>Feature sequence001 470 1690 gene locus_tag LOCUS_00010 470 1690 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_00010 1757 3064 gene locus_tag LOCUS_00020 1757 3064 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390141.1 protein_id gnl|my_center|LOCUS_00020 3242 3682 gene locus_tag LOCUS_00030 3242 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3791 4288 gene locus_tag LOCUS_00040 3791 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5013 4297 gene locus_tag LOCUS_00050 5013 4297 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454428.1 protein_id gnl|my_center|LOCUS_00050 6507 5161 gene locus_tag LOCUS_00060 6507 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7257 6571 gene locus_tag LOCUS_00070 7257 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7884 7408 gene locus_tag LOCUS_00080 7884 7408 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583226.1 protein_id gnl|my_center|LOCUS_00080 9605 8205 gene locus_tag LOCUS_00090 9605 8205 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048439.1 protein_id gnl|my_center|LOCUS_00090 11302 9800 gene locus_tag LOCUS_00100 11302 9800 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869880.1 protein_id gnl|my_center|LOCUS_00100 13695 12151 gene locus_tag LOCUS_00110 13695 12151 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 protein_id gnl|my_center|LOCUS_00110 14842 13946 gene locus_tag LOCUS_00120 14842 13946 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963493.1 protein_id gnl|my_center|LOCUS_00120 16877 15072 gene locus_tag LOCUS_00130 16877 15072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 17566 17375 gene locus_tag LOCUS_00140 17566 17375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 18252 17791 gene locus_tag LOCUS_00150 gene smpB 18252 17791 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123919.1 protein_id gnl|my_center|LOCUS_00150 18626 18387 gene locus_tag LOCUS_00160 18626 18387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19078 19755 gene locus_tag LOCUS_00170 19078 19755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 19864 20418 gene locus_tag LOCUS_00180 19864 20418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21283 20573 gene locus_tag LOCUS_00190 21283 20573 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583993.1 protein_id gnl|my_center|LOCUS_00190 22614 21403 gene locus_tag LOCUS_00200 22614 21403 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095809.1 protein_id gnl|my_center|LOCUS_00200 23963 22839 gene locus_tag LOCUS_00210 23963 22839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 26086 24479 gene locus_tag LOCUS_00220 26086 24479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 27311 26355 gene locus_tag LOCUS_00230 27311 26355 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_00230 28377 27391 gene locus_tag LOCUS_00240 28377 27391 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 protein_id gnl|my_center|LOCUS_00240 29263 28391 gene locus_tag LOCUS_00250 29263 28391 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453817.1 protein_id gnl|my_center|LOCUS_00250 30212 29250 gene locus_tag LOCUS_00260 30212 29250 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_00260 31880 30303 gene locus_tag LOCUS_00270 31880 30303 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016819.1 protein_id gnl|my_center|LOCUS_00270 33639 32182 gene locus_tag LOCUS_00280 33639 32182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 35311 33671 gene locus_tag LOCUS_00290 35311 33671 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084146450.1 protein_id gnl|my_center|LOCUS_00290 37049 35436 gene locus_tag LOCUS_00300 37049 35436 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084146450.1 protein_id gnl|my_center|LOCUS_00300 37209 37012 gene locus_tag LOCUS_00310 37209 37012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 38251 37229 gene locus_tag LOCUS_00320 38251 37229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 39474 38377 gene locus_tag LOCUS_00330 39474 38377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 39986 41359 gene locus_tag LOCUS_00340 39986 41359 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_00340 41477 42574 gene locus_tag LOCUS_00350 gene galM 41477 42574 CDS product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263236.1 protein_id gnl|my_center|LOCUS_00350 42863 43288 gene locus_tag LOCUS_00360 42863 43288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 43288 44661 gene locus_tag LOCUS_00370 43288 44661 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066177.1 protein_id gnl|my_center|LOCUS_00370 45290 44769 gene locus_tag LOCUS_00380 45290 44769 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060742.1 protein_id gnl|my_center|LOCUS_00380 