_tag LOCUS_2050 6856 4649 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545329.1 protein_id gnl|my_center|LOCUS_2050 8990 7002 gene locus_tag LOCUS_2060 8990 7002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2060 >Feature sequence013 956 123 gene locus_tag LOCUS_2070 956 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2070 1062 1370 gene locus_tag LOCUS_2080 1062 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2080 3278 1362 gene locus_tag LOCUS_2090 3278 1362 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876827.1 protein_id gnl|my_center|LOCUS_2090 3918 3280 gene locus_tag LOCUS_2100 gene psmB 3918 3280 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876826.1 protein_id gnl|my_center|LOCUS_2100 5778 5071 gene locus_tag LOCUS_2110 5778 5071 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870336.1 protein_id gnl|my_center|LOCUS_2110 5854 6939 gene locus_tag LOCUS_2120 5854 6939 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391684.1 protein_id gnl|my_center|LOCUS_2120 7873 6911 gene locus_tag LOCUS_2130 7873 6911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2130 7998 8933 gene locus_tag LOCUS_2140 7998 8933 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978312.1 protein_id gnl|my_center|LOCUS_2140 9245 8922 gene locus_tag LOCUS_2150 9245 8922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2150 9889 9365 gene locus_tag LOCUS_2160 9889 9365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2160 10736 9942 gene locus_tag LOCUS_2170 10736 9942 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867247.1 protein_id gnl|my_center|LOCUS_2170 >Feature sequence014 939 67 gene locus_tag LOCUS_2180 939 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2180 999 2018 gene locus_tag LOCUS_2190 999 2018 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762127.1 protein_id gnl|my_center|LOCUS_2190 2747 2001 gene locus_tag LOCUS_2200 2747 2001 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065164.1 protein_id gnl|my_center|LOCUS_2200 3661 2744 gene locus_tag LOCUS_2210 3661 2744 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_2210 3768 4766 gene locus_tag LOCUS_2220 3768 4766 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878151.1 protein_id gnl|my_center|LOCUS_2220 6203 4746 gene locus_tag LOCUS_2230 6203 4746 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_2230 6330 7013 gene locus_tag LOCUS_2240 6330 7013 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809144.1 protein_id gnl|my_center|LOCUS_2240 7025 7879 gene locus_tag LOCUS_2250 7025 7879 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809896.1 protein_id gnl|my_center|LOCUS_2250 7881 8723 gene locus_tag LOCUS_2260 7881 8723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2260 8764 10368 gene locus_tag LOCUS_2270 8764 10368 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460454.1 protein_id gnl|my_center|LOCUS_2270 >Feature sequence015 2354 2659 gene locus_tag LOCUS_2280 gene rpl12p 2354 2659 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250366.1 protein_id gnl|my_center|LOCUS_2280 3496 2642 gene locus_tag LOCUS_2290 3496 2642 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870010.1 protein_id gnl|my_center|LOCUS_2290 4143 3493 gene locus_tag LOCUS_2300 4143 3493 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061119.1 protein_id gnl|my_center|LOCUS_2300 4223 5656 gene locus_tag LOCUS_2310 gene proS 4223 5656 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583195.1 protein_id gnl|my_center|LOCUS_2310 5685 6326 gene locus_tag LOCUS_2320 5685 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2320 7107 6295 gene locus_tag LOCUS_2330 7107 6295 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940312.1 protein_id gnl|my_center|LOCUS_2330 7150 7377 gene locus_tag LOCUS_2340 7150 7377 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011033302.1 protein_id gnl|my_center|LOCUS_2340 7500 7748 gene locus_tag LOCUS_2350 7500 7748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2350 7999 7745 gene locus_tag LOCUS_2360 7999 7745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2360 8537 8001 gene locus_tag LOCUS_2370 gene endA 8537 8001 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978320.1 protein_id gnl|my_center|LOCUS_2370 9193 8534 gene locus_tag LOCUS_2380 9193 8534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2380 <10252 9248 gene locus_tag LOCUS_2390 <10252 9248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762861.1:ATP-dependent DNA ligase >Feature sequence016 384 1640 gene locus_tag LOCUS_2400 384 1640 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020758.1 protein_id gnl|my_center|LOCUS_2400 2906 1974 gene locus_tag LOCUS_2410 2906 1974 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867617.1 protein_id gnl|my_center|LOCUS_2410 3959 2922 gene locus_tag LOCUS_2420 3959 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2420 5013 3961 gene locus_tag LOCUS_2430 gene dnaG 5013 3961 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879392.1 protein_id gnl|my_center|LOCUS_2430 5808 5119 gene locus_tag LOCUS_2440 5808 5119 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_2440 6502 5765 gene locus_tag LOCUS_2450 6502 5765 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763220.1 protein_id gnl|my_center|LOCUS_2450 7596 6499 gene locus_tag LOCUS_2460 7596 6499 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582967.1 protein_id gnl|my_center|LOCUS_2460 8690 7626 gene locus_tag LOCUS_2470 8690 7626 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249523.1 protein_id gnl|my_center|LOCUS_2470 8727 9692 gene locus_tag LOCUS_2480 8727 9692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2480 >Feature sequence017 870 7 gene locus_tag LOCUS_2490 870 7 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879265.1 protein_id gnl|my_center|LOCUS_2490 1889 870 gene locus_tag LOCUS_2500 1889 870 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064459.1 protein_id gnl|my_center|LOCUS_2500 3579 1924 gene locus_tag LOCUS_2510 3579 1924 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762356.1 protein_id gnl|my_center|LOCUS_2510 4733 3621 gene locus_tag LOCUS_2520 4733 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2520 4877 4803 gene locus_tag LOCUS_t0040 4877 4803 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 7605 4912 gene locus_tag LOCUS_2530 7605 4912 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878645.1 protein_id gnl|my_center|LOCUS_2530 7747 8436 gene locus_tag LOCUS_2540 7747 8436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2540 9514 8390 gene locus_tag LOCUS_2550 9514 8390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2550 >Feature sequence018 1672 1223 gene locus_tag LOCUS_2560 1672 1223 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762532.1 protein_id gnl|my_center|LOCUS_2560 1769 2839 gene locus_tag LOCUS_2570 1769 2839 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013682815.1 protein_id gnl|my_center|LOCUS_2570 2840 4042 gene locus_tag LOCUS_2580 gene pgk 2840 4042 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061271.1 protein_id gnl|my_center|LOCUS_2580 4069 4143 gene locus_tag LOCUS_t0050 4069 4143 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4749 4141 gene locus_tag LOCUS_2590 4749 4141 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879199.1 protein_id gnl|my_center|LOCUS_2590 8039 4824 gene locus_tag LOCUS_2600 gene carB 8039 4824 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107320.1 protein_id gnl|my_center|LOCUS_2600 9148 8036 gene locus_tag LOCUS_2610 gene carA 9148 8036 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240374.1 protein_id gnl|my_center|LOCUS_2610 >Feature sequence019 1061 162 gene locus_tag LOCUS_2620 1061 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2620 1236 1051 gene locus_tag LOCUS_2630 1236 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2630 1617 1237 gene locus_tag LOCUS_2640 gene yciH 1617 1237 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878414.1 protein_id gnl|my_center|LOCUS_2640 1744 2520 gene locus_tag LOCUS_2650 gene nadE 1744 2520 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878500.1 protein_id gnl|my_center|LOCUS_2650 3683 2517 gene locus_tag LOCUS_2660 3683 2517 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978565.1 protein_id gnl|my_center|LOCUS_2660 3784 5043 gene locus_tag LOCUS_2670 gene hisS 3784 5043 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868795.1 protein_id gnl|my_center|LOCUS_2670 5534 5040 gene locus_tag LOCUS_2680 5534 5040 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880262.1 protein_id gnl|my_center|LOCUS_2680 5655 5577 gene locus_tag LOCUS_t0060 5655 5577 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5801 6397 gene locus_tag LOCUS_2690 5801 6397 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256490.1 protein_id gnl|my_center|LOCUS_2690 7553 6363 gene locus_tag LOCUS_2700 7553 6363 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021450.1 protein_id gnl|my_center|LOCUS_2700 8162 7608 gene locus_tag LOCUS_2710 8162 7608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2710 8718 8164 gene locus_tag LOCUS_2720 8718 8164 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903837.1 protein_id gnl|my_center|LOCUS_2720 <9387 8753 gene locus_tag LOCUS_2730 <9387 8753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763487.1:pyridoxal-phosphate dependent enzyme >Feature sequence020 896 54 gene locus_tag LOCUS_2740 896 54 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146468.1 protein_id gnl|my_center|LOCUS_2740 1650 889 gene locus_tag LOCUS_2750 1650 889 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249248.1 protein_id gnl|my_center|LOCUS_2750 1727 2101 gene locus_tag LOCUS_2760 1727 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2760 2120 3109 gene locus_tag LOCUS_2770 gene priL 2120 3109 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020168.1 protein_id gnl|my_center|LOCUS_2770 3096 4175 gene locus_tag LOCUS_2780 gene priS 3096 4175 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064280.1 protein_id gnl|my_center|LOCUS_2780 4172 4729 gene locus_tag LOCUS_2790 4172 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249491.1 protein_id gnl|my_center|LOCUS_2790 5021 4710 gene locus_tag LOCUS_2800 5021 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2800 5446 5018 gene locus_tag LOCUS_2810 5446 5018 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250572.1 protein_id gnl|my_center|LOCUS_2810 5518 5829 gene locus_tag LOCUS_2820 gene eif1A 5518 5829 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869944.1 protein_id gnl|my_center|LOCUS_2820 7244 5808 gene locus_tag LOCUS_2830 7244 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2830 7990 7241 gene locus_tag LOCUS_2840 7990 7241 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251231.1 protein_id gnl|my_center|LOCUS_2840 8783 8037 gene locus_tag LOCUS_2850 8783 8037 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978941.1 protein_id gnl|my_center|LOCUS_2850 >Feature sequence021 129 362 gene locus_tag LOCUS_2860 129 362 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762745.1 protein_id gnl|my_center|LOCUS_2860 577 347 gene locus_tag LOCUS_2870 577 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2870 2739 574 gene locus_tag LOCUS_2880 2739 574 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429724.1 protein_id gnl|my_center|LOCUS_2880 