>Feature sequence001 501 1013 gene locus_tag LOCUS_00010 501 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 998 1525 gene locus_tag LOCUS_00020 998 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1522 1809 gene locus_tag LOCUS_00030 1522 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 1820 2242 gene locus_tag LOCUS_00040 gene ssb 1820 2242 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815182.1 protein_id gnl|my_center|LOCUS_00040 2251 2940 gene locus_tag LOCUS_00050 2251 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 2870 3649 gene locus_tag LOCUS_00060 2870 3649 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986775.1 protein_id gnl|my_center|LOCUS_00060 3183 3192 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3646 4014 gene locus_tag LOCUS_00070 3646 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 4047 4256 gene locus_tag LOCUS_00080 4047 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 4259 4459 gene locus_tag LOCUS_00090 4259 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 4478 4972 gene locus_tag LOCUS_00100 4478 4972 CDS product phage N-6-adenine-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047611.1 protein_id gnl|my_center|LOCUS_00100 5044 6144 gene locus_tag LOCUS_00110 5044 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 6128 6601 gene locus_tag LOCUS_00120 6128 6601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 6669 7214 gene locus_tag LOCUS_00130 6669 7214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 7226 7654 gene locus_tag LOCUS_00140 7226 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 7698 8072 gene locus_tag LOCUS_00150 7698 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 8089 8286 gene locus_tag LOCUS_00160 8089 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 8287 8475 gene locus_tag LOCUS_00170 8287 8475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 8472 9041 gene locus_tag LOCUS_00180 8472 9041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 9034 9429 gene locus_tag LOCUS_00190 9034 9429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 9416 9715 gene locus_tag LOCUS_00200 9416 9715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 9732 10058 gene locus_tag LOCUS_00210 9732 10058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 10206 10406 gene locus_tag LOCUS_00220 10206 10406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 10517 11050 gene locus_tag LOCUS_00230 10517 11050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 10992 12392 gene locus_tag LOCUS_00240 10992 12392 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_00240 12405 14393 gene locus_tag LOCUS_00250 12405 14393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 14390 14683 gene locus_tag LOCUS_00260 14390 14683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 14851 15795 gene locus_tag LOCUS_00270 14851 15795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 15828 16823 gene locus_tag LOCUS_00280 15828 16823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 16846 17133 gene locus_tag LOCUS_00290 16846 17133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 17238 18743 gene locus_tag LOCUS_00300 17238 18743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 18743 20578 gene locus_tag LOCUS_00310 18743 20578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 20582 21883 gene locus_tag LOCUS_00320 20582 21883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 21888 22214 gene locus_tag LOCUS_00330 21888 22214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 22211 22417 gene locus_tag LOCUS_00340 22211 22417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 22410 23216 gene locus_tag LOCUS_00350 22410 23216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 23231 23551 gene locus_tag LOCUS_00360 23231 23551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 23548 23853 gene locus_tag LOCUS_00370 23548 23853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 23867 25090 gene locus_tag LOCUS_00380 23867 25090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 25101 25319 gene locus_tag LOCUS_00390 25101 25319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 25312 25497 gene locus_tag LOCUS_00400 25312 25497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 25494 27101 gene locus_tag LOCUS_00410 25494 27101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 27115 29298 gene locus_tag LOCUS_00420 27115 29298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 >Feature sequence002 373 38 gene locus_tag LOCUS_00430 373 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 1262 396 gene locus_tag LOCUS_00440 gene rapZ 1262 396 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_00440 2164 1250 gene locus_tag LOCUS_00450 gene murB 2164 1250 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_00450 3475 2261 gene locus_tag LOCUS_00460 3475 2261 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788259.1 protein_id gnl|my_center|LOCUS_00460 5877 3784 gene locus_tag LOCUS_00470 5877 3784 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_00470 6203 5946 gene locus_tag LOCUS_00480 6203 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 6896 7060 gene locus_tag LOCUS_00490 gene rpmG 6896 7060 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_00490 7102 7455 gene locus_tag LOCUS_00500 7102 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 7468 7989 gene locus_tag LOCUS_00510 gene nusG 7468 7989 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_00510 8055 8480 gene locus_tag LOCUS_00520 gene rplK 8055 8480 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_00520 8503 9195 gene locus_tag LOCUS_00530 gene rplA 8503 9195 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_00530 9440 9982 gene locus_tag LOCUS_00540 gene rplJ 9440 9982 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235042.1 protein_id gnl|my_center|LOCUS_00540 10029 10403 gene locus_tag LOCUS_00550 10029 10403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 10683 11408 gene locus_tag LOCUS_00560 gene rpsB 10683 11408 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_00560 11494 12408 gene locus_tag LOCUS_00570 gene tsf 11494 12408 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384678.1 protein_id gnl|my_center|LOCUS_00570 12616 13575 gene locus_tag LOCUS_00580 12616 13575 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392351.1 protein_id gnl|my_center|LOCUS_00580 13572 14204 gene locus_tag LOCUS_00590 13572 14204 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942088.1 protein_id gnl|my_center|LOCUS_00590 14978 14139 gene locus_tag LOCUS_00600 14978 14139 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 protein_id gnl|my_center|LOCUS_00600 15057 15638 gene locus_tag LOCUS_00610 15057 15638 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172636477.1 protein_id gnl|my_center|LOCUS_00610 15635 16288 gene locus_tag LOCUS_00620 15635 16288 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_00620 18875 16389 gene locus_tag LOCUS_00630 gene pcrA 18875 16389 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163769.1 protein_id gnl|my_center|LOCUS_00630 20173 19049 gene locus_tag LOCUS_00640 20173 19049 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393701.1 protein_id gnl|my_center|LOCUS_00640 20299 20308 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21048 20572 gene locus_tag LOCUS_00650 gene ispF 21048 20572 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_00650 21763 21026 gene locus_tag LOCUS_00660 gene ispD 21763 21026 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942744.1 protein_id gnl|my_center|LOCUS_00660 23885 21900 gene locus_tag LOCUS_00670 23885 21900 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811135.1 protein_id gnl|my_center|LOCUS_00670 24504 23875 gene locus_tag LOCUS_00680 24504 23875 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 protein_id gnl|my_center|LOCUS_00680 25181 24501 gene locus_tag LOCUS_00690 gene cmk 25181 24501 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460204.1 protein_id gnl|my_center|LOCUS_00690 26383 25178 gene locus_tag LOCUS_00700 26383 25178 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_00700 >Feature sequence003 2775 2257 gene locus_tag LOCUS_00710 2775 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 3339 2788 gene locus_tag LOCUS_00720 gene coaD 3339 2788 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388467.1 protein_id gnl|my_center|LOCUS_00720 3916 3371 gene locus_tag LOCUS_00730 gene rsmD 3916 3371 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460510.1 protein_id gnl|my_center|LOCUS_00730 5751 3919 gene locus_tag LOCUS_00740 gene uvrC 5751 3919 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048309.1 protein_id gnl|my_center|LOCUS_00740 6094 5831 gene locus_tag LOCUS_00750 6094 5831 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_00750 6427 7245 gene locus_tag LOCUS_00760 gene truB 6427 7245 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_00760 7246 8205 gene locus_tag LOCUS_00770 7246 8205 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438310.1 protein_id gnl|my_center|LOCUS_00770 8202 8450 gene locus_tag LOCUS_00780 8202 8450 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939908.1 protein_id gnl|my_center|LOCUS_00780 9934 8732 gene locus_tag LOCUS_00790 gene tuf 9934 8732 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_00790 12138 10036 gene locus_tag LOCUS_00800 gene fusA 12138 10036 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_00800 12624 12154 gene locus_tag LOCUS_00810 gene rpsG 12624 12154 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393941.1 protein_id gnl|my_center|LOCUS_00810 13213 12791 gene locus_tag LOCUS_00820 gene rpsL 13213 12791 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142340.1 protein_id gnl|my_center|LOCUS_00820 13575 13321 gene locus_tag LOCUS_00830 13575 13321 CDS product 50S ribosomal protein L7Ae-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393943.1 protein_id gnl|my_center|LOCUS_00830 13750 13923 gene locus_tag LOCUS_00840 13750 13923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 14104 13916 gene locus_tag LOCUS_00850 14104 13916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 14018 14194 gene locus_tag LOCUS_00860 14018 14194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 14771 14301 gene locus_tag LOCUS_00870 14771 14301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 15168 15428 gene locus_tag LOCUS_00880 15168 15428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 19111 15584 gene locus_tag LOCUS_00890 gene nifJ 19111 15584 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965527.1 protein_id gnl|my_center|LOCUS_00890 19406 20923 gene locus_tag LOCUS_00900 19406 20923 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_00900 21553 21305 gene locus_tag LOCUS_00910 21553 21305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 >Feature sequence004 1576 128 gene locus_tag LOCUS_00920 1576 128 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863284.1 protein_id gnl|my_center|LOCUS_00920 1977 1579 gene locus_tag LOCUS_00930 1977 1579 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393960.1 protein_id gnl|my_center|LOCUS_00930 3082 2054 gene locus_tag LOCUS_00940 3082 2054 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_00940 3938 3231 gene locus_tag LOCUS_00950 3938 3231 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541081.1 protein_id gnl|my_center|LOCUS_00950 6195 3982 gene locus_tag LOCUS_00960 6195 3982 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966138.1 protein_id gnl|my_center|LOCUS_00960 8584 6617 gene locus_tag LOCUS_00970 8584 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 10656 8581 gene locus_tag LOCUS_00980 10656 8581 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_00980 11055 11300 gene locus_tag LOCUS_00990 11055 11300 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868899.1 protein_id gnl|my_center|LOCUS_00990 11297 12361 gene locus_tag LOCUS_01000 gene hydE 11297 12361 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048412.1 protein_id gnl|my_center|LOCUS_01000 12362 13780 gene locus_tag LOCUS_01010 gene hydG 12362 13780 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203501.1 protein_id gnl|my_center|LOCUS_01010 13806 15005 gene locus_tag LOCUS_01020 gene hydF 13806 15005 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392791.1 protein_id gnl|my_center|LOCUS_01020 15310 15924 gene locus_tag LOCUS_01030 gene plsY 15310 15924 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614129.1 protein_id gnl|my_center|LOCUS_01030 15912 17039 gene locus_tag LOCUS_01040 15912 17039 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_01040 17640 17275 gene locus_tag LOCUS_01050 17640 17275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 17981 17679 gene locus_tag LOCUS_01060 17981 17679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 >Feature sequence005 183 1361 gene locus_tag LOCUS_01070 183 1361 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109323.1 protein_id gnl|my_center|LOCUS_01070 1523 2029 gene locus_tag LOCUS_01080 1523 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 2233 2448 gene locus_tag LOCUS_01090 2233 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 2616 3017 gene locus_tag LOCUS_01100 2616 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 3696 2992 gene locus_tag LOCUS_01110 3696 2992 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068399.1 protein_id gnl|my_center|LOCUS_01110 4177 6285 gene locus_tag LOCUS_01120 4177 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 6694 6368 gene locus_tag LOCUS_01130 gene hisE 6694 6368 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721355.1 protein_id gnl|my_center|LOCUS_01130 7030 6698 gene locus_tag LOCUS_01140 gene hisI 7030 6698 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646591.1 protein_id gnl|my_center|LOCUS_01140 7782 7027 gene locus_tag LOCUS_01150 gene hisF 7782 7027 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_01150 8517 7795 gene locus_tag LOCUS_01160 gene hisA 8517 7795 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949114.1 protein_id gnl|my_center|LOCUS_01160 9122 8514 gene locus_tag LOCUS_01170 gene hisH 9122 8514 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949113.1 protein_id gnl|my_center|LOCUS_01170 9702 9124 gene locus_tag LOCUS_01180 gene hisB 9702 9124 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837141.1 protein_id gnl|my_center|LOCUS_01180 10988 9702 gene locus_tag LOCUS_01190 gene hisD 10988 9702 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964255.1 protein_id gnl|my_center|LOCUS_01190 12594 10981 gene locus_tag LOCUS_01200 12594 10981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 13232 12633 gene locus_tag LOCUS_01210 gene yihA 13232 12633 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045119.1 protein_id gnl|my_center|LOCUS_01210 15647 13245 gene locus_tag LOCUS_01220 gene lon 15647 13245 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_01220 16170 15766 gene locus_tag LOCUS_01230 16170 15766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01230 17023 16100 gene locus_tag LOCUS_01240 17023 16100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01240 16173 16182 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence006 213 312 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2133 1477 gene locus_tag LOCUS_01250 2133 1477 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897858.1 protein_id gnl|my_center|LOCUS_01250 2798 2133 gene locus_tag LOCUS_01260 2798 2133 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902988.1 protein_id gnl|my_center|LOCUS_01260 4129 2870 gene locus_tag LOCUS_01270 4129 2870 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527150.1 protein_id gnl|my_center|LOCUS_01270 5274 4456 gene locus_tag LOCUS_01280 5274 4456 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_01280 6234 5302 gene locus_tag LOCUS_01290 6234 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 7685 6186 gene locus_tag LOCUS_01300 7685 6186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 8293 7682 gene locus_tag LOCUS_01310 8293 7682 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_01310 8740 8303 gene locus_tag LOCUS_01320 gene dtd 8740 8303 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368967.1 protein_id gnl|my_center|LOCUS_01320 9807 8737 gene locus_tag LOCUS_01330 gene alr 9807 8737 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462255.1 protein_id gnl|my_center|LOCUS_01330 9992 10067 gene locus_tag LOCUS_t00010 9992 10067 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11430 10225 gene locus_tag LOCUS_01340 11430 10225 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392932.1 protein_id gnl|my_center|LOCUS_01340 12313 11516 gene locus_tag LOCUS_01350 12313 11516 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021222.1 protein_id gnl|my_center|LOCUS_01350 13353 12310 gene locus_tag LOCUS_01360 13353 12310 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021223.1 protein_id gnl|my_center|LOCUS_01360 >Feature sequence007 646 479 gene locus_tag LOCUS_01370 646 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 1109 648 gene locus_tag LOCUS_01380 gene mscL 1109 648 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338438.1 protein_id gnl|my_center|LOCUS_01380 1434 1111 gene locus_tag LOCUS_01390 1434 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 2758 1460 gene locus_tag LOCUS_01400 gene serS 2758 1460 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_01400 3389 2817 gene locus_tag LOCUS_01410 3389 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 4275 3394 gene locus_tag LOCUS_01420 4275 3394 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_01420 5126 4368 gene locus_tag LOCUS_01430 5126 4368 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_01430 6204 5344 gene locus_tag LOCUS_01440 gene noc 6204 5344 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226829.1 protein_id gnl|my_center|LOCUS_01440 7414 6398 gene locus_tag LOCUS_01450 7414 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01450 8324 7296 gene locus_tag LOCUS_01460 8324 7296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01460 7566 7575 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8976 8425 gene locus_tag LOCUS_01470 gene hpt 8976 8425 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_01470 10336 8960 gene locus_tag LOCUS_01480 gene tilS 10336 8960 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_01480 11694 10333 gene locus_tag LOCUS_01490 gene dnaB 11694 10333 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_01490 12179 11733 gene locus_tag