>Feature sequence001 412 987 gene locus_tag LOCUS_00010 412 987 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061023.1 protein_id gnl|my_center|LOCUS_00010 974 1153 gene locus_tag LOCUS_00020 974 1153 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867287.1 protein_id gnl|my_center|LOCUS_00020 1153 2334 gene locus_tag LOCUS_00030 1153 2334 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064241.1 protein_id gnl|my_center|LOCUS_00030 2340 3149 gene locus_tag LOCUS_00040 2340 3149 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023273.1 protein_id gnl|my_center|LOCUS_00040 3146 3517 gene locus_tag LOCUS_00050 3146 3517 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879687.1 protein_id gnl|my_center|LOCUS_00050 3635 4621 gene locus_tag LOCUS_00060 3635 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4698 5570 gene locus_tag LOCUS_00070 4698 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 5603 6151 gene locus_tag LOCUS_00080 5603 6151 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023416.1 protein_id gnl|my_center|LOCUS_00080 6220 7551 gene locus_tag LOCUS_00090 6220 7551 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261901.1 protein_id gnl|my_center|LOCUS_00090 7561 8973 gene locus_tag LOCUS_00100 7561 8973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10892 8976 gene locus_tag LOCUS_00110 10892 8976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12655 10916 gene locus_tag LOCUS_00120 12655 10916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 12795 13655 gene locus_tag LOCUS_00130 12795 13655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 15765 13657 gene locus_tag LOCUS_00140 15765 13657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16907 15762 gene locus_tag LOCUS_00150 16907 15762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 18243 16891 gene locus_tag LOCUS_00160 18243 16891 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867775.1 protein_id gnl|my_center|LOCUS_00160 19037 18285 gene locus_tag LOCUS_00170 19037 18285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 19638 19408 gene locus_tag LOCUS_00180 19638 19408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19769 19842 gene locus_tag LOCUS_t00010 19769 19842 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 21128 19845 gene locus_tag LOCUS_00190 21128 19845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 23273 21204 gene locus_tag LOCUS_00200 23273 21204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 23330 23785 gene locus_tag LOCUS_00210 23330 23785 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023461.1 protein_id gnl|my_center|LOCUS_00210 23852 24151 gene locus_tag LOCUS_00220 23852 24151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25071 24154 gene locus_tag LOCUS_00230 25071 24154 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877642.1 protein_id gnl|my_center|LOCUS_00230 >Feature sequence002 1238 474 gene locus_tag LOCUS_00240 1238 474 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878032.1 protein_id gnl|my_center|LOCUS_00240 1412 1239 gene locus_tag LOCUS_00250 1412 1239 CDS product RNA-protein complex protein Nop10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250052.1 protein_id gnl|my_center|LOCUS_00250 2203 1409 gene locus_tag LOCUS_00260 2203 1409 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496399.1 protein_id gnl|my_center|LOCUS_00260 2382 2206 gene locus_tag LOCUS_00270 2382 2206 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147173.1 protein_id gnl|my_center|LOCUS_00270 2666 2385 gene locus_tag LOCUS_00280 2666 2385 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868833.1 protein_id gnl|my_center|LOCUS_00280 3333 2770 gene locus_tag LOCUS_00290 3333 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 4538 3357 gene locus_tag LOCUS_00300 gene priS 4538 3357 CDS product DNA primase small subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289337.1 protein_id gnl|my_center|LOCUS_00300 4602 5012 gene locus_tag LOCUS_00310 gene pfdA 4602 5012 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880460.1 protein_id gnl|my_center|LOCUS_00310 5016 6059 gene locus_tag LOCUS_00320 gene ftsY 5016 6059 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877216.1 protein_id gnl|my_center|LOCUS_00320 6451 6056 gene locus_tag LOCUS_00330 6451 6056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 7670 6432 gene locus_tag LOCUS_00340 gene eif2g 7670 6432 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875900.1 protein_id gnl|my_center|LOCUS_00340 8073 7663 gene locus_tag LOCUS_00350 8073 7663 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878018.1 protein_id gnl|my_center|LOCUS_00350 8233 11097 gene locus_tag LOCUS_00360 8233 11097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 13245 11344 gene locus_tag LOCUS_00370 13245 11344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 13464 13616 gene locus_tag LOCUS_00380 13464 13616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 13659 14288 gene locus_tag LOCUS_00390 13659 14288 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020240.1 protein_id gnl|my_center|LOCUS_00390 14411 15349 gene locus_tag LOCUS_00400 14411 15349 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146738.1 protein_id gnl|my_center|LOCUS_00400 15358 16017 gene locus_tag LOCUS_00410 15358 16017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 16484 16077 gene locus_tag LOCUS_00420 16484 16077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 17175 16438 gene locus_tag LOCUS_00430 17175 16438 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020169.1 protein_id gnl|my_center|LOCUS_00430 18544 17243 gene locus_tag LOCUS_00440 18544 17243 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065269.1 protein_id gnl|my_center|LOCUS_00440 19439 18510 gene locus_tag LOCUS_00450 19439 18510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 19736 19858 gene locus_tag LOCUS_00460 19736 19858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 <20877 19855 gene locus_tag LOCUS_00470 <20877 19855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066092.1:radical SAM protein >Feature sequence003 <1 1584 gene locus_tag LOCUS_00480 <1 1584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878921.1:phenylalanine--tRNA ligase subunit beta 1585 2736 gene locus_tag LOCUS_00490 1585 2736 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250179.1 protein_id gnl|my_center|LOCUS_00490 2747 3679 gene locus_tag LOCUS_00500 2747 3679 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879092.1 protein_id gnl|my_center|LOCUS_00500 4281 4928 gene locus_tag LOCUS_00510 gene radB 4281 4928 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860416.1 protein_id gnl|my_center|LOCUS_00510 5041 9423 gene locus_tag LOCUS_00520 5041 9423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 9622 14460 gene locus_tag LOCUS_00530 9622 14460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 14995 15390 gene locus_tag LOCUS_00540 14995 15390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 16350 15421 gene locus_tag LOCUS_00550 16350 15421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 18013 16397 gene locus_tag LOCUS_00560 18013 16397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 18162 20573 gene locus_tag LOCUS_00570 18162 20573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 >Feature sequence004 <1 624 gene locus_tag LOCUS_00580 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064947.1:RNA methyltransferase 841 617 gene locus_tag LOCUS_00590 841 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 1996 881 gene locus_tag LOCUS_00600 1996 881 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868734.1 protein_id gnl|my_center|LOCUS_00600 3615 1993 gene locus_tag LOCUS_00610 gene pyrG 3615 1993 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250144.1 protein_id gnl|my_center|LOCUS_00610 4969 3671 gene locus_tag LOCUS_00620 4969 3671 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_00620 5060 5407 gene locus_tag LOCUS_00630 5060 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289276.1 protein_id gnl|my_center|LOCUS_00630 5408 5484 gene locus_tag LOCUS_t00020 5408 5484 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6504 5671 gene locus_tag LOCUS_00640 6504 5671 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761778.1 protein_id gnl|my_center|LOCUS_00640 7506 6712 gene locus_tag LOCUS_00650 7506 6712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 7692 11276 gene locus_tag LOCUS_00660 gene smc 7692 11276 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024214.1 protein_id gnl|my_center|LOCUS_00660 11273 12130 gene locus_tag LOCUS_00670 11273 12130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 12142 12663 gene locus_tag LOCUS_00680 12142 12663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 13446 12751 gene locus_tag LOCUS_00690 13446 12751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 14692 13451 gene locus_tag LOCUS_00700 14692 13451 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053767.1 protein_id gnl|my_center|LOCUS_00700 15435 14746 gene locus_tag LOCUS_00710 15435 14746 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_00710 16254 15436 gene locus_tag LOCUS_00720 16254 15436 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930606.1 protein_id gnl|my_center|LOCUS_00720 17068 16685 gene locus_tag LOCUS_00730 gene eif5A 17068 16685 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878148.1 protein_id gnl|my_center|LOCUS_00730 17331 17071 gene locus_tag LOCUS_00740 17331 17071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 17615 17367 gene locus_tag LOCUS_00750 17615 17367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 17750 19888 gene locus_tag LOCUS_00760 17750 19888 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 protein_id gnl|my_center|LOCUS_00760 19893 20417 gene locus_tag LOCUS_00770 19893 20417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 20417 20490 gene locus_tag LOCUS_t00030 20417 20490 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence005 70 1056 gene locus_tag LOCUS_00780 70 1056 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870998.1 protein_id gnl|my_center|LOCUS_00780 1101 1628 gene locus_tag LOCUS_00790 1101 1628 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870105.1 protein_id gnl|my_center|LOCUS_00790 1615 2748 gene locus_tag LOCUS_00800 1615 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 2745 4280 gene locus_tag LOCUS_00810 gene citF 2745 4280 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870113.1 protein_id gnl|my_center|LOCUS_00810 4462 4277 gene locus_tag LOCUS_00820 4462 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 4696 4929 gene locus_tag LOCUS_00830 4696 4929 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146889.1 protein_id gnl|my_center|LOCUS_00830 4947 6074 gene locus_tag LOCUS_00840 gene sat 4947 6074 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868287.1 protein_id gnl|my_center|LOCUS_00840 6081 7040 gene locus_tag LOCUS_00850 6081 7040 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868286.1 protein_id gnl|my_center|LOCUS_00850 7040 7600 gene locus_tag LOCUS_00860 7040 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 7606 8115 gene locus_tag LOCUS_00870 gene cysC 7606 8115 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868289.1 protein_id gnl|my_center|LOCUS_00870 8262 9008 gene locus_tag LOCUS_00880 8262 9008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 9309 10322 gene locus_tag LOCUS_00890 9309 10322 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546129.1 protein_id gnl|my_center|LOCUS_00890 12043 10319 gene locus_tag LOCUS_00900 12043 10319 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867223.1 protein_id gnl|my_center|LOCUS_00900 12416 12171 gene locus_tag LOCUS_00910 gene moaD 12416 12171 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251068.1 protein_id gnl|my_center|LOCUS_00910 13123 12413 gene locus_tag LOCUS_00920 13123 12413 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867188.1 protein_id gnl|my_center|LOCUS_00920 13619 13314 gene locus_tag LOCUS_00930 13619 13314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878070.1 protein_id gnl|my_center|LOCUS_00930 13693 13896 gene locus_tag LOCUS_00940 13693 13896 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519083.1 protein_id gnl|my_center|LOCUS_00940 13957 15180 gene locus_tag LOCUS_00950 13957 15180 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644929.1 protein_id gnl|my_center|LOCUS_00950 16512 15193 gene locus_tag LOCUS_00960 16512 15193 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496722.1 protein_id gnl|my_center|LOCUS_00960 16618 18831 gene locus_tag LOCUS_00970 16618 18831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 18846 19082 gene locus_tag LOCUS_00980 18846 19082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 19149 19394 gene locus_tag LOCUS_00990 19149 19394 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878901.1 protein_id gnl|my_center|LOCUS_00990 >Feature sequence006 994 191 gene locus_tag LOCUS_01000 994 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 1141 1335 gene locus_tag LOCUS_01010 1141 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 1369 2052 gene locus_tag LOCUS_01020 1369 2052 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_01020 2515 2039 gene locus_tag LOCUS_01030 2515 2039 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869872.1 protein_id gnl|my_center|LOCUS_01030 2998 2519 gene locus_tag LOCUS_01040 2998 2519 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878044.1 protein_id gnl|my_center|LOCUS_01040 3260 3009 gene locus_tag LOCUS_01050 3260 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 3451 4728 gene locus_tag LOCUS_01060 3451 4728 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966033.1 protein_id gnl|my_center|LOCUS_01060 4928 5389 gene locus_tag LOCUS_01070 4928 5389 CDS product HsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453603.1 protein_id gnl|my_center|LOCUS_01070 5432 5890 gene locus_tag LOCUS_01080 5432 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 7337 5904 gene locus_tag LOCUS_01090 gene purF 7337 5904 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869699.1 protein_id gnl|my_center|LOCUS_01090 7473 8714 gene locus_tag LOCUS_01100 7473 8714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 8801 10957 gene locus_tag LOCUS_01110 8801 10957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 12103 10919 gene locus_tag LOCUS_01120 12103 10919 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871044.1 protein_id gnl|my_center|LOCUS_01120 12118 12399 gene locus_tag LOCUS_01130 12118 12399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 12401 12742 gene locus_tag LOCUS_01140 gene pth2 12401 12742 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251250.1 protein_id gnl|my_center|LOCUS_01140 12854 13330 gene locus_tag LOCUS_01150 12854 13330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 13327 13950 gene locus_tag LOCUS_01160 13327 13950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 14459 13947 gene locus_tag LOCUS_01170 14459 13947 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020400.1 protein_id gnl|my_center|LOCUS_01170 14530 16227 gene locus_tag LOCUS_01180 14530 16227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 16553 16242 gene locus_tag LOCUS_01190 16553 16242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 17104 16727 gene locus_tag LOCUS_01200 17104 16727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 17158 18141 gene locus_tag LOCUS_01210 gene bgsA 17158 18141 CDS product cell wall glycolipid biosynthesis glucosyltransferase BgsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359375.1 protein_id gnl|my_center|LOCUS_01210 >Feature sequence007 3035 2592 gene locus_tag LOCUS_01220 3035 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 3417 3343 gene locus_tag LOCUS_t00040 3417 3343 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3490 4182 gene locus_tag LOCUS_01230 3490 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 4216 4671 gene locus_tag LOCUS_01240 gene ndk 4216 4671 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_01240 4860 4720 gene locus_tag LOCUS_01250 4860 4720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 5497 4850 gene locus_tag LOCUS_01260 5497 4850 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250555.1 protein_id gnl|my_center|LOCUS_01260 6885 5494 gene locus_tag LOCUS_01270 6885 5494 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296141.1 protein_id gnl|my_center|LOCUS_01270 8647 6890 gene locus_tag LOCUS_01280 8647 6890 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250553.1 protein_id gnl|my_center|LOCUS_01280 8968 8648 gene locus_tag LOCUS_01290 8968 8648 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250552.1 protein_id gnl|my_center|LOCUS_01290 10034 8970 gene locus_tag LOCUS_01300 10034 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 10605 10039 gene locus_tag LOCUS_01310 10605 10039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 11197 10613 gene locus_tag LOCUS_01320 11197 10613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 13168 11204 gene locus_tag LOCUS_01330 13168 11204 