3015 2752 gene locus_tag LOCUS_2890 3015 2752 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878078.1 protein_id gnl|my_center|LOCUS_2890 3198 3025 gene locus_tag LOCUS_2900 3198 3025 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867153.1 protein_id gnl|my_center|LOCUS_2900 4247 3225 gene locus_tag LOCUS_2910 4247 3225 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878132.1 protein_id gnl|my_center|LOCUS_2910 5757 4252 gene locus_tag LOCUS_2920 5757 4252 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877091.1 protein_id gnl|my_center|LOCUS_2920 6241 5738 gene locus_tag LOCUS_2930 gene ilvN 6241 5738 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496411.1 protein_id gnl|my_center|LOCUS_2930 7938 6250 gene locus_tag LOCUS_2940 gene ilvB 7938 6250 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146975.1 protein_id gnl|my_center|LOCUS_2940 8318 8076 gene locus_tag LOCUS_2950 8318 8076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2950 >Feature sequence022 1080 385 gene locus_tag LOCUS_2960 1080 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2960 2273 1083 gene locus_tag LOCUS_2970 2273 1083 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942363.1 protein_id gnl|my_center|LOCUS_2970 3097 2273 gene locus_tag LOCUS_2980 3097 2273 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942362.1 protein_id gnl|my_center|LOCUS_2980 4020 3136 gene locus_tag LOCUS_2990 4020 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903431.1 protein_id gnl|my_center|LOCUS_2990 4742 4020 gene locus_tag LOCUS_3000 4742 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3000 5863 4739 gene locus_tag LOCUS_3010 gene pseC 5863 4739 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_3010 6825 5860 gene locus_tag LOCUS_3020 6825 5860 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901996.1 protein_id gnl|my_center|LOCUS_3020 7906 6830 gene locus_tag LOCUS_3030 7906 6830 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048110.1 protein_id gnl|my_center|LOCUS_3030 8021 7949 gene locus_tag LOCUS_t0070 8021 7949 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence023 1877 3259 gene locus_tag LOCUS_3040 1877 3259 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924859.1 protein_id gnl|my_center|LOCUS_3040 3287 4384 gene locus_tag LOCUS_3050 3287 4384 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877767.1 protein_id gnl|my_center|LOCUS_3050 4384 5397 gene locus_tag LOCUS_3060 4384 5397 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869629.1 protein_id gnl|my_center|LOCUS_3060 6745 5390 gene locus_tag LOCUS_3070 6745 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3070 <7904 6738 gene locus_tag LOCUS_3080 <7904 6738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868348.1:phosphoglucosamine mutase >Feature sequence024 1704 433 gene locus_tag LOCUS_3090 gene gldA 1704 433 CDS product bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374004.1 protein_id gnl|my_center|LOCUS_3090 2604 1795 gene locus_tag LOCUS_3100 gene cofE 2604 1795 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023428.1 protein_id gnl|my_center|LOCUS_3100 3603 2608 gene locus_tag LOCUS_3110 gene dph2 3603 2608 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868245.1 protein_id gnl|my_center|LOCUS_3110 4084 3575 gene locus_tag LOCUS_3120 4084 3575 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846759.1 protein_id gnl|my_center|LOCUS_3120 4205 4573 gene locus_tag LOCUS_3130 4205 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3130 4658 5731 gene locus_tag LOCUS_3140 4658 5731 CDS product TRM11 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248963.1 protein_id gnl|my_center|LOCUS_3140 6391 5696 gene locus_tag LOCUS_3150 6391 5696 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250920.1 protein_id gnl|my_center|LOCUS_3150 >Feature sequence025 267 650 gene locus_tag LOCUS_3160 267 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3160 995 651 gene locus_tag LOCUS_3170 gene trxA 995 651 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878779.1 protein_id gnl|my_center|LOCUS_3170 1230 1302 gene locus_tag LOCUS_t0080 1230 1302 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1331 1750 gene locus_tag LOCUS_3180 1331 1750 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_3180 3114 1747 gene locus_tag LOCUS_3190 3114 1747 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004069588.1 protein_id gnl|my_center|LOCUS_3190 3166 4077 gene locus_tag LOCUS_3200 gene ilvE 3166 4077 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 protein_id gnl|my_center|LOCUS_3200 4059 4406 gene locus_tag LOCUS_3210 4059 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3210 5328 4360 gene locus_tag LOCUS_3220 5328 4360 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761782.1 protein_id gnl|my_center|LOCUS_3220 5687 5316 gene locus_tag LOCUS_3230 5687 5316 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496879.1 protein_id gnl|my_center|LOCUS_3230 7399 5813 gene locus_tag LOCUS_3240 gene pheT 7399 5813 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878921.1 protein_id gnl|my_center|LOCUS_3240 >Feature sequence026 <1 1190 gene locus_tag LOCUS_3250 <1 1190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003230253.1:acetyl-CoA carboxylase biotin carboxylase subunit 1273 1641 gene locus_tag LOCUS_3260 1273 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3260 3366 1642 gene locus_tag LOCUS_3270 gene glmS 3366 1642 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249760.1 protein_id gnl|my_center|LOCUS_3270 3472 4392 gene locus_tag LOCUS_3280 3472 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3280 4787 4389 gene locus_tag LOCUS_3290 4787 4389 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875677.1 protein_id gnl|my_center|LOCUS_3290 5283 4771 gene locus_tag LOCUS_3300 5283 4771 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980144.1 protein_id gnl|my_center|LOCUS_3300 5768 5322 gene locus_tag LOCUS_3310 5768 5322 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980145.1 protein_id gnl|my_center|LOCUS_3310 5842 6846 gene locus_tag LOCUS_3320 5842 6846 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496543.1 protein_id gnl|my_center|LOCUS_3320 7147 6836 gene locus_tag LOCUS_3330 7147 6836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3330 >Feature sequence027 180 653 gene locus_tag LOCUS_3340 180 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3340 1287 715 gene locus_tag LOCUS_3350 1287 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3350 2231 1290 gene locus_tag LOCUS_3360 2231 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3360 2542 2466 gene locus_tag LOCUS_t0090 2542 2466 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4117 2519 gene locus_tag LOCUS_3370 4117 2519 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917973.1 protein_id gnl|my_center|LOCUS_3370 5310 4108 gene locus_tag LOCUS_3380 5310 4108 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250627.1 protein_id gnl|my_center|LOCUS_3380 6061 5354 gene locus_tag LOCUS_3390 6061 5354 CDS product A24 family peptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878436.1 protein_id gnl|my_center|LOCUS_3390 6185 6484 gene locus_tag LOCUS_3400 6185 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3400 >Feature sequence028 <1 549 gene locus_tag LOCUS_3410 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249983.1:AIR synthase family protein 569 982 gene locus_tag LOCUS_3420 569 982 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296128.1 protein_id gnl|my_center|LOCUS_3420 985 1836 gene locus_tag LOCUS_3430 985 1836 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876243.1 protein_id gnl|my_center|LOCUS_3430 1838 2584 gene locus_tag LOCUS_3440 1838 2584 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_3440 2562 3371 gene locus_tag LOCUS_3450 2562 3371 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485751.1 protein_id gnl|my_center|LOCUS_3450 3977 3333 gene locus_tag LOCUS_3460 3977 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3460 4044 4457 gene locus_tag LOCUS_3470 4044 4457 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546772.1 protein_id gnl|my_center|LOCUS_3470 4454 6217 gene locus_tag LOCUS_3480 4454 6217 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877591.1 protein_id gnl|my_center|LOCUS_3480 7136 6177 gene locus_tag LOCUS_3490 gene galT 7136 6177 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080684.1 protein_id gnl|my_center|LOCUS_3490 >Feature sequence029 <1 1431 gene locus_tag LOCUS_3500 <1 1431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392959.1:ribonucleoside triphosphate reductase 1428 2144 gene locus_tag LOCUS_3510 1428 2144 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_3510 2205 3602 gene locus_tag LOCUS_3520 gene cysS 2205 3602 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249399.1 protein_id gnl|my_center|LOCUS_3520 3599 5623 gene locus_tag LOCUS_3530 gene topA 3599 5623 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868544.1 protein_id gnl|my_center|LOCUS_3530 5620 5847 gene locus_tag LOCUS_3540 5620 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3540 >Feature sequence030 <1 699 gene locus_tag LOCUS_3550 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879317.1:metallophosphoesterase family protein 1972 686 gene locus_tag LOCUS_3560 1972 686 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876459.1 protein_id gnl|my_center|LOCUS_3560 2026 2763 gene locus_tag LOCUS_3570 2026 2763 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060945.1 protein_id gnl|my_center|LOCUS_3570 2760 3320 gene locus_tag LOCUS_3580 2760 3320 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496497.1 protein_id gnl|my_center|LOCUS_3580 3305 4825 gene locus_tag LOCUS_3590 3305 4825 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979316.1 protein_id gnl|my_center|LOCUS_3590 4806 5891 gene locus_tag LOCUS_3600 4806 5891 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876639.1 protein_id gnl|my_center|LOCUS_3600 6223 5888 gene locus_tag LOCUS_3610 6223 5888 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251013.1 protein_id gnl|my_center|LOCUS_3610 6392 6317 gene locus_tag LOCUS_t0100 6392 6317 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6445 6522 gene locus_tag LOCUS_t0110 6445 6522 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7030 6521 gene locus_tag LOCUS_3620 7030 6521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3620 >Feature sequence031 383 18 gene locus_tag LOCUS_3630 383 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3630 1187 417 gene locus_tag LOCUS_3640 1187 417 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762787.1 protein_id gnl|my_center|LOCUS_3640 2002 1217 gene locus_tag LOCUS_3650 gene uppS 2002 1217 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870889.1 protein_id gnl|my_center|LOCUS_3650 3111 1999 gene locus_tag LOCUS_3660 3111 1999 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147160.1 protein_id gnl|my_center|LOCUS_3660 3942 3133 gene locus_tag LOCUS_3670 3942 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979293.1 protein_id gnl|my_center|LOCUS_3670 3976 4659 gene locus_tag LOCUS_3680 3976 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3680 4731 6287 gene locus_tag LOCUS_3690 4731 6287 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903114.1 protein_id gnl|my_center|LOCUS_3690 >Feature sequence032 922 59 