45465 45316 gene locus_tag LOCUS_00390 45465 45316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 47305 45581 gene locus_tag LOCUS_00400 47305 45581 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775581.1 protein_id gnl|my_center|LOCUS_00400 47602 47841 gene locus_tag LOCUS_00410 47602 47841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 47948 48023 gene locus_tag LOCUS_t00010 47948 48023 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 49761 48061 gene locus_tag LOCUS_00420 49761 48061 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_00420 50563 50048 gene locus_tag LOCUS_00430 50563 50048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 52398 50923 gene locus_tag LOCUS_00440 52398 50923 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704601.1 protein_id gnl|my_center|LOCUS_00440 55355 52773 gene locus_tag LOCUS_00450 55355 52773 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990086.1 protein_id gnl|my_center|LOCUS_00450 57427 55619 gene locus_tag LOCUS_00460 57427 55619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 58786 57824 gene locus_tag LOCUS_00470 58786 57824 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815889.1 protein_id gnl|my_center|LOCUS_00470 59963 58956 gene locus_tag LOCUS_00480 59963 58956 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860722.1 protein_id gnl|my_center|LOCUS_00480 61522 60050 gene locus_tag LOCUS_00490 61522 60050 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860721.1 protein_id gnl|my_center|LOCUS_00490 63359 61797 gene locus_tag LOCUS_00500 63359 61797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 64869 63496 gene locus_tag LOCUS_00510 64869 63496 CDS product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459600.1 protein_id gnl|my_center|LOCUS_00510 65154 66062 gene locus_tag LOCUS_00520 65154 66062 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423235.1 protein_id gnl|my_center|LOCUS_00520 67929 66298 gene locus_tag LOCUS_00530 67929 66298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 68343 68131 gene locus_tag LOCUS_00540 68343 68131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 69909 68491 gene locus_tag LOCUS_00550 69909 68491 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094729231.1 protein_id gnl|my_center|LOCUS_00550 71106 70240 gene locus_tag LOCUS_00560 71106 70240 CDS product ARMT1-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582978.1 protein_id gnl|my_center|LOCUS_00560 72171 71134 gene locus_tag LOCUS_00570 72171 71134 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547989.1 protein_id gnl|my_center|LOCUS_00570 73864 72284 gene locus_tag LOCUS_00580 73864 72284 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_00580 74865 74044 gene locus_tag LOCUS_00590 74865 74044 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865299.1 protein_id gnl|my_center|LOCUS_00590 76321 75338 gene locus_tag LOCUS_00600 76321 75338 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521577.1 protein_id gnl|my_center|LOCUS_00600 77815 76325 gene locus_tag LOCUS_00610 77815 76325 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612398.1 protein_id gnl|my_center|LOCUS_00610 78964 77915 gene locus_tag LOCUS_00620 78964 77915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 80617 79121 gene locus_tag LOCUS_00630 80617 79121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 81489 80614 gene locus_tag LOCUS_00640 81489 80614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 83208 81595 gene locus_tag LOCUS_00650 83208 81595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 84631 83441 gene locus_tag LOCUS_00660 gene gguB 84631 83441 CDS product sugar ABC transporter permease GguB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311699.1 protein_id gnl|my_center|LOCUS_00660 86186 84648 gene locus_tag LOCUS_00670 gene gguA 86186 84648 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533633.1 protein_id gnl|my_center|LOCUS_00670 87565 86444 gene locus_tag LOCUS_00680 gene chvE 87565 86444 CDS product sugar ABC transporter substrate-binding protein ChvE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311697.1 protein_id gnl|my_center|LOCUS_00680 88046 89068 gene locus_tag LOCUS_00690 88046 89068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 89070 90608 gene locus_tag LOCUS_00700 89070 90608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 90773 92416 gene locus_tag LOCUS_00710 90773 92416 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_00710 92596 93657 gene locus_tag LOCUS_00720 gene xylF 92596 93657 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936757.1 protein_id gnl|my_center|LOCUS_00720 95419 93683 gene locus_tag LOCUS_00730 95419 93683 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990061.1 