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869718.1 protein_id gnl|my_center|LOCUS_01330 13488 13165 gene locus_tag LOCUS_01340 13488 13165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 13543 14766 gene locus_tag LOCUS_01350 13543 14766 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871137.1 protein_id gnl|my_center|LOCUS_01350 16592 14781 gene locus_tag LOCUS_01360 16592 14781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 16774 17565 gene locus_tag LOCUS_01370 16774 17565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 >Feature sequence008 4396 3233 gene locus_tag LOCUS_01380 4396 3233 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249758.1 protein_id gnl|my_center|LOCUS_01380 4515 4441 gene locus_tag LOCUS_t00050 4515 4441 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5527 4505 gene locus_tag LOCUS_01390 gene trm5b 5527 4505 CDS product tRNA (guanine(37)-N1)-methyltransferase Trm5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867861.1 protein_id gnl|my_center|LOCUS_01390 5956 6555 gene locus_tag LOCUS_01400 5956 6555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 6734 7324 gene locus_tag LOCUS_01410 6734 7324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 8562 7309 gene locus_tag LOCUS_01420 gene eno 8562 7309 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147178.1 protein_id gnl|my_center|LOCUS_01420 9373 8597 gene locus_tag LOCUS_01430 9373 8597 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876504.1 protein_id gnl|my_center|LOCUS_01430 10230 9358 gene locus_tag LOCUS_01440 10230 9358 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330368.1 protein_id gnl|my_center|LOCUS_01440 11513 10227 gene locus_tag LOCUS_01450 11513 10227 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020936.1 protein_id gnl|my_center|LOCUS_01450 12102 11494 gene locus_tag LOCUS_01460 12102 11494 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496635.1 protein_id gnl|my_center|LOCUS_01460 16015 12137 gene locus_tag LOCUS_01470 16015 12137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 16927 16049 gene locus_tag LOCUS_01480 16927 16049 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320027.1 protein_id gnl|my_center|LOCUS_01480 <17529 17010 gene locus_tag LOCUS_01490 <17529 17010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081633.1:ABC transporter permease >Feature sequence009 218 2155 gene locus_tag LOCUS_01500 gene rqcH 218 2155 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250389.1 protein_id gnl|my_center|LOCUS_01500 2152 3198 gene locus_tag LOCUS_01510 2152 3198 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867805.1 protein_id gnl|my_center|LOCUS_01510 3938 3192 gene locus_tag LOCUS_01520 3938 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 4899 4039 gene locus_tag LOCUS_01530 4899 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 5043 5987 gene locus_tag LOCUS_01540 5043 5987 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023440.1 protein_id gnl|my_center|LOCUS_01540 6876 5995 gene locus_tag LOCUS_01550 6876 5995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 7070 8014 gene locus_tag LOCUS_01560 gene htpX 7070 8014 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022098.1 protein_id gnl|my_center|LOCUS_01560 8020 8673 gene locus_tag LOCUS_01570 8020 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 8727 9458 gene locus_tag LOCUS_01580 8727 9458 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024199.1 protein_id gnl|my_center|LOCUS_01580 9660 9442 gene locus_tag LOCUS_01590 9660 9442 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877297.1 protein_id gnl|my_center|LOCUS_01590 10262 9657 gene locus_tag LOCUS_01600 10262 9657 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878134.1 protein_id gnl|my_center|LOCUS_01600 10330 12513 gene locus_tag LOCUS_01610 10330 12513 CDS product hydrophobe/amphiphile efflux-3 (HAE3) family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868797.1 protein_id gnl|my_center|LOCUS_01610 12669 12478 gene locus_tag LOCUS_01620 12669 12478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 13268 12666 gene locus_tag LOCUS_01630 13268 12666 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064573.1 protein_id gnl|my_center|LOCUS_01630 13932 13273 gene locus_tag LOCUS_01640 gene rpiA 13932 13273 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060856.1 protein_id gnl|my_center|LOCUS_01640 14106 14672 gene locus_tag LOCUS_01650 14106 14672 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877913.1 protein_id gnl|my_center|LOCUS_01650 14766 16061 gene locus_tag LOCUS_01660 14766 16061 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053195.1 protein_id gnl|my_center|LOCUS_01660 >Feature sequence010 <1 1409 gene locus_tag LOCUS_01670 <1 1409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583781.1:isoleucine--tRNA ligase 2024 1410 gene locus_tag LOCUS_01680 2024 1410 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545723.1 protein_id gnl|my_center|LOCUS_01680 2591 2073 gene locus_tag LOCUS_01690 2591 2073 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877737.1 protein_id gnl|my_center|LOCUS_01690 3333 2632 gene locus_tag LOCUS_01700 3333 2632 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878046.1 protein_id gnl|my_center|LOCUS_01700 3471 4994 gene locus_tag LOCUS_01710 3471 4994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 5099 5026 gene locus_tag LOCUS_t00060 5099 5026 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5209 6093 gene locus_tag LOCUS_01720 gene mptA 5209 6093 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876820.1 protein_id gnl|my_center|LOCUS_01720 6146 6388 gene locus_tag LOCUS_01730 6146 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 7130 8254 gene locus_tag LOCUS_01740 7130 8254 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870110.1 protein_id gnl|my_center|LOCUS_01740 8257 9399 gene locus_tag LOCUS_01750 8257 9399 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021461.1 protein_id gnl|my_center|LOCUS_01750 9452 9688 gene locus_tag LOCUS_01760 9452 9688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 9688 10017 gene locus_tag LOCUS_01770 9688 10017 CDS product DNA-directed RNA polymerase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061025.1 protein_id gnl|my_center|LOCUS_01770 10037 10603 gene locus_tag LOCUS_01780 10037 10603 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876938.1 protein_id gnl|my_center|LOCUS_01780 10600 11352 gene locus_tag LOCUS_01790 gene rsmA 10600 11352 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870542.1 protein_id gnl|my_center|LOCUS_01790 11425 11862 gene locus_tag LOCUS_01800 11425 11862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 11958 11881 gene locus_tag LOCUS_t00070 11958 11881 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 12462 12001 gene locus_tag LOCUS_01810 12462 12001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 13751 12450 gene locus_tag LOCUS_01820 13751 12450 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544964.1 protein_id gnl|my_center|LOCUS_01820 14491 13736 gene locus_tag LOCUS_01830 14491 13736 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546316.1 protein_id gnl|my_center|LOCUS_01830 16404 14488 gene locus_tag LOCUS_01840 16404 14488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 <16961 16434 gene locus_tag LOCUS_01850 <16961 16434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868811.1:XTP/dITP diphosphatase >Feature sequence011 1188 388 gene locus_tag LOCUS_01860 gene truA 1188 388 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249878.1 protein_id gnl|my_center|LOCUS_01860 1680 1285 gene locus_tag LOCUS_01870 1680 1285 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870963.1 protein_id gnl|my_center|LOCUS_01870 1868 3142 gene locus_tag LOCUS_01880 gene gatD 1868 3142 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867819.1 protein_id gnl|my_center|LOCUS_01880 4210 3161 gene locus_tag LOCUS_01890 4210 3161 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877370.1 protein_id gnl|my_center|LOCUS_01890 4796 4182 gene locus_tag LOCUS_01900 4796 4182 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879522.1 protein_id gnl|my_center|LOCUS_01900 6709 4793 gene locus_tag LOCUS_01910 gene iorA 6709 4793 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877454.1 protein_id gnl|my_center|LOCUS_01910 6741 8057 gene locus_tag LOCUS_01920 6741 8057 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868207.1 protein_id gnl|my_center|LOCUS_01920 11186 8280 gene locus_tag LOCUS_01930 11186 8280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 12073 11348 gene locus_tag LOCUS_01940 12073 11348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 14818 12149 gene locus_tag LOCUS_01950 14818 12149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 >Feature sequence012 694 4926 gene locus_tag LOCUS_01960 694 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 4923 6533 gene locus_tag LOCUS_01970 4923 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 7572 6517 gene locus_tag LOCUS_01980 7572 6517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 8369 7671 gene locus_tag LOCUS_01990 8369 7671 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022379.1 protein_id gnl|my_center|LOCUS_01990 8762 9217 gene locus_tag LOCUS_02000 8762 9217 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250202.1 protein_id gnl|my_center|LOCUS_02000 9220 10581 gene locus_tag LOCUS_02010 9220 10581 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330372.1 protein_id gnl|my_center|LOCUS_02010 10553 10777 gene locus_tag LOCUS_02020 10553 10777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 10798 12303 gene locus_tag LOCUS_02030 gene serS 10798 12303 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870589.1 protein_id gnl|my_center|LOCUS_02030 13424 12300 gene locus_tag LOCUS_02040 13424 12300 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760696.1 protein_id gnl|my_center|LOCUS_02040 13486 14253 gene locus_tag LOCUS_02050 13486 14253 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020954.1 protein_id gnl|my_center|LOCUS_02050 14250 15566 gene locus_tag LOCUS_02060 14250 15566 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020953.1 protein_id gnl|my_center|LOCUS_02060 >Feature sequence013 227 301 gene locus_tag LOCUS_t00080 227 301 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 328 624 gene locus_tag LOCUS_02070 328 624 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876674.1 protein_id gnl|my_center|LOCUS_02070 630 4004 gene locus_tag LOCUS_02080 630 4004 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867738.1 protein_id gnl|my_center|LOCUS_02080 4011 6680 gene locus_tag LOCUS_02090 4011 6680 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879381.1 protein_id gnl|my_center|LOCUS_02090 6683 7855 gene locus_tag LOCUS_02100 gene rpoA2 6683 7855 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879382.1 protein_id gnl|my_center|LOCUS_02100 7860 8162 gene locus_tag LOCUS_02110 7860 8162 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870557.1 protein_id gnl|my_center|LOCUS_02110 8166 8591 gene locus_tag LOCUS_02120 8166 8591 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879384.1 protein_id gnl|my_center|LOCUS_02120 8652 10097 gene locus_tag LOCUS_02130 8652 10097 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249074.1 protein_id gnl|my_center|LOCUS_02130 10088 10561 gene locus_tag LOCUS_02140 10088 10561 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249075.1 protein_id gnl|my_center|LOCUS_02140 10546 10818 gene locus_tag LOCUS_02150 10546 10818 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867436.1 protein_id gnl|my_center|LOCUS_02150 10808 11950 gene locus_tag LOCUS_02160 10808 11950 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925160.1 protein_id gnl|my_center|LOCUS_02160 11988 13853 gene locus_tag LOCUS_02170 gene gatE 11988 13853 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869511.1 protein_id gnl|my_center|LOCUS_02170 14218 13841 gene locus_tag LOCUS_02180 14218 13841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 14904 14206 gene locus_tag LOCUS_02190 14904 14206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 >Feature sequence014 435 692 gene locus_tag LOCUS_02200 435 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 699 941 gene locus_tag LOCUS_02210 699 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 997 1746 gene locus_tag LOCUS_02220 997 1746 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545002.1 protein_id gnl|my_center|LOCUS_02220 1918 2277 gene locus_tag LOCUS_02230 1918 2277 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876799.1 protein_id gnl|my_center|LOCUS_02230 2274 2639 gene locus_tag LOCUS_02240 2274 2639 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064575.1 protein_id gnl|my_center|LOCUS_02240 2649 3509 gene locus_tag LOCUS_02250 2649 3509 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496419.1 protein_id gnl|my_center|LOCUS_02250 3665 4651 gene locus_tag LOCUS_02260 3665 4651 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_02260 4752 5612 gene locus_tag LOCUS_02270 4752 5612 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858299.1 protein_id gnl|my_center|LOCUS_02270 5587 6042 gene locus_tag LOCUS_02280 5587 6042 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972200.1 protein_id gnl|my_center|LOCUS_02280 7379 6072 gene locus_tag LOCUS_02290 7379 6072 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_02290 8659 7448 gene locus_tag LOCUS_02300 8659 7448 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_02300 9686 8856 gene locus_tag LOCUS_02310 9686 8856 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024069.1 protein_id gnl|my_center|LOCUS_02310 10905 9727 gene locus_tag LOCUS_02320 10905 9727 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957833.1 protein_id gnl|my_center|LOCUS_02320 12088 10892 gene locus_tag LOCUS_02330 12088 10892 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257788.1 protein_id gnl|my_center|LOCUS_02330 12215 13048 gene locus_tag LOCUS_02340 12215 13048 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024124.1 protein_id gnl|my_center|LOCUS_02340 13045 13908 gene locus_tag LOCUS_02350 13045 13908 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024123.1 protein_id gnl|my_center|LOCUS_02350 13909 14259 gene locus_tag LOCUS_02360 13909 14259 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146466.1 protein_id gnl|my_center|LOCUS_02360 14256 14855 gene locus_tag LOCUS_02370 gene udg 14256 14855 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147255.1 protein_id gnl|my_center|LOCUS_02370 14833 15471 gene locus_tag LOCUS_02380 14833 15471 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024284.1 protein_id gnl|my_center|LOCUS_02380 >Feature sequence015 1607 576 gene locus_tag LOCUS_02390 1607 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 1889 1617 gene locus_tag LOCUS_02400 1889 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 2968 1955 gene locus_tag LOCUS_02410 2968 1955 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877631.1 protein_id gnl|my_center|LOCUS_02410 4433 5008 gene locus_tag LOCUS_02420 4433 5008 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878792.1 protein_id gnl|my_center|LOCUS_02420 5050 7230 gene locus_tag LOCUS_02430 5050 7230 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_02430 8284 7235 gene locus_tag LOCUS_02440 8284 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 10104 8281 gene locus_tag LOCUS_02450 10104 8281 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878560.1 protein_id gnl|my_center|LOCUS_02450 10912 10160 gene locus_tag LOCUS_02460 10912 10160 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020150.1 protein_id gnl|my_center|LOCUS_02460 11790 10846 gene locus_tag LOCUS_02470 11790 10846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 13080 12058 gene locus_tag LOCUS_02480 13080 12058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 13537 13262 gene locus_tag LOCUS_02490 13537 13262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 14618 13560 gene locus_tag LOCUS_02500 14618 13560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 >Feature sequence016 1508 417 gene locus_tag LOCUS_02510 1508 417 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496414.1 protein_id gnl|my_center|LOCUS_02510 1625 2344 gene locus_tag LOCUS_02520 1625 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 2721 2350 gene locus_tag LOCUS_02530 2721 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 3819 2773 gene locus_tag LOCUS_02540 3819 2773 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391982.1 protein_id gnl|my_center|LOCUS_02540 5030 3819 gene locus_tag LOCUS_02550 5030 3819 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868642.1 protein_id gnl|my_center|LOCUS_02550 5957 5037 gene locus_tag LOCUS_02560 5957 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 6021 7184 gene locus_tag LOCUS_02570 6021 7184 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870834.1 protein_id gnl|my_center|LOCUS_02570 7445 7194 gene locus_tag LOCUS_02580 7445 7194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 7584 9551 gene locus_tag LOCUS_02590 gene lonB 