gene locus_tag LOCUS_3700 gene lysX 922 59 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_3700 1097 924 gene locus_tag LOCUS_3710 gene lysW 1097 924 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256239.1 protein_id gnl|my_center|LOCUS_3710 2535 1102 gene locus_tag LOCUS_3720 gene argH 2535 1102 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875908.1 protein_id gnl|my_center|LOCUS_3720 3707 2532 gene locus_tag LOCUS_3730 3707 2532 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167827706.1 protein_id gnl|my_center|LOCUS_3730 3796 4473 gene locus_tag LOCUS_3740 3796 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3740 5409 4444 gene locus_tag LOCUS_3750 5409 4444 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256513.1 protein_id gnl|my_center|LOCUS_3750 5836 5411 gene locus_tag LOCUS_3760 5836 5411 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878568.1 protein_id gnl|my_center|LOCUS_3760 5872 6618 gene locus_tag LOCUS_3770 gene psmA 5872 6618 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_3770 7004 6615 gene locus_tag LOCUS_3780 7004 6615 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762564.1 protein_id gnl|my_center|LOCUS_3780 >Feature sequence033 1322 141 gene locus_tag LOCUS_3790 1322 141 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057679.1 protein_id gnl|my_center|LOCUS_3790 1431 3659 gene locus_tag LOCUS_3800 1431 3659 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846742.1 protein_id gnl|my_center|LOCUS_3800 3656 5527 gene locus_tag LOCUS_3810 3656 5527 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980280.1 protein_id gnl|my_center|LOCUS_3810 5566 6396 gene locus_tag LOCUS_3820 gene cas6 5566 6396 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977967.1 protein_id gnl|my_center|LOCUS_3820 >Feature sequence034 994 710 gene locus_tag LOCUS_3830 gene gatC 994 710 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_3830 2306 999 gene locus_tag LOCUS_3840 gene aspS 2306 999 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878420.1 protein_id gnl|my_center|LOCUS_3840 3147 2326 gene locus_tag LOCUS_3850 gene panB 3147 2326 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867972.1 protein_id gnl|my_center|LOCUS_3850 3883 3122 gene locus_tag LOCUS_3860 3883 3122 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867813.1 protein_id gnl|my_center|LOCUS_3860 4743 3880 gene locus_tag LOCUS_3870 4743 3880 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892274.1 protein_id gnl|my_center|LOCUS_3870 4836 5813 gene locus_tag LOCUS_3880 4836 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3880 >Feature sequence035 1208 420 gene locus_tag LOCUS_3890 1208 420 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082765.1 protein_id gnl|my_center|LOCUS_3890 1998 1165 gene locus_tag LOCUS_3900 1998 1165 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249697.1 protein_id gnl|my_center|LOCUS_3900 2830 1988 gene locus_tag LOCUS_3910 2830 1988 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867495.1 protein_id gnl|my_center|LOCUS_3910 3384 2824 gene locus_tag LOCUS_3920 3384 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3920 4699 3404 gene locus_tag LOCUS_3930 4699 3404 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878898.1 protein_id gnl|my_center|LOCUS_3930 5783 4701 gene locus_tag LOCUS_3940 5783 4701 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460055.1 protein_id gnl|my_center|LOCUS_3940 <6896 5752 gene locus_tag LOCUS_3950 <6896 5752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243040.1:ABC transporter substrate-binding protein >Feature sequence036 696 1559 gene locus_tag LOCUS_3960 gene folP 696 1559 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250112.1 protein_id gnl|my_center|LOCUS_3960 1585 1863 gene locus_tag LOCUS_3970 1585 1863 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978937.1 protein_id gnl|my_center|LOCUS_3970 1860 2054 gene locus_tag LOCUS_3980 1860 2054 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147173.1 protein_id gnl|my_center|LOCUS_3980 3224 2055 gene locus_tag LOCUS_3990 3224 2055 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_3990 3985 3236 gene locus_tag LOCUS_4000 3985 3236 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249490.1 protein_id gnl|my_center|LOCUS_4000 4365 4036 gene locus_tag LOCUS_4010 4365 4036 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249488.1 protein_id gnl|my_center|LOCUS_4010 5800 4403 gene locus_tag LOCUS_4020 gene gltA 5800 4403 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583430.1 protein_id gnl|my_center|LOCUS_4020 6609 5797 gene locus_tag LOCUS_4030 6609 5797 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868068.1 protein_id gnl|my_center|LOCUS_4030 6812 6636 gene locus_tag LOCUS_4040 6812 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4040 >Feature sequence037 <1 1168 gene locus_tag LOCUS_4050 <1 1168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762346.1:ABC transporter substrate-binding protein 1188 2129 gene locus_tag LOCUS_4060 1188 2129 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391163.1 protein_id gnl|my_center|LOCUS_4060 2126 3205 gene locus_tag LOCUS_4070 2126 3205 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095662.1 protein_id gnl|my_center|LOCUS_4070 3202 3957 gene locus_tag LOCUS_4080 3202 3957 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496773.1 protein_id gnl|my_center|LOCUS_4080 3950 4672 gene locus_tag LOCUS_4090 3950 4672 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762258.1 protein_id gnl|my_center|LOCUS_4090 5172 4675 gene locus_tag LOCUS_4100 5172 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4100 6358 5207 gene locus_tag LOCUS_4110 6358 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4110 6408 6483 gene locus_tag LOCUS_t0120 6408 6483 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6705 6617 gene locus_tag LOCUS_t0130 6705 6617 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence038 682 371 gene locus_tag LOCUS_4120 682 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4120 752 961 gene locus_tag LOCUS_4130 752 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4130 1386 958 gene locus_tag LOCUS_4140 1386 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4140 1997 1506 gene locus_tag LOCUS_4150 1997 1506 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583986.1 protein_id gnl|my_center|LOCUS_4150 3189 2032 gene locus_tag LOCUS_4160 gene cdvC 3189 2032 CDS product cell division protein CdvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979234.1 protein_id gnl|my_center|LOCUS_4160 3767 3189 gene locus_tag LOCUS_4170 3767 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4170 4442 3810 gene locus_tag LOCUS_4180 gene cdvB1/B2 4442 3810 CDS product cell division protein CdvB1/B2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979256.1 protein_id gnl|my_center|LOCUS_4180 4536 5696 gene locus_tag LOCUS_4190 4536 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4190 >Feature sequence039 822 749 gene locus_tag LOCUS_t0140 822 749 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1579 848 gene locus_tag LOCUS_4200 1579 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4200 1878 1582 gene locus_tag LOCUS_4210 1878 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4210 1932 2903 gene locus_tag LOCUS_4220 1932 2903 CDS product UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251204.1 protein_id gnl|my_center|LOCUS_4220 2900 3142 gene locus_tag LOCUS_4230 2900 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4230 3167 3676 gene locus_tag LOCUS_4240 3167 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4240 3911 3642 gene locus_tag LOCUS_4250 3911 3642 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978185.1 protein_id gnl|my_center|LOCUS_4250 4867 3908 gene locus_tag LOCUS_4260 4867 3908 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024326.1 protein_id gnl|my_center|LOCUS_4260 5978 4869 gene locus_tag LOCUS_4270 5978 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4270 6050 6125 gene locus_tag LOCUS_t0150 6050 6125 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence040 323 1288 gene locus_tag LOCUS_4280 323 1288 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403765.1 protein_id gnl|my_center|LOCUS_4280 1754 1278 gene locus_tag LOCUS_4290 1754 1278 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868433.1 protein_id gnl|my_center|LOCUS_4290 1797 2033 gene locus_tag LOCUS_4300 1797 2033 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846912.1 protein_id gnl|my_center|LOCUS_4300 2043 2201 gene locus_tag LOCUS_4310 2043 2201 CDS product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978307.1 protein_id gnl|my_center|LOCUS_4310 2198 2785 gene locus_tag LOCUS_4320 2198 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4320 2778 3455 gene locus_tag LOCUS_4330 gene rpiA 2778 3455 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878443.1 protein_id gnl|my_center|LOCUS_4330 4097 3441 gene locus_tag LOCUS_4340 4097 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_4340 4387 4046 gene locus_tag LOCUS_4350 4387 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4350 4910 4404 gene locus_tag LOCUS_4360 4910 4404 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545295.1 protein_id gnl|my_center|LOCUS_4360 5435 4914 gene locus_tag LOCUS_4370 5435 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4370 5629 5432 gene locus_tag LOCUS_4380 5629 5432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4380 >Feature sequence041 <1 2121 gene locus_tag LOCUS_4390 <1 2121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867740.1:DNA-directed RNA polymerase subunit A'' 2118 2435 gene locus_tag LOCUS_4400 2118 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4400 2432 2650 gene locus_tag LOCUS_4410 2432 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4410 2626 2901 gene locus_tag LOCUS_4420 2626 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4420 2915 3358 gene locus_tag LOCUS_4430 2915 3358 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978223.1 protein_id gnl|my_center|LOCUS_4430 3398 3832 gene locus_tag LOCUS_4440 3398 3832 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876681.1 protein_id gnl|my_center|LOCUS_4440 3837 4433 gene locus_tag LOCUS_4450 3837 4433 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978220.1 protein_id gnl|my_center|LOCUS_4450 4487 5800 gene locus_tag LOCUS_4460 gene tuf 4487 5800 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978219.1 protein_id gnl|my_center|LOCUS_4460 5808 6122 gene locus_tag LOCUS_4470 gene rpsJ 5808 6122 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867802.1 protein_id gnl|my_center|LOCUS_4470 >Feature sequence042 185 949 gene locus_tag LOCUS_4480 185 949 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404626.1 protein_id gnl|my_center|LOCUS_4480 1368 946 gene locus_tag LOCUS_4490 1368 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4490 2487 1405 gene locus_tag LOCUS_4500 2487 1405 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250252.1 protein_id gnl|my_center|LOCUS_4500 2540 2995 gene locus_tag LOCUS_4510 2540 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878211.1 protein_id gnl|my_center|LOCUS_4510 2992 3330 gene locus_tag LOCUS_4520 2992 3330 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250923.1 protein_id gnl|my_center|LOCUS_4520 3736 3317 gene locus_tag LOCUS_4530 3736 