LOCUS_01500 gene rplI 12179 11733 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_01500 14181 12196 gene locus_tag LOCUS_01510 14181 12196 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397329.1 protein_id gnl|my_center|LOCUS_01510 >Feature sequence008 <1 1057 gene locus_tag LOCUS_01520 <1 1057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010906069.1:substrate-binding domain-containing protein 1130 1282 gene locus_tag LOCUS_01530 1130 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 1279 2487 gene locus_tag LOCUS_01540 1279 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 2681 3661 gene locus_tag LOCUS_01550 2681 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 3658 5160 gene locus_tag LOCUS_01560 3658 5160 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582804.1 protein_id gnl|my_center|LOCUS_01560 5157 6185 gene locus_tag LOCUS_01570 5157 6185 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082910121.1 protein_id gnl|my_center|LOCUS_01570 7732 6290 gene locus_tag LOCUS_01580 7732 6290 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_01580 8450 7740 gene locus_tag LOCUS_01590 8450 7740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 10401 8806 gene locus_tag LOCUS_01600 10401 8806 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_01600 11880 10456 gene locus_tag LOCUS_01610 11880 10456 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016772.1 protein_id gnl|my_center|LOCUS_01610 12025 12855 gene locus_tag LOCUS_01620 12025 12855 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_01620 12871 13347 gene locus_tag LOCUS_01630 12871 13347 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797943.1 protein_id gnl|my_center|LOCUS_01630 13864 13298 gene locus_tag LOCUS_01640 13864 13298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 13990 15048 gene locus_tag LOCUS_01650 gene pyrB 13990 15048 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965942.1 protein_id gnl|my_center|LOCUS_01650 >Feature sequence009 1087 398 gene locus_tag LOCUS_01660 gene vanR 1087 398 CDS product vancomycin resistance response regulator transcriptoin factor VanR-G-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436401.1 protein_id gnl|my_center|LOCUS_01660 1987 1196 gene locus_tag LOCUS_01670 1987 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 2342 2007 gene locus_tag LOCUS_01680 2342 2007 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773743.1 protein_id gnl|my_center|LOCUS_01680 4645 2348 gene locus_tag LOCUS_01690 4645 2348 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462063.1 protein_id gnl|my_center|LOCUS_01690 5135 6445 gene locus_tag LOCUS_01700 5135 6445 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016800.1 protein_id gnl|my_center|LOCUS_01700 6587 6663 gene locus_tag LOCUS_t00020 6587 6663 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6765 7148 gene locus_tag LOCUS_01710 6765 7148 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668289.1 protein_id gnl|my_center|LOCUS_01710 7339 8406 gene locus_tag LOCUS_01720 7339 8406 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_01720 8938 8495 gene locus_tag LOCUS_01730 8938 8495 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_01730 10413 9136 gene locus_tag LOCUS_01740 gene obgE 10413 9136 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_01740 10761 10474 gene locus_tag LOCUS_01750 gene rpmA 10761 10474 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357774.1 protein_id gnl|my_center|LOCUS_01750 11109 10765 gene locus_tag LOCUS_01760 11109 10765 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973720.1 protein_id gnl|my_center|LOCUS_01760 11424 11113 gene locus_tag LOCUS_01770 gene rplU 11424 11113 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392094.1 protein_id gnl|my_center|LOCUS_01770 12023 11751 gene locus_tag LOCUS_01780 12023 11751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 12214 12438 gene locus_tag LOCUS_01790 12214 12438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 12602 13447 gene locus_tag LOCUS_01800 12602 13447 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728712.1 protein_id gnl|my_center|LOCUS_01800 13768 14820 gene locus_tag LOCUS_01810 13768 14820 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_01810 14844 15053 gene locus_tag LOCUS_01820 14844 15053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 >Feature sequence010 436 1152 gene locus_tag LOCUS_01830 436 1152 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380521.1 protein_id gnl|my_center|LOCUS_01830 1166 2221 gene locus_tag LOCUS_01840 1166 2221 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383751.1 protein_id gnl|my_center|LOCUS_01840 2362 3732 gene locus_tag LOCUS_01850 2362 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 4678 3740 gene locus_tag LOCUS_01860 gene prmA 4678 3740 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816472.1 protein_id gnl|my_center|LOCUS_01860 5555 4683 gene locus_tag LOCUS_01870 5555 4683 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_01870 5674 6438 gene locus_tag LOCUS_01880 5674 6438 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407737.1 protein_id gnl|my_center|LOCUS_01880 6546 7484 gene locus_tag LOCUS_01890 gene miaA 6546 7484 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_01890 7561 7794 gene locus_tag LOCUS_01900 gene hfq 7561 7794 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965139.1 protein_id gnl|my_center|LOCUS_01900 7842 9116 gene locus_tag LOCUS_01910 7842 9116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 9113 9823 gene locus_tag LOCUS_01920 9113 9823 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_01920 9851 10315 gene locus_tag LOCUS_01930 9851 10315 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965419.1 protein_id gnl|my_center|LOCUS_01930 10331 11095 gene locus_tag LOCUS_01940 10331 11095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 11130 12017 gene locus_tag LOCUS_01950 11130 12017 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_01950 12423 12088 gene locus_tag LOCUS_01960 12423 12088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 12425 13051 gene locus_tag LOCUS_01970 12425 13051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 13739 13122 gene locus_tag LOCUS_01980 13739 13122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 >Feature sequence011 <1 1153 gene locus_tag LOCUS_01990 <1 1153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272494.1:molybdopterin molybdotransferase MoeA 1167 2117 gene locus_tag LOCUS_02000 gene moaA 1167 2117 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943757.1 protein_id gnl|my_center|LOCUS_02000 2119 3087 gene locus_tag LOCUS_02010 2119 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 3080 3586 gene locus_tag LOCUS_02020 3080 3586 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_02020 3598 3993 gene locus_tag LOCUS_02030 3598 3993 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807790.1 protein_id gnl|my_center|LOCUS_02030 4000 4704 gene locus_tag LOCUS_02040 4000 4704 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945134.1 protein_id gnl|my_center|LOCUS_02040 4722 5168 gene locus_tag LOCUS_02050 4722 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 6241 5165 gene locus_tag LOCUS_02060 6241 5165 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989529.1 protein_id gnl|my_center|LOCUS_02060 6316 6777 gene locus_tag LOCUS_02070 6316 6777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 7453 8412 gene locus_tag LOCUS_02080 7453 8412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 10099 8639 gene locus_tag LOCUS_02090 10099 8639 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837625.1 protein_id gnl|my_center|LOCUS_02090 10521 10141 gene locus_tag LOCUS_02100 10521 10141 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949091.1 protein_id gnl|my_center|LOCUS_02100 10739 11914 gene locus_tag LOCUS_02110 10739 11914 CDS product NAD-dependent malic enzyme 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199012.1 protein_id gnl|my_center|LOCUS_02110 >Feature sequence012 1634 591 gene locus_tag LOCUS_02120 1634 591 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624176.1 protein_id gnl|my_center|LOCUS_02120 3614 1770 gene locus_tag LOCUS_02130 3614 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 3677 4168 gene locus_tag LOCUS_02140 3677 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 5039 4218 gene locus_tag LOCUS_02150 5039 4218 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_02150 5786 5058 gene locus_tag LOCUS_02160 5786 5058 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_02160 6836 5844 gene locus_tag LOCUS_02170 6836 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 7010 8332 gene locus_tag LOCUS_02180 gene murC 7010 8332 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_02180 8422 9546 gene locus_tag LOCUS_02190 8422 9546 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053675.1 protein_id gnl|my_center|LOCUS_02190 10565 9576 gene locus_tag LOCUS_02200 10565 9576 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919500.1 protein_id gnl|my_center|LOCUS_02200 10774 11238 gene locus_tag LOCUS_02210 10774 11238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 11354 12100 gene locus_tag LOCUS_02220 gene fabG 11354 12100 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_02220 >Feature sequence013 265 1419 gene locus_tag LOCUS_02230 gene csaB 265 1419 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391759.1 protein_id gnl|my_center|LOCUS_02230 1416 2489 gene locus_tag LOCUS_02240 1416 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 2538 3047 gene locus_tag LOCUS_02250 gene purE 2538 3047 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393549.1 protein_id gnl|my_center|LOCUS_02250 3044 4093 gene locus_tag LOCUS_02260 gene purM 3044 4093 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_02260 4090 4737 gene locus_tag LOCUS_02270 gene purN 4090 4737 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_02270 4734 5447 gene locus_tag LOCUS_02280 4734 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 5453 6622 gene locus_tag LOCUS_02290 5453 6622 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_02290 6644 7900 gene locus_tag LOCUS_02300 gene purD 6644 7900 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_02300 8036 8902 gene locus_tag LOCUS_02310 8036 8902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 8922 9104 gene locus_tag LOCUS_02320 8922 9104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 9353 10126 gene locus_tag LOCUS_02330 9353 10126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 10173 11573 gene locus_tag LOCUS_02340 10173 11573 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310640.1 protein_id gnl|my_center|LOCUS_02340 >Feature sequence014 364 1314 gene locus_tag LOCUS_02350 364 1314 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_02350 1370 2152 gene locus_tag LOCUS_02360 1370 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 2169 2711 gene locus_tag LOCUS_02370 2169 2711 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002785057.1 protein_id gnl|my_center|LOCUS_02370 2708 4162 gene locus_tag LOCUS_02380 2708 4162 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949007.1 protein_id gnl|my_center|LOCUS_02380 5427 4369 gene locus_tag LOCUS_02390 5427 4369 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205352220.1 protein_id gnl|my_center|LOCUS_02390 5997 5455 gene locus_tag LOCUS_02400 5997 5455 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_02400 6069 6497 gene locus_tag LOCUS_02410 6069 6497 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963997.1 protein_id gnl|my_center|LOCUS_02410 7072 7410 gene locus_tag LOCUS_02420 7072 7410 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878703.1 protein_id gnl|my_center|LOCUS_02420 7447 8232 gene locus_tag LOCUS_02430 7447 8232 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878702.1 protein_id gnl|my_center|LOCUS_02430 8488 8976 gene locus_tag LOCUS_02440 8488 8976 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355429.1 protein_id gnl|my_center|LOCUS_02440 8973 9671 gene locus_tag LOCUS_02450 8973 9671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 9675 10457 gene locus_tag LOCUS_02460 9675 10457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 <11582 10424 gene locus_tag LOCUS_02470 <11582 10424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009891654.1:MATE family efflux transporter >Feature sequence015 962 1720 gene locus_tag LOCUS_02480 962 1720 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393842.1 protein_id gnl|my_center|LOCUS_02480 1695 2363 gene locus_tag LOCUS_02490 1695 2363 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812008.1 protein_id gnl|my_center|LOCUS_02490 2365 2907 gene locus_tag LOCUS_02500 2365 2907 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_02500 2888 3448 gene locus_tag LOCUS_02510 2888 3448 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_02510 3470 4666 gene locus_tag LOCUS_02520 gene mltG 3470 4666 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944665.1 protein_id gnl|my_center|LOCUS_02520 4656 5867 gene locus_tag LOCUS_02530 4656 5867 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_02530 5884 6405 gene locus_tag LOCUS_02540 5884 6405 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060742.1 protein_id gnl|my_center|LOCUS_02540 6859 7707 gene locus_tag LOCUS_02550 6859 7707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 7822 9672 gene locus_tag LOCUS_02560 7822 9672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 9789 11195 gene locus_tag LOCUS_02570 gene pepV 9789 11195 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459801.1 protein_id gnl|my_center|LOCUS_02570 >Feature sequence016 <1 1050 gene locus_tag LOCUS_02580 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454642.1:toxic anion resistance protein 1100 2086 gene locus_tag LOCUS_02590 1100 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 2034 3125 gene locus_tag LOCUS_02600 2034 3125 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965937.1 protein_id gnl|my_center|LOCUS_02600 3180 4676 gene locus_tag LOCUS_02610 gene glpK 3180 4676 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_02610 4921 6282 gene locus_tag LOCUS_02620 gene mnmE 4921 6282 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258674.1 protein_id gnl|my_center|LOCUS_02620 6786 7292 gene locus_tag LOCUS_02630 6786 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 7608 7387 gene locus_tag LOCUS_02640 7608 7387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 8550 7765 gene locus_tag LOCUS_02650 8550 7765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 8668 8501 gene locus_tag LOCUS_02660 8668 8501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 9642 8746 gene locus_tag LOCUS_02670 gene era 9642 8746 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_02670 10138 9635 gene locus_tag LOCUS_02680 gene ybeY 10138 9635 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964605.1 protein_id gnl|my_center|LOCUS_02680 <11151 10153 gene locus_tag LOCUS_02690 <11151 10153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861553.1:PhoH family protein >Feature sequence017 1531 332 gene locus_tag LOCUS_02700 1531 332 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814514.1 protein_id gnl|my_center|LOCUS_02700 2202 1528 gene locus_tag LOCUS_02710 2202 1528 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_02710 2411 3106 gene locus_tag LOCUS_02720 2411 3106 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_02720 3124 4929 gene locus_tag LOCUS_02730 3124 4929 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256471.1 protein_id gnl|my_center|LOCUS_02730 5009 5134 gene locus_tag LOCUS_02740 5009 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 5277 6008 gene locus_tag LOCUS_02750 5277 6008 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836504.1 protein_id gnl|my_center|LOCUS_02750 5281 5290 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5989 6411 gene locus_tag LOCUS_02760 5989 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 7055 6462 gene locus_tag LOCUS_02770 7055 6462 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_02770 7837 7070 gene locus_tag LOCUS_02780 7837 7070 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853290.1 protein_id gnl|my_center|LOCUS_02780 8571 7834 gene locus_tag LOCUS_02790 8571 7834 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853332.1 protein_id gnl|my_center|LOCUS_02790 8958 8578 gene locus_tag LOCUS_02800 8958 8578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 10021 9083 gene locus_tag LOCUS_02810 10021 9083 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027305.1 protein_id gnl|my_center|LOCUS_02810 10896 10174 gene locus_tag LOCUS_02820 10896 10174 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853259.1 protein_id gnl|my_center|LOCUS_02820 >Feature sequence018 1594 101 gene locus_tag LOCUS_02830 gene cobA 1594 101 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_02830 2487 1591 gene locus_tag LOCUS_02840 gene hemC 2487 1591 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039609.1 protein_id gnl|my_center|LOCUS_02840 2942 2484 gene locus_tag LOCUS_02850 2942 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 4152 2896 gene locus_tag LOCUS_02860 gene hemA 4152 2896 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392764.1 protein_id gnl|my_center|LOCUS_02860 4949 4185 gene locus_tag LOCUS_02870 4949 4185 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898260.1 protein_id gnl|my_center|LOCUS_02870 5464 5640 gene locus_tag LOCUS_02880 5464 5640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 5637 5816 gene locus_tag LOCUS_02890 5637 5816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 5839 8493 gene locus_tag LOCUS_02900 5839 8493 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_02900 8809 8884 gene locus_tag LOCUS_t00030 8809 8884 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 <11024 9000 gene locus_tag LOCUS_02910 <11024 9000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990688.1:leucine-rich repeat protein >Feature sequence019 <1 1394 gene locus_tag LOCUS_02920 <1 1394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392918.1:nucleoside recognition domain-containing protein 2721 1480 gene locus_tag LOCUS_02930 2721 1480 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775268.1 protein_id gnl|my_center|LOCUS_02930 6095 3093 gene locus_tag LOCUS_02940 6095 3093 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054447.1 protein_id gnl|my_center|LOCUS_02940 6648 6202 gene locus_tag LOCUS_02950 