7584 9551 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877871.1 protein_id gnl|my_center|LOCUS_02590 9557 10063 gene locus_tag LOCUS_02600 9557 10063 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870045.1 protein_id gnl|my_center|LOCUS_02600 10095 10310 gene locus_tag LOCUS_02610 10095 10310 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878376.1 protein_id gnl|my_center|LOCUS_02610 10619 12193 gene locus_tag LOCUS_02620 gene hutU 10619 12193 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226823.1 protein_id gnl|my_center|LOCUS_02620 12190 13710 gene locus_tag LOCUS_02630 gene hutH 12190 13710 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 protein_id gnl|my_center|LOCUS_02630 13772 14188 gene locus_tag LOCUS_02640 13772 14188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 >Feature sequence017 15 2159 gene locus_tag LOCUS_02650 gene nrdD 15 2159 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869385.1 protein_id gnl|my_center|LOCUS_02650 2218 2916 gene locus_tag LOCUS_02660 2218 2916 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_02660 2988 3710 gene locus_tag LOCUS_02670 gene psmA 2988 3710 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_02670 3711 4406 gene locus_tag LOCUS_02680 3711 4406 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877998.1 protein_id gnl|my_center|LOCUS_02680 4406 5086 gene locus_tag LOCUS_02690 gene rrp4 4406 5086 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021780.1 protein_id gnl|my_center|LOCUS_02690 5091 5834 gene locus_tag LOCUS_02700 gene rrp41 5091 5834 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867734.1 protein_id gnl|my_center|LOCUS_02700 5827 6636 gene locus_tag LOCUS_02710 gene rrp42 5827 6636 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250584.1 protein_id gnl|my_center|LOCUS_02710 6620 6886 gene locus_tag LOCUS_02720 6620 6886 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867396.1 protein_id gnl|my_center|LOCUS_02720 6888 7028 gene locus_tag LOCUS_02730 6888 7028 CDS product DNA-directed RNA polymerase subunit P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021777.1 protein_id gnl|my_center|LOCUS_02730 7030 7266 gene locus_tag LOCUS_02740 gene pcc1 7030 7266 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146522.1 protein_id gnl|my_center|LOCUS_02740 7434 8345 gene locus_tag LOCUS_02750 7434 8345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 8489 8641 gene locus_tag LOCUS_02760 8489 8641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 8727 9962 gene locus_tag LOCUS_02770 8727 9962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 10005 12218 gene locus_tag LOCUS_02780 10005 12218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 13510 12203 gene locus_tag LOCUS_02790 13510 12203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 >Feature sequence018 582 1475 gene locus_tag LOCUS_02800 582 1475 CDS product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065870.1 protein_id gnl|my_center|LOCUS_02800 2352 1468 gene locus_tag LOCUS_02810 2352 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 5264 2343 gene locus_tag LOCUS_02820 5264 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 5355 5283 gene locus_tag LOCUS_t00090 5355 5283 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 5448 5371 gene locus_tag LOCUS_t00100 5448 5371 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5895 5683 gene locus_tag LOCUS_02830 5895 5683 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877934.1 protein_id gnl|my_center|LOCUS_02830 7172 5928 gene locus_tag LOCUS_02840 7172 5928 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249495.1 protein_id gnl|my_center|LOCUS_02840 8416 7169 gene locus_tag LOCUS_02850 8416 7169 CDS product aconitase/3-isopropylmalate dehydratase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870106.1 protein_id gnl|my_center|LOCUS_02850 8971 8438 gene locus_tag LOCUS_02860 8971 8438 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355957.1 protein_id gnl|my_center|LOCUS_02860 9940 9011 gene locus_tag LOCUS_02870 9940 9011 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966531.1 protein_id gnl|my_center|LOCUS_02870 10084 11370 gene locus_tag LOCUS_02880 10084 11370 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545699.1 protein_id gnl|my_center|LOCUS_02880 12413 11412 gene locus_tag LOCUS_02890 gene radA 12413 11412 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023460.1 protein_id gnl|my_center|LOCUS_02890 13758 12424 gene locus_tag LOCUS_02900 13758 12424 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251170.1 protein_id gnl|my_center|LOCUS_02900 >Feature sequence019 63 1400 gene locus_tag LOCUS_02910 63 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 1393 1881 gene locus_tag LOCUS_02920 1393 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 1878 2507 gene locus_tag LOCUS_02930 1878 2507 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250883.1 protein_id gnl|my_center|LOCUS_02930 2500 3219 gene locus_tag LOCUS_02940 2500 3219 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080614.1 protein_id gnl|my_center|LOCUS_02940 3191 4642 gene locus_tag LOCUS_02950 3191 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 4819 5298 gene locus_tag LOCUS_02960 4819 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 6439 5345 gene locus_tag LOCUS_02970 6439 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 6550 7857 gene locus_tag LOCUS_02980 6550 7857 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_02980 7971 9734 gene locus_tag LOCUS_02990 gene infB 7971 9734 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875898.1 protein_id gnl|my_center|LOCUS_02990 9731 10549 gene locus_tag LOCUS_03000 9731 10549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249468.1 protein_id gnl|my_center|LOCUS_03000 11970 10690 gene locus_tag LOCUS_03010 11970 10690 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583645.1 protein_id gnl|my_center|LOCUS_03010 13523 12027 gene locus_tag LOCUS_03020 13523 12027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 >Feature sequence020 <1 869 gene locus_tag LOCUS_03030 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979315.1:deoxyhypusine synthase 1688 891 gene locus_tag LOCUS_03040 gene mftE 1688 891 CDS product mycofactocin biosynthesis peptidyl-dipeptidase MftE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403497.1 protein_id gnl|my_center|LOCUS_03040 2569 1685 gene locus_tag LOCUS_03050 gene map 2569 1685 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870846.1 protein_id gnl|my_center|LOCUS_03050 3158 2670 gene locus_tag LOCUS_03060 3158 2670 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065943.1 protein_id gnl|my_center|LOCUS_03060 4037 3180 gene locus_tag LOCUS_03070 4037 3180 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879523.1 protein_id gnl|my_center|LOCUS_03070 4221 6212 gene locus_tag LOCUS_03080 4221 6212 CDS product CGP-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251118.1 protein_id gnl|my_center|LOCUS_03080 6206 7252 gene locus_tag LOCUS_03090 gene endA 6206 7252 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023532.1 protein_id gnl|my_center|LOCUS_03090 7305 7649 gene locus_tag LOCUS_03100 7305 7649 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986393.1 protein_id gnl|my_center|LOCUS_03100 7642 8490 gene locus_tag LOCUS_03110 7642 8490 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865102.1 protein_id gnl|my_center|LOCUS_03110 9295 8465 gene locus_tag LOCUS_03120 gene speE 9295 8465 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249102.1 protein_id gnl|my_center|LOCUS_03120 9390 9758 gene locus_tag LOCUS_03130 9390 9758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 9760 11178 gene locus_tag LOCUS_03140 9760 11178 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060924.1 protein_id gnl|my_center|LOCUS_03140 11181 12155 gene locus_tag LOCUS_03150 11181 12155 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_03150 12157 12333 gene locus_tag LOCUS_03160 12157 12333 CDS product methytransferase partner Trm112 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902783.1 protein_id gnl|my_center|LOCUS_03160 <13563 12308 gene locus_tag LOCUS_03170 <13563 12308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249735.1:helicase C-terminal domain-containing protein >Feature sequence021 209 1156 gene locus_tag LOCUS_03180 gene guaA 209 1156 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867924.1 protein_id gnl|my_center|LOCUS_03180 1158 1733 gene locus_tag LOCUS_03190 1158 1733 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249145.1 protein_id gnl|my_center|LOCUS_03190 2300 1737 gene locus_tag LOCUS_03200 2300 1737 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868085.1 protein_id gnl|my_center|LOCUS_03200 3043 2297 gene locus_tag LOCUS_03210 3043 2297 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868227.1 protein_id gnl|my_center|LOCUS_03210 3229 4095 gene locus_tag LOCUS_03220 3229 4095 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878298.1 protein_id gnl|my_center|LOCUS_03220 4097 4684 gene locus_tag LOCUS_03230 4097 4684 CDS product KaiC associated regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064643.1 protein_id gnl|my_center|LOCUS_03230 4687 7878 gene locus_tag LOCUS_03240 gene rgy 4687 7878 CDS product reverse gyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878524.1 protein_id gnl|my_center|LOCUS_03240 8816 7890 gene locus_tag LOCUS_03250 gene trxB 8816 7890 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060886.1 protein_id gnl|my_center|LOCUS_03250 9416 8826 gene locus_tag LOCUS_03260 9416 8826 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065298.1 protein_id gnl|my_center|LOCUS_03260 11976 9337 gene locus_tag LOCUS_03270 11976 9337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 13131 12106 gene locus_tag LOCUS_03280 13131 12106 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053771.1 protein_id gnl|my_center|LOCUS_03280 >Feature sequence022 2408 1506 gene locus_tag LOCUS_03290 2408 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 3271 2405 gene locus_tag LOCUS_03300 3271 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 5410 3272 gene locus_tag LOCUS_03310 5410 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 5612 6094 gene locus_tag LOCUS_03320 5612 6094 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251039.1 protein_id gnl|my_center|LOCUS_03320 6039 6560 gene locus_tag LOCUS_03330 6039 6560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03330 6557 7783 gene locus_tag LOCUS_03340 6557 7783 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867842.1 protein_id gnl|my_center|LOCUS_03340 7786 8193 gene locus_tag LOCUS_03350 7786 8193 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867840.1 protein_id gnl|my_center|LOCUS_03350 8647 8201 gene locus_tag LOCUS_03360 gene hycI 8647 8201 CDS product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870136.1 protein_id gnl|my_center|LOCUS_03360 8691 9737 gene locus_tag LOCUS_03370 gene hypE 8691 9737 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060768.1 protein_id gnl|my_center|LOCUS_03370 10322 9762 gene locus_tag LOCUS_03380 10322 9762 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250624.1 protein_id gnl|my_center|LOCUS_03380 10379 12169 gene locus_tag LOCUS_03390 10379 12169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 12166 12975 gene locus_tag LOCUS_03400 12166 12975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 >Feature sequence023 910 620 gene locus_tag LOCUS_03410 910 620 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250833.1 protein_id gnl|my_center|LOCUS_03410 4655 963 gene locus_tag LOCUS_03420 4655 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 4838 8509 gene locus_tag LOCUS_03430 4838 8509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 8722 9816 gene locus_tag LOCUS_03440 8722 9816 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060968.1 protein_id gnl|my_center|LOCUS_03440 9813 11120 gene locus_tag LOCUS_03450 9813 11120 CDS product bifunctional L-myo-inositol-1-phosphate cytidylyltransferase/CDP-L-myo-inositol myo-inositolphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880881.1 protein_id gnl|my_center|LOCUS_03450 11192 11734 gene locus_tag LOCUS_03460 11192 11734 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249257.1 protein_id gnl|my_center|LOCUS_03460 12268 11735 gene locus_tag LOCUS_03470 12268 11735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 12653 12273 gene locus_tag LOCUS_03480 12653 12273 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545896.1 protein_id gnl|my_center|LOCUS_03480 >Feature sequence024 984 283 gene locus_tag LOCUS_03490 984 283 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250639.1 protein_id gnl|my_center|LOCUS_03490 1387 968 gene locus_tag LOCUS_03500 1387 968 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496977.1 protein_id gnl|my_center|LOCUS_03500 2555 1389 gene locus_tag LOCUS_03510 2555 1389 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_03510 3616 2561 gene locus_tag LOCUS_03520 3616 2561 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871070.1 protein_id gnl|my_center|LOCUS_03520 4552 3680 gene locus_tag LOCUS_03530 4552 3680 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867255.1 protein_id gnl|my_center|LOCUS_03530 7329 4558 gene locus_tag LOCUS_03540 7329 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 7792 8904 gene locus_tag LOCUS_03550 7792 8904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 10063 8891 gene locus_tag LOCUS_03560 10063 8891 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868783.1 protein_id gnl|my_center|LOCUS_03560 11131 10079 gene locus_tag LOCUS_03570 gene bpsA 11131 10079 CDS product N(4)-bis(aminopropyl)spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250642.1 protein_id gnl|my_center|LOCUS_03570 11824 11369 gene locus_tag LOCUS_03580 11824 11369 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868968.1 protein_id gnl|my_center|LOCUS_03580 >Feature sequence025 670 239 gene locus_tag LOCUS_03590 670 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 1930 1724 gene locus_tag LOCUS_03600 1930 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 2135 3052 gene locus_tag LOCUS_03610 gene nadA 2135 3052 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583121.1 protein_id gnl|my_center|LOCUS_03610 3036 4229 gene locus_tag LOCUS_03620 gene nifS 3036 4229 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_03620 4229 4609 gene locus_tag LOCUS_03630 gene nifU 4229 4609 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877697.1 protein_id gnl|my_center|LOCUS_03630 4612 5088 gene locus_tag LOCUS_03640 4612 5088 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870785.1 protein_id gnl|my_center|LOCUS_03640 5085 5810 gene locus_tag LOCUS_03650 gene queC 5085 5810 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272362.1 protein_id gnl|my_center|LOCUS_03650 6855 5794 gene locus_tag LOCUS_03660 6855 5794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 7355 6858 gene locus_tag LOCUS_03670 gene nob1 7355 6858 CDS product type II toxin-antitoxin system toxin endoribonuclease Nob1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877892.1 protein_id gnl|my_center|LOCUS_03670 8545 7355 gene locus_tag LOCUS_03680 gene hisS 8545 7355 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061190.1 protein_id gnl|my_center|LOCUS_03680 9238 8687 gene locus_tag LOCUS_03690 9238 8687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 10104 9235 gene locus_tag LOCUS_03700 10104 9235 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847020.1 protein_id gnl|my_center|LOCUS_03700 10374 10114 gene locus_tag LOCUS_03710 10374 10114 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064806.1 protein_id gnl|my_center|LOCUS_03710 12763 10469 gene locus_tag LOCUS_03720 12763 10469 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878955.1 protein_id gnl|my_center|LOCUS_03720 >Feature sequence026 1581 313 gene locus_tag LOCUS_03730 1581 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 2568 1627 gene locus_tag LOCUS_03740 gene thiL 2568 1627 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877008.1 protein_id gnl|my_center|LOCUS_03740 2509 3654 gene locus_tag LOCUS_03750 gene purM 2509 3654 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879189.1 protein_id gnl|my_center|LOCUS_03750 3946 4218 gene locus_tag LOCUS_03760 3946 4218 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021485.1 protein_id gnl|my_center|LOCUS_03760 4909 4229 gene locus_tag LOCUS_03770 4909 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 6671 4956 gene locus_tag LOCUS_03780 6671 4956 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867608.1 protein_id gnl|my_center|LOCUS_03780 7656 6673 gene locus_tag LOCUS_03790 7656 6673 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146738.1 protein_id gnl|my_center|LOCUS_03790 8705 7647 gene locus_tag LOCUS_03800 gene fni 8705 7647 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020653.1 protein_id gnl|my_center|LOCUS_03800 9459 8689 gene locus_tag LOCUS_03810 9459 8689 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867666.1 protein_id gnl|my_center|LOCUS_03810 10174 9524 gene locus_tag