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4530 4449 3769 gene locus_tag LOCUS_4540 4449 3769 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867812.1 protein_id gnl|my_center|LOCUS_4540 4871 4476 gene locus_tag LOCUS_4550 4871 4476 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060955.1 protein_id gnl|my_center|LOCUS_4550 5736 4861 gene locus_tag LOCUS_4560 gene mptA 5736 4861 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066005.1 protein_id gnl|my_center|LOCUS_4560 5809 6336 gene locus_tag LOCUS_4570 5809 6336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4570 >Feature sequence043 459 1490 gene locus_tag LOCUS_4580 459 1490 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_4580 1493 2359 gene locus_tag LOCUS_4590 1493 2359 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878389.1 protein_id gnl|my_center|LOCUS_4590 2404 3174 gene locus_tag LOCUS_4600 gene hpaI 2404 3174 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431692.1 protein_id gnl|my_center|LOCUS_4600 3183 4172 gene locus_tag LOCUS_4610 gene ilvC 3183 4172 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762306.1 protein_id gnl|my_center|LOCUS_4610 5048 4173 gene locus_tag LOCUS_4620 5048 4173 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763004.1 protein_id gnl|my_center|LOCUS_4620 5128 5805 gene locus_tag LOCUS_4630 5128 5805 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080870.1 protein_id gnl|my_center|LOCUS_4630 5882 5805 gene locus_tag LOCUS_t0160 5882 5805 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence044 64 1344 gene locus_tag LOCUS_4640 64 1344 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582434.1 protein_id gnl|my_center|LOCUS_4640 1458 2318 gene locus_tag LOCUS_4650 1458 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4650 2345 2421 gene locus_tag LOCUS_t0170 2345 2421 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3557 2421 gene locus_tag LOCUS_4660 3557 2421 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545826.1 protein_id gnl|my_center|LOCUS_4660 4227 3538 gene locus_tag LOCUS_4670 gene sufC 4227 3538 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876773.1 protein_id gnl|my_center|LOCUS_4670 6151 4289 gene locus_tag LOCUS_4680 gene aor 6151 4289 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250017.1 protein_id gnl|my_center|LOCUS_4680 >Feature sequence045 <1 1136 gene locus_tag LOCUS_4690 <1 1136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967895.1:zinc-binding dehydrogenase 1276 2277 gene locus_tag LOCUS_4700 gene ala 1276 2277 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879161.1 protein_id gnl|my_center|LOCUS_4700 2322 3722 gene locus_tag LOCUS_4710 2322 3722 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009208278.1 protein_id gnl|my_center|LOCUS_4710 3724 4980 gene locus_tag LOCUS_4720 3724 4980 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257999.1 protein_id gnl|my_center|LOCUS_4720 >Feature sequence046 2 274 gene locus_tag LOCUS_4730 2 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4730 268 984 gene locus_tag LOCUS_4740 268 984 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762949.1 protein_id gnl|my_center|LOCUS_4740 981 2024 gene locus_tag LOCUS_4750 gene fni 981 2024 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020653.1 protein_id gnl|my_center|LOCUS_4750 2015 3043 gene locus_tag LOCUS_4760 2015 3043 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227641.1 protein_id gnl|my_center|LOCUS_4760 3045 4745 gene locus_tag LOCUS_4770 3045 4745 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867608.1 protein_id gnl|my_center|LOCUS_4770 4759 5925 gene locus_tag LOCUS_4780 4759 5925 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258527.1 protein_id gnl|my_center|LOCUS_4780 5961 6049 gene locus_tag LOCUS_t0180 5961 6049 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence047 326 252 gene locus_tag LOCUS_t0190 326 252 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 574 350 gene locus_tag LOCUS_4790 574 350 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876456.1 protein_id gnl|my_center|LOCUS_4790 692 883 gene locus_tag LOCUS_4800 692 883 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496434.1 protein_id gnl|my_center|LOCUS_4800 880 1614 gene locus_tag LOCUS_4810 880 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4810 2129 1611 gene locus_tag LOCUS_4820 2129 1611 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240266.1 protein_id gnl|my_center|LOCUS_4820 2761 2114 gene locus_tag LOCUS_4830 2761 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4830 2848 3510 gene locus_tag LOCUS_4840 gene tpiA 2848 3510 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868855.1 protein_id gnl|my_center|LOCUS_4840 4823 3507 gene locus_tag LOCUS_4850 gene aspS 4823 3507 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875865.1 protein_id gnl|my_center|LOCUS_4850 5301 4792 gene locus_tag LOCUS_4860 5301 4792 CDS product transcription elongation factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762432.1 protein_id gnl|my_center|LOCUS_4860 5651 5373 gene locus_tag LOCUS_4870 gene albA 5651 5373 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879448.1 protein_id gnl|my_center|LOCUS_4870 5735 5917 gene locus_tag LOCUS_4880 5735 5917 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978144.1 protein_id gnl|my_center|LOCUS_4880 5919 5992 gene locus_tag LOCUS_t0200 5919 5992 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence048 <1 706 gene locus_tag LOCUS_4890 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022265.1:APC family permease 2256 691 gene locus_tag LOCUS_4900 2256 691 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249122.1 protein_id gnl|my_center|LOCUS_4900 3938 2277 gene locus_tag LOCUS_4910 3938 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4910 3984 4496 gene locus_tag LOCUS_4920 3984 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4920 >Feature sequence049 90 4 gene locus_tag LOCUS_t0210 90 4 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 149 1222 gene locus_tag LOCUS_4930 gene hisC 149 1222 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877195.1 protein_id gnl|my_center|LOCUS_4930 1834 1217 gene locus_tag LOCUS_4940 1834 1217 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837716.1 protein_id gnl|my_center|LOCUS_4940 3176 1866 gene locus_tag LOCUS_4950 3176 1866 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876597.1 protein_id gnl|my_center|LOCUS_4950 3425 3183 gene locus_tag LOCUS_4960 3425 3183 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_4960 4719 3463 gene locus_tag LOCUS_4970 gene lysA 4719 3463 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_4970 5135 4800 gene locus_tag LOCUS_4980 5135 4800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4980 >Feature sequence050 604 1110 gene locus_tag LOCUS_4990 gene mobB 604 1110 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460721.1 protein_id gnl|my_center|LOCUS_4990 2026 1097 gene locus_tag LOCUS_5000 2026 1097 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_5000 2429 2028 gene locus_tag LOCUS_5010 2429 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5010 2946 2449 gene locus_tag LOCUS_5020 2946 2449 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496839.1 protein_id gnl|my_center|LOCUS_5020 3756 2971 gene locus_tag LOCUS_5030 3756 2971 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876505.1 protein_id gnl|my_center|LOCUS_5030 3818 4210 gene locus_tag LOCUS_5040 3818 4210 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762335.1 protein_id gnl|my_center|LOCUS_5040 5315 4200 gene locus_tag LOCUS_5050 5315 4200 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392231.1 protein_id gnl|my_center|LOCUS_5050 <5848 5308 gene locus_tag LOCUS_5060 <5848 5308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010869715.1:V-type ATP synthase subunit C >Feature sequence051 781 230 gene locus_tag LOCUS_5070 781 230 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867177.1 protein_id gnl|my_center|LOCUS_5070 812 1243 gene locus_tag LOCUS_5080 812 1243 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583024.1 protein_id gnl|my_center|LOCUS_5080 1278 1445 gene locus_tag LOCUS_5090 1278 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5090 1442 3139 gene locus_tag LOCUS_5100 1442 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5100 3140 3418 gene locus_tag LOCUS_5110 gene albA 3140 3418 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979310.1 protein_id gnl|my_center|LOCUS_5110 4183 3389 gene locus_tag LOCUS_5120 gene tmk 4183 3389 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867602.1 protein_id gnl|my_center|LOCUS_5120 4551 4180 gene locus_tag LOCUS_5130 4551 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5130 4737 5318 gene locus_tag LOCUS_5140 4737 5318 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024490.1 protein_id gnl|my_center|LOCUS_5140 5321 5524 gene locus_tag LOCUS_5150 5321 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5150 >Feature sequence052 400 603 gene locus_tag LOCUS_5160 400 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5160 623 2461 gene locus_tag LOCUS_5170 623 2461 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868458.1 protein_id gnl|my_center|LOCUS_5170 3317 2442 gene locus_tag LOCUS_5180 gene speB 3317 2442 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023880.1 protein_id gnl|my_center|LOCUS_5180 3995 3336 gene locus_tag LOCUS_5190 3995 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5190 <5822 4033 gene locus_tag LOCUS_5200 <5822 4033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762568.1:DNA-directed DNA polymerase I >Feature sequence053 2284 662 gene locus_tag LOCUS_5210 2284 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5210 2939 2262 gene locus_tag LOCUS_5220 2939 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5220 3116 3601 gene locus_tag LOCUS_5230 gene lrpA 3116 3601 CDS product HTH-type transcriptional regulator LrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251084.1 protein_id gnl|my_center|LOCUS_5230 4340 3684 gene locus_tag LOCUS_5240 4340 3684 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545344.1 protein_id gnl|my_center|LOCUS_5240 5196 4363 gene locus_tag LOCUS_5250 gene trm5b 5196 4363 CDS product tRNA (guanine(37)-N1)-methyltransferase Trm5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867861.1 protein_id gnl|my_center|LOCUS_5250 >Feature sequence054 634 377 gene locus_tag LOCUS_5260 634 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5260 2025 631 gene locus_tag LOCUS_5270 2025 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5270 3734 2025 gene locus_tag LOCUS_5280 3734 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5280 4080 3736 gene locus_tag LOCUS_5290 4080 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5290 4207 4064 gene locus_tag LOCUS_5300 4207 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5300 4502 4188 gene locus_tag LOCUS_5310 4502 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5310 5433 4513 gene locus_tag LOCUS_5320 5433 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5320 >Feature sequence055 746 1201 gene locus_tag LOCUS_5330 746 1201 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023392.1 protein_id gnl|my_center|LOCUS_5330 1283 1513 gene locus_tag LOCUS_5340 1283 1513 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943881.1 protein_id