protein_id gnl|my_center|LOCUS_00730 96321 95404 gene locus_tag LOCUS_00740 96321 95404 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546354.1 protein_id gnl|my_center|LOCUS_00740 96697 97725 gene locus_tag LOCUS_00750 96697 97725 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392448.1 protein_id gnl|my_center|LOCUS_00750 97951 99528 gene locus_tag LOCUS_00760 97951 99528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 100033 99656 gene locus_tag LOCUS_00770 100033 99656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391648.1 protein_id gnl|my_center|LOCUS_00770 100938 100258 gene locus_tag LOCUS_00780 100938 100258 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703288.1 protein_id gnl|my_center|LOCUS_00780 103249 101312 gene locus_tag LOCUS_00790 103249 101312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 103677 104543 gene locus_tag LOCUS_00800 103677 104543 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643080.1 protein_id gnl|my_center|LOCUS_00800 104977 104687 gene locus_tag LOCUS_00810 104977 104687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 105327 104974 gene locus_tag LOCUS_00820 105327 104974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 105640 108147 gene locus_tag LOCUS_00830 105640 108147 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674247.1 protein_id gnl|my_center|LOCUS_00830 110019 108478 gene locus_tag LOCUS_00840 110019 108478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 110427 111320 gene locus_tag LOCUS_00850 gene cysD 110427 111320 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_00850 111320 113143 gene locus_tag LOCUS_00860 gene cysN 111320 113143 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503688.1 protein_id gnl|my_center|LOCUS_00860 113352 114467 gene locus_tag LOCUS_00870 113352 114467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 115932 114565 gene locus_tag LOCUS_00880 115932 114565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 117456 115975 gene locus_tag LOCUS_00890 117456 115975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484949.1 protein_id gnl|my_center|LOCUS_00890 120024 117565 gene locus_tag LOCUS_00900 120024 117565 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014636419.1 protein_id gnl|my_center|LOCUS_00900 121882 121700 gene locus_tag LOCUS_00910 121882 121700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 122928 121978 gene locus_tag LOCUS_00920 122928 121978 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994687.1 protein_id gnl|my_center|LOCUS_00920 123216 123815 gene locus_tag LOCUS_00930 123216 123815 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 protein_id gnl|my_center|LOCUS_00930 125217 124159 gene locus_tag LOCUS_00940 125217 124159 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140468.1 protein_id gnl|my_center|LOCUS_00940 126032 125262 gene locus_tag LOCUS_00950 126032 125262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 127824 126571 gene locus_tag LOCUS_00960 127824 126571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 128091 127939 gene locus_tag LOCUS_00970 128091 127939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 129089 128088 gene locus_tag LOCUS_00980 129089 128088 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005975400.1 protein_id gnl|my_center|LOCUS_00980 129876 129079 gene locus_tag LOCUS_00990 129876 129079 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903786.1 protein_id gnl|my_center|LOCUS_00990 131586 129958 gene locus_tag LOCUS_01000 131586 129958 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903785.1 protein_id gnl|my_center|LOCUS_01000 132741 131914 gene locus_tag LOCUS_01010 132741 131914 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903784.1 protein_id gnl|my_center|LOCUS_01010 133841 132843 gene locus_tag LOCUS_01020 133841 132843 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015650.1 protein_id gnl|my_center|LOCUS_01020 135298 134756 gene locus_tag LOCUS_01030 135298 134756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 135188 137788 gene locus_tag LOCUS_01040 135188 137788 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461988.1 protein_id gnl|my_center|LOCUS_01040 137971 138921 gene locus_tag LOCUS_01050 137971 138921 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836550.1 protein_id gnl|my_center|LOCUS_01050 139516 140052 gene locus_tag LOCUS_01060 139516 140052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 142401 140149 gene locus_tag LOCUS_01070 142401 140149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 143799 142696 gene locus_tag LOCUS_01080 143799 142696 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143046.1 protein_id gnl|my_center|LOCUS_01080 144235 144041 gene locus_tag LOCUS_01090 