LOCUS_03820 10174 9524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 10310 10684 gene locus_tag LOCUS_03830 10310 10684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 10771 10697 gene locus_tag LOCUS_t00110 10771 10697 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 11008 12027 gene locus_tag LOCUS_03840 11008 12027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 12034 12327 gene locus_tag LOCUS_03850 12034 12327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 >Feature sequence027 1005 127 gene locus_tag LOCUS_03860 1005 127 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878600.1 protein_id gnl|my_center|LOCUS_03860 2601 1027 gene locus_tag LOCUS_03870 2601 1027 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496733.1 protein_id gnl|my_center|LOCUS_03870 2758 3258 gene locus_tag LOCUS_03880 gene rplJ 2758 3258 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878836.1 protein_id gnl|my_center|LOCUS_03880 4619 3255 gene locus_tag LOCUS_03890 4619 3255 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867359.1 protein_id gnl|my_center|LOCUS_03890 5507 4644 gene locus_tag LOCUS_03900 gene folP 5507 4644 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_03900 6266 5553 gene locus_tag LOCUS_03910 6266 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 6355 7326 gene locus_tag LOCUS_03920 6355 7326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 7366 8559 gene locus_tag LOCUS_03930 gene cruC 7366 8559 CDS product hydroxychlorobactene glucosyltransferase CruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933643.1 protein_id gnl|my_center|LOCUS_03930 8929 8564 gene locus_tag LOCUS_03940 8929 8564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 10213 8957 gene locus_tag LOCUS_03950 10213 8957 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965694.1 protein_id gnl|my_center|LOCUS_03950 10881 10213 gene locus_tag LOCUS_03960 gene purN 10881 10213 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_03960 12009 10906 gene locus_tag LOCUS_03970 12009 10906 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870460.1 protein_id gnl|my_center|LOCUS_03970 <12541 12011 gene locus_tag LOCUS_03980 <12541 12011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010871083.1:NTPase >Feature sequence028 74 1699 gene locus_tag LOCUS_03990 74 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 1696 2418 gene locus_tag LOCUS_04000 1696 2418 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020802.1 protein_id gnl|my_center|LOCUS_04000 2465 2623 gene locus_tag LOCUS_04010 2465 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 2628 5366 gene locus_tag LOCUS_04020 2628 5366 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878645.1 protein_id gnl|my_center|LOCUS_04020 5437 5817 gene locus_tag LOCUS_04030 gene gcvH 5437 5817 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865076.1 protein_id gnl|my_center|LOCUS_04030 6308 5814 gene locus_tag LOCUS_04040 6308 5814 CDS product Isopropylmalate/citramalate isomerase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870790.1 protein_id gnl|my_center|LOCUS_04040 6402 8189 gene locus_tag LOCUS_04050 6402 8189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 8251 8679 gene locus_tag LOCUS_04060 8251 8679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 8687 8965 gene locus_tag LOCUS_04070 8687 8965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 9008 9700 gene locus_tag LOCUS_04080 9008 9700 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_04080 9697 11139 gene locus_tag LOCUS_04090 9697 11139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 12374 11136 gene locus_tag LOCUS_04100 12374 11136 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064787.1 protein_id gnl|my_center|LOCUS_04100 >Feature sequence029 <1 846 gene locus_tag LOCUS_04110 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496653.1:type II/IV secretion system ATPase subunit 856 2619 gene locus_tag LOCUS_04120 gene flaJ 856 2619 CDS product archaellar assembly protein FlaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249004.1 protein_id gnl|my_center|LOCUS_04120 3245 2616 gene locus_tag LOCUS_04130 3245 2616 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870406.1 protein_id gnl|my_center|LOCUS_04130 4005 3361 gene locus_tag LOCUS_04140 4005 3361 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870406.1 protein_id gnl|my_center|LOCUS_04140 4493 4149 gene locus_tag LOCUS_04150 4493 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 4616 5668 gene locus_tag LOCUS_04160 4616 5668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 5672 5962 gene locus_tag LOCUS_04170 5672 5962 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876811.1 protein_id gnl|my_center|LOCUS_04170 6002 6580 gene locus_tag LOCUS_04180 6002 6580 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250928.1 protein_id gnl|my_center|LOCUS_04180 6577 6840 gene locus_tag LOCUS_04190 6577 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 6842 8002 gene locus_tag LOCUS_04200 6842 8002 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250930.1 protein_id gnl|my_center|LOCUS_04200 7999 8904 gene locus_tag LOCUS_04210 7999 8904 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846976.1 protein_id gnl|my_center|LOCUS_04210 9950 8901 gene locus_tag LOCUS_04220 9950 8901 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_04220 11018 9990 gene locus_tag LOCUS_04230 11018 9990 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545362.1 protein_id gnl|my_center|LOCUS_04230 11823 11023 gene locus_tag LOCUS_04240 gene lsrF 11823 11023 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098846.1 protein_id gnl|my_center|LOCUS_04240 11872 12327 gene locus_tag LOCUS_04250 11872 12327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 >Feature sequence030 1495 140 gene locus_tag LOCUS_04260 1495 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 2286 1573 gene locus_tag LOCUS_04270 2286 1573 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763153.1 protein_id gnl|my_center|LOCUS_04270 3136 2336 gene locus_tag LOCUS_04280 gene pyrF 3136 2336 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931823.1 protein_id gnl|my_center|LOCUS_04280 3189 4271 gene locus_tag LOCUS_04290 3189 4271 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_04290 4340 5521 gene locus_tag LOCUS_04300 4340 5521 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870830.1 protein_id gnl|my_center|LOCUS_04300 5518 5919 gene locus_tag LOCUS_04310 5518 5919 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020302.1 protein_id gnl|my_center|LOCUS_04310 5956 6029 gene locus_tag LOCUS_t00120 5956 6029 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7081 6110 gene locus_tag LOCUS_04320 7081 6110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 7249 9348 gene locus_tag LOCUS_04330 7249 9348 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020726.1 protein_id gnl|my_center|LOCUS_04330 9446 10009 gene locus_tag LOCUS_04340 9446 10009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 10350 10063 gene locus_tag LOCUS_04350 10350 10063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 11404 10457 gene locus_tag LOCUS_04360 11404 10457 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_04360 >Feature sequence031 585 268 gene locus_tag LOCUS_04370 585 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 1325 2047 gene locus_tag LOCUS_04380 1325 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 4284 2056 gene locus_tag LOCUS_04390 gene hypF 4284 2056 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250947.1 protein_id gnl|my_center|LOCUS_04390 5335 4208 gene locus_tag LOCUS_04400 gene hypD 5335 4208 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582513.1 protein_id gnl|my_center|LOCUS_04400 5718 7166 gene locus_tag LOCUS_04410 5718 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 8614 7484 gene locus_tag LOCUS_04420 8614 7484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 8672 9730 gene locus_tag LOCUS_04430 8672 9730 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023593.1 protein_id gnl|my_center|LOCUS_04430 9730 10158 gene locus_tag LOCUS_04440 9730 10158 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871151.1 protein_id gnl|my_center|LOCUS_04440 10751 10155 gene locus_tag LOCUS_04450 10751 10155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 <11542 10748 gene locus_tag LOCUS_04460 <11542 10748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003229102.1:methionine adenosyltransferase >Feature sequence032 2182 2907 gene locus_tag LOCUS_04470 2182 2907 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867555.1 protein_id gnl|my_center|LOCUS_04470 2996 5131 gene locus_tag LOCUS_04480 2996 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 5121 5666 gene locus_tag LOCUS_04490 5121 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 5758 6849 gene locus_tag LOCUS_04500 5758 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 6831 7868 gene locus_tag LOCUS_04510 6831 7868 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878512.1 protein_id gnl|my_center|LOCUS_04510 7870 8637 gene locus_tag LOCUS_04520 gene trmI 7870 8637 CDS product tRNA (adenine(57)-N(1)/adenine(58)-N(1))-methyltransferase TrmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867553.1 protein_id gnl|my_center|LOCUS_04520 9117 8644 gene locus_tag LOCUS_04530 gene dcd 9117 8644 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846226.1 protein_id gnl|my_center|LOCUS_04530 10203 9118 gene locus_tag LOCUS_04540 10203 9118 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391684.1 protein_id gnl|my_center|LOCUS_04540 10979 10404 gene locus_tag LOCUS_04550 10979 10404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 >Feature sequence033 1891 170 gene locus_tag LOCUS_04560 1891 170 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879805.1 protein_id gnl|my_center|LOCUS_04560 2057 2269 gene locus_tag LOCUS_04570 2057 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 3521 2259 gene locus_tag LOCUS_04580 3521 2259 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545033.1 protein_id gnl|my_center|LOCUS_04580 3928 3533 gene locus_tag LOCUS_04590 gene speD 3928 3533 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496461.1 protein_id gnl|my_center|LOCUS_04590 5409 4099 gene locus_tag LOCUS_04600 5409 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 5611 5516 gene locus_tag LOCUS_t00130 5611 5516 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6289 5597 gene locus_tag LOCUS_04610 6289 5597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 6349 6546 gene locus_tag LOCUS_04620 6349 6546 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251242.1 protein_id gnl|my_center|LOCUS_04620 6634 7323 gene locus_tag LOCUS_04630 gene ribB 6634 7323 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869547.1 protein_id gnl|my_center|LOCUS_04630 7308 7778 gene locus_tag LOCUS_04640 7308 7778 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064389.1 protein_id gnl|my_center|LOCUS_04640 7756 8250 gene locus_tag LOCUS_04650 gene ribC 7756 8250 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870697.1 protein_id gnl|my_center|LOCUS_04650 8232 8654 gene locus_tag LOCUS_04660 gene ribH 8232 8654 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877002.1 protein_id gnl|my_center|LOCUS_04660 9136 8651 gene locus_tag LOCUS_04670 9136 8651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 9503 9138 gene locus_tag LOCUS_04680 9503 9138 CDS product DUF2073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064681.1 protein_id gnl|my_center|LOCUS_04680 10162 9500 gene locus_tag LOCUS_04690 10162 9500 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878677.1 protein_id gnl|my_center|LOCUS_04690 >Feature sequence034 1675 1304 gene locus_tag LOCUS_04700 1675 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 3561 1915 gene locus_tag LOCUS_04710 3561 1915 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809743.1 protein_id gnl|my_center|LOCUS_04710 3692 4162 gene locus_tag LOCUS_04720 3692 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 4159 4971 gene locus_tag LOCUS_04730 4159 4971 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861239.1 protein_id gnl|my_center|LOCUS_04730 4968 5597 gene locus_tag LOCUS_04740 4968 5597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 5764 5600 gene locus_tag LOCUS_04750 5764 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 7145 5889 gene locus_tag LOCUS_04760 7145 5889 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546536.1 protein_id gnl|my_center|LOCUS_04760 7255 8562 gene locus_tag LOCUS_04770 7255 8562 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_04770 8628 9506 gene locus_tag LOCUS_04780 8628 9506 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037756.1 protein_id gnl|my_center|LOCUS_04780 >Feature sequence035 1422 997 gene locus_tag LOCUS_04790 1422 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 1693 1508 gene locus_tag LOCUS_04800 1693 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04800 2030 1713 gene locus_tag LOCUS_04810 2030 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04810 2518 2030 gene locus_tag LOCUS_04820 2518 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04820 2651 2508 gene locus_tag LOCUS_04830 2651 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 3729 2857 gene locus_tag LOCUS_04840 3729 2857 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274369.1 protein_id gnl|my_center|LOCUS_04840 5097 3778 gene locus_tag LOCUS_04850 5097 3778 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020230.1 protein_id gnl|my_center|LOCUS_04850 5404 5162 gene locus_tag LOCUS_04860 5404 5162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 5564 5475 gene locus_tag LOCUS_t00140 5564 5475 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6160 5849 gene locus_tag LOCUS_04870 gene rpsJ 6160 5849 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021276.1 protein_id gnl|my_center|LOCUS_04870 7469 6195 gene locus_tag LOCUS_04880 gene tuf 7469 6195 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021277.1 protein_id gnl|my_center|LOCUS_04880 7684 8160 gene locus_tag LOCUS_04890 7684 8160 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250457.1 protein_id gnl|my_center|LOCUS_04890 8172 8735 gene locus_tag LOCUS_04900 8172 8735 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869685.1 protein_id gnl|my_center|LOCUS_04900 8737 9120 gene locus_tag LOCUS_04910 8737 9120 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879772.1 protein_id gnl|my_center|LOCUS_04910 9117 9920 gene locus_tag LOCUS_04920 9117 9920 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875678.1 protein_id gnl|my_center|LOCUS_04920 9954 10026 gene locus_tag LOCUS_t00150 9954 10026 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence036 3239 2853 gene locus_tag LOCUS_04930 3239 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 3477 3704 gene locus_tag LOCUS_04940 3477 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 3788 4888 gene locus_tag LOCUS_04950 gene ftsZ 3788 4888 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023772.1 protein_id gnl|my_center|LOCUS_04950 5574 4885 gene locus_tag LOCUS_04960 gene pyrH 5574 4885 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879534.1 protein_id gnl|my_center|LOCUS_04960 5992 5567 gene locus_tag LOCUS_04970 5992 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 6068 6802 gene locus_tag LOCUS_04980 6068 6802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 8190 6799 gene locus_tag LOCUS_04990 8190 6799 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878691.1 protein_id gnl|my_center|LOCUS_04990 8303 8388 gene locus_tag LOCUS_t00160 8303 8388 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9383 8388 gene locus_tag LOCUS_05000 gene dph2 9383 8388 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876932.1 protein_id gnl|my_center|LOCUS_05000 <10142 9389 gene locus_tag LOCUS_05010 <10142 9389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867137.1:TIGR00529 family membrane protein >Feature sequence037 579 208 gene locus_tag LOCUS_05020 579 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 2015 594 gene locus_tag LOCUS_05030 gene proS 2015 594 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249505.1 protein_id gnl|my_center|LOCUS_05030 2202 2053 gene locus_tag LOCUS_05040 2202 2053 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250446.1 protein_id gnl|my_center|LOCUS_05040 2697 2323 gene locus_tag LOCUS_05050 2697 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 2639 2926 gene locus_tag LOCUS_05060 2639 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 3287 3460 gene locus_tag LOCUS_05070 3287 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 6171 3445 gene locus_tag LOCUS_05080 gene alaS 6171 3445 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868790.1 protein_id gnl|my_center|LOCUS_05080 6224 6907 gene locus_tag LOCUS_05090 6224 6907 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970750.1 protein_id gnl|my_center|LOCUS_05090 8068 6926 gene locus_tag LOCUS_05100 8068 6926 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065228.1 protein_id gnl|my_center|LOCUS_05100 8263 9114 gene locus_tag LOCUS_05110 