6648 6202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02950 6776 7216 gene locus_tag LOCUS_02960 6776 7216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 7314 8477 gene locus_tag LOCUS_02970 7314 8477 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460576.1 protein_id gnl|my_center|LOCUS_02970 8492 8929 gene locus_tag LOCUS_02980 8492 8929 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765511.1 protein_id gnl|my_center|LOCUS_02980 8966 9814 gene locus_tag LOCUS_02990 8966 9814 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289273.1 protein_id gnl|my_center|LOCUS_02990 9838 10530 gene locus_tag LOCUS_03000 9838 10530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 >Feature sequence020 1263 577 gene locus_tag LOCUS_03010 gene phoP 1263 577 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229442.1 protein_id gnl|my_center|LOCUS_03010 1905 1384 gene locus_tag LOCUS_03020 1905 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 3219 1921 gene locus_tag LOCUS_03030 3219 1921 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_03030 4375 3311 gene locus_tag LOCUS_03040 4375 3311 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724273.1 protein_id gnl|my_center|LOCUS_03040 5172 4687 gene locus_tag LOCUS_03050 5172 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03050 5817 5188 gene locus_tag LOCUS_03060 5817 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03060 7212 5833 gene locus_tag LOCUS_03070 7212 5833 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305385.1 protein_id gnl|my_center|LOCUS_03070 8131 7235 gene locus_tag LOCUS_03080 gene ftsX 8131 7235 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564193.1 protein_id gnl|my_center|LOCUS_03080 8807 8118 gene locus_tag LOCUS_03090 gene ftsE 8807 8118 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_03090 10192 9125 gene locus_tag LOCUS_03100 10192 9125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 >Feature sequence021 760 92 gene locus_tag LOCUS_03110 760 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 1273 1920 gene locus_tag LOCUS_03120 gene rpe 1273 1920 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480039.1 protein_id gnl|my_center|LOCUS_03120 1923 2525 gene locus_tag LOCUS_03130 gene recR 1923 2525 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963454.1 protein_id gnl|my_center|LOCUS_03130 2539 3453 gene locus_tag LOCUS_03140 2539 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 3450 4280 gene locus_tag LOCUS_03150 3450 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 4313 4582 gene locus_tag LOCUS_03160 4313 4582 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671306.1 protein_id gnl|my_center|LOCUS_03160 4584 4919 gene locus_tag LOCUS_03170 4584 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 4925 5287 gene locus_tag LOCUS_03180 4925 5287 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807902.1 protein_id gnl|my_center|LOCUS_03180 5405 5623 gene locus_tag LOCUS_03190 5405 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 5604 5972 gene locus_tag LOCUS_03200 5604 5972 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682305.1 protein_id gnl|my_center|LOCUS_03200 6049 6810 gene locus_tag LOCUS_03210 6049 6810 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461363.1 protein_id gnl|my_center|LOCUS_03210 8336 6909 gene locus_tag LOCUS_03220 8336 6909 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262041.1 protein_id gnl|my_center|LOCUS_03220 9764 8856 gene locus_tag LOCUS_03230 9764 8856 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547143.1 protein_id gnl|my_center|LOCUS_03230 >Feature sequence022 1627 248 gene locus_tag LOCUS_03240 1627 248 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263484.1 protein_id gnl|my_center|LOCUS_03240 997 1006 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2058 1804 gene locus_tag LOCUS_03250 gene spoIIID 2058 1804 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356559.1 protein_id gnl|my_center|LOCUS_03250 2896 2372 gene locus_tag LOCUS_03260 gene pgsA 2896 2372 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869392.1 protein_id gnl|my_center|LOCUS_03260 4219 2900 gene locus_tag LOCUS_03270 gene rimO 4219 2900 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_03270 4869 4216 gene locus_tag LOCUS_03280 4869 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 5981 4866 gene locus_tag LOCUS_03290 gene recA 5981 4866 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_03290 6857 6000 gene locus_tag LOCUS_03300 gene prmC 6857 6000 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_03300 7856 6885 gene locus_tag LOCUS_03310 7856 6885 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947980.1 protein_id gnl|my_center|LOCUS_03310 9338 7896 gene locus_tag LOCUS_03320 9338 7896 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948133.1 protein_id gnl|my_center|LOCUS_03320 >Feature sequence023 <1 1106 gene locus_tag LOCUS_03330 <1 1106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029239.1:aspartate--tRNA ligase 1445 2932 gene locus_tag LOCUS_03340 1445 2932 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811628.1 protein_id gnl|my_center|LOCUS_03340 3344 3432 gene locus_tag LOCUS_t00040 3344 3432 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3566 4183 gene locus_tag LOCUS_03350 3566 4183 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048153.1 protein_id gnl|my_center|LOCUS_03350 4929 4480 gene locus_tag LOCUS_03360 gene rnhA 4929 4480 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933276.1 protein_id gnl|my_center|LOCUS_03360 7469 4926 gene locus_tag LOCUS_03370 gene gyrA 7469 4926 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_03370 9427 7484 gene locus_tag LOCUS_03380 gene gyrB 9427 7484 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815132.1 protein_id gnl|my_center|LOCUS_03380 >Feature sequence024 3437 2838 gene locus_tag LOCUS_03390 gene pth 3437 2838 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_03390 4779 3817 gene locus_tag LOCUS_03400 4779 3817 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359343.1 protein_id gnl|my_center|LOCUS_03400 5043 5429 gene locus_tag LOCUS_03410 5043 5429 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687513.1 protein_id gnl|my_center|LOCUS_03410 5426 6328 gene locus_tag LOCUS_03420 5426 6328 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_03420 6303 8306 gene locus_tag LOCUS_03430 6303 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 >Feature sequence025 427 1557 gene locus_tag LOCUS_03440 427 1557 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_03440 1554 2432 gene locus_tag LOCUS_03450 1554 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 2429 3898 gene locus_tag LOCUS_03460 2429 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 3895 5352 gene locus_tag LOCUS_03470 3895 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 5638 6393 gene locus_tag LOCUS_03480 5638 6393 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861670.1 protein_id gnl|my_center|LOCUS_03480 9161 6534 gene locus_tag LOCUS_03490 gene ppdK 9161 6534 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_03490 >Feature sequence026 40 576 gene locus_tag LOCUS_03500 40 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 415 424 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 586 1938 gene locus_tag LOCUS_03510 586 1938 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_03510 1991 2500 gene locus_tag LOCUS_03520 gene cobO 1991 2500 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867207.1 protein_id gnl|my_center|LOCUS_03520 2514 3698 gene locus_tag LOCUS_03530 2514 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 3717 5240 gene locus_tag LOCUS_03540 3717 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 6722 5385 gene locus_tag LOCUS_03550 gene rpoD 6722 5385 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_03550 7153 6719 gene locus_tag LOCUS_03560 7153 6719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 8418 7150 gene locus_tag LOCUS_03570 8418 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 7196 7205 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <9396 8494 gene locus_tag LOCUS_03580 <9396 8494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392159.1:deoxyguanosinetriphosphate triphosphohydrolase >Feature sequence027 1377 1943 gene locus_tag LOCUS_03590 gene thiT 1377 1943 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966211.1 protein_id gnl|my_center|LOCUS_03590 1984 2814 gene locus_tag LOCUS_03600 1984 2814 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966224.1 protein_id gnl|my_center|LOCUS_03600 4161 2905 gene locus_tag LOCUS_03610 gene ugpC 4161 2905 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_03610 4706 4392 gene locus_tag LOCUS_03620 4706 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03620 5307 4741 gene locus_tag LOCUS_03630 5307 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03630 6275 5394 gene locus_tag LOCUS_03640 6275 5394 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192120.1 protein_id gnl|my_center|LOCUS_03640 7172 6288 gene locus_tag LOCUS_03650 7172 6288 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003052879.1 protein_id gnl|my_center|LOCUS_03650 8833 7445 gene locus_tag LOCUS_03660 8833 7445 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672105.1 protein_id gnl|my_center|LOCUS_03660 >Feature sequence028 1629 4 gene locus_tag LOCUS_03670 gene argS 1629 4 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462258.1 protein_id gnl|my_center|LOCUS_03670 2076 1633 gene locus_tag LOCUS_03680 2076 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 2969 2154 gene locus_tag LOCUS_03690 gene murI 2969 2154 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_03690 3263 4306 gene locus_tag LOCUS_03700 3263 4306 CDS product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861386.1 protein_id gnl|my_center|LOCUS_03700 4303 5709 gene locus_tag LOCUS_03710 gene eutA 4303 5709 CDS product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861388.1 protein_id gnl|my_center|LOCUS_03710 5781 7085 gene locus_tag LOCUS_03720 5781 7085 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861389.1 protein_id gnl|my_center|LOCUS_03720 7099 8046 gene locus_tag LOCUS_03730 gene eutC 7099 8046 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897052.1 protein_id gnl|my_center|LOCUS_03730 8043 8696 gene locus_tag LOCUS_03740 gene eutL 8043 8696 CDS product ethanolamine utilization microcompartment protein EutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111023.1 protein_id gnl|my_center|LOCUS_03740 >Feature sequence029 1148 45 gene locus_tag LOCUS_03750 1148 45 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062822309.1 protein_id gnl|my_center|LOCUS_03750 1449 1201 gene locus_tag LOCUS_03760 1449 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 2285 1446 gene locus_tag LOCUS_03770 gene pgeF 2285 1446 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940760.1 protein_id gnl|my_center|LOCUS_03770 5048 2289 gene locus_tag LOCUS_03780 gene secA 5048 2289 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_03780 5326 7395 gene locus_tag LOCUS_03790 5326 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 >Feature sequence030 348 473 gene locus_tag LOCUS_03800 348 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 507 1565 gene locus_tag LOCUS_03810 507 1565 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_03810 1581 1970 gene locus_tag LOCUS_03820 1581 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 1988 2488 gene locus_tag LOCUS_03830 1988 2488 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399375.1 protein_id gnl|my_center|LOCUS_03830 5109 2578 gene locus_tag LOCUS_03840 gene clpB 5109 2578 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143566.1 protein_id gnl|my_center|LOCUS_03840 5916 5254 gene locus_tag LOCUS_03850 5916 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 7124 5952 gene locus_tag LOCUS_03860 7124 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 7870 7121 gene locus_tag LOCUS_03870 gene truA 7870 7121 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048349.1 protein_id gnl|my_center|LOCUS_03870 8727 7921 gene locus_tag LOCUS_03880 8727 7921 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_03880 9093 8728 gene locus_tag LOCUS_03890 9093 8728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 >Feature sequence031 1757 600 gene locus_tag LOCUS_03900 1757 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 3036 1741 gene locus_tag LOCUS_03910 3036 1741 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705138.1 protein_id gnl|my_center|LOCUS_03910 3494 4972 gene locus_tag LOCUS_03920 3494 4972 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_03920 4989 5588 gene locus_tag LOCUS_03930 4989 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 5612 6748 gene locus_tag LOCUS_03940 gene alr 5612 6748 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_03940 7036 7111 gene locus_tag LOCUS_t00050 7036 7111 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7779 7375 gene locus_tag LOCUS_03950 7779 7375 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680115.1 protein_id gnl|my_center|LOCUS_03950 8002 7808 gene locus_tag LOCUS_03960 8002 7808 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674407.1 protein_id gnl|my_center|LOCUS_03960 >Feature sequence032 1685 1299 gene locus_tag LOCUS_03970 1685 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 1914 1669 gene locus_tag LOCUS_03980 1914 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 2174 1911 gene locus_tag LOCUS_03990 2174 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 3937 2441 gene locus_tag LOCUS_04000 gene lysS 3937 2441 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861998.1 protein_id gnl|my_center|LOCUS_04000 4428 3955 gene locus_tag LOCUS_04010 gene greA 4428 3955 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_04010 4776 6086 gene locus_tag LOCUS_04020 4776 6086 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068784.1 protein_id gnl|my_center|LOCUS_04020 6708 5998 gene locus_tag LOCUS_04030 6708 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 6821 8092 gene locus_tag LOCUS_04040 6821 8092 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068784.1 protein_id gnl|my_center|LOCUS_04040 <8949 8188 gene locus_tag LOCUS_04050 <8949 8188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_080510924.1:ATP-binding protein >Feature sequence033 <1 763 gene locus_tag LOCUS_04060 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877336.1:phosphate ABC transporter permease PstA note possible pseudo, frameshifted 516 525 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 723 866 gene locus_tag LOCUS_04070 723 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 863 1618 gene locus_tag LOCUS_04080 gene pstB 863 1618 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536449.1 protein_id gnl|my_center|LOCUS_04080 1936 2463 gene locus_tag LOCUS_04090 gene infC 1936 2463 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973215.1 protein_id gnl|my_center|LOCUS_04090 2478 2681 gene locus_tag LOCUS_04100 gene rpmI 2478 2681 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545453.1 protein_id gnl|my_center|LOCUS_04100 2725 3081 gene locus_tag LOCUS_04110 gene rplT 2725 3081 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028296.1 protein_id gnl|my_center|LOCUS_04110 3145 4098 gene locus_tag LOCUS_04120 3145 4098 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938705.1 protein_id gnl|my_center|LOCUS_04120 4879 4211 gene locus_tag LOCUS_04130 4879 4211 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016025.1 protein_id gnl|my_center|LOCUS_04130 5926 5255 gene locus_tag LOCUS_04140 5926 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 6389 6015 gene locus_tag LOCUS_04150 6389 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 6552 6352 gene locus_tag LOCUS_04160 6552 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 7921 6638 gene locus_tag LOCUS_04170 gene hemL 7921 6638 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095641.1 protein_id gnl|my_center|LOCUS_04170 <8829 7921 gene locus_tag LOCUS_04180 <8829 7921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392760.1:porphobilinogen synthase >Feature sequence034 2071 1022 gene locus_tag LOCUS_04190 2071 1022 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_04190 3163 2189 gene locus_tag LOCUS_04200 gene pta 3163 2189 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067221.1 protein_id gnl|my_center|LOCUS_04200 3367 4269 gene locus_tag LOCUS_04210 gene gpr 3367 4269 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430954.1 protein_id gnl|my_center|LOCUS_04210 4512 5828 gene locus_tag LOCUS_04220 gene dnaA 4512 5828 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_04220 6039 7154 gene locus_tag LOCUS_04230 gene dnaN 6039 7154 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_04230 7156 7377 gene locus_tag LOCUS_04240 gene yaaA 7156 7377 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963332.1 protein_id gnl|my_center|LOCUS_04240 7368 8477 gene locus_tag LOCUS_04250 gene recF 7368 8477 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028050.1 protein_id gnl|my_center|LOCUS_04250 >Feature sequence035 384 13 gene locus_tag LOCUS_04260 384 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 644 354 gene locus_tag LOCUS_04270 gene remA 644 354 CDS product extracellular matrix/biofilm regulator RemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154355.1 protein_id gnl|my_center|LOCUS_04270 1561 674 gene locus_tag LOCUS_04280 1561 674 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_04280 2074 1577 gene locus_tag LOCUS_04290 2074 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963966.1 protein_id gnl|my_center|LOCUS_04290 2712 2104 gene locus_tag LOCUS_04300 2712 2104 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_04300 3152 2709 gene locus_tag LOCUS_04310 3152 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 3591 3160 gene locus_tag LOCUS_04320 3591 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04320 3196 3205 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4007 3576 gene locus_tag LOCUS_04330 4007 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 5287 4019 gene locus_tag LOCUS_04340 5287 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 6167 5268 gene locus_tag LOCUS_04350 gene cdaA 6167 5268 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420697.1 protein_id gnl|my_center|LOCUS_04350 6430 7686 gene locus_tag LOCUS_04360 6430 7686 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263449.1 protein_id