144235 144041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 144537 144232 gene locus_tag LOCUS_01100 144537 144232 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994780.1 protein_id gnl|my_center|LOCUS_01100 145526 144624 gene locus_tag LOCUS_01110 145526 144624 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_01110 146160 147545 gene locus_tag LOCUS_01120 gene melB 146160 147545 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032709637.1 protein_id gnl|my_center|LOCUS_01120 148318 147548 gene locus_tag LOCUS_01130 148318 147548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 148799 149128 gene locus_tag LOCUS_01140 148799 149128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 150663 149341 gene locus_tag LOCUS_01150 150663 149341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 152056 150824 gene locus_tag LOCUS_01160 152056 150824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 152177 152914 gene locus_tag LOCUS_01170 152177 152914 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427805.1 protein_id gnl|my_center|LOCUS_01170 153930 153184 gene locus_tag LOCUS_01180 gene cobI 153930 153184 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461549.1 protein_id gnl|my_center|LOCUS_01180 154669 154343 gene locus_tag LOCUS_01190 154669 154343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 155541 156899 gene locus_tag LOCUS_01200 155541 156899 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_01200 158779 157163 gene locus_tag LOCUS_01210 158779 157163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 160171 159248 gene locus_tag LOCUS_01220 160171 159248 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727964.1 protein_id gnl|my_center|LOCUS_01220 161146 160190 gene locus_tag LOCUS_01230 161146 160190 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285971.1 protein_id gnl|my_center|LOCUS_01230 162346 161258 gene locus_tag LOCUS_01240 162346 161258 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974942.1 protein_id gnl|my_center|LOCUS_01240 165711 162883 gene locus_tag LOCUS_01250 165711 162883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 167721 166030 gene locus_tag LOCUS_01260 167721 166030 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458957.1 protein_id gnl|my_center|LOCUS_01260 168296 169663 gene locus_tag LOCUS_01270 168296 169663 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_01270 170095 169712 gene locus_tag LOCUS_01280 170095 169712 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 protein_id gnl|my_center|LOCUS_01280 170370 170092 gene locus_tag LOCUS_01290 170370 170092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 171389 170679 gene locus_tag LOCUS_01300 171389 170679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 173935 171788 gene locus_tag LOCUS_01310 173935 171788 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459421.1 protein_id gnl|my_center|LOCUS_01310 174378 175265 gene locus_tag LOCUS_01320 174378 175265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 175411 175614 gene locus_tag LOCUS_01330 175411 175614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 175595 175909 gene locus_tag LOCUS_01340 175595 175909 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396712.1 protein_id gnl|my_center|LOCUS_01340 176089 176400 gene locus_tag LOCUS_01350 176089 176400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 176568 177233 gene locus_tag LOCUS_01360 176568 177233 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963612.1 protein_id gnl|my_center|LOCUS_01360 177976 177371 gene locus_tag LOCUS_01370 177976 177371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 178733 177951 gene locus_tag LOCUS_01380 178733 177951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 179602 178859 gene locus_tag LOCUS_01390 179602 178859 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861366.1 protein_id gnl|my_center|LOCUS_01390 180268 180041 gene locus_tag LOCUS_01400 180268 180041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 180663 180274 gene locus_tag LOCUS_01410 180663 180274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 181143 180931 gene locus_tag LOCUS_01420 181143 180931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 181352 181164 gene locus_tag LOCUS_01430 181352 181164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 181479 182261 gene locus_tag LOCUS_01440 181479 182261 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105572.1 protein_id gnl|my_center|LOCUS_01440 182248 182496 gene locus_tag LOCUS_01450 182248 182496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 183025 182609 gene locus_tag LOCUS_01460 183025 182609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 184298 183192 gene locus_tag LOCUS_01470 184298 