gnl|my_center|LOCUS_5340 1513 1734 gene locus_tag LOCUS_5350 1513 1734 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249666.1 protein_id gnl|my_center|LOCUS_5350 1731 2252 gene locus_tag LOCUS_5360 1731 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_5360 2227 3741 gene locus_tag LOCUS_5370 2227 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_5370 3746 4237 gene locus_tag LOCUS_5380 3746 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5380 4319 4543 gene locus_tag LOCUS_5390 4319 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5390 4566 4653 gene locus_tag LOCUS_t0220 4566 4653 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5393 4632 gene locus_tag LOCUS_5400 5393 4632 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867960.1 protein_id gnl|my_center|LOCUS_5400 >Feature sequence056 857 357 gene locus_tag LOCUS_5410 857 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5410 1903 893 gene locus_tag LOCUS_5420 1903 893 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323130.1 protein_id gnl|my_center|LOCUS_5420 3483 1903 gene locus_tag LOCUS_5430 3483 1903 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_5430 3591 5228 gene locus_tag LOCUS_5440 3591 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5440 >Feature sequence057 2999 792 gene locus_tag LOCUS_5450 2999 792 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_5450 3909 3055 gene locus_tag LOCUS_5460 3909 3055 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755895.1 protein_id gnl|my_center|LOCUS_5460 4095 3934 gene locus_tag LOCUS_5470 4095 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5470 4298 5164 gene locus_tag LOCUS_5480 4298 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5480 >Feature sequence058 271 1047 gene locus_tag LOCUS_5490 271 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5490 1393 1037 gene locus_tag LOCUS_5500 1393 1037 CDS product DNA polymerase ligase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023353.1 protein_id gnl|my_center|LOCUS_5500 1637 1386 gene locus_tag LOCUS_5510 1637 1386 CDS product 50S ribosomal protein L35ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867507.1 protein_id gnl|my_center|LOCUS_5510 1766 2770 gene locus_tag LOCUS_5520 1766 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5520 2767 4908 gene locus_tag LOCUS_5530 2767 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5530 >Feature sequence059 <1 1499 gene locus_tag LOCUS_5540 <1 1499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867481.1:chromosome segregation protein SMC 1492 2106 gene locus_tag LOCUS_5550 1492 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5550 2084 2599 gene locus_tag LOCUS_5560 2084 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5560 2589 2969 gene locus_tag LOCUS_5570 2589 2969 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250142.1 protein_id gnl|my_center|LOCUS_5570 2966 3247 gene locus_tag LOCUS_5580 gene srp19 2966 3247 CDS product signal recognition particle SRP19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878753.1 protein_id gnl|my_center|LOCUS_5580 3543 3244 gene locus_tag LOCUS_5590 3543 3244 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240464.1 protein_id gnl|my_center|LOCUS_5590 >Feature sequence060 539 1741 gene locus_tag LOCUS_5600 539 1741 CDS product putative sugar nucleotidyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256908.1 protein_id gnl|my_center|LOCUS_5600 1783 2805 gene locus_tag LOCUS_5610 1783 2805 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880453.1 protein_id gnl|my_center|LOCUS_5610 >Feature sequence061 1019 228 gene locus_tag LOCUS_5620 1019 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5620 1932 1009 gene locus_tag LOCUS_5630 1932 1009 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976555.1 protein_id gnl|my_center|LOCUS_5630 2062 1987 gene locus_tag LOCUS_t0230 2062 1987 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3652 2096 gene locus_tag LOCUS_5640 3652 2096 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249122.1 protein_id gnl|my_center|LOCUS_5640 <5213 3678 gene locus_tag LOCUS_5650 <5213 3678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496564.1:leucine--tRNA ligase >Feature sequence062 513 1214 gene locus_tag LOCUS_5660 gene pyrF 513 1214 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868434.1 protein_id gnl|my_center|LOCUS_5660 1617 1180 gene locus_tag LOCUS_5670 1617 1180 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761848.1 protein_id gnl|my_center|LOCUS_5670 2399 1614 gene locus_tag LOCUS_5680 2399 1614 CDS product inorganic polyphosphate/ATP-NAD kinase (Poly(P)/ATP NAD kinase) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546481.1 protein_id gnl|my_center|LOCUS_5680 2464 3525 gene locus_tag LOCUS_5690 2464 3525 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881144.1 protein_id gnl|my_center|LOCUS_5690 4500 3526 gene locus_tag LOCUS_5700 gene radA 4500 3526 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878493.1 protein_id gnl|my_center|LOCUS_5700 >Feature sequence063 237 43 gene locus_tag LOCUS_5710 237 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5710 830 225 gene locus_tag LOCUS_5720 830 225 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249857.1 protein_id gnl|my_center|LOCUS_5720 1452 823 gene locus_tag LOCUS_5730 1452 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879749.1 protein_id gnl|my_center|LOCUS_5730 1484 1840 gene locus_tag LOCUS_5740 1484 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5740 1872 2621 gene locus_tag LOCUS_5750 1872 2621 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878032.1 protein_id gnl|my_center|LOCUS_5750 4081 2618 gene locus_tag LOCUS_5760 4081 2618 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 protein_id gnl|my_center|LOCUS_5760 4166 4453 gene locus_tag LOCUS_5770 4166 4453 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978432.1 protein_id gnl|my_center|LOCUS_5770 4450 4764 gene locus_tag LOCUS_5780 4450 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5780 >Feature sequence064 3 2126 gene locus_tag LOCUS_5790 3 2126 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762768.1 protein_id gnl|my_center|LOCUS_5790 3335 2118 gene locus_tag LOCUS_5800 gene thrC 3335 2118 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880362.1 protein_id gnl|my_center|LOCUS_5800 3416 4561 gene locus_tag LOCUS_5810 3416 4561 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143789.1 protein_id gnl|my_center|LOCUS_5810 >Feature sequence065 <1 1398 gene locus_tag LOCUS_5820 <1 1398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979431.1:type I glutamate--ammonia ligase 1489 2580 gene locus_tag LOCUS_5830 1489 2580 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868238.1 protein_id gnl|my_center|LOCUS_5830 3606 2581 gene locus_tag LOCUS_5840 3606 2581 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902535.1 protein_id gnl|my_center|LOCUS_5840 4392 3694 gene locus_tag LOCUS_5850 4392 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5850 >Feature sequence066 1893 154 gene locus_tag LOCUS_5860 1893 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5860 1929 2567 gene locus_tag LOCUS_5870 1929 2567 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485759.1 protein_id gnl|my_center|LOCUS_5870 2564 3358 gene locus_tag LOCUS_5880 2564 3358 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496399.1 protein_id gnl|my_center|LOCUS_5880 3355 3528 gene locus_tag LOCUS_5890 3355 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5890 <4779 3510 gene locus_tag LOCUS_5900 <4779 3510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978933.1:STT3 domain-containing protein >Feature sequence067 <1 873 gene locus_tag LOCUS_5910 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879267.1:ABC transporter ATP-binding protein 1196 870 gene locus_tag LOCUS_5920 1196 870 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978733.1 protein_id gnl|my_center|LOCUS_5920 1769 1269 gene locus_tag LOCUS_5930 1769 1269 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879257.1 protein_id gnl|my_center|LOCUS_5930 3058 1778 gene locus_tag LOCUS_5940 3058 1778 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083007.1 protein_id gnl|my_center|LOCUS_5940 3115 4524 gene locus_tag LOCUS_5950 gene pyk 3115 4524 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393367.1 protein_id gnl|my_center|LOCUS_5950 >Feature sequence068 389 1108 gene locus_tag LOCUS_5960 389 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5960 1248 3254 gene locus_tag LOCUS_5970 1248 3254 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081506.1 protein_id gnl|my_center|LOCUS_5970 3281 4309 gene locus_tag LOCUS_5980 3281 4309 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081437.1 protein_id gnl|my_center|LOCUS_5980 >Feature sequence069 <1 1162 gene locus_tag LOCUS_5990 <1 1162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057679.1:TRC40/GET3/ArsA family transport-energizing ATPase 2512 1163 gene locus_tag LOCUS_6000 2512 1163 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258001.1 protein_id gnl|my_center|LOCUS_6000 3042 2614 gene locus_tag LOCUS_6010 3042 2614 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867748.1 protein_id gnl|my_center|LOCUS_6010 3085 3171 gene locus_tag LOCUS_t0240 3085 3171 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4382 3171 gene locus_tag LOCUS_6020 4382 3171 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978370.1 protein_id gnl|my_center|LOCUS_6020 4712 4389 gene locus_tag LOCUS_6030 4712 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6030 >Feature sequence070 40 723 gene locus_tag LOCUS_6040 40 723 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023459.1 protein_id gnl|my_center|LOCUS_6040 720 2585 gene locus_tag LOCUS_6050 720 2585 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867806.1 protein_id gnl|my_center|LOCUS_6050 2619 3194 gene locus_tag LOCUS_6060 2619 3194 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878792.1 protein_id gnl|my_center|LOCUS_6060 3196 4035 gene locus_tag LOCUS_6070 3196 4035 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880876.