gnl|my_center|LOCUS_04360 >Feature sequence036 124 273 gene locus_tag LOCUS_04370 124 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 1163 396 gene locus_tag LOCUS_04380 1163 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 3074 1185 gene locus_tag LOCUS_04390 3074 1185 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945027.1 protein_id gnl|my_center|LOCUS_04390 3967 3086 gene locus_tag LOCUS_04400 3967 3086 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460731.1 protein_id gnl|my_center|LOCUS_04400 5111 3945 gene locus_tag LOCUS_04410 5111 3945 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760696.1 protein_id gnl|my_center|LOCUS_04410 5327 6013 gene locus_tag LOCUS_04420 5327 6013 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948592.1 protein_id gnl|my_center|LOCUS_04420 6052 6717 gene locus_tag LOCUS_04430 gene deoC 6052 6717 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453154.1 protein_id gnl|my_center|LOCUS_04430 6714 7043 gene locus_tag LOCUS_04440 6714 7043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04440 7059 7676 gene locus_tag LOCUS_04450 7059 7676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04450 >Feature sequence037 5377 2075 gene locus_tag LOCUS_04460 gene addB 5377 2075 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948191.1 protein_id gnl|my_center|LOCUS_04460 7177 5702 gene locus_tag LOCUS_04470 gene guaB 7177 5702 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226803.1 protein_id gnl|my_center|LOCUS_04470 7799 7197 gene locus_tag LOCUS_04480 7799 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 8343 7807 gene locus_tag LOCUS_04490 8343 7807 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940892.1 protein_id gnl|my_center|LOCUS_04490 >Feature sequence038 910 59 gene locus_tag LOCUS_04500 gene rsmA 910 59 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651552.1 protein_id gnl|my_center|LOCUS_04500 1708 3078 gene locus_tag LOCUS_04510 gene murD 1708 3078 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_04510 3079 4119 gene locus_tag LOCUS_04520 3079 4119 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459800.1 protein_id gnl|my_center|LOCUS_04520 4116 5156 gene locus_tag LOCUS_04530 4116 5156 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_04530 5170 6168 gene locus_tag LOCUS_04540 5170 6168 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249732.1 protein_id gnl|my_center|LOCUS_04540 6168 7406 gene locus_tag LOCUS_04550 6168 7406 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_04550 7497 8087 gene locus_tag LOCUS_04560 gene yunB 7497 8087 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393210.1 protein_id gnl|my_center|LOCUS_04560 >Feature sequence039 2048 1314 gene locus_tag LOCUS_04570 2048 1314 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_04570 3268 2045 gene locus_tag LOCUS_04580 3268 2045 CDS product D-aspartate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294441.1 protein_id gnl|my_center|LOCUS_04580 3658 3733 gene locus_tag LOCUS_t00060 3658 3733 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4526 3846 gene locus_tag LOCUS_04590 4526 3846 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913203.1 protein_id gnl|my_center|LOCUS_04590 4774 6156 gene locus_tag LOCUS_04600 4774 6156 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 protein_id gnl|my_center|LOCUS_04600 6300 7505 gene locus_tag LOCUS_04610 6300 7505 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_04610 >Feature sequence040 1255 335 gene locus_tag LOCUS_04620 1255 335 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929426.1 protein_id gnl|my_center|LOCUS_04620 2128 1358 gene locus_tag LOCUS_04630 2128 1358 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814594.1 protein_id gnl|my_center|LOCUS_04630 2796 2125 gene locus_tag LOCUS_04640 2796 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 3311 2778 gene locus_tag LOCUS_04650 3311 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04650 4091 3342 gene locus_tag LOCUS_04660 4091 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04660 4427 5074 gene locus_tag LOCUS_04670 4427 5074 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168857.1 protein_id gnl|my_center|LOCUS_04670 5087 5620 gene locus_tag LOCUS_04680 5087 5620 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_04680 6097 5738 gene locus_tag LOCUS_04690 6097 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 6929 6471 gene locus_tag LOCUS_04700 6929 6471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 7989 6937 gene locus_tag LOCUS_04710 7989 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 7026 7035 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence041 243 950 gene locus_tag LOCUS_04720 gene sigK 243 950 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 protein_id gnl|my_center|LOCUS_04720 1220 2752 gene locus_tag LOCUS_04730 1220 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 2749 3459 gene locus_tag LOCUS_04740 gene cps4B 2749 3459 CDS product capsular polysaccharide biosynthesis protein Cps4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922734.1 protein_id gnl|my_center|LOCUS_04740 5033 3675 gene locus_tag LOCUS_04750 5033 3675 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_04750 5313 5044 gene locus_tag LOCUS_04760 5313 5044 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963800.1 protein_id gnl|my_center|LOCUS_04760 5947 5315 gene locus_tag LOCUS_04770 gene yfbR 5947 5315 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158196.1 protein_id gnl|my_center|LOCUS_04770 6232 6017 gene locus_tag LOCUS_04780 6232 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681036.1 protein_id gnl|my_center|LOCUS_04780 >Feature sequence042 8 988 gene locus_tag LOCUS_04790 gene preA 8 988 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987091.1 protein_id gnl|my_center|LOCUS_04790 1005 2330 gene locus_tag LOCUS_04800 1005 2330 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029123.1 protein_id gnl|my_center|LOCUS_04800 2344 3495 gene locus_tag LOCUS_04810 2344 3495 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158673.1 protein_id gnl|my_center|LOCUS_04810 3518 4783 gene locus_tag LOCUS_04820 3518 4783 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948355.1 protein_id gnl|my_center|LOCUS_04820 5000 7174 gene locus_tag LOCUS_04830 5000 7174 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787402.1 protein_id gnl|my_center|LOCUS_04830 >Feature sequence043 44 1552 gene locus_tag LOCUS_04840 44 1552 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392657.1 protein_id gnl|my_center|LOCUS_04840 2103 1492 gene locus_tag LOCUS_04850 gene spoIIR 2103 1492 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425996.1 protein_id gnl|my_center|LOCUS_04850 3083 2175 gene locus_tag LOCUS_04860 3083 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 3974 3114 gene locus_tag LOCUS_04870 gene ispE 3974 3114 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356061.1 protein_id gnl|my_center|LOCUS_04870 5254 3971 gene locus_tag LOCUS_04880 5254 3971 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_04880 5943 5341 gene locus_tag LOCUS_04890 gene thrH 5943 5341 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_04890 7630 6143 gene locus_tag LOCUS_04900 7630 6143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 >Feature sequence044 1195 1383 gene locus_tag LOCUS_04910 gene rpmB 1195 1383 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965040.1 protein_id gnl|my_center|LOCUS_04910 2037 1489 gene locus_tag LOCUS_04920 2037 1489 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_04920 2230 2700 gene locus_tag LOCUS_04930 2230 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 3410 2679 gene locus_tag LOCUS_04940 3410 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 4137 3292 gene locus_tag LOCUS_04950 4137 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 3414 3423 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5820 4438 gene locus_tag LOCUS_04960 5820 4438 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430743.1 protein_id gnl|my_center|LOCUS_04960 <7588 6113 gene locus_tag LOCUS_04970 <7588 6113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767612.1:sodium-translocating pyrophosphatase >Feature sequence045 1776 850 gene locus_tag LOCUS_04980 1776 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 1954 4788 gene locus_tag LOCUS_04990 1954 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 6050 4878 gene locus_tag LOCUS_05000 6050 4878 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490229.1 protein_id gnl|my_center|LOCUS_05000 7154 6072 gene locus_tag LOCUS_05010 gene serC 7154 6072 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_05010 >Feature sequence046 65 421 gene locus_tag LOCUS_05020 65 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05020 464 703 gene locus_tag LOCUS_05030 464 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05030 700 1521 gene locus_tag LOCUS_05040 gene thiD 700 1521 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_05040 1518 2819 gene locus_tag LOCUS_05050 gene thiC 1518 2819 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047970.1 protein_id gnl|my_center|LOCUS_05050 3089 3757 gene locus_tag LOCUS_05060 3089 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 >Feature sequence047 1682 177 gene locus_tag LOCUS_05070 1682 177 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 protein_id gnl|my_center|LOCUS_05070 2509 1979 gene locus_tag LOCUS_05080 2509 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05080 2843 2454 gene locus_tag LOCUS_05090 2843 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 2589 2598 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3447 2827 gene locus_tag LOCUS_05100 3447 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 4086 3472 gene locus_tag LOCUS_05110 4086 3472 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294657.1 protein_id gnl|my_center|LOCUS_05110 4941 4126 gene locus_tag LOCUS_05120 4941 4126 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459311.1 protein_id gnl|my_center|LOCUS_05120 <7432 4963 gene locus_tag LOCUS_05130 <7432 4963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005809161.1:molybdopterin-dependent oxidoreductase >Feature sequence048 152 802 gene locus_tag LOCUS_05140 152 802 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_05140 824 2311 gene locus_tag LOCUS_05150 824 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 1363 1462 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2312 3184 gene locus_tag LOCUS_05160 gene rsmI 2312 3184 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391594.1 protein_id gnl|my_center|LOCUS_05160 3265 4101 gene locus_tag LOCUS_05170 3265 4101 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966363.1 protein_id gnl|my_center|LOCUS_05170 4143 4457 gene locus_tag LOCUS_05180 gene trxA 4143 4457 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018928.1 protein_id gnl|my_center|LOCUS_05180 4633 7230 gene locus_tag LOCUS_05190 gene clpB 4633 7230 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_05190 >Feature sequence049 1751 651 gene locus_tag LOCUS_05200 1751 651 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258677.1 protein_id gnl|my_center|LOCUS_05200 5806 1754 gene locus_tag LOCUS_05210 gene carB 5806 1754 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_05210 6878 5790 gene locus_tag LOCUS_05220 gene carA 6878 5790 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104362.1 protein_id gnl|my_center|LOCUS_05220 >Feature sequence050 426 1784 gene locus_tag LOCUS_05230 gene murA 426 1784 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460694.1 protein_id gnl|my_center|LOCUS_05230 1706 2467 gene locus_tag LOCUS_05240 1706 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 2618 3775 gene locus_tag LOCUS_05250 gene ftsZ 2618 3775 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965000.1 protein_id gnl|my_center|LOCUS_05250 4102 4992 gene locus_tag LOCUS_05260 4102 4992 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963617.1 protein_id gnl|my_center|LOCUS_05260 5881 5096 gene locus_tag LOCUS_05270 5881 5096 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894390.1 protein_id gnl|my_center|LOCUS_05270 7119 6022 gene locus_tag LOCUS_05280 gene eutH 7119 6022 CDS product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897061.1 protein_id gnl|my_center|LOCUS_05280 >Feature sequence051 136 1080 gene locus_tag LOCUS_05290 gene fabK 136 1080 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_05290 1068 1997 gene locus_tag LOCUS_05300 gene fabD 1068 1997 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_05300 1991 2716 gene locus_tag LOCUS_05310 gene fabG 1991 2716 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_05310 2810 3241 gene locus_tag LOCUS_05320 gene fabZ 2810 3241 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966834.1 protein_id gnl|my_center|LOCUS_05320 3238 3705 gene locus_tag LOCUS_05330 3238 3705 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289317.1 protein_id gnl|my_center|LOCUS_05330 3702 4931 gene locus_tag LOCUS_05340 gene fabF 3702 4931 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412652.1 protein_id gnl|my_center|LOCUS_05340 4935 6140 gene locus_tag LOCUS_05350 gene fabF 4935 6140 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_05350 6159 6791 gene locus_tag LOCUS_05360 6159 6791 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965893.1 protein_id gnl|my_center|LOCUS_05360 6909 7193 gene locus_tag LOCUS_05370 gene yajC 6909 7193 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426573.1 protein_id gnl|my_center|LOCUS_05370 >Feature sequence052 <1 760 gene locus_tag LOCUS_05380 <1 760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545591.1:1,4-alpha-glucan branching protein GlgB 873 2081 gene locus_tag LOCUS_05390 873 2081 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_05390 2074 3189 gene locus_tag LOCUS_05400 gene glgD 2074 3189 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418641.1 protein_id gnl|my_center|LOCUS_05400 3200 4660 gene locus_tag LOCUS_05410 gene glgA 3200 4660 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 protein_id gnl|my_center|LOCUS_05410 4688 7114 gene locus_tag LOCUS_05420 4688 7114 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081712308.1 protein_id gnl|my_center|LOCUS_05420 >Feature sequence053 431 1600 gene locus_tag LOCUS_05430 431 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 1597 2730 gene locus_tag LOCUS_05440 1597 2730 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272909.1 protein_id gnl|my_center|LOCUS_05440 2735 3556 gene locus_tag LOCUS_05450 gene nifH 2735 3556 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933198.1 protein_id gnl|my_center|LOCUS_05450 3780 3870 gene locus_tag LOCUS_t00070 3780 3870 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4030 4509 gene locus_tag LOCUS_05460 4030 4509 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941194.1 protein_id gnl|my_center|LOCUS_05460 4530 6194 gene locus_tag LOCUS_05470 gene glnS 4530 6194 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418271.1 protein_id gnl|my_center|LOCUS_05470 <7146 6450 gene locus_tag LOCUS_05480 <7146 6450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143540.1:3-isopropylmalate dehydrogenase >Feature sequence054 2847 1339 gene locus_tag LOCUS_05490 2847 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 3996 3124 gene locus_tag LOCUS_05500 gene rsgA 3996 3124 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392430.1 protein_id gnl|my_center|LOCUS_05500 5978 3993 gene locus_tag LOCUS_05510 gene pknB 5978 3993 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087065956.1 protein_id gnl|my_center|LOCUS_05510 6730 5999 gene locus_tag LOCUS_05520 6730 5999 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287376.1 protein_id gnl|my_center|LOCUS_05520 >Feature sequence055 1207 428 gene locus_tag LOCUS_05530 gene trpA 1207 428 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_05530 2390 1200 gene locus_tag LOCUS_05540 gene trpB 2390 1200 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 protein_id gnl|my_center|LOCUS_05540 3027 2404 gene locus_tag LOCUS_05550 3027 2404 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 protein_id gnl|my_center|LOCUS_05550 3812 3024 gene locus_tag LOCUS_05560 gene trpC 3812 3024 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_05560 4841 3831 gene locus_tag LOCUS_05570 gene trpD 4841 3831 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_05570 5438 4860 gene locus_tag LOCUS_05580 5438 4860 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636333.1 protein_id gnl|my_center|LOCUS_05580 6901 5426 gene locus_tag LOCUS_05590 gene trpE 6901 5426 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880347.1 protein_id gnl|my_center|LOCUS_05590 >Feature sequence056 885 322 gene locus_tag LOCUS_05600 gene ahpC 885 322 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817384.1 protein_id gnl|my_center|LOCUS_05600 1071 1856 gene locus_tag LOCUS_05610 1071 1856 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_05610 3213 1930 gene locus_tag LOCUS_05620 3213 1930 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966034.1 protein_id gnl|my_center|LOCUS_05620 3964 3224 gene locus_tag LOCUS_05630 3964 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 4139 4975 gene locus_tag LOCUS_05640 4139 4975 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764673.1 protein_id gnl|my_center|LOCUS_05640 6039 6608 gene locus_tag LOCUS_05650 6039 6608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 >Feature sequence057 419 1900 gene locus_tag LOCUS_05660 gene gltX 419 1900 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_05660 2116 1967 gene locus_tag LOCUS_05670 2116 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 2366 3709 gene locus_tag LOCUS_05680 gene ypeB 2366 3709 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391745.1 protein_id gnl|my_center|LOCUS_05680 4409 3636 gene locus_tag LOCUS_05690 gene rnc 4409 3636 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_05690 4758 4432 gene locus_tag LOCUS_05700 4758 4432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 5888 4764 gene locus_tag LOCUS_05710 gene plsX 5888 4764 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428446.1 protein_id gnl|my_center|LOCUS_05710 <6968 5885 gene locus_tag LOCUS_05720 <6968 5885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813284.1:methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO 6026 6035 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence058 1140 433 gene locus_tag LOCUS_05730 1140 433 