183192 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963504.1 protein_id gnl|my_center|LOCUS_01470 185575 184298 gene locus_tag LOCUS_01480 185575 184298 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861634.1 protein_id gnl|my_center|LOCUS_01480 187159 185591 gene locus_tag LOCUS_01490 187159 185591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 188162 187173 gene locus_tag LOCUS_01500 188162 187173 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_01500 190965 188605 gene locus_tag LOCUS_01510 190965 188605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 191817 191191 gene locus_tag LOCUS_01520 191817 191191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 192468 192016 gene locus_tag LOCUS_01530 192468 192016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 192814 192494 gene locus_tag LOCUS_01540 192814 192494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 192966 192811 gene locus_tag LOCUS_01550 192966 192811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 193162 192953 gene locus_tag LOCUS_01560 193162 192953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 194635 193466 gene locus_tag LOCUS_01570 194635 193466 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682004.1 protein_id gnl|my_center|LOCUS_01570 196006 194939 gene locus_tag LOCUS_01580 196006 194939 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682008.1 protein_id gnl|my_center|LOCUS_01580 197858 196077 gene locus_tag LOCUS_01590 197858 196077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 199740 198115 gene locus_tag LOCUS_01600 199740 198115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 201871 200474 gene locus_tag LOCUS_01610 201871 200474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 204504 202351 gene locus_tag LOCUS_01620 204504 202351 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_01620 205557 204712 gene locus_tag LOCUS_01630 205557 204712 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525205.1 protein_id gnl|my_center|LOCUS_01630 206454 205570 gene locus_tag LOCUS_01640 206454 205570 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_01640 207919 206639 gene locus_tag LOCUS_01650 207919 206639 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530238.1 protein_id gnl|my_center|LOCUS_01650 208349 209209 gene locus_tag LOCUS_01660 208349 209209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 211437 209305 gene locus_tag LOCUS_01670 211437 209305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 212583 211708 gene locus_tag LOCUS_01680 gene aguB 212583 211708 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246756.1 protein_id gnl|my_center|LOCUS_01680 214028 212694 gene locus_tag LOCUS_01690 214028 212694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 215828 214284 gene locus_tag LOCUS_01700 215828 214284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 217393 216005 gene locus_tag LOCUS_01710 217393 216005 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088780.1 protein_id gnl|my_center|LOCUS_01710 218447 217638 gene locus_tag LOCUS_01720 218447 217638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 219597 218749 gene locus_tag LOCUS_01730 219597 218749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 219949 220048 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 221633 220236 gene locus_tag LOCUS_01740 221633 220236 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016772.1 protein_id gnl|my_center|LOCUS_01740 222929 221892 gene locus_tag LOCUS_01750 222929 221892 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102084.1 protein_id gnl|my_center|LOCUS_01750 224101 223196 gene locus_tag LOCUS_01760 224101 223196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 224866 224204 gene locus_tag LOCUS_01770 224866 224204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 225616 225071 gene locus_tag LOCUS_01780 225616 225071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 227117 225858 gene locus_tag LOCUS_01790 227117 225858 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211654.1 protein_id gnl|my_center|LOCUS_01790 229005 227374 gene locus_tag LOCUS_01800 229005 227374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 230216 229242 gene locus_tag LOCUS_01810 230216 229242 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_01810 231193 230213 gene locus_tag LOCUS_01820 231193 230213 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 protein_id gnl|my_center|LOCUS_01820 232072 231206 gene locus_tag LOCUS_01830 232072 231206 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_01830 233021 232086 gene locus_tag LOCUS_01840 233021 232086 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_01840 234430 233126 gene locus_tag LOCUS_01850 234430 