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_6070 4051 4224 gene locus_tag LOCUS_6080 4051 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_6080 >Feature sequence071 89 3565 gene locus_tag LOCUS_6090 gene fdnG 89 3565 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941441.1 protein_id gnl|my_center|LOCUS_6090 3562 4455 gene locus_tag LOCUS_6100 3562 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6100 >Feature sequence072 487 53 gene locus_tag LOCUS_6110 487 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6110 538 720 gene locus_tag LOCUS_6120 538 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6120 1865 732 gene locus_tag LOCUS_6130 1865 732 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066036.1 protein_id gnl|my_center|LOCUS_6130 3260 1878 gene locus_tag LOCUS_6140 gene glcD 3260 1878 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890729.1 protein_id gnl|my_center|LOCUS_6140 >Feature sequence073 66 1118 gene locus_tag LOCUS_6150 gene argC 66 1118 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762032.1 protein_id gnl|my_center|LOCUS_6150 1121 1912 gene locus_tag LOCUS_6160 1121 1912 CDS product [LysW]-aminoadipate/[LysW]-glutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978133.1 protein_id gnl|my_center|LOCUS_6160 1913 3103 gene locus_tag LOCUS_6170 1913 3103 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228893.1 protein_id gnl|my_center|LOCUS_6170 3100 3519 gene locus_tag LOCUS_6180 3100 3519 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250236.1 protein_id gnl|my_center|LOCUS_6180 >Feature sequence074 1126 254 gene locus_tag LOCUS_6190 1126 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6190 1165 1093 gene locus_tag LOCUS_t0250 1165 1093 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2281 1202 gene locus_tag LOCUS_6200 gene asd 2281 1202 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876434.1 protein_id gnl|my_center|LOCUS_6200 4035 2305 gene locus_tag LOCUS_6210 4035 2305 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978120.1 protein_id gnl|my_center|LOCUS_6210 >Feature sequence075 102 1238 gene locus_tag LOCUS_6220 102 1238 CDS product DUF1512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979465.1 protein_id gnl|my_center|LOCUS_6220 1247 1435 gene locus_tag LOCUS_6230 1247 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6230 2310 1432 gene locus_tag LOCUS_6240 gene map 2310 1432 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870846.1 protein_id gnl|my_center|LOCUS_6240 2349 2813 gene locus_tag LOCUS_6250 2349 2813 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061166.1 protein_id gnl|my_center|LOCUS_6250 3408 2803 gene locus_tag LOCUS_6260 gene psmB 3408 2803 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762506.1 protein_id gnl|my_center|LOCUS_6260 <4454 3436 gene locus_tag LOCUS_6270 <4454 3436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762505.1:RNA 3'-terminal phosphate cyclase >Feature sequence076 1 927 gene locus_tag LOCUS_6280 1 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6280 929 3022 gene locus_tag LOCUS_6290 929 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6290 3063 4328 gene locus_tag LOCUS_6300 3063 4328 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868807.1 protein_id gnl|my_center|LOCUS_6300 >Feature sequence077 1623 1009 gene locus_tag LOCUS_6310 1623 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6310 2160 1669 gene locus_tag LOCUS_6320 2160 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6320 2918 2322 gene locus_tag LOCUS_6330 2918 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6330 2951 3448 gene locus_tag LOCUS_6340 gene tsaA 2951 3448 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978062.1 protein_id gnl|my_center|LOCUS_6340 4228 3449 gene locus_tag LOCUS_6350 4228 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6350 >Feature sequence078 <1 614 gene locus_tag LOCUS_6360 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289241.1:PHP domain-containing protein 598 1266 gene locus_tag LOCUS_6370 598 1266 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877219.1 protein_id gnl|my_center|LOCUS_6370 1306 1719 gene locus_tag LOCUS_6380 gene pfdA 1306 1719 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249956.1 protein_id gnl|my_center|LOCUS_6380 1720 2625 gene locus_tag LOCUS_6390 gene ftsY 1720 2625 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867626.1 protein_id gnl|my_center|LOCUS_6390 2627 3559 gene locus_tag LOCUS_6400 gene argF 2627 3559 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878750.1 protein_id gnl|my_center|LOCUS_6400 <4352 3549 gene locus_tag LOCUS_6410 <4352 3549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250373.1:D-aminoacyl-tRNA deacylase >Feature sequence079 691 1494 gene locus_tag LOCUS_6420 691 1494 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902223.1 protein_id gnl|my_center|LOCUS_6420 2283 1462 gene locus_tag LOCUS_6430 2283 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6430 3376 2318 gene locus_tag LOCUS_6440 3376 2318 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020340.1 protein_id gnl|my_center|LOCUS_6440 4177 3386 gene locus_tag LOCUS_6450 4177 3386 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020339.1 protein_id gnl|my_center|LOCUS_6450 >Feature sequence080 2758 239 gene locus_tag LOCUS_6460 2758 239 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081868573.1 protein_id gnl|my_center|LOCUS_6460 >Feature sequence081 11 1183 gene locus_tag LOCUS_6470 11 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6470 1214 1498 gene locus_tag LOCUS_6480 1214 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6480 1495 2115 gene locus_tag LOCUS_6490 1495 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6490 2102 2287 gene locus_tag LOCUS_6500 2102 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6500 3290 2274 gene locus_tag LOCUS_6510 3290 2274 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755922.1 protein_id gnl|my_center|LOCUS_6510 >Feature sequence082 1115 2308 gene locus_tag LOCUS_6520 1115 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6520 >Feature sequence083 1854 232 gene locus_tag LOCUS_6530 1854 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6530 2104 2017 gene locus_tag LOCUS_t0260 2104 2017 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2802 2203 gene locus_tag LOCUS_6540 2802 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6540 2855 3664 gene locus_tag LOCUS_6550 gene pheA 2855 3664 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038038884.1 protein_id gnl|my_center|LOCUS_6550 3664 4185 gene locus_tag LOCUS_6560 3664 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6560 >Feature sequence084 3 1934 gene locus_tag LOCUS_6570 gene asnB 3 1934 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868273.1 protein_id gnl|my_center|LOCUS_6570 1947 3176 gene locus_tag LOCUS_6580 gene hflX 1947 3176 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868200.1 protein_id gnl|my_center|LOCUS_6580 3173 3697 gene locus_tag LOCUS_6590 3173 3697 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053622.1 protein_id gnl|my_center|LOCUS_6590 >Feature sequence085 1063 80 gene locus_tag LOCUS_6600 gene pta 1063 80 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943344.1 protein_id gnl|my_center|LOCUS_6600 1156 1887 gene locus_tag LOCUS_6610 1156 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6610 2106 1876 gene locus_tag LOCUS_6620 2106 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6620 2189 2725 gene locus_tag LOCUS_6630 2189 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6630 2759 3313 gene locus_tag LOCUS_6640 2759 3313 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545477.1 protein_id gnl|my_center|LOCUS_6640 <4135 3321 gene locus_tag LOCUS_6650 <4135 3321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867803.1:transcription initiation factor IIB >Feature sequence086 71 1261 gene locus_tag LOCUS_6660 71 1261 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584117.1 protein_id gnl|my_center|LOCUS_6660 1347 2954 gene locus_tag LOCUS_6670 1347 2954 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980485.1 protein_id gnl|my_center|LOCUS_6670 3018 3962 gene locus_tag LOCUS_6680 3018 3962 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870499.1 protein_id gnl|my_center|LOCUS_6680 >Feature sequence087 1083 55 gene locus_tag LOCUS_6690 gene pepQ 1083 55 CDS product Xaa-Pro dipeptidase PepQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146836.1 protein_id gnl|my_center|LOCUS_6690 1400 1080 gene locus_tag LOCUS_6700 1400 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6700 1803 1411 gene locus_tag LOCUS_6710 1803 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6710 <4092 1934 gene locus_tag LOCUS_6720 <4092 1934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878912.1:chloride channel protein >Feature sequence088 <1 856 gene locus_tag LOCUS_6730 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146644.1:ABC transporter ATP-binding protein 825 1859 gene locus_tag LOCUS_6740 825 1859 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584051.1 protein_id gnl|my_center|LOCUS_6740 1938 1862 gene locus_tag LOCUS_t0270 1938 1862 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2146 2880 gene locus_tag LOCUS_6750 2146 2880 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631587.1 protein_id gnl|my_center|LOCUS_6750 3903 2884 gene locus_tag LOCUS_6760 gene gyaR 3903 2884 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249634.1 protein_id gnl|my_center|LOCUS_6760 4044 3958 gene locus_tag LOCUS_t0280 4044 3958 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence089 1449 301 gene locus_tag LOCUS_6770 1449 301 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249135.1 protein_id gnl|my_center|LOCUS_6770 2465 1446 gene locus_tag LOCUS_6780 2465 1446 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868484.1 protein_id gnl|my_center|LOCUS_6780 2616 3845 gene locus_tag LOCUS_6790 2616 3845 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948915.1 protein_id gnl|my_center|LOCUS_6790 >Feature sequence090 434 1105 gene locus_tag LOCUS_6800 gene pyrH 434 1105 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876512.1 protein_id gnl|my_center|LOCUS_6800 1136 2509 gene locus_tag LOCUS_6810 gene purB 1136 2509 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868368.1 protein_id gnl|my_center|LOCUS_6810 3448 2471 gene locus_tag LOCUS_6820 3448 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6820 <4007 3489 gene locus_tag LOCUS_6830 <4007 3489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545352.1:MarC family protein >Feature sequence091 540 995 gene locus_tag LOCUS_6840 540 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6840 992 1582 gene locus_tag LOCUS_6850 992 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6850 1606 1800 gene locus_tag LOCUS_6860 1606 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6860 3298 1760 gene locus_tag LOCUS_6870 3298 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6870 >Feature sequence092 72 518 gene locus_tag LOCUS_6880 72 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6880 544 966 gene locus_tag LOCUS_6890 544 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6890 1626 994 gene locus_tag LOCUS_6900 1626 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6900 2162 1638 gene locus_tag LOCUS_6910 2162 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6910 2304 2729 gene locus_tag LOCUS_6920 2304 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6920 3582 2722 gene locus_tag LOCUS_6930 3582 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6930 >Feature sequence093 399 1310 gene locus_tag LOCUS_6940 399 1310 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762863.1 protein_id gnl|my_center|LOCUS_6940 1370 2185 gene locus_tag LOCUS_6950 1370 2185 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980161.1 protein_id gnl|my_center|LOCUS_6950 3582 2182 gene locus_tag LOCUS_6960 3582 2182 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943345.1 protein_id gnl|my_center|LOCUS_6960 3908 3579 gene locus_tag LOCUS_6970 3908 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6970 >Feature sequence094 <1 1287 gene locus_tag LOCUS_6980 <1 1287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048370.1:glycine--tRNA ligase 1364 2575 gene locus_tag LOCUS_6990 1364 2575 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876437.1 protein_id gnl|my_center|LOCUS_6990 2572 3369 gene locus_tag LOCUS_7000 2572 3369 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881009.1 protein_id gnl|my_center|LOCUS_7000 >Feature sequence095 557 1636 gene locus_tag LOCUS_7010 