8263 9114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 9216 9947 gene locus_tag LOCUS_05120 9216 9947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 10036 10108 gene locus_tag LOCUS_t00170 10036 10108 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence038 1338 139 gene locus_tag LOCUS_05130 1338 139 CDS product homocitrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877238.1 protein_id gnl|my_center|LOCUS_05130 1858 1307 gene locus_tag LOCUS_05140 1858 1307 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867800.1 protein_id gnl|my_center|LOCUS_05140 2190 4847 gene locus_tag LOCUS_05150 2190 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 5833 4844 gene locus_tag LOCUS_05160 5833 4844 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868238.1 protein_id gnl|my_center|LOCUS_05160 5900 6739 gene locus_tag LOCUS_05170 5900 6739 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022056.1 protein_id gnl|my_center|LOCUS_05170 6736 7242 gene locus_tag LOCUS_05180 6736 7242 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496586.1 protein_id gnl|my_center|LOCUS_05180 8150 7569 gene locus_tag LOCUS_05190 8150 7569 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251069.1 protein_id gnl|my_center|LOCUS_05190 8827 8156 gene locus_tag LOCUS_05200 8827 8156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 9598 8918 gene locus_tag LOCUS_05210 9598 8918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 >Feature sequence039 <1 538 gene locus_tag LOCUS_05220 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289232.1:type II/IV secretion system ATPase subunit 531 2192 gene locus_tag LOCUS_05230 531 2192 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148183415.1 protein_id gnl|my_center|LOCUS_05230 2173 3081 gene locus_tag LOCUS_05240 2173 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 3084 3983 gene locus_tag LOCUS_05250 3084 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 4082 4417 gene locus_tag LOCUS_05260 4082 4417 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875846.1 protein_id gnl|my_center|LOCUS_05260 4475 4753 gene locus_tag LOCUS_05270 gene srp19 4475 4753 CDS product signal recognition particle subunit SRP19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902992.1 protein_id gnl|my_center|LOCUS_05270 4872 5693 gene locus_tag LOCUS_05280 4872 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 6008 6202 gene locus_tag LOCUS_05290 6008 6202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 6561 7220 gene locus_tag LOCUS_05300 6561 7220 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904055.1 protein_id gnl|my_center|LOCUS_05300 8328 7261 gene locus_tag LOCUS_05310 8328 7261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775723.1 protein_id gnl|my_center|LOCUS_05310 8435 9076 gene locus_tag LOCUS_05320 8435 9076 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878079.1 protein_id gnl|my_center|LOCUS_05320 9073 9321 gene locus_tag LOCUS_05330 9073 9321 CDS product DUF504 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876898.1 protein_id gnl|my_center|LOCUS_05330 >Feature sequence040 <1 517 gene locus_tag LOCUS_05340 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398777.1:asparagine--tRNA ligase 529 804 gene locus_tag LOCUS_05350 529 804 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259430.1 protein_id gnl|my_center|LOCUS_05350 1293 808 gene locus_tag LOCUS_05360 1293 808 CDS product ADP-ribose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880613.1 protein_id gnl|my_center|LOCUS_05360 1541 1290 gene locus_tag LOCUS_05370 1541 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 2391 1543 gene locus_tag LOCUS_05380 2391 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871153.1 protein_id gnl|my_center|LOCUS_05380 2584 2423 gene locus_tag LOCUS_05390 2584 2423 CDS product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876286.1 protein_id gnl|my_center|LOCUS_05390 2833 2612 gene locus_tag LOCUS_05400 2833 2612 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878376.1 protein_id gnl|my_center|LOCUS_05400 2888 3370 gene locus_tag LOCUS_05410 2888 3370 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870950.1 protein_id gnl|my_center|LOCUS_05410 3442 3762 gene locus_tag LOCUS_05420 3442 3762 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877119.1 protein_id gnl|my_center|LOCUS_05420 3759 4385 gene locus_tag LOCUS_05430 3759 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 5399 4380 gene locus_tag LOCUS_05440 5399 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 9177 5503 gene locus_tag LOCUS_05450 9177 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 >Feature sequence041 1110 130 gene locus_tag LOCUS_05460 1110 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 3924 1246 gene locus_tag LOCUS_05470 gene valS 3924 1246 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870520.1 protein_id gnl|my_center|LOCUS_05470 3992 5095 gene locus_tag LOCUS_05480 3992 5095 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146822.1 protein_id gnl|my_center|LOCUS_05480 5181 5555 gene locus_tag LOCUS_05490 gene rpl7ae 5181 5555 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053601.1 protein_id gnl|my_center|LOCUS_05490 5557 5766 gene locus_tag LOCUS_05500 5557 5766 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867791.1 protein_id gnl|my_center|LOCUS_05500 5772 5954 gene locus_tag LOCUS_05510 5772 5954 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878269.1 protein_id gnl|my_center|LOCUS_05510 5966 7225 gene locus_tag LOCUS_05520 gene larA 5966 7225 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860456.1 protein_id gnl|my_center|LOCUS_05520 7230 7724 gene locus_tag LOCUS_05530 7230 7724 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583265.1 protein_id gnl|my_center|LOCUS_05530 7781 8566 gene locus_tag LOCUS_05540 7781 8566 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250562.1 protein_id gnl|my_center|LOCUS_05540 >Feature sequence042 2365 794 gene locus_tag LOCUS_05550 2365 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 2480 6268 gene locus_tag LOCUS_05560 2480 6268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 7151 6783 gene locus_tag LOCUS_05570 7151 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 7846 7148 gene locus_tag LOCUS_05580 7846 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 >Feature sequence043 350 1267 gene locus_tag LOCUS_05590 gene rnz 350 1267 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_05590 1328 1720 gene locus_tag LOCUS_05600 1328 1720 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064265.1 protein_id gnl|my_center|LOCUS_05600 1753 2826 gene locus_tag LOCUS_05610 1753 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 4061 2832 gene locus_tag LOCUS_05620 4061 2832 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867755.1 protein_id gnl|my_center|LOCUS_05620 4788 4054 gene locus_tag LOCUS_05630 4788 4054 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250288.1 protein_id gnl|my_center|LOCUS_05630 5019 4816 gene locus_tag LOCUS_05640 5019 4816 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879124.1 protein_id gnl|my_center|LOCUS_05640 5413 5039 gene locus_tag LOCUS_05650 5413 5039 CDS product DUF2178 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879123.1 protein_id gnl|my_center|LOCUS_05650 5597 6775 gene locus_tag LOCUS_05660 5597 6775 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868019.1 protein_id gnl|my_center|LOCUS_05660 6873 8168 gene locus_tag LOCUS_05670 gene glyA 6873 8168 CDS product bifunctional serine hydroxymethyltransferase/L-allo-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871121.1 protein_id gnl|my_center|LOCUS_05670 >Feature sequence044 684 1601 gene locus_tag LOCUS_05680 684 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 1639 1709 gene locus_tag LOCUS_t00180 1639 1709 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1737 2441 gene locus_tag LOCUS_05690 1737 2441 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251184.1 protein_id gnl|my_center|LOCUS_05690 3951 2455 gene locus_tag LOCUS_05700 3951 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 6124 4649 gene locus_tag LOCUS_05710 6124 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 7586 6204 gene locus_tag LOCUS_05720 7586 6204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 >Feature sequence045 <1 575 gene locus_tag LOCUS_05730 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060960.1:elongation factor EF-2 1828 731 gene locus_tag LOCUS_05740 gene gcvT 1828 731 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868215.1 protein_id gnl|my_center|LOCUS_05740 2265 1882 gene locus_tag LOCUS_05750 2265 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 4255 2276 gene locus_tag LOCUS_05760 gene feoB 4255 2276 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249665.1 protein_id gnl|my_center|LOCUS_05760 4488 4252 gene locus_tag LOCUS_05770 4488 4252 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249666.1 protein_id gnl|my_center|LOCUS_05770 4738 6030 gene locus_tag LOCUS_05780 4738 6030 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_05780 6738 6022 gene locus_tag LOCUS_05790 gene sfsA 6738 6022 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249730.1 protein_id gnl|my_center|LOCUS_05790 <8069 7015 gene locus_tag LOCUS_05800 <8069 7015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584117.1:FprA family A-type flavoprotein >Feature sequence046 <1 636 gene locus_tag LOCUS_05810 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867600.1:NDP-sugar synthase 633 1304 gene locus_tag LOCUS_05820 633 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 1350 2732 gene locus_tag LOCUS_05830 gene glmM 1350 2732 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877192.1 protein_id gnl|my_center|LOCUS_05830 4026 2716 gene locus_tag LOCUS_05840 4026 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 4120 5109 gene locus_tag LOCUS_05850 4120 5109 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023987.1 protein_id gnl|my_center|LOCUS_05850 5106 5951 gene locus_tag LOCUS_05860 5106 5951 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023985.1 protein_id gnl|my_center|LOCUS_05860 5941 7608 gene locus_tag LOCUS_05870 gene glyS 5941 7608 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869726.1 protein_id gnl|my_center|LOCUS_05870 >Feature sequence047 709 170 gene locus_tag LOCUS_05880 709 170 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870161.1 protein_id gnl|my_center|LOCUS_05880 1410 760 gene locus_tag LOCUS_05890 1410 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 1963 1400 gene locus_tag LOCUS_05900 1963 1400 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060730.1 protein_id gnl|my_center|LOCUS_05900 3499 1970 gene locus_tag LOCUS_05910 gene secY 3499 1970 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021124.1 protein_id gnl|my_center|LOCUS_05910 3896 3504 gene locus_tag LOCUS_05920 3896 3504 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762714.1 protein_id gnl|my_center|LOCUS_05920 4126 3959 gene locus_tag LOCUS_05930 4126 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 4215 4288 gene locus_tag LOCUS_t00190 4215 4288 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4388 4460 gene locus_tag LOCUS_t00200 4388 4460 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5323 4730 gene locus_tag LOCUS_05940 5323 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 6163 5363 gene locus_tag LOCUS_05950 6163 5363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 6421 6597 gene locus_tag LOCUS_05960 6421 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 7543 6581 gene locus_tag LOCUS_05970 7543 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 7729 7614 gene locus_tag LOCUS_r00010 7729 7614 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence048 270 197 gene locus_tag LOCUS_t00210 270 197 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 332 1354 gene locus_tag LOCUS_05980 gene priL 332 1354 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903675.1 protein_id gnl|my_center|LOCUS_05980 1351 1947 gene locus_tag LOCUS_05990 gene tmk 1351 1947 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024311.1 protein_id gnl|my_center|LOCUS_05990 1944 3737 gene locus_tag LOCUS_06000 gene arcS 1944 3737 CDS product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024500.1 protein_id gnl|my_center|LOCUS_06000 6628 3734 gene locus_tag LOCUS_06010 6628 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 6820 7263 gene locus_tag LOCUS_06020 6820 7263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 >Feature sequence049 45 368 gene locus_tag LOCUS_06030 45 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 482 409 gene locus_tag LOCUS_t00220 482 409 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1068 532 gene locus_tag LOCUS_06040 1068 532 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867717.1 protein_id gnl|my_center|LOCUS_06040 1845 1078 gene locus_tag LOCUS_06050 1845 1078 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020938.1 protein_id gnl|my_center|LOCUS_06050 2170 1847 gene locus_tag LOCUS_06060 gene eif1A 2170 1847 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869944.1 protein_id gnl|my_center|LOCUS_06060 2761 2207 gene locus_tag LOCUS_06070 2761 2207 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081962.1 protein_id gnl|my_center|LOCUS_06070 2884 3153 gene locus_tag LOCUS_06080 2884 3153 CDS product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876930.1 protein_id gnl|my_center|LOCUS_06080 3150 4442 gene locus_tag LOCUS_06090 gene truD 3150 4442 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065655.1 protein_id gnl|my_center|LOCUS_06090 4822 4439 gene locus_tag LOCUS_06100 4822 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 5037 4855 gene locus_tag LOCUS_06110 5037 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 5289 5104 gene locus_tag LOCUS_06120 5289 5104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 6134 5784 gene locus_tag LOCUS_06130 6134 5784 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_06130 6421 6131 gene locus_tag LOCUS_06140 6421 6131 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546611.1 protein_id gnl|my_center|LOCUS_06140 6950 6789 gene locus_tag LOCUS_06150 6950 6789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 7702 6956 gene locus_tag LOCUS_06160 7702 6956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 >Feature sequence050 1944 2954 gene locus_tag LOCUS_06170 1944 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 3016 3384 gene locus_tag LOCUS_06180 3016 3384 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878647.1 protein_id gnl|my_center|LOCUS_06180 3381 3608 gene locus_tag LOCUS_06190 3381 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 4498 3611 gene locus_tag LOCUS_06200 gene uppS 4498 3611 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867696.1 protein_id gnl|my_center|LOCUS_06200 4626 5216 gene locus_tag LOCUS_06210 gene rpoE 4626 5216 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878613.1 protein_id gnl|my_center|LOCUS_06210 5213 5398 gene locus_tag LOCUS_06220 5213 5398 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875904.1 protein_id gnl|my_center|LOCUS_06220 5399 5926 gene locus_tag LOCUS_06230 5399 5926 CDS product GTP-dependent dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868805.1 protein_id gnl|my_center|LOCUS_06230 5907 6326 gene locus_tag LOCUS_06240 5907 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 6313 6477 gene locus_tag LOCUS_06250 6313 6477 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878609.1 protein_id gnl|my_center|LOCUS_06250 6555 6628 gene locus_tag LOCUS_t00230 6555 6628 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence051 368 4009 gene locus_tag LOCUS_06260 368 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 4099 5370 gene locus_tag LOCUS_06270 4099 5370 CDS product Single-stranded DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020639.1 protein_id gnl|my_center|LOCUS_06270 5367 6233 gene locus_tag LOCUS_06280 5367 6233 CDS product RPA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064919.1 protein_id gnl|my_center|LOCUS_06280 6610 6230 gene locus_tag LOCUS_06290 gene sepF 6610 6230 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878285.1 protein_id gnl|my_center|LOCUS_06290 <7431 6653 gene locus_tag LOCUS_06300 <7431 6653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000023851.1:HAMP domain-containing sensor histidine kinase >Feature sequence052 179 264 gene locus_tag LOCUS_t00240 179 264 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1454 306 gene locus_tag LOCUS_06310 1454 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 2178 1555 gene locus_tag LOCUS_06320 2178 1555 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_06320 2226 2447 gene locus_tag LOCUS_06330 2226 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 2628 3146 gene locus_tag LOCUS_06340 2628 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 3143 3745 gene locus_tag LOCUS_06350 gene pyrE 3143 3745 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868222.1 protein_id gnl|my_center|LOCUS_06350 3786 5117 gene locus_tag LOCUS_06360 gene purD 3786 5117 