233126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102087.1 protein_id gnl|my_center|LOCUS_01850 234781 235665 gene locus_tag LOCUS_01860 234781 235665 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421915.1 protein_id gnl|my_center|LOCUS_01860 236464 235658 gene locus_tag LOCUS_01870 gene fabG 236464 235658 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099550.1 protein_id gnl|my_center|LOCUS_01870 237807 236602 gene locus_tag LOCUS_01880 237807 236602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 238193 237804 gene locus_tag LOCUS_01890 238193 237804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767242.1 protein_id gnl|my_center|LOCUS_01890 238538 239725 gene locus_tag LOCUS_01900 238538 239725 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918420.1 protein_id gnl|my_center|LOCUS_01900 239856 241277 gene locus_tag LOCUS_01910 239856 241277 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 protein_id gnl|my_center|LOCUS_01910 241252 241470 gene locus_tag LOCUS_01920 241252 241470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 241703 243367 gene locus_tag LOCUS_01930 241703 243367 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_01930 243563 243441 gene locus_tag LOCUS_01940 243563 243441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 244100 243888 gene locus_tag LOCUS_01950 244100 243888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 244431 244114 gene locus_tag LOCUS_01960 244431 244114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01960 245827 244433 gene locus_tag LOCUS_01970 245827 244433 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930806.1 protein_id gnl|my_center|LOCUS_01970 246173 245814 gene locus_tag LOCUS_01980 246173 245814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 246968 246504 gene locus_tag LOCUS_01990 246968 246504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 247960 247013 gene locus_tag LOCUS_02000 247960 247013 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_02000 248937 247975 gene locus_tag LOCUS_02010 248937 247975 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 protein_id gnl|my_center|LOCUS_02010 249821 248952 gene locus_tag LOCUS_02020 249821 248952 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_02020 250770 249823 gene locus_tag LOCUS_02030 250770 249823 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_02030 252444 250894 gene locus_tag LOCUS_02040 252444 250894 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065068.1 protein_id gnl|my_center|LOCUS_02040 254151 252778 gene locus_tag LOCUS_02050 254151 252778 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_02050 256420 254276 gene locus_tag LOCUS_02060 256420 254276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 257683 256460 gene locus_tag LOCUS_02070 257683 256460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 259416 258052 gene locus_tag LOCUS_02080 259416 258052 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_02080 260269 259430 gene locus_tag LOCUS_02090 gene phlG 260269 259430 CDS product phloretin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112428.1 protein_id gnl|my_center|LOCUS_02090 260741 261694 gene locus_tag LOCUS_02100 260741 261694 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246430.1 protein_id gnl|my_center|LOCUS_02100 263679 261856 gene locus_tag LOCUS_02110 263679 261856 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083002.1 protein_id gnl|my_center|LOCUS_02110 265936 263993 gene locus_tag LOCUS_02120 265936 263993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 267048 266236 gene locus_tag LOCUS_02130 267048 266236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 268346 267570 gene locus_tag LOCUS_02140 268346 267570 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391964.1 protein_id gnl|my_center|LOCUS_02140 269841 268546 gene locus_tag LOCUS_02150 269841 268546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 271507 270119 gene locus_tag LOCUS_02160 271507 270119 CDS product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459600.1 protein_id gnl|my_center|LOCUS_02160 272576 271569 gene locus_tag LOCUS_02170 272576 271569 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053899.1 protein_id gnl|my_center|LOCUS_02170 273838 272834 gene locus_tag LOCUS_02180 273838 272834 CDS product FMN-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254509.1 protein_id gnl|my_center|LOCUS_02180 275064 274171 gene locus_tag LOCUS_02190 275064 274171 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832366.1 protein_id gnl|my_center|LOCUS_02190 277040 275316 gene locus_tag LOCUS_02200 277040 275316 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627326.1 protein_id gnl|my_center|LOCUS_02200 277372 278259 gene locus_tag LOCUS_02210 