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_05730 2228 1143 gene locus_tag LOCUS_05740 gene dacB 2228 1143 CDS product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230505.1 protein_id gnl|my_center|LOCUS_05740 2655 2218 gene locus_tag LOCUS_05750 gene ytfJ 2655 2218 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965359.1 protein_id gnl|my_center|LOCUS_05750 3289 2630 gene locus_tag LOCUS_05760 3289 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 3840 3286 gene locus_tag LOCUS_05770 3840 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 4621 3830 gene locus_tag LOCUS_05780 4621 3830 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_05780 5310 4621 gene locus_tag LOCUS_05790 5310 4621 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869499.1 protein_id gnl|my_center|LOCUS_05790 6523 5573 gene locus_tag LOCUS_05800 6523 5573 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_05800 >Feature sequence059 582 391 gene locus_tag LOCUS_05810 582 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 1227 1066 gene locus_tag LOCUS_05820 1227 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 1907 1224 gene locus_tag LOCUS_05830 1907 1224 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891221.1 protein_id gnl|my_center|LOCUS_05830 3293 1911 gene locus_tag LOCUS_05840 3293 1911 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422669.1 protein_id gnl|my_center|LOCUS_05840 5071 3290 gene locus_tag LOCUS_05850 5071 3290 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426762.1 protein_id gnl|my_center|LOCUS_05850 5424 5116 gene locus_tag LOCUS_05860 5424 5116 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422665.1 protein_id gnl|my_center|LOCUS_05860 6415 5417 gene locus_tag LOCUS_05870 6415 5417 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439726.1 protein_id gnl|my_center|LOCUS_05870 >Feature sequence060 1325 90 gene locus_tag LOCUS_05880 gene madB 1325 90 CDS product Na+-transporting malonate decarboxylase, carboxybiotin decarboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389075.1 protein_id gnl|my_center|LOCUS_05880 1449 1318 gene locus_tag LOCUS_05890 1449 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 3142 1598 gene locus_tag LOCUS_05900 3142 1598 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869044.1 protein_id gnl|my_center|LOCUS_05900 3559 3155 gene locus_tag LOCUS_05910 gene mce 3559 3155 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_05910 4521 3556 gene locus_tag LOCUS_05920 gene meaB 4521 3556 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867373.1 protein_id gnl|my_center|LOCUS_05920 4929 4525 gene locus_tag LOCUS_05930 4929 4525 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_05930 5960 4932 gene locus_tag LOCUS_05940 5960 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05940 6640 5951 gene locus_tag LOCUS_05950 6640 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05950 5987 5996 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence061 285 581 gene locus_tag LOCUS_05960 gene rpsF 285 581 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_05960 592 1044 gene locus_tag LOCUS_05970 gene ssb 592 1044 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721668.1 protein_id gnl|my_center|LOCUS_05970 1182 1427 gene locus_tag LOCUS_05980 gene rpsR 1182 1427 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_05980 1449 1458 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2161 1679 gene locus_tag LOCUS_05990 gene queF 2161 1679 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832596.1 protein_id gnl|my_center|LOCUS_05990 3276 2596 gene locus_tag LOCUS_06000 3276 2596 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879601.1 protein_id gnl|my_center|LOCUS_06000 3968 3273 gene locus_tag LOCUS_06010 gene queC 3968 3273 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 protein_id gnl|my_center|LOCUS_06010 5780 4188 gene locus_tag LOCUS_06020 5780 4188 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143601.1 protein_id gnl|my_center|LOCUS_06020 6269 6544 gene locus_tag LOCUS_06030 6269 6544 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458924.1 protein_id gnl|my_center|LOCUS_06030 >Feature sequence062 1928 1143 gene locus_tag LOCUS_06040 1928 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 3225 1945 gene locus_tag LOCUS_06050 3225 1945 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143476.1 protein_id gnl|my_center|LOCUS_06050 4106 3306 gene locus_tag LOCUS_06060 4106 3306 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393997.1 protein_id gnl|my_center|LOCUS_06060 5622 4126 gene locus_tag LOCUS_06070 5622 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 5878 5660 gene locus_tag LOCUS_06080 gene yidD 5878 5660 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457867.1 protein_id gnl|my_center|LOCUS_06080 6228 5875 gene locus_tag LOCUS_06090 6228 5875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 6522 6388 gene locus_tag LOCUS_06100 6522 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 >Feature sequence063 1085 681 gene locus_tag LOCUS_06110 1085 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 1209 2930 gene locus_tag LOCUS_06120 1209 2930 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583011.1 protein_id gnl|my_center|LOCUS_06120 2920 4815 gene locus_tag LOCUS_06130 2920 4815 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083002.1 protein_id gnl|my_center|LOCUS_06130 5897 4881 gene locus_tag LOCUS_06140 gene galE 5897 4881 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_06140 <6745 5956 gene locus_tag LOCUS_06150 <6745 5956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203586.1:nucleotidyltransferase >Feature sequence064 592 1974 gene locus_tag LOCUS_06160 592 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 1971 3128 gene locus_tag LOCUS_06170 1971 3128 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682009.1 protein_id gnl|my_center|LOCUS_06170 3216 4235 gene locus_tag LOCUS_06180 3216 4235 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682008.1 protein_id gnl|my_center|LOCUS_06180 4232 5518 gene locus_tag LOCUS_06190 4232 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 5216 5225 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5406 6131 gene locus_tag LOCUS_06200 5406 6131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 >Feature sequence065 70 759 gene locus_tag LOCUS_06210 70 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 836 2272 gene locus_tag LOCUS_06220 836 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 2521 3867 gene locus_tag LOCUS_06230 2521 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 3231 3330 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3881 4666 gene locus_tag LOCUS_06240 3881 4666 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144055.1 protein_id gnl|my_center|LOCUS_06240 >Feature sequence066 <1 557 gene locus_tag LOCUS_06250 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003416935.1:HPr(Ser) kinase/phosphatase 953 570 gene locus_tag LOCUS_06260 953 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 1630 953 gene locus_tag LOCUS_06270 1630 953 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948011.1 protein_id gnl|my_center|LOCUS_06270 1778 1975 gene locus_tag LOCUS_06280 1778 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 2043 3311 gene locus_tag LOCUS_06290 2043 3311 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681109.1 protein_id gnl|my_center|LOCUS_06290 3394 4260 gene locus_tag LOCUS_06300 3394 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 4262 6040 gene locus_tag LOCUS_06310 4262 6040 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414744.1 protein_id gnl|my_center|LOCUS_06310 6069 6078 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence067 1697 738 gene locus_tag LOCUS_06320 1697 738 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553997.1 protein_id gnl|my_center|LOCUS_06320 3031 1709 gene locus_tag LOCUS_06330 3031 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 4242 3028 gene locus_tag LOCUS_06340 4242 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 5366 4233 gene locus_tag LOCUS_06350 5366 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 <6504 5436 gene locus_tag LOCUS_06360 <6504 5436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810402.1:iron ABC transporter permease >Feature sequence068 <1 921 gene locus_tag LOCUS_06370 <1 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000863460.1:signal recognition particle protein 988 1233 gene locus_tag LOCUS_06380 gene rpsP 988 1233 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_06380 1245 1475 gene locus_tag LOCUS_06390 1245 1475 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392483.1 protein_id gnl|my_center|LOCUS_06390 1605 2099 gene locus_tag LOCUS_06400 gene rimM 1605 2099 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_06400 2099 2857 gene locus_tag LOCUS_06410 gene trmD 2099 2857 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965065.1 protein_id gnl|my_center|LOCUS_06410 3454 2942 gene locus_tag LOCUS_06420 3454 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 5919 3451 gene locus_tag LOCUS_06430 gene clpC 5919 3451 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235011.1 protein_id gnl|my_center|LOCUS_06430 4379 4388 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6109 6276 gene locus_tag LOCUS_06440 6109 6276 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002559159.1 protein_id gnl|my_center|LOCUS_06440 >Feature sequence069 <1 923 gene locus_tag LOCUS_06450 <1 923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964210.1:3-deoxy-7-phosphoheptulonate synthase 937 1998 gene locus_tag LOCUS_06460 gene aroB 937 1998 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964212.1 protein_id gnl|my_center|LOCUS_06460 1995 3164 gene locus_tag LOCUS_06470 gene aroA 1995 3164 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_06470 3161 4138 gene locus_tag LOCUS_06480 gene aroC 3161 4138 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_06480 4151 5296 gene locus_tag LOCUS_06490 gene pheA 4151 5296 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_06490 5289 5789 gene locus_tag LOCUS_06500 5289 5789 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393065.1 protein_id gnl|my_center|LOCUS_06500 5786 6211 gene locus_tag LOCUS_06510 gene aroQ 5786 6211 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083137.1 protein_id gnl|my_center|LOCUS_06510 >Feature sequence070 2108 1146 gene locus_tag LOCUS_06520 2108 1146 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022101.1 protein_id gnl|my_center|LOCUS_06520 2417 2139 gene locus_tag LOCUS_06530 2417 2139 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027435.1 protein_id gnl|my_center|LOCUS_06530 2632 2414 gene locus_tag LOCUS_06540 2632 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 3325 2681 gene locus_tag LOCUS_06550 3325 2681 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303217.1 protein_id gnl|my_center|LOCUS_06550 4616 3327 gene locus_tag LOCUS_06560 gene hflX 4616 3327 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_06560 5133 4618 gene locus_tag LOCUS_06570 5133 4618 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434028.1 protein_id gnl|my_center|LOCUS_06570 <6268 5358 gene locus_tag LOCUS_06580 <6268 5358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002368663.1:recombinase family protein >Feature sequence071 4226 1797 gene locus_tag LOCUS_06590 4226 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 4781 4269 gene locus_tag LOCUS_06600 4781 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 5639 4803 gene locus_tag LOCUS_06610 5639 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 >Feature sequence072 163 1011 gene locus_tag LOCUS_06620 gene metA 163 1011 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_06620 1344 1054 gene locus_tag LOCUS_06630 1344 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 1686 1372 gene locus_tag LOCUS_06640 1686 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 2129 2138 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2159 3568 gene locus_tag LOCUS_06650 2159 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 3594 4067 gene locus_tag LOCUS_06660 3594 4067 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070053.1 protein_id gnl|my_center|LOCUS_06660 4547 4161 gene locus_tag LOCUS_06670 4547 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 5748 4690 gene locus_tag LOCUS_06680 gene hisC 5748 4690 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966312.1 protein_id gnl|my_center|LOCUS_06680 5936 5745 gene locus_tag LOCUS_06690 5936 5745 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence073 <1 589 gene locus_tag LOCUS_06700 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966490.1:stage V sporulation protein T 1508 672 gene locus_tag LOCUS_06710 gene folD 1508 672 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941526.1 protein_id gnl|my_center|LOCUS_06710 2475 1492 gene locus_tag LOCUS_06720 gene lgt 2475 1492 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578277.1 protein_id gnl|my_center|LOCUS_06720 3749 2472 gene locus_tag LOCUS_06730 3749 2472 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411976.1 protein_id gnl|my_center|LOCUS_06730 5034 3754 gene locus_tag LOCUS_06740 5034 3754 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_06740 <6195 5388 gene locus_tag LOCUS_06750 <6195 5388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009931856.1:membrane protein >Feature sequence074 <1 295 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccgtcccctcgcgggggtgagatgaatt 1588 500 gene locus_tag LOCUS_06760 gene csm5 1588 500 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917169.1 protein_id gnl|my_center|LOCUS_06760 2367 1585 gene locus_tag LOCUS_06770 gene csm4 2367 1585 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414288.1 protein_id gnl|my_center|LOCUS_06770 2728 2543 gene locus_tag LOCUS_06780 2728 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 3211 2741 gene locus_tag LOCUS_06790 3211 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06790 3674 3216 gene locus_tag LOCUS_06800 gene csm2 3674 3216 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917164.1 protein_id gnl|my_center|LOCUS_06800 5806 3680 gene locus_tag LOCUS_06810 5806 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 >Feature sequence075 2346 2101 gene locus_tag LOCUS_06820 2346 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 3478 2441 gene locus_tag LOCUS_06830 gene ispG 3478 2441 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_06830 4565 3492 gene locus_tag LOCUS_06840 gene rseP 4565 3492 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965102.1 protein_id gnl|my_center|LOCUS_06840 5708 4569 gene locus_tag LOCUS_06850 5708 4569 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188776689.1 protein_id gnl|my_center|LOCUS_06850 >Feature sequence076 1084 431 gene locus_tag LOCUS_06860 1084 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 2335 1124 gene locus_tag LOCUS_06870 2335 1124 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119310.1 protein_id gnl|my_center|LOCUS_06870 2556 3947 gene locus_tag LOCUS_06880 2556 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 3947 5101 gene locus_tag LOCUS_06890 gene nagA 3947 5101 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722368.1 protein_id gnl|my_center|LOCUS_06890 5077 5086 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5098 5823 gene locus_tag LOCUS_06900 gene nagB 5098 5823 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868991.1 protein_id gnl|my_center|LOCUS_06900 >Feature sequence077 492 692 gene locus_tag LOCUS_06910 492 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 707 1318 gene locus_tag LOCUS_06920 707 1318 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886588.1 protein_id gnl|my_center|LOCUS_06920 1302 1619 gene locus_tag LOCUS_06930 gene yhbY 1302 1619 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460893.1 protein_id gnl|my_center|LOCUS_06930 1669 2850 gene locus_tag LOCUS_06940 1669 2850 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679466.1 protein_id gnl|my_center|LOCUS_06940 2851 3960 gene locus_tag LOCUS_06950 2851 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 3981 4337 gene locus_tag LOCUS_06960 gene rsfS 3981 4337 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_06960 >Feature sequence078 <1 1044 gene locus_tag LOCUS_06970 <1 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357725.1:translation elongation factor 4 1073 2014 gene locus_tag LOCUS_06980 1073 2014 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_06980 3184 2033 gene locus_tag LOCUS_06990 3184 2033 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021367800.1 protein_id gnl|my_center|LOCUS_06990 3480 3797 gene locus_tag LOCUS_07000 3480 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 3807 5888 gene locus_tag LOCUS_07010 3807 5888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 >Feature sequence079 436 1542 gene locus_tag LOCUS_07020 436 1542 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942069.1 protein_id gnl|my_center|LOCUS_07020 1539 3743 gene locus_tag LOCUS_07030 1539 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 3863 4510 gene locus_tag LOCUS_07040 3863 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 <5958 4630 gene locus_tag LOCUS_07050 <5958 4630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022042.1:MATE family efflux transporter >Feature sequence080 1523 219 gene locus_tag LOCUS_07060 1523 219 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_07060 3479 1761 gene locus_tag LOCUS_07070 3479 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 <5876 3923 gene locus_tag LOCUS_07080 <5876 3923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438316.1:polyribonucleotide nucleotidyltransferase >Feature sequence081 272 1027 gene locus_tag LOCUS_07090 gene cobS 272 1027 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460078.1 protein_id gnl|my_center|LOCUS_07090 1038 1406 gene locus_tag LOCUS_07100 1038 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 1415 2014 gene locus_tag LOCUS_07110 1415 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 2008 2976 gene locus_tag LOCUS_07120 gene cbiB 2008 2976 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_07120 2973 4037 gene locus_tag LOCUS_07130 gene cobD 2973 4037 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392618.1 protein_id gnl|my_center|LOCUS_07130 4040 5530 gene locus_tag LOCUS_07140 4040 5530 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989707.1 protein_id gnl|my_center|LOCUS_07140 