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061056.1 protein_id gnl|my_center|LOCUS_06360 5119 5898 gene locus_tag LOCUS_06370 5119 5898 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879698.1 protein_id gnl|my_center|LOCUS_06370 <7403 5900 gene locus_tag LOCUS_06380 <7403 5900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250640.1:S8 family serine peptidase >Feature sequence053 1221 481 gene locus_tag LOCUS_06390 gene fabG 1221 481 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_06390 1286 1870 gene locus_tag LOCUS_06400 1286 1870 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867981.1 protein_id gnl|my_center|LOCUS_06400 3424 1958 gene locus_tag LOCUS_06410 gene cysS 3424 1958 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249399.1 protein_id gnl|my_center|LOCUS_06410 3506 4024 gene locus_tag LOCUS_06420 3506 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 4126 6951 gene locus_tag LOCUS_06430 4126 6951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 >Feature sequence054 857 477 gene locus_tag LOCUS_06440 857 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 1639 854 gene locus_tag LOCUS_06450 1639 854 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060996.1 protein_id gnl|my_center|LOCUS_06450 2160 1648 gene locus_tag LOCUS_06460 2160 1648 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876850.1 protein_id gnl|my_center|LOCUS_06460 2247 2768 gene locus_tag LOCUS_06470 2247 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 2809 3246 gene locus_tag LOCUS_06480 2809 3246 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980447.1 protein_id gnl|my_center|LOCUS_06480 3251 4429 gene locus_tag LOCUS_06490 gene coaBC 3251 4429 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867837.1 protein_id gnl|my_center|LOCUS_06490 4431 5300 gene locus_tag LOCUS_06500 4431 5300 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066198.1 protein_id gnl|my_center|LOCUS_06500 5886 5290 gene locus_tag LOCUS_06510 5886 5290 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867340.1 protein_id gnl|my_center|LOCUS_06510 6539 5883 gene locus_tag LOCUS_06520 6539 5883 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250408.1 protein_id gnl|my_center|LOCUS_06520 >Feature sequence055 526 1287 gene locus_tag LOCUS_06530 gene mtnP 526 1287 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583293.1 protein_id gnl|my_center|LOCUS_06530 1284 1706 gene locus_tag LOCUS_06540 1284 1706 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877206.1 protein_id gnl|my_center|LOCUS_06540 1703 2113 gene locus_tag LOCUS_06550 1703 2113 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583024.1 protein_id gnl|my_center|LOCUS_06550 4094 2115 gene locus_tag LOCUS_06560 gene acs 4094 2115 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319494.1 protein_id gnl|my_center|LOCUS_06560 5012 4197 gene locus_tag LOCUS_06570 gene nadC 5012 4197 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867134.1 protein_id gnl|my_center|LOCUS_06570 6074 5139 gene locus_tag LOCUS_06580 6074 5139 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_06580 >Feature sequence056 1541 27 gene locus_tag LOCUS_06590 1541 27 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020229.1 protein_id gnl|my_center|LOCUS_06590 2082 1525 gene locus_tag LOCUS_06600 2082 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 4210 2159 gene locus_tag LOCUS_06610 4210 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 4410 5048 gene locus_tag LOCUS_06620 4410 5048 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583839.1 protein_id gnl|my_center|LOCUS_06620 6009 5038 gene locus_tag LOCUS_06630 6009 5038 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393452.1 protein_id gnl|my_center|LOCUS_06630 6905 6006 gene locus_tag LOCUS_06640 6905 6006 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250918.1 protein_id gnl|my_center|LOCUS_06640 >Feature sequence057 1433 216 gene locus_tag LOCUS_06650 1433 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 2296 1430 gene locus_tag LOCUS_06660 2296 1430 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763736.1 protein_id gnl|my_center|LOCUS_06660 2442 2735 gene locus_tag LOCUS_06670 gene albA 2442 2735 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249515.1 protein_id gnl|my_center|LOCUS_06670 3494 2796 gene locus_tag LOCUS_06680 gene mptE 3494 2796 CDS product 6-hydroxymethyl-7,8-dihydropterin pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871158.1 protein_id gnl|my_center|LOCUS_06680 4600 3491 gene locus_tag LOCUS_06690 4600 3491 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879550.1 protein_id gnl|my_center|LOCUS_06690 5553 4642 gene locus_tag LOCUS_06700 5553 4642 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496485.1 protein_id gnl|my_center|LOCUS_06700 >Feature sequence058 556 855 gene locus_tag LOCUS_06710 556 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 1036 2562 gene locus_tag LOCUS_06720 1036 2562 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144207.1 protein_id gnl|my_center|LOCUS_06720 3245 2559 gene locus_tag LOCUS_06730 3245 2559 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064741.1 protein_id gnl|my_center|LOCUS_06730 3875 3255 gene locus_tag LOCUS_06740 3875 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 5227 3878 gene locus_tag LOCUS_06750 5227 3878 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582949.1 protein_id gnl|my_center|LOCUS_06750 6376 5261 gene locus_tag LOCUS_06760 6376 5261 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868272.1 protein_id gnl|my_center|LOCUS_06760 >Feature sequence059 515 1864 gene locus_tag LOCUS_06770 515 1864 CDS product RuvB-like helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867485.1 protein_id gnl|my_center|LOCUS_06770 2432 1866 gene locus_tag LOCUS_06780 2432 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 2516 3559 gene locus_tag LOCUS_06790 2516 3559 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978258.1 protein_id gnl|my_center|LOCUS_06790 4264 3545 gene locus_tag LOCUS_06800 4264 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 4346 6760 gene locus_tag LOCUS_06810 4346 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 >Feature sequence060 784 2097 gene locus_tag LOCUS_06820 784 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 2090 3529 gene locus_tag LOCUS_06830 gene gcvPB 2090 3529 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868896.1 protein_id gnl|my_center|LOCUS_06830 4964 3534 gene locus_tag LOCUS_06840 4964 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 6340 4982 gene locus_tag LOCUS_06850 6340 4982 CDS product acyl-protein synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112567.1 protein_id gnl|my_center|LOCUS_06850 6624 6427 gene locus_tag LOCUS_06860 6624 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 >Feature sequence061 108 659 gene locus_tag LOCUS_06870 108 659 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879493.1 protein_id gnl|my_center|LOCUS_06870 643 1278 gene locus_tag LOCUS_06880 643 1278 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020322.1 protein_id gnl|my_center|LOCUS_06880 1286 2566 gene locus_tag LOCUS_06890 gene hflX 1286 2566 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868200.1 protein_id gnl|my_center|LOCUS_06890 3470 2568 gene locus_tag LOCUS_06900 3470 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 3657 3729 gene locus_tag LOCUS_t00250 3657 3729 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3734 3808 gene locus_tag LOCUS_t00260 3734 3808 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3923 4138 gene locus_tag LOCUS_06910 3923 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 4113 4805 gene locus_tag LOCUS_06920 4113 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 5613 4846 gene locus_tag LOCUS_06930 5613 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 5933 5610 gene locus_tag LOCUS_06940 5933 5610 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023310.1 protein_id gnl|my_center|LOCUS_06940 6151 5930 gene locus_tag LOCUS_06950 6151 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 >Feature sequence062 41 745 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgaaatcagactaaggtaggattgaaat 828 1403 gene locus_tag LOCUS_06960 828 1403 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230366.1 protein_id gnl|my_center|LOCUS_06960 2267 1398 gene locus_tag LOCUS_06970 2267 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 2851 2300 gene locus_tag LOCUS_06980 2851 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 3584 2880 gene locus_tag LOCUS_06990 3584 2880 CDS product A24 family peptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020568.1 protein_id gnl|my_center|LOCUS_06990 4215 3718 gene locus_tag LOCUS_07000 4215 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 >Feature sequence063 175 378 gene locus_tag LOCUS_07010 175 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 710 387 gene locus_tag LOCUS_07020 710 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289276.1 protein_id gnl|my_center|LOCUS_07020 851 1216 gene locus_tag LOCUS_07030 851 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 1957 1367 gene locus_tag LOCUS_07040 1957 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249130.1 protein_id gnl|my_center|LOCUS_07040 2693 1950 gene locus_tag LOCUS_07050 2693 1950 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877405.1 protein_id gnl|my_center|LOCUS_07050 5272 2690 gene locus_tag LOCUS_07060 5272 2690 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146858.1 protein_id gnl|my_center|LOCUS_07060 >Feature sequence064 376 1764 gene locus_tag LOCUS_07070 376 1764 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263739.1 protein_id gnl|my_center|LOCUS_07070 2545 1748 gene locus_tag LOCUS_07080 2545 1748 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846195.1 protein_id gnl|my_center|LOCUS_07080 2635 5835 gene locus_tag LOCUS_07090 2635 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 >Feature sequence065 680 1312 gene locus_tag LOCUS_07100 680 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 2818 1403 gene locus_tag LOCUS_07110 2818 1403 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064509.1 protein_id gnl|my_center|LOCUS_07110 4826 2922 gene locus_tag LOCUS_07120 4826 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 5671 4859 gene locus_tag LOCUS_07130 5671 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064842.1 protein_id gnl|my_center|LOCUS_07130 >Feature sequence066 1086 211 gene locus_tag LOCUS_07140 gene amrB 1086 211 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875685.1 protein_id gnl|my_center|LOCUS_07140 1203 1361 gene locus_tag LOCUS_07150 1203 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 1553 1362 gene locus_tag LOCUS_07160 1553 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 2157 1594 gene locus_tag LOCUS_07170 gene hpt 2157 1594 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061024.1 protein_id gnl|my_center|LOCUS_07170 3305 2154 gene locus_tag LOCUS_07180 gene mfnA 3305 2154 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868331.1 protein_id gnl|my_center|LOCUS_07180 3424 3762 gene locus_tag LOCUS_07190 3424 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 3926 4903 gene locus_tag LOCUS_07200 3926 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 4929 6173 gene locus_tag LOCUS_07210 4929 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence067 399 103 gene locus_tag LOCUS_07220 399 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 2529 541 gene locus_tag LOCUS_07230 2529 541 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_07230 3238 2594 gene locus_tag LOCUS_07240 gene pcp 3238 2594 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246307.1 protein_id gnl|my_center|LOCUS_07240 3362 5356 gene locus_tag LOCUS_07250 3362 5356 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250730.1 protein_id gnl|my_center|LOCUS_07250 <6020 5422 gene locus_tag LOCUS_07260 <6020 5422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001039012.1:collagenase ColA >Feature sequence068 255 923 gene locus_tag LOCUS_07270 255 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 916 1737 gene locus_tag LOCUS_07280 916 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 1771 2193 gene locus_tag LOCUS_07290 1771 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902675.1 protein_id gnl|my_center|LOCUS_07290 2204 2647 gene locus_tag LOCUS_07300 2204 2647 CDS product flagellar protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147053.1 protein_id gnl|my_center|LOCUS_07300 2657 3370 gene locus_tag LOCUS_07310 2657 3370 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496652.1 protein_id gnl|my_center|LOCUS_07310 3380 5032 gene locus_tag LOCUS_07320 3380 5032 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496653.1 protein_id gnl|my_center|LOCUS_07320 >Feature sequence069 1621 380 gene locus_tag LOCUS_07330 1621 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 2102 1626 gene locus_tag LOCUS_07340 2102 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 2460 2648 gene locus_tag LOCUS_07350 2460 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 2686 3540 gene locus_tag LOCUS_07360 2686 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 3652 4713 gene locus_tag LOCUS_07370 3652 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 5276 4770 gene locus_tag LOCUS_07380 5276 4770 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583273.1 protein_id gnl|my_center|LOCUS_07380 5697 5278 gene locus_tag LOCUS_07390 5697 5278 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence070 345 971 gene locus_tag LOCUS_07400 345 971 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869660.1 protein_id gnl|my_center|LOCUS_07400 964 2376 gene locus_tag LOCUS_07410 964 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 4252 2384 gene locus_tag LOCUS_07420 4252 2384 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877518.1 protein_id gnl|my_center|LOCUS_07420 4244 4720 gene locus_tag LOCUS_07430 4244 4720 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060740.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence071 479 24 gene locus_tag LOCUS_07440 479 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 1804 686 gene locus_tag LOCUS_07450 1804 686 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763330.1 protein_id gnl|my_center|LOCUS_07450 3092 1860 gene locus_tag LOCUS_07460 3092 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 4028 3120 gene locus_tag LOCUS_07470 4028 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 4446 4039 gene locus_tag LOCUS_07480 gene trxA 4446 4039 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878779.1 protein_id gnl|my_center|LOCUS_07480 4635 4880 gene locus_tag LOCUS_07490 4635 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 >Feature sequence072 53 1033 gene locus_tag LOCUS_07500 53 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 1964 1023 gene locus_tag LOCUS_07510 1964 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 2228 2638 gene locus_tag LOCUS_07520 2228 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 3248 2691 gene locus_tag LOCUS_07530 3248 2691 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881124.1 protein_id gnl|my_center|LOCUS_07530 3282 4184 gene locus_tag LOCUS_07540 gene mvk 3282 4184 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256769.1 protein_id gnl|my_center|LOCUS_07540 4181 5425 gene locus_tag LOCUS_07550 4181 5425 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867967.1 protein_id gnl|my_center|LOCUS_07550 >Feature sequence073 82 864 gene locus_tag LOCUS_07560 82 864 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250740.1 protein_id gnl|my_center|LOCUS_07560 1420 953 gene locus_tag LOCUS_07570 1420 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 3102 1642 gene locus_tag LOCUS_07580 3102 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 >Feature sequence074 1458 1264 gene locus_tag LOCUS_07590 1458 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 3361 2033 gene locus_tag LOCUS_07600 3361 2033 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583645.1 protein_id gnl|my_center|LOCUS_07600 4925 3414 gene locus_tag LOCUS_07610 4925 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 >Feature sequence075 95 1564 gene locus_tag LOCUS_07620 95 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 2421 1561 gene locus_tag LOCUS_07630 2421 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 2580 3233 gene locus_tag LOCUS_07640 2580 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 4765 3230 gene locus_tag LOCUS_07650 gene purH 4765 3230 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244516.1 protein_id gnl|my_center|LOCUS_07650 >Feature sequence076 38 1516 gene locus_tag LOCUS_07660 38 1516 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 protein_id gnl|my_center|LOCUS_07660 1549 2301 gene locus_tag LOCUS_07670 1549 2301 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066594.1 protein_id gnl|my_center|LOCUS_07670 2298 3047 gene locus_tag LOCUS_07680 2298 3047 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867813.1 protein_id gnl|my_center|LOCUS_07680 3062 4369 gene locus_tag LOCUS_07690 gene aspS 3062 4369 