557 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7010 2642 1623 gene locus_tag LOCUS_7020 2642 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7020 2685 3287 gene locus_tag LOCUS_7030 2685 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7030 3853 3293 gene locus_tag LOCUS_7040 3853 3293 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742650.1 protein_id gnl|my_center|LOCUS_7040 >Feature sequence096 1576 971 gene locus_tag LOCUS_7050 gene hxlB 1576 971 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978137.1 protein_id gnl|my_center|LOCUS_7050 2362 1637 gene locus_tag LOCUS_7060 2362 1637 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867253.1 protein_id gnl|my_center|LOCUS_7060 3168 2359 gene locus_tag LOCUS_7070 3168 2359 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249697.1 protein_id gnl|my_center|LOCUS_7070 <3795 3165 gene locus_tag LOCUS_7080 <3795 3165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021751.1:ABC transporter ATP-binding protein >Feature sequence097 3102 574 gene locus_tag LOCUS_7090 3102 574 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879871.1 protein_id gnl|my_center|LOCUS_7090 <3789 3214 gene locus_tag LOCUS_7100 <3789 3214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257999.1:FAD-binding oxidoreductase >Feature sequence098 85 423 gene locus_tag LOCUS_7110 85 423 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867655.1 protein_id gnl|my_center|LOCUS_7110 416 856 gene locus_tag LOCUS_7120 gene rplM 416 856 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250452.1 protein_id gnl|my_center|LOCUS_7120 844 1263 gene locus_tag LOCUS_7130 844 1263 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061175.1 protein_id gnl|my_center|LOCUS_7130 1778 1272 gene locus_tag LOCUS_7140 1778 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7140 2406 1852 gene locus_tag LOCUS_7150 2406 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7150 2544 2762 gene locus_tag LOCUS_7160 2544 2762 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250450.1 protein_id gnl|my_center|LOCUS_7160 >Feature sequence099 <1 1694 gene locus_tag LOCUS_7170 <1 1694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211791.1:ATP-binding cassette domain-containing protein 2256 1702 gene locus_tag LOCUS_7180 2256 1702 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545477.1 protein_id gnl|my_center|LOCUS_7180 2829 2290 gene locus_tag LOCUS_7190 2829 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7190 2912 3142 gene locus_tag LOCUS_7200 2912 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7200 >Feature sequence100 1447 347 gene locus_tag LOCUS_7210 gene fbp 1447 347 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846263.1 protein_id gnl|my_center|LOCUS_7210 1544 2944 gene locus_tag LOCUS_7220 1544 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7220 3074 3147 gene locus_tag LOCUS_t0290 3074 3147 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3506 3659 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtatctcataaagagaattgaaaga >Feature sequence101 198 752 gene locus_tag LOCUS_7230 198 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7230 821 1006 gene locus_tag LOCUS_7240 821 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7240 1055 1285 gene locus_tag LOCUS_7250 1055 1285 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_7250 1282 1500 gene locus_tag LOCUS_7260 1282 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7260 1497 2402 gene locus_tag LOCUS_7270 1497 2402 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933177.1 protein_id gnl|my_center|LOCUS_7270 3275 2394 gene locus_tag LOCUS_7280 3275 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7280 >Feature sequence102 3 2237 gene locus_tag LOCUS_7290 3 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7290 2280 3236 gene locus_tag LOCUS_7300 2280 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7300 >Feature sequence103 528 905 gene locus_tag LOCUS_7310 528 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7310 1431 889 gene locus_tag LOCUS_7320 1431 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7320 1759 1403 gene locus_tag LOCUS_7330 1759 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7330 1925 2152 gene locus_tag LOCUS_7340 1925 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7340 2153 2890 gene locus_tag LOCUS_7350 2153 2890 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868227.1 protein_id gnl|my_center|LOCUS_7350 >Feature sequence104 3 341 gene locus_tag LOCUS_7360 3 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7360 394 945 gene locus_tag LOCUS_7370 394 945 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388657.1 protein_id gnl|my_center|LOCUS_7370 2010 961 gene locus_tag LOCUS_7380 2010 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7380 2115 3062 gene locus_tag LOCUS_7390 gene wtpA 2115 3062 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013684400.1 protein_id gnl|my_center|LOCUS_7390 >Feature sequence105 220 1428 gene locus_tag LOCUS_7400 gene coaBC 220 1428 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249472.1 protein_id gnl|my_center|LOCUS_7400 1425 2156 gene locus_tag LOCUS_7410 1425 2156 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013805.1 protein_id gnl|my_center|LOCUS_7410 2153 2686 gene locus_tag LOCUS_7420 2153 2686 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020434.1 protein_id gnl|my_center|LOCUS_7420 <3501 2687 gene locus_tag LOCUS_7430 <3501 2687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878793.1:CDC48 family AAA ATPase >Feature sequence106 1469 531 gene locus_tag LOCUS_7440 1469 531 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496725.1 protein_id gnl|my_center|LOCUS_7440 3111 1450 gene locus_tag LOCUS_7450 3111 1450 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867667.1 protein_id gnl|my_center|LOCUS_7450 >Feature sequence107 >Feature sequence108 736 822 gene locus_tag LOCUS_t0300 736 822 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1600 824 gene locus_tag LOCUS_7460 1600 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7460 1811 2815 gene locus_tag LOCUS_7470 1811 2815 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870829.1 protein_id gnl|my_center|LOCUS_7470 >Feature sequence109 1223 354 gene locus_tag LOCUS_7480 1223 354 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867575.1 protein_id gnl|my_center|LOCUS_7480 2046 1213 gene locus_tag LOCUS_7490 2046 1213 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249220.1 protein_id gnl|my_center|LOCUS_7490 2662 2021 gene locus_tag LOCUS_7500 2662 2021 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867573.1 protein_id gnl|my_center|LOCUS_7500 <3293 2659 gene locus_tag LOCUS_7510 <3293 2659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870761.1:3-dehydroquinate synthase II >Feature sequence110 1522 632 gene locus_tag LOCUS_7520 gene mvk 1522 632 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875686.1 protein_id gnl|my_center|LOCUS_7520 2356 1523 gene locus_tag LOCUS_7530 gene amrB 2356 1523 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875685.1 protein_id gnl|my_center|LOCUS_7530 2801 2382 gene locus_tag LOCUS_7540 2801 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7540 >Feature sequence111 874 1740 gene locus_tag LOCUS_7550 874 1740 CDS product serine/threonine-protein kinase RIO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774546.1 protein_id gnl|my_center|LOCUS_7550 2940 1732 gene locus_tag LOCUS_7560 2940 1732 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762445.1 protein_id gnl|my_center|LOCUS_7560 3195 2950 gene locus_tag LOCUS_7570 3195 2950 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878376.1 protein_id gnl|my_center|LOCUS_7570 >Feature sequence112 643 1347 gene locus_tag LOCUS_7580 643 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7580 2858 1338 gene locus_tag LOCUS_7590 gene tgtA 2858 1338 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978287.1 protein_id gnl|my_center|LOCUS_7590 >Feature sequence113 <1 549 gene locus_tag LOCUS_7600 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846340.1:minichromosome maintenance protein MCM 546 2684 gene locus_tag LOCUS_7610 546 2684 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868004.1 protein_id gnl|my_center|LOCUS_7610 <3203 2653 gene locus_tag LOCUS_7620 <3203 2653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763194.1:radical SAM protein >Feature sequence114 392 1033 gene locus_tag LOCUS_7630 gene rpsB 392 1033 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867661.1 protein_id gnl|my_center|LOCUS_7630 1817 1035 gene locus_tag LOCUS_7640 1817 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7640 2220 1795 gene locus_tag LOCUS_7650 2220 1795 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879807.1 protein_id gnl|my_center|LOCUS_7650 <3193 2204 gene locus_tag LOCUS_7660 <3193 2204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876489.1:TldD/PmbA family protein >Feature sequence115 209 1450 gene locus_tag LOCUS_7670 209 1450 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583659.1 protein_id gnl|my_center|LOCUS_7670 1480 2268 gene locus_tag LOCUS_7680 gene proC 1480 2268 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_7680 2578 2249 gene locus_tag LOCUS_7690 2578 2249 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986701.1 protein_id gnl|my_center|LOCUS_7690 <3143 2575 gene locus_tag LOCUS_7700 <3143 2575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867986.1:ATP-binding protein >Feature sequence116 1136 306 gene locus_tag LOCUS_7710 1136 306 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082270.1 protein_id gnl|my_center|LOCUS_7710 1484 1167 gene locus_tag LOCUS_7720 1484 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7720 1790 2272 gene locus_tag LOCUS_7730 1790 2272 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979561.1 protein_id gnl|my_center|LOCUS_7730 2308 2679 gene locus_tag LOCUS_7740 2308 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7740 >Feature sequence117 2370 1024 gene locus_tag LOCUS_7750 gene gcvPA 2370 1024 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250331.1 protein_id gnl|my_center|LOCUS_7750 >Feature sequence118 1165 617 gene locus_tag LOCUS_7760 1165 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7760 1400 1137 gene locus_tag LOCUS_7770 1400 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7770 2744 1455 gene locus_tag LOCUS_7780 2744 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7780 >Feature sequence119 <1 860 gene locus_tag LOCUS_7790 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979564.1:AmmeMemoRadiSam system radical SAM enzyme 893 1975 gene locus_tag LOCUS_7800 893 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7800 2009 2203 gene locus_tag LOCUS_7810 2009 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7810 <2986 2200 gene locus_tag LOCUS_7820 <2986 2200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878039.1:MBL fold metallo-hydrolase >Feature sequence120 607 59 gene locus_tag LOCUS_7830 607 59 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583840.1 protein_id gnl|my_center|LOCUS_7830 1144 638 gene locus_tag LOCUS_7840 1144 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7840 2143 1223 gene locus_tag LOCUS_7850 gene porB 2143 1223 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496444.1 protein_id gnl|my_center|LOCUS_7850 <2977 2140 