5527 5820 gene locus_tag LOCUS_07150 5527 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 >Feature sequence082 357 79 gene locus_tag LOCUS_07160 357 79 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_07160 1251 457 gene locus_tag LOCUS_07170 1251 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 2862 1288 gene locus_tag LOCUS_07180 2862 1288 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_07180 4253 2952 gene locus_tag LOCUS_07190 4253 2952 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_07190 5076 4255 gene locus_tag LOCUS_07200 5076 4255 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016086425.1 protein_id gnl|my_center|LOCUS_07200 >Feature sequence083 722 2293 gene locus_tag LOCUS_07210 722 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 3375 2302 gene locus_tag LOCUS_07220 3375 2302 CDS product PRK06851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048278.1 protein_id gnl|my_center|LOCUS_07220 3589 4632 gene locus_tag LOCUS_07230 3589 4632 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102084.1 protein_id gnl|my_center|LOCUS_07230 4896 4684 gene locus_tag LOCUS_07240 4896 4684 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037754.1 protein_id gnl|my_center|LOCUS_07240 5166 5241 gene locus_tag LOCUS_t00080 5166 5241 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5245 5321 gene locus_tag LOCUS_t00090 5245 5321 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5325 5400 gene locus_tag LOCUS_t00100 5325 5400 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 5435 5510 gene locus_tag LOCUS_t00110 5435 5510 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5554 5627 gene locus_tag LOCUS_t00120 5554 5627 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence084 506 45 gene locus_tag LOCUS_07250 gene rpiB 506 45 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966164.1 protein_id gnl|my_center|LOCUS_07250 1273 527 gene locus_tag LOCUS_07260 1273 527 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896027.1 protein_id gnl|my_center|LOCUS_07260 3394 1535 gene locus_tag LOCUS_07270 3394 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 3875 4414 gene locus_tag LOCUS_07280 gene nuoE 3875 4414 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_07280 4428 4796 gene locus_tag LOCUS_07290 4428 4796 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_07290 >Feature sequence085 1318 260 gene locus_tag LOCUS_07300 gene cobT 1318 260 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_07300 2676 1315 gene locus_tag LOCUS_07310 2676 1315 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816689.1 protein_id gnl|my_center|LOCUS_07310 3875 2673 gene locus_tag LOCUS_07320 3875 2673 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943626.1 protein_id gnl|my_center|LOCUS_07320 4615 3872 gene locus_tag LOCUS_07330 gene cobK 4615 3872 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392609.1 protein_id gnl|my_center|LOCUS_07330 5349 4624 gene locus_tag LOCUS_07340 gene cobJ 5349 4624 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392608.1 protein_id gnl|my_center|LOCUS_07340 >Feature sequence086 154 888 gene locus_tag LOCUS_07350 gene cobJ 154 888 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931509.1 protein_id gnl|my_center|LOCUS_07350 885 1613 gene locus_tag LOCUS_07360 gene cobK 885 1613 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812303.1 protein_id gnl|my_center|LOCUS_07360 1610 2800 gene locus_tag LOCUS_07370 1610 2800 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631406.1 protein_id gnl|my_center|LOCUS_07370 3456 3465 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3593 4225 gene locus_tag LOCUS_07380 3593 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07380 4212 5270 gene locus_tag LOCUS_07390 gene cobT 4212 5270 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541537.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence087 142 651 gene locus_tag LOCUS_07400 142 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 685 879 gene locus_tag LOCUS_07410 gene spoIIIAC 685 879 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888937.1 protein_id gnl|my_center|LOCUS_07410 883 1269 gene locus_tag LOCUS_07420 gene spoIIIAD 883 1269 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393042.1 protein_id gnl|my_center|LOCUS_07420 1347 2372 gene locus_tag LOCUS_07430 1347 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 2369 2860 gene locus_tag LOCUS_07440 2369 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 2857 3381 gene locus_tag LOCUS_07450 2857 3381 CDS product stage III sporulation protein AG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428419.1 protein_id gnl|my_center|LOCUS_07450 3392 3991 gene locus_tag LOCUS_07460 3392 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 5481 4132 gene locus_tag LOCUS_07470 5481 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 >Feature sequence088 591 55 gene locus_tag LOCUS_07480 591 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07480 1110 709 gene locus_tag LOCUS_07490 gene cdd 1110 709 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080780.1 protein_id gnl|my_center|LOCUS_07490 1247 1723 gene locus_tag LOCUS_07500 1247 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 1778 3316 gene locus_tag LOCUS_07510 1778 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 3335 5278 gene locus_tag LOCUS_07520 3335 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 >Feature sequence089 927 259 gene locus_tag LOCUS_07530 927 259 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759985.1 protein_id gnl|my_center|LOCUS_07530 1879 1031 gene locus_tag LOCUS_07540 1879 1031 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_07540 3215 1962 gene locus_tag LOCUS_07550 3215 1962 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922544.1 protein_id gnl|my_center|LOCUS_07550 3728 3318 gene locus_tag LOCUS_07560 3728 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 4051 5361 gene locus_tag LOCUS_07570 4051 5361 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831993.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence090 469 2052 gene locus_tag LOCUS_07580 469 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941782.1 protein_id gnl|my_center|LOCUS_07580 2192 3034 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tatttcaatccactccccccgcgtggggggagac 3056 3155 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3176 3811 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatccactccccccgcgtggggggagac 4273 3983 gene locus_tag LOCUS_07590 gene cas2 4273 3983 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932801.1 protein_id gnl|my_center|LOCUS_07590 5312 4281 gene locus_tag LOCUS_07600 gene cas1c 5312 4281 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_07600 >Feature sequence091 99 296 gene locus_tag LOCUS_07610 99 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 293 1156 gene locus_tag LOCUS_07620 gene dpaA 293 1156 CDS product dipicolinic acid synthetase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231888.1 protein_id gnl|my_center|LOCUS_07620 1158 1742 gene locus_tag LOCUS_07630 1158 1742 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392579.1 protein_id gnl|my_center|LOCUS_07630 3016 1925 gene locus_tag LOCUS_07640 gene ychF 3016 1925 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815179.1 protein_id gnl|my_center|LOCUS_07640 3289 3411 gene locus_tag LOCUS_07650 3289 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 3478 4077 gene locus_tag LOCUS_07660 3478 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 4008 4259 gene locus_tag LOCUS_07670 4008 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 4948 4634 gene locus_tag LOCUS_07680 4948 4634 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359499.1 protein_id gnl|my_center|LOCUS_07680 5298 4990 gene locus_tag LOCUS_07690 5298 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 >Feature sequence092 1405 77 gene locus_tag LOCUS_07700 gene der 1405 77 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460200.1 protein_id gnl|my_center|LOCUS_07700 2781 1429 gene locus_tag LOCUS_07710 2781 1429 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965017.1 protein_id gnl|my_center|LOCUS_07710 3035 2856 gene locus_tag LOCUS_07720 gene rpmF 3035 2856 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984764.1 protein_id gnl|my_center|LOCUS_07720 3550 3110 gene locus_tag LOCUS_07730 3550 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 4354 3725 gene locus_tag LOCUS_07740 gene upp 4354 3725 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815407.1 protein_id gnl|my_center|LOCUS_07740 5088 4378 gene locus_tag LOCUS_07750 gene tsaB 5088 4378 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_07750 >Feature sequence093 2414 1320 gene locus_tag LOCUS_07760 2414 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 4319 2634 gene locus_tag LOCUS_07770 4319 2634 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_07770 4993 4316 gene locus_tag LOCUS_07780 4993 4316 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_07780 >Feature sequence094 54 1178 gene locus_tag LOCUS_07790 54 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 1153 1665 gene locus_tag LOCUS_07800 1153 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 1795 3174 gene locus_tag LOCUS_07810 1795 3174 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence095 1193 432 gene locus_tag LOCUS_07820 1193 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07820 2396 1239 gene locus_tag LOCUS_07830 2396 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07830 3299 2424 gene locus_tag LOCUS_07840 3299 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 3571 3296 gene locus_tag LOCUS_07850 3571 3296 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986717.1 protein_id gnl|my_center|LOCUS_07850 5173 3578 gene locus_tag LOCUS_07860 5173 3578 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721936.1 protein_id gnl|my_center|LOCUS_07860 >Feature sequence096 1421 291 gene locus_tag LOCUS_07870 gene tgt 1421 291 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965580.1 protein_id gnl|my_center|LOCUS_07870 2509 1460 gene locus_tag LOCUS_07880 gene queA 2509 1460 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_07880 2891 3982 gene locus_tag LOCUS_07890 gene asd 2891 3982 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963889.1 protein_id gnl|my_center|LOCUS_07890 3998 4888 gene locus_tag LOCUS_07900 gene dapA 3998 4888 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_07900 4910 5239 gene locus_tag LOCUS_07910 4910 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 >Feature sequence097 595 77 gene locus_tag LOCUS_07920 595 77 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_07920 1650 613 gene locus_tag LOCUS_07930 1650 613 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094940977.1 protein_id gnl|my_center|LOCUS_07930 3079 2072 gene locus_tag LOCUS_07940 3079 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 4267 3425 gene locus_tag LOCUS_07950 4267 3425 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519031.1 protein_id gnl|my_center|LOCUS_07950 <5168 4264 gene locus_tag LOCUS_07960 <5168 4264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461367.1:amidohydrolase >Feature sequence098 107 1129 gene locus_tag LOCUS_07970 107 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 3066 1240 gene locus_tag LOCUS_07980 3066 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 4047 3232 gene locus_tag LOCUS_07990 4047 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965639.1 protein_id gnl|my_center|LOCUS_07990 4261 4884 gene locus_tag LOCUS_08000 4261 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 >Feature sequence099 100 176 gene locus_tag LOCUS_t00130 100 176 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 245 254 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 289 363 gene locus_tag LOCUS_t00140 289 363 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 367 442 gene locus_tag LOCUS_t00150 367 442 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1037 735 gene locus_tag LOCUS_08010 1037 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08010 1038 1047 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1821 3131 gene locus_tag LOCUS_08020 1821 3131 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016070.1 protein_id gnl|my_center|LOCUS_08020 3143 4012 gene locus_tag LOCUS_08030 gene nadC 3143 4012 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360683.1 protein_id gnl|my_center|LOCUS_08030 4009 4572 gene locus_tag LOCUS_08040 4009 4572 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900176.1 protein_id gnl|my_center|LOCUS_08040 >Feature sequence100 3700 1295 gene locus_tag LOCUS_08050 3700 1295 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_08050 4437 3898 gene locus_tag LOCUS_08060 4437 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 <5017 4488 gene locus_tag LOCUS_08070 <5017 4488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460703.1:16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH >Feature sequence101 <1 986 gene locus_tag LOCUS_08080 <1 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048377.1:stage II sporulation protein E 2071 1034 gene locus_tag LOCUS_08090 2071 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 2225 3265 gene locus_tag LOCUS_08100 gene gap 2225 3265 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_08100 3836 3633 gene locus_tag LOCUS_08110 3836 3633 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_08110 4133 4552 gene locus_tag LOCUS_08120 gene ruvX 4133 4552 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810863.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence102 579 920 gene locus_tag LOCUS_08130 579 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08130 1184 2524 gene locus_tag LOCUS_08140 1184 2524 CDS product Trk family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888508.1 protein_id gnl|my_center|LOCUS_08140 2538 3194 gene locus_tag LOCUS_08150 2538 3194 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357824.1 protein_id gnl|my_center|LOCUS_08150 3196 3954 gene locus_tag LOCUS_08160 3196 3954 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003158483.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence103 678 1184 gene locus_tag LOCUS_08170 gene nuoE 678 1184 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582933.1 protein_id gnl|my_center|LOCUS_08170 1181 2491 gene locus_tag LOCUS_08180 gene nuoF 1181 2491 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082918.1 protein_id gnl|my_center|LOCUS_08180 2481 4223 gene locus_tag LOCUS_08190 2481 4223 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence104 475 23 gene locus_tag LOCUS_08200 475 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 1549 482 gene locus_tag LOCUS_08210 gene hrcA 1549 482 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_08210 2014 1763 gene locus_tag LOCUS_08220 2014 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 3912 2149 gene locus_tag LOCUS_08230 3912 2149 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_08230 <4813 3927 gene locus_tag LOCUS_08240 <4813 3927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986412.1:NADH-quinone oxidoreductase subunit NuoF >Feature sequence105 64 1281 gene locus_tag LOCUS_08250 64 1281 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461084.1 protein_id gnl|my_center|LOCUS_08250 1851 1354 gene locus_tag LOCUS_08260 1851 1354 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_08260 2246 4561 gene locus_tag LOCUS_08270 2246 4561 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143331.1 protein_id gnl|my_center|LOCUS_08270 >Feature sequence106 2204 1188 gene locus_tag LOCUS_08280 2204 1188 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771886.1 protein_id gnl|my_center|LOCUS_08280 3233 2907 gene locus_tag LOCUS_08290 3233 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 4710 3757 gene locus_tag LOCUS_08300 4710 3757 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102569.1 protein_id gnl|my_center|LOCUS_08300 >Feature sequence107 <1 530 gene locus_tag LOCUS_08310 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947941.1:TatD family hydrolase 532 1020 gene locus_tag LOCUS_08320 532 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 574 583 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1219 3183 gene locus_tag LOCUS_08330 1219 3183 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964362.1 protein_id gnl|my_center|LOCUS_08330 3216 3647 gene locus_tag LOCUS_08340 3216 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 3789 4220 gene locus_tag LOCUS_08350 3789 4220 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence108 1628 1074 gene locus_tag LOCUS_08360 1628 1074 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_08360 2511 1621 gene locus_tag LOCUS_08370 2511 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 2693 3565 gene locus_tag LOCUS_08380 2693 3565 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_08380 3562 4407 gene locus_tag LOCUS_08390 3562 4407 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226187.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence109 <1 1216 gene locus_tag LOCUS_08400 <1 1216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000572274.1:helicase-exonuclease AddAB subunit AddA 1871 1524 gene locus_tag LOCUS_08410 1871 1524 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245674.1 protein_id gnl|my_center|LOCUS_08410 2336 3028 gene locus_tag LOCUS_08420 2336 3028 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_08420 3040 3837 gene locus_tag LOCUS_08430 3040 3837 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_08430 3865 4452 gene locus_tag LOCUS_08440 gene scpB 3865 4452 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259764.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence110 1780 185 gene locus_tag LOCUS_08450 1780 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 2117 1914 gene locus_tag LOCUS_08460 2117 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 2345 2127 gene locus_tag LOCUS_08470 2345 2127 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423266.1 protein_id gnl|my_center|LOCUS_08470 4192 2369 gene locus_tag LOCUS_08480 4192 2369 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878960.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence111 2076 154 gene locus_tag LOCUS_08490 2076 154 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_08490 2225 4057 gene locus_tag LOCUS_08500 gene asnB 2225 4057 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233080.