277372 278259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 278489 278370 gene locus_tag LOCUS_02220 278489 278370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 278500 279144 gene locus_tag LOCUS_02230 278500 279144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 279991 279254 gene locus_tag LOCUS_02240 279991 279254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 281777 280683 gene locus_tag LOCUS_02250 281777 280683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 282029 281838 gene locus_tag LOCUS_02260 282029 281838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 282070 283152 gene locus_tag LOCUS_02270 282070 283152 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140077.1 protein_id gnl|my_center|LOCUS_02270 284549 283503 gene locus_tag LOCUS_02280 284549 283503 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_02280 284700 284494 gene locus_tag LOCUS_02290 284700 284494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 285208 285044 gene locus_tag LOCUS_02300 285208 285044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 285936 285388 gene locus_tag LOCUS_02310 285936 285388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 286277 286062 gene locus_tag LOCUS_02320 286277 286062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 286447 286262 gene locus_tag LOCUS_02330 286447 286262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 >Feature sequence002 2027 273 gene locus_tag LOCUS_02340 2027 273 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_02340 2432 2626 gene locus_tag LOCUS_02350 2432 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 3533 2715 gene locus_tag LOCUS_02360 gene yidA 3533 2715 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861537.1 protein_id gnl|my_center|LOCUS_02360 4854 3706 gene locus_tag LOCUS_02370 4854 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 5087 5004 gene locus_tag LOCUS_t00020 5087 5004 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5203 5131 gene locus_tag LOCUS_t00030 5203 5131 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7212 5446 gene locus_tag LOCUS_02380 7212 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 8207 7407 gene locus_tag LOCUS_02390 8207 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 9732 8278 gene locus_tag LOCUS_02400 gene guaB 9732 8278 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048242.1 protein_id gnl|my_center|LOCUS_02400 10625 10125 gene locus_tag LOCUS_02410 10625 10125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 11431 10751 gene locus_tag LOCUS_02420 11431 10751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 13272 11653 gene locus_tag LOCUS_02430 gene groL 13272 11653 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435012.1 protein_id gnl|my_center|LOCUS_02430 13730 13443 gene locus_tag LOCUS_02440 13730 13443 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_02440 14840 14058 gene locus_tag LOCUS_02450 gene codY 14840 14058 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362579.1 protein_id gnl|my_center|LOCUS_02450 17173 15116 gene locus_tag LOCUS_02460 gene topA 17173 15116 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_02460 18260 17181 gene locus_tag LOCUS_02470 gene dprA 18260 17181 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_02470 20006 18483 gene locus_tag LOCUS_02480 20006 18483 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546463.1 protein_id gnl|my_center|LOCUS_02480 20342 20602 gene locus_tag LOCUS_02490 20342 20602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 21104 22192 gene locus_tag LOCUS_02500 21104 22192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 22189 23418 gene locus_tag LOCUS_02510 22189 23418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 24476 23691 gene locus_tag LOCUS_02520 24476 23691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 24807 25979 gene locus_tag LOCUS_02530 24807 25979 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_02530 26925 26059 gene locus_tag LOCUS_02540 26925 26059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 27550 26936 gene locus_tag LOCUS_02550 gene spoIIIAG 27550 26936 CDS product stage III sporulation protein AG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230248.1 protein_id gnl|my_center|LOCUS_02550 28216 27710 gene locus_tag LOCUS_02560 28216 27710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 29608 28436 gene locus_tag LOCUS_02570 29608 28436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 30093 29752 gene locus_tag LOCUS_02580 gene spoIIIAD 30093 29752 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810912.1 protein_id gnl|my_center|LOCUS_02580 30546 30352 gene locus_tag LOCUS_02590 gene spoIIIAC 30546 30352 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888937.1 