gene locus_tag LOCUS_7860 <2977 2140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582673.1:transketolase C-terminal domain-containing protein >Feature sequence121 215 1000 gene locus_tag LOCUS_7870 215 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7870 2752 1853 gene locus_tag LOCUS_7880 2752 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7880 2927 2742 gene locus_tag LOCUS_7890 2927 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7890 >Feature sequence122 <1 938 gene locus_tag LOCUS_7900 <1 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000087103.1:aminopeptidase P family protein 1976 939 gene locus_tag LOCUS_7910 1976 939 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978607.1 protein_id gnl|my_center|LOCUS_7910 2351 1983 gene locus_tag LOCUS_7920 2351 1983 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869146.1 protein_id gnl|my_center|LOCUS_7920 <2949 2414 gene locus_tag LOCUS_7930 <2949 2414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846973.1:heme o synthase >Feature sequence123 <1 660 gene locus_tag LOCUS_7940 <1 660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393278.1:fumarylacetoacetate hydrolase family protein 1322 675 gene locus_tag LOCUS_7950 1322 675 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545081.1 protein_id gnl|my_center|LOCUS_7950 1385 1801 gene locus_tag LOCUS_7960 1385 1801 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879219.1 protein_id gnl|my_center|LOCUS_7960 1843 2247 gene locus_tag LOCUS_7970 1843 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7970 2251 2874 gene locus_tag LOCUS_7980 2251 2874 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496597.1 protein_id gnl|my_center|LOCUS_7980 >Feature sequence124 891 220 gene locus_tag LOCUS_7990 891 220 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025306754.1 protein_id gnl|my_center|LOCUS_7990 969 2537 gene locus_tag LOCUS_8000 gene ppcA 969 2537 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980180.1 protein_id gnl|my_center|LOCUS_8000 >Feature sequence125 186 479 gene locus_tag LOCUS_8010 186 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8010 476 1435 gene locus_tag LOCUS_8020 476 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8020 >Feature sequence126 1311 1009 gene locus_tag LOCUS_8030 gene nuoK 1311 1009 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210271.1 protein_id gnl|my_center|LOCUS_8030 1808 1308 gene locus_tag LOCUS_8040 1808 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8040 2286 1795 gene locus_tag LOCUS_8050 gene nuoI 2286 1795 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847026.1 protein_id gnl|my_center|LOCUS_8050 <2921 2283 gene locus_tag LOCUS_8060 <2921 2283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015591312.1:NADH-quinone oxidoreductase subunit NuoH >Feature sequence127 1855 623 gene locus_tag LOCUS_8070 gene prf1 1855 623 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870340.1 protein_id gnl|my_center|LOCUS_8070 2462 1881 gene locus_tag LOCUS_8080 2462 1881 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061023.1 protein_id gnl|my_center|LOCUS_8080 >Feature sequence128 <2916 1848 gene locus_tag LOCUS_8090 <2916 1848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762057.1:SMC family ATPase >Feature sequence129 235 1269 gene locus_tag LOCUS_8100 235 1269 CDS product DUF1464 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250249.1 protein_id gnl|my_center|LOCUS_8100 1352 2113 gene locus_tag LOCUS_8110 1352 2113 CDS product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098631.1 protein_id gnl|my_center|LOCUS_8110 <2904 2128 gene locus_tag LOCUS_8120 <2904 2128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546088.1:cation:proton antiporter >Feature sequence130 102 332 gene locus_tag LOCUS_8130 102 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8130 550 317 gene locus_tag LOCUS_8140 550 317 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762745.1 protein_id gnl|my_center|LOCUS_8140 623 1834 gene locus_tag LOCUS_8150 623 1834 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763075.1 protein_id gnl|my_center|LOCUS_8150 1843 2673 gene locus_tag LOCUS_8160 1843 2673 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240504.1 protein_id gnl|my_center|LOCUS_8160 >Feature sequence131 <1 689 gene locus_tag LOCUS_8170 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404751.1:tagatose 1,6-diphosphate aldolase 745 1383 gene locus_tag LOCUS_8180 745 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8180 1352 2077 gene locus_tag LOCUS_8190 1352 2077 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146498.1 protein_id gnl|my_center|LOCUS_8190 >Feature sequence132 <1 696 gene locus_tag LOCUS_8200 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879872.1:4Fe-4S dicluster domain-containing protein 693 1391 gene locus_tag LOCUS_8210 693 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8210 1527 2783 gene locus_tag LOCUS_8220 1527 2783 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763120.1 protein_id gnl|my_center|LOCUS_8220 >Feature sequence133 356 195 gene locus_tag LOCUS_8230 356 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8230 434 652 gene locus_tag LOCUS_8240 434 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8240 669 742 gene locus_tag LOCUS_t0310 669 742 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 783 1358 gene locus_tag LOCUS_8250 gene udg 783 1358 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053779.1 protein_id gnl|my_center|LOCUS_8250 2095 1355 gene locus_tag LOCUS_8260 2095 1355 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868772.1 protein_id gnl|my_center|LOCUS_8260 2592 2134 gene locus_tag LOCUS_8270 2592 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8270 >Feature sequence134 <1 1101 gene locus_tag LOCUS_8280 <1 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980252.1:dihydroxy-acid dehydratase 2090 1098 gene locus_tag LOCUS_8290 gene ilvC 2090 1098 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496863.1 protein_id gnl|my_center|LOCUS_8290 <2791 2113 gene locus_tag LOCUS_8300 <2791 2113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004079967.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB >Feature sequence135 <1 1391 gene locus_tag LOCUS_8310 <1 1391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846316.1:elongation factor EF-2 1886 1374 gene locus_tag LOCUS_8320 1886 1374 CDS product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147114.1 protein_id gnl|my_center|LOCUS_8320 <2790 1912 gene locus_tag LOCUS_8330 <2790 1912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867862.1:flap endonuclease-1 >Feature sequence136 1531 422 gene locus_tag LOCUS_8340 1531 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8340 1656 2654 gene locus_tag LOCUS_8350 gene galT 1656 2654 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393433.1 protein_id gnl|my_center|LOCUS_8350 >Feature sequence137 647 519 gene locus_tag LOCUS_8360 647 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8360 2247 769 gene locus_tag LOCUS_8370 2247 769 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249122.1 protein_id gnl|my_center|LOCUS_8370 >Feature sequence138 1143 448 gene locus_tag LOCUS_8380 1143 448 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_8380 2406 1180 gene locus_tag LOCUS_8390 2406 1180 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496851.1 protein_id gnl|my_center|LOCUS_8390 >Feature sequence139 <1 1149 gene locus_tag LOCUS_8400 <1 1149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249215.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme 1121 1960 gene locus_tag LOCUS_8410 1121 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8410 2236 1949 gene locus_tag LOCUS_8420 2236 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8420 >Feature sequence140 245 739 gene locus_tag LOCUS_8430 245 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023018.1 protein_id gnl|my_center|LOCUS_8430 749 1279 gene locus_tag LOCUS_8440 749 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8440 1291 1980 gene locus_tag LOCUS_8450 1291 1980 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065603.1 protein_id gnl|my_center|LOCUS_8450 >Feature sequence141 490 149 gene locus_tag LOCUS_8460 490 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8460 543 2348 gene locus_tag LOCUS_8470 543 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8470 >Feature sequence142 822 1427 gene locus_tag LOCUS_8480 822 1427 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867133.1 protein_id gnl|my_center|LOCUS_8480 1424 2572 gene locus_tag LOCUS_8490 1424 2572 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020503.1 protein_id gnl|my_center|LOCUS_8490 >Feature sequence143 759 1112 gene locus_tag LOCUS_8500 gene pth2 759 1112 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146590.1 protein_id gnl|my_center|LOCUS_8500 1109 2320 gene locus_tag LOCUS_8510 gene truD 1109 2320 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762266.1 protein_id gnl|my_center|LOCUS_8510 >Feature sequence144 338 1333 gene locus_tag LOCUS_8520 338 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_8520 1318 1941 gene locus_tag LOCUS_8530 1318 1941 CDS product Kae1-associated kinase Bud32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249630.1 protein_id gnl|my_center|LOCUS_8530 1938 2489 gene locus_tag LOCUS_8540 1938 2489 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877036.1 protein_id gnl|my_center|LOCUS_8540 >Feature sequence145 <2616 1428 gene locus_tag LOCUS_8550 <2616 1428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980304.1:proton-conducting transporter membrane subunit >Feature sequence146 474 1034 gene locus_tag LOCUS_8560 474 1034 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867555.1 protein_id gnl|my_center|LOCUS_8560 2006 999 gene locus_tag LOCUS_8570 2006 999 CDS product TGS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978498.1 protein_id gnl|my_center|LOCUS_8570 <2596 2041 gene locus_tag LOCUS_8580 <2596 2041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877084.1:bifunctional 5,6,7,8-tetrahydromethanopterin hydro-lyase/3-hexulose-6-phosphate synthase >Feature sequence147 >Feature sequence148 <2544 1293 gene locus_tag LOCUS_8590 <2544 1293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066007.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA >Feature sequence149 2 805 gene locus_tag LOCUS_8600 2 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8600 802 1644 gene locus_tag LOCUS_8610 gene lysX 802 1644 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229004.1 protein_id gnl|my_center|LOCUS_8610 >Feature sequence150 <2513 1587 gene locus_tag LOCUS_8620 <2513 1587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867819.1:Glu-tRNA(Gln) amidotransferase subunit GatD >Feature sequence151 <1 2461 gene locus_tag LOCUS_8630 <1 2461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392653.1:UPF0182 family protein >Feature sequence152 1250 963 gene locus_tag LOCUS_8640 1250 963 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762971.1 protein_id gnl|my_center|LOCUS_8640 1818 1252 gene locus_tag LOCUS_8650 1818 1252 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250928.1 protein_id gnl|my_center|LOCUS_8650 <2500 1892 gene locus_tag LOCUS_8660 <2500 1892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460435.1:NADH-quinone oxidoreductase subunit N