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence112 <1 1081 gene locus_tag LOCUS_08510 <1 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222424.1:HlyD family efflux transporter periplasmic adaptor subunit 1643 1338 gene locus_tag LOCUS_08520 1643 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 3159 1660 gene locus_tag LOCUS_08530 3159 1660 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337936.1 protein_id gnl|my_center|LOCUS_08530 4371 3625 gene locus_tag LOCUS_08540 4371 3625 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392585.1 protein_id gnl|my_center|LOCUS_08540 >Feature sequence113 819 163 gene locus_tag LOCUS_08550 819 163 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048024.1 protein_id gnl|my_center|LOCUS_08550 2647 812 gene locus_tag LOCUS_08560 2647 812 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_08560 2825 4219 gene locus_tag LOCUS_08570 2825 4219 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895854.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence114 342 1301 gene locus_tag LOCUS_08580 342 1301 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421392.1 protein_id gnl|my_center|LOCUS_08580 1325 2185 gene locus_tag LOCUS_08590 gene prmC 1325 2185 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973616.1 protein_id gnl|my_center|LOCUS_08590 2210 2788 gene locus_tag LOCUS_08600 2210 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 3093 4289 gene locus_tag LOCUS_08610 gene recA 3093 4289 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532151.1 protein_id gnl|my_center|LOCUS_08610 >Feature sequence115 2158 416 gene locus_tag LOCUS_08620 2158 416 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986472.1 protein_id gnl|my_center|LOCUS_08620 3905 2172 gene locus_tag LOCUS_08630 3905 2172 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_08630 <4615 4021 gene locus_tag LOCUS_08640 <4615 4021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015783.1:YiiX/YebB-like N1pC/P60 family cysteine hydrolase >Feature sequence116 245 1720 gene locus_tag LOCUS_08650 245 1720 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143476.1 protein_id gnl|my_center|LOCUS_08650 1174 1183 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1764 2087 gene locus_tag LOCUS_08660 1764 2087 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549116.1 protein_id gnl|my_center|LOCUS_08660 2087 3079 gene locus_tag LOCUS_08670 2087 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 3076 3597 gene locus_tag LOCUS_08680 3076 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 >Feature sequence117 2642 99 gene locus_tag LOCUS_08690 2642 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 3163 3078 gene locus_tag LOCUS_t00160 3163 3078 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3248 3173 gene locus_tag LOCUS_t00170 3248 3173 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3362 3694 gene locus_tag LOCUS_08700 3362 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 4413 3697 gene locus_tag LOCUS_08710 4413 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 >Feature sequence118 38 1198 gene locus_tag LOCUS_08720 38 1198 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705013.1 protein_id gnl|my_center|LOCUS_08720 >Feature sequence119 2 901 gene locus_tag LOCUS_08730 2 901 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970995.1 protein_id gnl|my_center|LOCUS_08730 1053 1505 gene locus_tag LOCUS_08740 1053 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 2915 2217 gene locus_tag LOCUS_08750 2915 2217 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358516.1 protein_id gnl|my_center|LOCUS_08750 3343 2912 gene locus_tag LOCUS_08760 3343 2912 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264782.1 protein_id gnl|my_center|LOCUS_08760 <4452 3349 gene locus_tag LOCUS_08770 <4452 3349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792381.1:long-chain fatty acid--CoA ligase >Feature sequence120 3 266 gene locus_tag LOCUS_08780 3 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 2293 347 gene locus_tag LOCUS_08790 2293 347 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459965.1 protein_id gnl|my_center|LOCUS_08790 3452 2283 gene locus_tag LOCUS_08800 3452 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 4366 3443 gene locus_tag LOCUS_08810 gene pyrD 4366 3443 CDS product dihydroorotate oxidase B catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081057.1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence121 324 791 gene locus_tag LOCUS_08820 324 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 1077 1490 gene locus_tag LOCUS_08830 1077 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 1494 1997 gene locus_tag LOCUS_08840 1494 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 2245 1970 gene locus_tag LOCUS_08850 2245 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 2513 3160 gene locus_tag LOCUS_08860 2513 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 >Feature sequence122 1522 278 gene locus_tag LOCUS_08870 1522 278 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392227.1 protein_id gnl|my_center|LOCUS_08870 1991 1536 gene locus_tag LOCUS_08880 1991 1536 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228021.1 protein_id gnl|my_center|LOCUS_08880 3426 2038 gene locus_tag LOCUS_08890 gene glmM 3426 2038 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521474.1 protein_id gnl|my_center|LOCUS_08890 <4432 3688 gene locus_tag LOCUS_08900 <4432 3688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391166.1:phosphoenolpyruvate carboxykinase (GTP) >Feature sequence123 >Feature sequence124 <1 770 gene locus_tag LOCUS_08910 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357496.1:tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD 1879 2583 gene locus_tag LOCUS_08920 1879 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 <4343 2849 gene locus_tag LOCUS_08930 <4343 2849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813982.1:NAD(P)-binding protein >Feature sequence125 647 2107 gene locus_tag LOCUS_08940 647 2107 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661024.1 protein_id gnl|my_center|LOCUS_08940 2122 2976 gene locus_tag LOCUS_08950 gene speE 2122 2976 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_08950 2973 3869 gene locus_tag LOCUS_08960 gene speB 2973 3869 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808139.1 protein_id gnl|my_center|LOCUS_08960 >Feature sequence126 103 540 gene locus_tag LOCUS_08970 103 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08970 703 1113 gene locus_tag LOCUS_08980 703 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 2544 1351 gene locus_tag LOCUS_08990 2544 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 2753 2550 gene locus_tag LOCUS_09000 2753 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 3175 2657 gene locus_tag LOCUS_09010 3175 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 2698 2707 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3460 3897 gene locus_tag LOCUS_09020 gene rplM 3460 3897 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459272.1 protein_id gnl|my_center|LOCUS_09020 >Feature sequence127 <1 2047 gene locus_tag LOCUS_09030 <1 2047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016931.1:acyl-CoA dehydratase activase 2053 3363 gene locus_tag LOCUS_09040 2053 3363 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016932.1 protein_id gnl|my_center|LOCUS_09040 3400 3726 gene locus_tag LOCUS_09050 3400 3726 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399122.1 protein_id gnl|my_center|LOCUS_09050 3713 4090 gene locus_tag LOCUS_09060 3713 4090 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640651.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence128 1644 892 gene locus_tag LOCUS_09070 1644 892 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770693.1 protein_id gnl|my_center|LOCUS_09070 2555 1641 gene locus_tag LOCUS_09080 2555 1641 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458890.1 protein_id gnl|my_center|LOCUS_09080 3772 2552 gene locus_tag LOCUS_09090 3772 2552 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398755.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence129 109 1197 gene locus_tag LOCUS_09100 gene ylbJ 109 1197 CDS product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392455.1 protein_id gnl|my_center|LOCUS_09100 1465 1674 gene locus_tag LOCUS_09110 1465 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 2096 2314 gene locus_tag LOCUS_09120 2096 2314 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037754.1 protein_id gnl|my_center|LOCUS_09120 2995 2753 gene locus_tag LOCUS_09130 2995 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 3600 3328 gene locus_tag LOCUS_09140 3600 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 >Feature sequence130 1776 526 gene locus_tag LOCUS_09150 gene thiH 1776 526 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015813.1 protein_id gnl|my_center|LOCUS_09150 2563 1790 gene locus_tag LOCUS_09160 2563 1790 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015814.1 protein_id gnl|my_center|LOCUS_09160 3381 2560 gene locus_tag LOCUS_09170 gene thiF 3381 2560 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056327.1 protein_id gnl|my_center|LOCUS_09170 3577 3383 gene locus_tag LOCUS_09180 gene thiS 3577 3383 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_09180 >Feature sequence131 503 1012 gene locus_tag LOCUS_09190 gene def 503 1012 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_09190 1012 1947 gene locus_tag LOCUS_09200 gene fmt 1012 1947 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392417.1 protein_id gnl|my_center|LOCUS_09200 1239 1248 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1944 3245 gene locus_tag LOCUS_09210 gene rsmB 1944 3245 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_09210 >Feature sequence132 1441 734 gene locus_tag LOCUS_09220 gene sigF 1441 734 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 protein_id gnl|my_center|LOCUS_09220 1884 1438 gene locus_tag LOCUS_09230 gene spoIIAB 1884 1438 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230452.1 protein_id gnl|my_center|LOCUS_09230 2268 1939 gene locus_tag LOCUS_09240 2268 1939 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393007.1 protein_id gnl|my_center|LOCUS_09240 3695 2379 gene locus_tag LOCUS_09250 3695 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09250 3716 3725 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence133 <1 1060 gene locus_tag LOCUS_09260 <1 1060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_198480691.1:electron transport complex subunit RsxC 1057 2208 gene locus_tag LOCUS_09270 1057 2208 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_09270 2205 2801 gene locus_tag LOCUS_09280 2205 2801 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_09280 2794 3534 gene locus_tag LOCUS_09290 2794 3534 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_09290 >Feature sequence134 <1 1881 gene locus_tag LOCUS_09300 <1 1881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963848.1:ABC transporter permease 1913 3118 gene locus_tag LOCUS_09310 1913 3118 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707892.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence135 526 2166 gene locus_tag LOCUS_09320 526 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 1251 1260 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2150 2590 gene locus_tag LOCUS_09330 2150 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 >Feature sequence136 82 519 gene locus_tag LOCUS_09340 82 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09340 724 1416 gene locus_tag LOCUS_09350 724 1416 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_09350 1413 2897 gene locus_tag LOCUS_09360 1413 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence137 453 462 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 976 1923 gene locus_tag LOCUS_09370 gene spoIVB 976 1923 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965372.1 protein_id gnl|my_center|LOCUS_09370 2949 1978 gene locus_tag LOCUS_09380 gene pdaA 2949 1978 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897898.1 protein_id gnl|my_center|LOCUS_09380 <3881 2993 gene locus_tag LOCUS_09390 <3881 2993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963614.1:bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase >Feature sequence138 <1 1283 gene locus_tag LOCUS_09400 <1 1283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048439.1:NAD(P)/FAD-dependent oxidoreductase 2672 1422 gene locus_tag LOCUS_09410 2672 1422 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234986.1 protein_id gnl|my_center|LOCUS_09410 <3850 2771 gene locus_tag LOCUS_09420 <3850 2771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392748.1:6-phosphofructokinase >Feature sequence139 <3826 2149 gene locus_tag LOCUS_09430 <3826 2149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003226808.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence140 181 1224 gene locus_tag LOCUS_09440 181 1224 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136824.1 protein_id gnl|my_center|LOCUS_09440 1227 1424 gene locus_tag LOCUS_09450 1227 1424 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796544.1 protein_id gnl|my_center|LOCUS_09450 2228 1521 gene locus_tag LOCUS_09460 2228 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 2340 2349 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3439 2498 gene locus_tag LOCUS_09470 3439 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 >Feature sequence141 1096 95 gene locus_tag LOCUS_09480 1096 95 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963846.1 protein_id gnl|my_center|LOCUS_09480 1772 1104 gene locus_tag LOCUS_09490 1772 1104 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434895.1 protein_id gnl|my_center|LOCUS_09490 >Feature sequence142 312 1025 gene locus_tag LOCUS_09500 312 1025 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391449.1 protein_id gnl|my_center|LOCUS_09500 1018 1857 gene locus_tag LOCUS_09510 1018 1857 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_09510 1860 2411 gene locus_tag LOCUS_09520 1860 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 3460 2492 gene locus_tag LOCUS_09530 gene dusB 3460 2492 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_09530 >Feature sequence143 129 1184 gene locus_tag LOCUS_09540 129 1184 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114722.1 protein_id gnl|my_center|LOCUS_09540 1189 2598 gene locus_tag LOCUS_09550 1189 2598 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_09550 3576 2584 gene locus_tag LOCUS_09560 gene mtnA 3576 2584 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460451.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence144 <1 1653 gene locus_tag LOCUS_09570 <1 1653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002329642.1:alpha-glucosidase 1650 2369 gene locus_tag LOCUS_09580 1650 2369 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922420.1 protein_id gnl|my_center|LOCUS_09580 <3736 2424 gene locus_tag LOCUS_09590 <3736 2424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002917858.1:4-alpha-glucanotransferase >Feature sequence145 <1 3048 gene locus_tag LOCUS_09600 <1 3048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000572274.1:helicase-exonuclease AddAB subunit AddA 3182 3385 gene locus_tag LOCUS_09610 gene rpmE 3182 3385 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462249.1 protein_id gnl|my_center|LOCUS_09610 >Feature sequence146 1031 444 gene locus_tag LOCUS_09620 1031 444 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461089.1 protein_id gnl|my_center|LOCUS_09620 1474 1058 gene locus_tag LOCUS_09630 1474 1058 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263255.1 protein_id gnl|my_center|LOCUS_09630 2646 1576 gene locus_tag LOCUS_09640 2646 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence147 1989 637 gene locus_tag LOCUS_09650 gene hisS 1989 637 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036976.1 protein_id gnl|my_center|LOCUS_09650 2535 2116 gene locus_tag LOCUS_09660 gene mgsA 2535 2116 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_09660 3323 2583 gene locus_tag LOCUS_09670 gene minD 3323 2583 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503310.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence148 783 1361 gene locus_tag LOCUS_09680 783 1361 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965241.1 protein_id gnl|my_center|LOCUS_09680 1405 2133 gene locus_tag LOCUS_09690 1405 2133 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584037.1 protein_id gnl|my_center|LOCUS_09690 >Feature sequence149 1185 814 gene locus_tag LOCUS_09700 1185 814 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384683.1 protein_id gnl|my_center|LOCUS_09700 1787 1182 gene locus_tag LOCUS_09710 gene rnhB 1787 1182 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262424.1 protein_id gnl|my_center|LOCUS_09710 2695 1784 gene locus_tag LOCUS_09720 gene ylqF 2695 1784 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_09720 3447 3022 gene locus_tag LOCUS_09730 3447 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 >Feature sequence150 2114 1089 gene locus_tag LOCUS_09740 gene pheS 2114 1089 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436795.1 protein_id gnl|my_center|LOCUS_09740 3064 2465 gene locus_tag LOCUS_09750 3064 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 >Feature sequence151 1479 910 gene locus_tag LOCUS_09760 1479 910 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_09760 2901 1645 gene locus_tag LOCUS_09770 2901 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 <3597 2998 gene locus_tag LOCUS_09780 <3597 2998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003596227.1:transcription-repair coupling factor >Feature sequence152 3 269 gene locus_tag LOCUS_09790 3 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 541 1311 gene locus_tag LOCUS_09800 gene cobS 541 1311 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460078.1 protein_id gnl|my_center|LOCUS_09800 1308 1646 gene locus_tag LOCUS_09810 1308 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1636 2211 gene locus_tag LOCUS_09820 1636 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1903 1912 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2224 3198 gene locus_tag LOCUS_09830 gene cbiB 2224 3198 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_09830 >Feature sequence153 1283 1292 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2158 1520 gene locus_tag LOCUS_09840 gene yunB 2158 1520 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418439.1 protein_id gnl|my_center|LOCUS_09840 3402 2281 gene locus_tag LOCUS_09850 3402 2281 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965138.1 protein_id gnl|my_center|LOCUS_09850 2493 2502 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence154 2277 1549 gene locus_tag LOCUS_09860 gene cobI 2277 1549 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392605.1 protein_id gnl|my_center|LOCUS_09860 3065 2274 gene locus_tag LOCUS_09870 3065 2274 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168485.