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249447.1 protein_id gnl|my_center|LOCUS_07690 4465 4380 gene locus_tag LOCUS_t00270 4465 4380 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4690 4520 gene locus_tag LOCUS_07700 4690 4520 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392923.1 protein_id gnl|my_center|LOCUS_07700 4928 5260 gene locus_tag LOCUS_07710 4928 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 >Feature sequence077 1573 212 gene locus_tag LOCUS_07720 1573 212 CDS product acyl-protein synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112567.1 protein_id gnl|my_center|LOCUS_07720 1821 1749 gene locus_tag LOCUS_t00280 1821 1749 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1869 2363 gene locus_tag LOCUS_07730 1869 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 2360 3397 gene locus_tag LOCUS_07740 gene rtcA 2360 3397 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978549.1 protein_id gnl|my_center|LOCUS_07740 3887 3384 gene locus_tag LOCUS_07750 3887 3384 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021158.1 protein_id gnl|my_center|LOCUS_07750 4004 3929 gene locus_tag LOCUS_t00290 4004 3929 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence078 1048 650 gene locus_tag LOCUS_07760 1048 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 1447 2379 gene locus_tag LOCUS_07770 gene pyrB 1447 2379 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251146.1 protein_id gnl|my_center|LOCUS_07770 2376 2837 gene locus_tag LOCUS_07780 gene pyrI 2376 2837 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060913.1 protein_id gnl|my_center|LOCUS_07780 4497 2830 gene locus_tag LOCUS_07790 4497 2830 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263455.1 protein_id gnl|my_center|LOCUS_07790 >Feature sequence079 118 777 gene locus_tag LOCUS_07800 118 777 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021121.1 protein_id gnl|my_center|LOCUS_07800 779 1243 gene locus_tag LOCUS_07810 gene rpmD 779 1243 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869977.1 protein_id gnl|my_center|LOCUS_07810 1301 1513 gene locus_tag LOCUS_07820 1301 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 1633 1833 gene locus_tag LOCUS_07830 1633 1833 CDS product DNA-directed RNA polymerase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250449.1 protein_id gnl|my_center|LOCUS_07830 1839 2459 gene locus_tag LOCUS_07840 gene rpsB 1839 2459 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250447.1 protein_id gnl|my_center|LOCUS_07840 2443 3189 gene locus_tag LOCUS_07850 2443 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 3727 3173 gene locus_tag LOCUS_07860 3727 3173 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240327.1 protein_id gnl|my_center|LOCUS_07860 4581 3718 gene locus_tag LOCUS_07870 4581 3718 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250915.1 protein_id gnl|my_center|LOCUS_07870 5476 4583 gene locus_tag LOCUS_07880 5476 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 >Feature sequence080 1194 811 gene locus_tag LOCUS_07890 1194 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 4371 1282 gene locus_tag LOCUS_07900 4371 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 4486 4716 gene locus_tag LOCUS_07910 4486 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 <5463 4744 gene locus_tag LOCUS_07920 <5463 4744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545636.1:alpha-glucan family phosphorylase >Feature sequence081 1326 478 gene locus_tag LOCUS_07930 1326 478 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896738.1 protein_id gnl|my_center|LOCUS_07930 2828 1953 gene locus_tag LOCUS_07940 2828 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 2884 3792 gene locus_tag LOCUS_07950 2884 3792 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146595.1 protein_id gnl|my_center|LOCUS_07950 3789 4574 gene locus_tag LOCUS_07960 3789 4574 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870966.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence082 1415 837 gene locus_tag LOCUS_07970 1415 837 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022488.1 protein_id gnl|my_center|LOCUS_07970 1528 2073 gene locus_tag LOCUS_07980 1528 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 2658 2101 gene locus_tag LOCUS_07990 2658 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 4000 2633 gene locus_tag LOCUS_08000 4000 2633 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_08000 5360 4005 gene locus_tag LOCUS_08010 5360 4005 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence083 613 314 gene locus_tag LOCUS_08020 613 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 2624 639 gene locus_tag LOCUS_08030 2624 639 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250730.1 protein_id gnl|my_center|LOCUS_08030 3973 2732 gene locus_tag LOCUS_08040 gene prf1 3973 2732 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870340.1 protein_id gnl|my_center|LOCUS_08040 5228 3990 gene locus_tag LOCUS_08050 5228 3990 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869538.1 protein_id gnl|my_center|LOCUS_08050 >Feature sequence084 1720 107 gene locus_tag LOCUS_08060 gene glgP 1720 107 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584150.1 protein_id gnl|my_center|LOCUS_08060 1939 1852 gene locus_tag LOCUS_t00300 1939 1852 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1985 2179 gene locus_tag LOCUS_08070 1985 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 2318 3385 gene locus_tag LOCUS_08080 2318 3385 CDS product SPOUT family RNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250208.1 protein_id gnl|my_center|LOCUS_08080 4258 3359 gene locus_tag LOCUS_08090 4258 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 4331 5164 gene locus_tag LOCUS_08100 gene purQ 4331 5164 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878755.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence085 108 1466 gene locus_tag LOCUS_08110 gene purB 108 1466 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496668.1 protein_id gnl|my_center|LOCUS_08110 1463 2497 gene locus_tag LOCUS_08120 1463 2497 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846716.1 protein_id gnl|my_center|LOCUS_08120 2673 3203 gene locus_tag LOCUS_08130 2673 3203 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762559.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08130 3207 3755 gene locus_tag LOCUS_08140 3207 3755 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877880.1 protein_id gnl|my_center|LOCUS_08140 <5086 3732 gene locus_tag LOCUS_08150 <5086 3732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868773.1:phosphoenolpyruvate carboxykinase (GTP) >Feature sequence086 1669 3060 gene locus_tag LOCUS_08160 1669 3060 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583648.1 protein_id gnl|my_center|LOCUS_08160 3110 3349 gene locus_tag LOCUS_08170 3110 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 3714 4466 gene locus_tag LOCUS_08180 3714 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08180 4522 4827 gene locus_tag LOCUS_08190 4522 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 >Feature sequence087 701 69 gene locus_tag LOCUS_08200 701 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 1112 702 gene locus_tag LOCUS_08210 1112 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 1840 1139 gene locus_tag LOCUS_08220 1840 1139 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876548.1 protein_id gnl|my_center|LOCUS_08220 2411 1833 gene locus_tag LOCUS_08230 2411 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 2464 3213 gene locus_tag LOCUS_08240 2464 3213 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867275.1 protein_id gnl|my_center|LOCUS_08240 >Feature sequence088 1233 463 gene locus_tag LOCUS_08250 1233 463 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061316.1 protein_id gnl|my_center|LOCUS_08250 1310 1729 gene locus_tag LOCUS_08260 gene rimI 1310 1729 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251164.1 protein_id gnl|my_center|LOCUS_08260 2013 1732 gene locus_tag LOCUS_08270 2013 1732 CDS product UPF0058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024502.1 protein_id gnl|my_center|LOCUS_08270 2481 2080 gene locus_tag LOCUS_08280 2481 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08280 3299 2469 gene locus_tag LOCUS_08290 3299 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08290 >Feature sequence089 685 86 gene locus_tag LOCUS_08300 685 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 963 2891 gene locus_tag LOCUS_08310 963 2891 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021597.1 protein_id gnl|my_center|LOCUS_08310 2893 3984 gene locus_tag LOCUS_08320 2893 3984 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878440.1 protein_id gnl|my_center|LOCUS_08320 4452 3973 gene locus_tag LOCUS_08330 4452 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence090 138 2108 gene locus_tag LOCUS_08340 138 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 2753 2109 gene locus_tag LOCUS_08350 2753 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 2979 3170 gene locus_tag LOCUS_08360 2979 3170 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391770.1 protein_id gnl|my_center|LOCUS_08360 3751 3260 gene locus_tag LOCUS_08370 gene leuD 3751 3260 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583553.1 protein_id gnl|my_center|LOCUS_08370 <4958 3751 gene locus_tag LOCUS_08380 <4958 3751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066440.1:homoaconitase large subunit >Feature sequence091 259 1122 gene locus_tag LOCUS_08390 259 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 1122 1322 gene locus_tag LOCUS_08400 1122 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 1319 1618 gene locus_tag LOCUS_08410 gene yciH 1319 1618 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496503.1 protein_id gnl|my_center|LOCUS_08410 1627 1893 gene locus_tag LOCUS_08420 1627 1893 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869964.1 protein_id gnl|my_center|LOCUS_08420 1899 2246 gene locus_tag LOCUS_08430 1899 2246 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869965.1 protein_id gnl|my_center|LOCUS_08430 2243 2641 gene locus_tag LOCUS_08440 2243 2641 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875655.1 protein_id gnl|my_center|LOCUS_08440 2651 3124 gene locus_tag LOCUS_08450 2651 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 3117 3842 gene locus_tag LOCUS_08460 3117 3842 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875657.1 protein_id gnl|my_center|LOCUS_08460 3832 4344 gene locus_tag LOCUS_08470 3832 4344 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869969.1 protein_id gnl|my_center|LOCUS_08470 4341 4496 gene locus_tag LOCUS_08480 4341 4496 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879404.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence092 <1 1413 gene locus_tag LOCUS_08490 <1 1413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767909.1:aminoacyl-histidine dipeptidase 1509 1823 gene locus_tag LOCUS_08500 1509 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 1913 3124 gene locus_tag LOCUS_08510 1913 3124 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249141.1 protein_id gnl|my_center|LOCUS_08510 <4750 3243 gene locus_tag LOCUS_08520 <4750 3243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878948.1:thermosome subunit beta >Feature sequence093 2668 1373 gene locus_tag LOCUS_08530 2668 1373 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868664.1 protein_id gnl|my_center|LOCUS_08530 4000 2672 gene locus_tag LOCUS_08540 4000 2672 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024460.1 protein_id gnl|my_center|LOCUS_08540 >Feature sequence094 814 359 gene locus_tag LOCUS_08550 814 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 2205 1351 gene locus_tag LOCUS_08560 2205 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 2496 4364 gene locus_tag LOCUS_08570 2496 4364 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868458.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence095 <1 652 gene locus_tag LOCUS_08580 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023880.1:agmatinase 686 2419 gene locus_tag LOCUS_08590 gene argS 686 2419 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877057.1 protein_id gnl|my_center|LOCUS_08590 2419 3195 gene locus_tag LOCUS_08600 2419 3195 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079210.1 protein_id gnl|my_center|LOCUS_08600 3188 4123 gene locus_tag LOCUS_08610 gene twy1 3188 4123 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193384983.1 protein_id gnl|my_center|LOCUS_08610 >Feature sequence096 193 831 gene locus_tag LOCUS_08620 193 831 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061119.1 protein_id gnl|my_center|LOCUS_08620 841 1359 gene locus_tag LOCUS_08630 841 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08630 1417 1686 gene locus_tag LOCUS_08640 1417 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08640 1699 2016 gene locus_tag LOCUS_08650 1699 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 3133 2030 gene locus_tag LOCUS_08660 gene trm14 3133 2030 CDS product tRNA (guanine(6)-N2)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064539.1 protein_id gnl|my_center|LOCUS_08660 <4625 3130 gene locus_tag LOCUS_08670 <4625 3130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879218.1:DNA polymerase II large subunit >Feature sequence097 273 899 gene locus_tag LOCUS_08680 gene psmB 273 899 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876826.1 protein_id gnl|my_center|LOCUS_08680 922 2832 gene locus_tag LOCUS_08690 922 2832 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023770.1 protein_id gnl|my_center|LOCUS_08690 >Feature sequence098 763 59 gene locus_tag LOCUS_08700 763 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 897 1043 gene locus_tag LOCUS_08710 897 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 1101 1973 gene locus_tag LOCUS_08720 1101 1973 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867130.1 protein_id gnl|my_center|LOCUS_08720 2874 1942 gene locus_tag LOCUS_08730 2874 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 2918 3691 gene locus_tag LOCUS_08740 2918 3691 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925142.1 protein_id gnl|my_center|LOCUS_08740 >Feature sequence099 879 130 gene locus_tag LOCUS_08750 879 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868476.1 protein_id gnl|my_center|LOCUS_08750 2963 876 gene locus_tag LOCUS_08760 2963 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 3527 2967 gene locus_tag LOCUS_08770 gene thpR 3527 2967 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876222.1 protein_id gnl|my_center|LOCUS_08770 <4408 3557 gene locus_tag LOCUS_08780 <4408 3557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249027.1:aldehyde ferredoxin oxidoreductase family protein >Feature sequence100 1576 395 gene locus_tag LOCUS_08790 1576 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08790 3242 1974 gene locus_tag LOCUS_08800 3242 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 3478 3239 gene locus_tag LOCUS_08810 3478 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 4397 3552 gene locus_tag LOCUS_08820 4397 3552 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880716.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence101 444 806 gene locus_tag LOCUS_08830 444 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 803 1477 gene locus_tag LOCUS_08840 803 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 1479 2591 gene locus_tag LOCUS_08850 1479 2591 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250252.1 protein_id gnl|my_center|LOCUS_08850 3457 2585 gene locus_tag LOCUS_08860 3457 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 >Feature sequence102 2236 1163 gene locus_tag LOCUS_08870 gene gap 2236 1163 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880662.1 protein_id gnl|my_center|LOCUS_08870 3523 2273 gene locus_tag LOCUS_08880 3523 2273 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251014.1 protein_id gnl|my_center|LOCUS_08880 4221 3520 gene locus_tag LOCUS_08890 4221 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08890 >Feature sequence103 1326 1126 gene locus_tag LOCUS_08900 1326 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 1946 1350 gene locus_tag LOCUS_08910 gene udg 1946 1350 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147255.1 protein_id gnl|my_center|LOCUS_08910 2376 1996 gene locus_tag LOCUS_08920 2376 1996 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104928.1 protein_id gnl|my_center|LOCUS_08920 2522 3163 gene locus_tag LOCUS_08930 2522 3163 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016533.1 protein_id gnl|my_center|LOCUS_08930 3602 3156 gene locus_tag LOCUS_08940 gene lrpA 3602 3156 CDS product HTH-type transcriptional regulator LrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251084.