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence155 2442 1729 gene locus_tag LOCUS_09880 2442 1729 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810589.1 protein_id gnl|my_center|LOCUS_09880 3515 2472 gene locus_tag LOCUS_09890 3515 2472 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027623.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence156 2 223 gene locus_tag LOCUS_09900 2 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 238 369 gene locus_tag LOCUS_09910 238 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 369 545 gene locus_tag LOCUS_09920 369 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 647 997 gene locus_tag LOCUS_09930 647 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 1013 1402 gene locus_tag LOCUS_09940 1013 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1419 1724 gene locus_tag LOCUS_09950 1419 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1822 3351 gene locus_tag LOCUS_09960 1822 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 >Feature sequence157 20 1177 gene locus_tag LOCUS_09970 gene wecB 20 1177 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393864.1 protein_id gnl|my_center|LOCUS_09970 1428 1150 gene locus_tag LOCUS_09980 1428 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 1807 1421 gene locus_tag LOCUS_09990 1807 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 2102 1827 gene locus_tag LOCUS_10000 2102 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 2216 2644 gene locus_tag LOCUS_10010 2216 2644 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016060.1 protein_id gnl|my_center|LOCUS_10010 2851 3243 gene locus_tag LOCUS_10020 2851 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10020 >Feature sequence158 <1 721 gene locus_tag LOCUS_10030 <1 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682372.1:ABC transporter ATP-binding protein note possible pseudo, frameshifted 675 1514 gene locus_tag LOCUS_10040 675 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10040 1477 3375 gene locus_tag LOCUS_10050 1477 3375 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671827.1 protein_id gnl|my_center|LOCUS_10050 >Feature sequence159 172 1056 gene locus_tag LOCUS_10060 gene truB 172 1056 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400189.1 protein_id gnl|my_center|LOCUS_10060 1094 1103 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2163 1129 gene locus_tag LOCUS_10070 gene bioB 2163 1129 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_10070 2609 2241 gene locus_tag LOCUS_10080 gene cutA 2609 2241 CDS product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949143.1 protein_id gnl|my_center|LOCUS_10080 2435 2444 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <3461 2609 gene locus_tag LOCUS_10090 <3461 2609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987157.1:aminoacyl-histidine dipeptidase >Feature sequence160 <3453 2102 gene locus_tag LOCUS_10100 <3453 2102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009898459.1:Na/Pi cotransporter family protein >Feature sequence161 3325 2525 gene locus_tag LOCUS_10110 3325 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 >Feature sequence162 1270 422 gene locus_tag LOCUS_10120 gene panB 1270 422 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287874.1 protein_id gnl|my_center|LOCUS_10120 2144 1284 gene locus_tag LOCUS_10130 2144 1284 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287872.1 protein_id gnl|my_center|LOCUS_10130 2627 2385 gene locus_tag LOCUS_10140 2627 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 2872 2615 gene locus_tag LOCUS_10150 2872 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 >Feature sequence163 404 976 gene locus_tag LOCUS_10160 404 976 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437445.1 protein_id gnl|my_center|LOCUS_10160 1002 1922 gene locus_tag LOCUS_10170 1002 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 2158 2967 gene locus_tag LOCUS_10180 2158 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 >Feature sequence164 1098 424 gene locus_tag LOCUS_10190 1098 424 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024089.1 protein_id gnl|my_center|LOCUS_10190 2473 1133 gene locus_tag LOCUS_10200 2473 1133 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809868.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence165 1413 676 gene locus_tag LOCUS_10210 1413 676 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_10210 2534 1428 gene locus_tag LOCUS_10220 gene dacB 2534 1428 CDS product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230505.1 protein_id gnl|my_center|LOCUS_10220 3075 2662 gene locus_tag LOCUS_10230 gene ytfJ 3075 2662 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402813.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence166 <1 801 gene locus_tag LOCUS_10240 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392702.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme 852 1451 gene locus_tag LOCUS_10250 gene thrH 852 1451 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_10250 1468 2748 gene locus_tag LOCUS_10260 1468 2748 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence167 1979 1503 gene locus_tag LOCUS_10270 1979 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 >Feature sequence168 50 463 gene locus_tag LOCUS_10280 50 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1548 559 gene locus_tag LOCUS_10290 1548 559 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_10290 1844 2902 gene locus_tag LOCUS_10300 1844 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 2899 3201 gene locus_tag LOCUS_10310 2899 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence169 291 1433 gene locus_tag LOCUS_10320 291 1433 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732062.1 protein_id gnl|my_center|LOCUS_10320 1623 1907 gene locus_tag LOCUS_10330 1623 1907 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence170 >Feature sequence171 692 18 gene locus_tag LOCUS_10340 692 18 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438070.1 protein_id gnl|my_center|LOCUS_10340 2540 696 gene locus_tag LOCUS_10350 2540 696 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099491.1 protein_id gnl|my_center|LOCUS_10350 3144 2647 gene locus_tag LOCUS_10360 3144 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence172 2821 2003 gene locus_tag LOCUS_10370 2821 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence173 1285 110 gene locus_tag LOCUS_10380 gene nifS 1285 110 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_10380 1507 1680 gene locus_tag LOCUS_10390 1507 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 1663 1672 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1692 2480 gene locus_tag LOCUS_10400 1692 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 >Feature sequence174 <1 522 gene locus_tag LOCUS_10410 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392813.1:asparagine synthase (glutamine-hydrolyzing) 1940 528 gene locus_tag LOCUS_10420 1940 528 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969140.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence175 273 2273 gene locus_tag LOCUS_10430 273 2273 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986938.1 protein_id gnl|my_center|LOCUS_10430 2275 2754 gene locus_tag LOCUS_10440 2275 2754 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869602.1 protein_id gnl|my_center|LOCUS_10440 >Feature sequence176 1743 556 gene locus_tag LOCUS_10450 1743 556 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861434.1 protein_id gnl|my_center|LOCUS_10450 2621 1803 gene locus_tag LOCUS_10460 gene argB 2621 1803 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence177 989 279 gene locus_tag LOCUS_10470 989 279 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666310.1 protein_id gnl|my_center|LOCUS_10470 2515 989 gene locus_tag LOCUS_10480 2515 989 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence178 119 625 gene locus_tag LOCUS_10490 119 625 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393068.1 protein_id gnl|my_center|LOCUS_10490 622 1479 gene locus_tag LOCUS_10500 622 1479 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060947.1 protein_id gnl|my_center|LOCUS_10500 1545 2225 gene locus_tag LOCUS_10510 1545 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 <2997 2275 gene locus_tag LOCUS_10520 <2997 2275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814514.1:HAMP domain-containing sensor histidine kinase >Feature sequence179 15 1307 gene locus_tag LOCUS_10530 15 1307 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_10530 1304 2584 gene locus_tag LOCUS_10540 1304 2584 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244823.1 protein_id gnl|my_center|LOCUS_10540 >Feature sequence180 1099 17 gene locus_tag LOCUS_10550 1099 17 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_10550 1971 1165 gene locus_tag LOCUS_10560 gene proB 1971 1165 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723561.1 protein_id gnl|my_center|LOCUS_10560 2204 2213 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2341 2688 gene locus_tag LOCUS_10570 2341 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence181 1289 522 gene locus_tag LOCUS_10580 gene udp 1289 522 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_10580 2260 1328 gene locus_tag LOCUS_10590 2260 1328 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172553.1 protein_id gnl|my_center|LOCUS_10590 <2970 2343 gene locus_tag LOCUS_10600 <2970 2343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002293380.1:rhamnulose-1-phosphate aldolase >Feature sequence182 <1 1124 gene locus_tag LOCUS_10610 <1 1124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943984.1:16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB 1117 2154 gene locus_tag LOCUS_10620 gene rlmN 1117 2154 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_10620 2179 2892 gene locus_tag LOCUS_10630 2179 2892 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648699.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence183 >Feature sequence184 221 3 gene locus_tag LOCUS_10640 221 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 2523 223 gene locus_tag LOCUS_10650 gene topA 2523 223 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541498.1 protein_id gnl|my_center|LOCUS_10650 2900 2589 gene locus_tag LOCUS_10660 2900 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 >Feature sequence185 204 1307 gene locus_tag LOCUS_10670 204 1307 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272365.1 protein_id gnl|my_center|LOCUS_10670 1304 1489 gene locus_tag LOCUS_10680 1304 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 1514 2593 gene locus_tag LOCUS_10690 1514 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence186 20 1852 gene locus_tag LOCUS_10700 20 1852 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460094.1 protein_id gnl|my_center|LOCUS_10700 1566 1575 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1849 2478 gene locus_tag LOCUS_10710 1849 2478 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045791.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence187 1190 459 gene locus_tag LOCUS_10720 1190 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10720 481 490 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1534 1609 gene locus_tag LOCUS_t00180 1534 1609 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2340 2023 gene locus_tag LOCUS_10730 2340 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence188 1664 387 gene locus_tag LOCUS_10740 1664 387 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887812.1 protein_id gnl|my_center|LOCUS_10740 <2877 1750 gene locus_tag LOCUS_10750 <2877 1750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015868.1:leucine-rich repeat domain-containing protein >Feature sequence189 79 861 gene locus_tag LOCUS_10760 79 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 1386 868 gene locus_tag LOCUS_10770 1386 868 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883304.1 protein_id gnl|my_center|LOCUS_10770 2455 1817 gene locus_tag LOCUS_10780 2455 1817 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966000.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence190 101 2170 gene locus_tag LOCUS_10790 gene fusA 101 2170 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence191 <1 829 gene locus_tag LOCUS_10800 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039484.1:sulfate ABC transporter substrate-binding protein 834 1670 gene locus_tag LOCUS_10810 gene cysT 834 1670 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926820.1 protein_id gnl|my_center|LOCUS_10810 1689 2522 gene locus_tag LOCUS_10820 gene cysW 1689 2522 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142072.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence192 1292 672 gene locus_tag LOCUS_10830 1292 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 2783 1329 gene locus_tag LOCUS_10840 2783 1329 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence193 1132 662 gene locus_tag LOCUS_10850 1132 662 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357714.1 protein_id gnl|my_center|LOCUS_10850 1360 2601 gene locus_tag LOCUS_10860 1360 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence194 2013 256 gene locus_tag LOCUS_10870 2013 256 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_10870 <2827 2301 gene locus_tag LOCUS_10880 <2827 2301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272451.1:DAK2 domain-containing protein >Feature sequence195 2436 2245 gene locus_tag LOCUS_10890 2436 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 >Feature sequence196 2761 2360 gene locus_tag LOCUS_10900 2761 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 >Feature sequence197 863 1534 gene locus_tag LOCUS_10910 863 1534 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948592.1 protein_id gnl|my_center|LOCUS_10910 1531 2616 gene locus_tag LOCUS_10920 1531 2616 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928176.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence198 >Feature sequence199 2330 504 gene locus_tag LOCUS_10930 gene typA 2330 504 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393394.1 protein_id gnl|my_center|LOCUS_10930 >Feature sequence200 625 1167 gene locus_tag LOCUS_10940 625 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1289 2449 gene locus_tag LOCUS_10950 1289 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 >Feature sequence201 150 995 gene locus_tag LOCUS_10960 150 995 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357673.1 protein_id gnl|my_center|LOCUS_10960 1029 1355 gene locus_tag LOCUS_10970 gene trxA 1029 1355 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830148.1 protein_id gnl|my_center|LOCUS_10970 1352 2149 gene locus_tag LOCUS_10980 1352 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 2125 2547 gene locus_tag LOCUS_10990 2125 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 >Feature sequence202 <1 524 gene locus_tag LOCUS_11000 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003422921.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase 545 718 gene locus_tag LOCUS_11010 545 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 750 1541 gene locus_tag LOCUS_11020 gene dapF 750 1541 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768322.1 protein_id gnl|my_center|LOCUS_11020 1627 2367 gene locus_tag LOCUS_11030 1627 2367 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393850.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence203 12 500 gene locus_tag LOCUS_11040 12 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1752 487 gene locus_tag LOCUS_11050 1752 487 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964978.1 protein_id gnl|my_center|LOCUS_11050 <2623 1766 gene locus_tag LOCUS_11060 <2623 1766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246072.1:leucine--tRNA ligase >Feature sequence204 49 987 gene locus_tag LOCUS_11070 49 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1000 1575 gene locus_tag LOCUS_11080 1000 1575 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807769.1 protein_id gnl|my_center|LOCUS_11080 1593 1602 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence205 1013 258 gene locus_tag LOCUS_11090 gene pdaB 1013 258 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048155.1 protein_id gnl|my_center|LOCUS_11090 2159 1509 gene locus_tag LOCUS_11100 gene nth 2159 1509 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence206 <1 1637 gene locus_tag LOCUS_11110 <1 1637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272342.1:DNA translocase FtsK >Feature sequence207 891 55 gene locus_tag LOCUS_11120 891 55 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249899.1 protein_id gnl|my_center|LOCUS_11120 1977 910 gene locus_tag LOCUS_11130 gene prfA 1977 910 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_11130 2501 1980 gene locus_tag LOCUS_11140 2501 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 >Feature sequence208 <1 700 gene locus_tag LOCUS_11150 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000088780.1:saccharopine dehydrogenase family protein 697 1902 gene locus_tag LOCUS_11160 gene nspC 697 1902 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764364.1 protein_id gnl|my_center|LOCUS_11160 2212 2137 gene locus_tag LOCUS_t00190 2212 2137 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2299 2225 gene locus_tag LOCUS_t00200 2299 2225 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2437 2361 gene locus_tag LOCUS_t00210 2437 2361 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence209 3 374 gene locus_tag LOCUS_11170 3 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1698 391 gene locus_tag LOCUS_11180 1698 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 >Feature sequence210 <1 655 gene locus_tag LOCUS_11190 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071542436.1:radical SAM protein 1597 680 gene locus_tag LOCUS_11200 1597 680 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_11200 1729 2031 gene locus_tag LOCUS_11210 1729 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 >Feature sequence211