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence104 588 4 gene locus_tag LOCUS_08950 588 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 2038 794 gene locus_tag LOCUS_08960 2038 794 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750457.1 protein_id gnl|my_center|LOCUS_08960 2699 2163 gene locus_tag LOCUS_08970 2699 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 3721 2699 gene locus_tag LOCUS_08980 gene fen 3721 2699 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250232.1 protein_id gnl|my_center|LOCUS_08980 >Feature sequence105 45 2858 gene locus_tag LOCUS_08990 45 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 <4268 2848 gene locus_tag LOCUS_09000 <4268 2848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879433.1:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence106 1003 344 gene locus_tag LOCUS_09010 1003 344 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496578.1 protein_id gnl|my_center|LOCUS_09010 1650 973 gene locus_tag LOCUS_09020 gene thyX 1650 973 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583167.1 protein_id gnl|my_center|LOCUS_09020 3246 1726 gene locus_tag LOCUS_09030 3246 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 3722 3249 gene locus_tag LOCUS_09040 3722 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 >Feature sequence107 491 291 gene locus_tag LOCUS_09050 491 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 1372 491 gene locus_tag LOCUS_09060 1372 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 1821 1372 gene locus_tag LOCUS_09070 gene rplV 1821 1372 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064485.1 protein_id gnl|my_center|LOCUS_09070 2271 1828 gene locus_tag LOCUS_09080 gene rpsS 2271 1828 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867460.1 protein_id gnl|my_center|LOCUS_09080 2982 2278 gene locus_tag LOCUS_09090 2982 2278 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875647.1 protein_id gnl|my_center|LOCUS_09090 3261 2995 gene locus_tag LOCUS_09100 3261 2995 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867462.1 protein_id gnl|my_center|LOCUS_09100 4027 3263 gene locus_tag LOCUS_09110 gene rpl4p 4027 3263 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869672.1 protein_id gnl|my_center|LOCUS_09110 >Feature sequence108 <1 631 gene locus_tag LOCUS_09120 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878032.1:proteasome assembly chaperone family protein 3417 628 gene locus_tag LOCUS_09130 3417 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 3613 3538 gene locus_tag LOCUS_t00310 3613 3538 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence109 594 1046 gene locus_tag LOCUS_09140 594 1046 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023392.1 protein_id gnl|my_center|LOCUS_09140 2076 1132 gene locus_tag LOCUS_09150 2076 1132 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867984.1 protein_id gnl|my_center|LOCUS_09150 2669 2073 gene locus_tag LOCUS_09160 2669 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 3304 2666 gene locus_tag LOCUS_09170 3304 2666 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024284.1 protein_id gnl|my_center|LOCUS_09170 3882 3301 gene locus_tag LOCUS_09180 gene udg 3882 3301 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053779.1 protein_id gnl|my_center|LOCUS_09180 >Feature sequence110 1115 228 gene locus_tag LOCUS_09190 1115 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 2095 1286 gene locus_tag LOCUS_09200 2095 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 3014 2097 gene locus_tag LOCUS_09210 3014 2097 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250976.1 protein_id gnl|my_center|LOCUS_09210 3114 3830 gene locus_tag LOCUS_09220 3114 3830 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360272.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence111 950 1606 gene locus_tag LOCUS_09230 950 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 2634 2329 gene locus_tag LOCUS_09240 2634 2329 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878730.1 protein_id gnl|my_center|LOCUS_09240 3031 2612 gene locus_tag LOCUS_09250 gene nudF 3031 2612 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870660.1 protein_id gnl|my_center|LOCUS_09250 <4105 3208 gene locus_tag LOCUS_09260 <4105 3208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014128488.1:isocitrate/isopropylmalate family dehydrogenase >Feature sequence112 442 1449 gene locus_tag LOCUS_09270 gene amrS 442 1449 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_09270 1868 1461 gene locus_tag LOCUS_09280 gene rlmH 1868 1461 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027000.1 protein_id gnl|my_center|LOCUS_09280 1918 2562 gene locus_tag LOCUS_09290 gene rnhB 1918 2562 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249756.1 protein_id gnl|my_center|LOCUS_09290 2958 2563 gene locus_tag LOCUS_09300 2958 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 3248 2955 gene locus_tag LOCUS_09310 3248 2955 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867625.1 protein_id gnl|my_center|LOCUS_09310 <4062 3245 gene locus_tag LOCUS_09320 <4062 3245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064444.1:NADP-dependent malic enzyme >Feature sequence113 994 140 gene locus_tag LOCUS_09330 994 140 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023435.1 protein_id gnl|my_center|LOCUS_09330 1208 2197 gene locus_tag LOCUS_09340 1208 2197 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066146.1 protein_id gnl|my_center|LOCUS_09340 2201 2965 gene locus_tag LOCUS_09350 2201 2965 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022096.1 protein_id gnl|my_center|LOCUS_09350 3777 2971 gene locus_tag LOCUS_09360 3777 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence114 1398 388 gene locus_tag LOCUS_09370 1398 388 CDS product TIGR01177 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876363.1 protein_id gnl|my_center|LOCUS_09370 1914 1402 gene locus_tag LOCUS_09380 1914 1402 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249834.1 protein_id gnl|my_center|LOCUS_09380 2597 1956 gene locus_tag LOCUS_09390 gene hypB 2597 1956 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869941.1 protein_id gnl|my_center|LOCUS_09390 2988 2590 gene locus_tag LOCUS_09400 2988 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 3079 3426 gene locus_tag LOCUS_09410 3079 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 3431 3739 gene locus_tag LOCUS_09420 3431 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence115 109 1089 gene locus_tag LOCUS_09430 gene mtnA 109 1089 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869953.1 protein_id gnl|my_center|LOCUS_09430 2964 1081 gene locus_tag LOCUS_09440 2964 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 <3905 3006 gene locus_tag LOCUS_09450 <3905 3006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013683176.1:DNA topoisomerase I >Feature sequence116 195 1685 gene locus_tag LOCUS_09460 195 1685 CDS product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870207.1 protein_id gnl|my_center|LOCUS_09460 >Feature sequence117 72 2021 gene locus_tag LOCUS_09470 72 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 >Feature sequence118 <1 2183 gene locus_tag LOCUS_09480 <1 2183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870988.1:PIP-CTERM sorting domain-containing protein 2781 3191 gene locus_tag LOCUS_09490 2781 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 >Feature sequence119 <1 1437 gene locus_tag LOCUS_09500 <1 1437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941704.1:MASE3 domain-containing protein 1540 1466 gene locus_tag LOCUS_t00320 1540 1466 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1797 1573 gene locus_tag LOCUS_09510 1797 1573 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867658.1 protein_id gnl|my_center|LOCUS_09510 2205 1804 gene locus_tag LOCUS_09520 2205 1804 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064334.1 protein_id gnl|my_center|LOCUS_09520 2615 2202 gene locus_tag LOCUS_09530 gene rplM 2615 2202 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878624.1 protein_id gnl|my_center|LOCUS_09530 2987 2622 gene locus_tag LOCUS_09540 2987 2622 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875679.1 protein_id gnl|my_center|LOCUS_09540 3087 3611 gene locus_tag LOCUS_09550 3087 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 >Feature sequence120 108 959 gene locus_tag LOCUS_09560 gene artA 108 959 CDS product archaeosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879538.1 protein_id gnl|my_center|LOCUS_09560 932 1600 gene locus_tag LOCUS_09570 932 1600 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879537.1 protein_id gnl|my_center|LOCUS_09570 1593 2240 gene locus_tag LOCUS_09580 1593 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 3272 2244 gene locus_tag LOCUS_09590 gene idsA 3272 2244 CDS product short chain isoprenyl diphosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875690.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence121 106 1437 gene locus_tag LOCUS_09600 106 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 >Feature sequence122 2009 1242 gene locus_tag LOCUS_09610 2009 1242 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_09610 2264 2506 gene locus_tag LOCUS_09620 2264 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence123 546 142 gene locus_tag LOCUS_09630 546 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 800 2017 gene locus_tag LOCUS_09640 800 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 2067 3383 gene locus_tag LOCUS_09650 gene thiC 2067 3383 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870539.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence124 911 60 gene locus_tag LOCUS_09660 gene thiI 911 60 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877292.1 protein_id gnl|my_center|LOCUS_09660 2740 1178 gene locus_tag LOCUS_09670 2740 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 >Feature sequence125 754 1884 gene locus_tag LOCUS_09680 gene ftsZ 754 1884 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024152.1 protein_id gnl|my_center|LOCUS_09680 2104 2535 gene locus_tag LOCUS_09690 2104 2535 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876681.1 protein_id gnl|my_center|LOCUS_09690 2538 3131 gene locus_tag LOCUS_09700 gene rpsG 2538 3131 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879386.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence126 1307 627 gene locus_tag LOCUS_09710 1307 627 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319832.1 protein_id gnl|my_center|LOCUS_09710 1609 1304 gene locus_tag LOCUS_09720 1609 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1587 2558 gene locus_tag LOCUS_09730 1587 2558 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867947.1 protein_id gnl|my_center|LOCUS_09730 2813 2565 gene locus_tag LOCUS_09740 2813 2565 CDS product DUF504 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876898.1 protein_id gnl|my_center|LOCUS_09740 >Feature sequence127 <1 632 gene locus_tag LOCUS_09750 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496444.1:pyruvate synthase subunit PorB 674 2023 gene locus_tag LOCUS_09760 674 2023 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064974.1 protein_id gnl|my_center|LOCUS_09760 3111 1999 gene locus_tag LOCUS_09770 3111 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 >Feature sequence128 312 1271 gene locus_tag LOCUS_09780 312 1271 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783220.1 protein_id gnl|my_center|LOCUS_09780 1300 1659 gene locus_tag LOCUS_09790 1300 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1656 2780 gene locus_tag LOCUS_09800 1656 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 >Feature sequence129 <1 1830 gene locus_tag LOCUS_09810 <1 1830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545423.1:DNA gyrase subunit A 2193 1897 gene locus_tag LOCUS_09820 2193 1897 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868393.1 protein_id gnl|my_center|LOCUS_09820 2605 2159 gene locus_tag LOCUS_09830 2605 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012940349.1 protein_id gnl|my_center|LOCUS_09830 >Feature sequence130 810 268 gene locus_tag LOCUS_09840 810 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 861 1892 gene locus_tag LOCUS_09850 861 1892 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877642.1 protein_id gnl|my_center|LOCUS_09850 <3093 1894 gene locus_tag LOCUS_09860 <3093 1894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056610.1:phosphoenolpyruvate synthase >Feature sequence131 1 636 gene locus_tag LOCUS_09870 1 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 >Feature sequence132 584 282 gene locus_tag LOCUS_09880 584 282 CDS product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250247.1 protein_id gnl|my_center|LOCUS_09880 2134 656 gene locus_tag LOCUS_09890 2134 656 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250791.1 protein_id gnl|my_center|LOCUS_09890 2221 2469 gene locus_tag LOCUS_09900 2221 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 2879 2953 gene locus_tag LOCUS_t00330 2879 2953 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence133 263 901 gene locus_tag LOCUS_09910 263 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 981 1667 gene locus_tag LOCUS_09920 981 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 2150 1716 gene locus_tag LOCUS_09930 2150 1716 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249295.1 protein_id gnl|my_center|LOCUS_09930 2599 2147 gene locus_tag LOCUS_09940 2599 2147 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022582.1 protein_id gnl|my_center|LOCUS_09940 2845 2773 gene locus_tag LOCUS_t00340 2845 2773 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence134 >Feature sequence135 510 1883 gene locus_tag LOCUS_09950 510 1883 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391671.1 protein_id gnl|my_center|LOCUS_09950 2536 1970 gene locus_tag LOCUS_09960 gene satP 2536 1970 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528527.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence136 323 814 gene locus_tag LOCUS_09970 323 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 821 1699 gene locus_tag LOCUS_09980 821 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 1696 2100 gene locus_tag LOCUS_09990 1696 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 >Feature sequence137 <1 1788 gene locus_tag LOCUS_10000 <1 1788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249705.1:tRNA(Met) cytidine acetyltransferase TmcA 1718 2038 gene locus_tag LOCUS_10010 1718 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 >Feature sequence138 <1 761 gene locus_tag LOCUS_10020 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250526.1:TrkA C-terminal domain-containing protein 1093 758 gene locus_tag LOCUS_10030 1093 758 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250923.1 protein_id gnl|my_center|LOCUS_10030 1134 2615 gene locus_tag LOCUS_10040 1134 2615 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147190.1 protein_id gnl|my_center|LOCUS_10040 >Feature sequence139 <1 527 gene locus_tag LOCUS_10050 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582729.1:radical SAM protein 696 1112 gene locus_tag LOCUS_10060 696 1112 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 protein_id gnl|my_center|LOCUS_10060 1259 1801 gene locus_tag LOCUS_10070 1259 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1842 2396 gene locus_tag LOCUS_10080 1842 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence140 114 2126 gene locus_tag LOCUS_10090 gene ligA 114 2126 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082648.1 protein_id gnl|my_center|LOCUS_10090 >Feature sequence141 161 1402 gene locus_tag LOCUS_10100 161 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1532 2233 gene locus_tag LOCUS_10110 1532 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 >Feature sequence142 >Feature sequence143 132 1070 gene locus_tag LOCUS_10120 132 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 1207 1452 gene locus_tag LOCUS_10130 1207 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence144 1294 695 gene locus_tag LOCUS_10140 1294 695 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868780.1 protein_id gnl|my_center|LOCUS_10140 1350 2219 gene locus_tag LOCUS_10150 gene speB 1350 2219 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023880.1 protein_id gnl|my_center|LOCUS_10150 >Feature sequence145 513 7 gene locus_tag LOCUS_10160 513 7 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875664.1 protein_id gnl|my_center|LOCUS_10160 971 510 gene locus_tag LOCUS_10170 971 510 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546237.1 protein_id gnl|my_center|LOCUS_10170 1762 968 gene locus_tag LOCUS_10180 1762 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 2314 1766 gene locus_tag LOCUS_10190 2314 1766 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869972.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence146 201 1199 gene locus_tag LOCUS_10200 gene pdxS 201 1199 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878015.1 protein_id gnl|my_center|LOCUS_10200 1193 1777 gene locus_tag LOCUS_10210 gene pdxT 1193 1777 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249171.1 protein_id gnl|my_center|LOCUS_10210 2106 1807 gene locus_tag LOCUS_10220 2106 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 2352 2119 gene locus_tag LOCUS_10230 2352 2119 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878901.1 protein_id gnl|my_center|LOCUS_10230