protein_id gnl|my_center|LOCUS_02590 31205 30675 gene locus_tag LOCUS_02600 31205 30675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 32134 31190 gene locus_tag LOCUS_02610 gene spoIIIAA 32134 31190 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272423.1 protein_id gnl|my_center|LOCUS_02610 32580 33506 gene locus_tag LOCUS_02620 gene arcC 32580 33506 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037992.1 protein_id gnl|my_center|LOCUS_02620 34446 33499 gene locus_tag LOCUS_02630 34446 33499 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015650.1 protein_id gnl|my_center|LOCUS_02630 36080 34692 gene locus_tag LOCUS_02640 36080 34692 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903785.1 protein_id gnl|my_center|LOCUS_02640 37157 36759 gene locus_tag LOCUS_02650 37157 36759 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293542.1 protein_id gnl|my_center|LOCUS_02650 38860 37424 gene locus_tag LOCUS_02660 38860 37424 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206416.1 protein_id gnl|my_center|LOCUS_02660 39851 38886 gene locus_tag LOCUS_02670 39851 38886 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975981.1 protein_id gnl|my_center|LOCUS_02670 41038 40073 gene locus_tag LOCUS_02680 41038 40073 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209999.1 protein_id gnl|my_center|LOCUS_02680 42528 41041 gene locus_tag LOCUS_02690 42528 41041 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210000.1 protein_id gnl|my_center|LOCUS_02690 43176 42799 gene locus_tag LOCUS_02700 43176 42799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 46019 43347 gene locus_tag LOCUS_02710 46019 43347 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582505.1 protein_id gnl|my_center|LOCUS_02710 46415 47536 gene locus_tag LOCUS_02720 46415 47536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 47794 47573 gene locus_tag LOCUS_02730 47794 47573 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_02730 49690 47795 gene locus_tag LOCUS_02740 49690 47795 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458920.1 protein_id gnl|my_center|LOCUS_02740 50208 49933 gene locus_tag LOCUS_02750 50208 49933 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458924.1 protein_id gnl|my_center|LOCUS_02750 51293 50463 gene locus_tag LOCUS_02760 51293 50463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 52497 51451 gene locus_tag LOCUS_02770 52497 51451 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068670.1 protein_id gnl|my_center|LOCUS_02770 53134 54831 gene locus_tag LOCUS_02780 53134 54831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 55691 55050 gene locus_tag LOCUS_02790 55691 55050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 56906 55806 gene locus_tag LOCUS_02800 56906 55806 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_02800 58716 57103 gene locus_tag LOCUS_02810 58716 57103 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 protein_id gnl|my_center|LOCUS_02810 59470 58799 gene locus_tag LOCUS_02820 59470 58799 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728678.1 protein_id gnl|my_center|LOCUS_02820 61116 59689 gene locus_tag LOCUS_02830 gene uxaC 61116 59689 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_02830 62294 61224 gene locus_tag LOCUS_02840 gene uxuA 62294 61224 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391968.1 protein_id gnl|my_center|LOCUS_02840 62757 62407 gene locus_tag LOCUS_02850 62757 62407 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467181.1 protein_id gnl|my_center|LOCUS_02850 63439 62936 gene locus_tag LOCUS_02860 63439 62936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 64926 63634 gene locus_tag LOCUS_02870 64926 63634 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898268.1 protein_id gnl|my_center|LOCUS_02870 65456 64929 gene locus_tag LOCUS_02880 65456 64929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 66691 65699 gene locus_tag LOCUS_02890 66691 65699 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_02890 68391 66913 gene locus_tag LOCUS_02900 68391 66913 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964015.1 protein_id gnl|my_center|LOCUS_02900 70024 68501 gene locus_tag LOCUS_02910 70024 68501 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964014.1 protein_id gnl|my_center|LOCUS_02910 71498 70323 gene locus_tag LOCUS_02920 71498 70323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 73321 71747 gene locus_tag LOCUS_02930 73321 71747 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109161.1 protein_id gnl|my_center|LOCUS_02930 75768 73342 gene locus_tag LOCUS_02940 75768 73342 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107432.1 protein_id gnl|my_center|LOCUS_02940 76892 76056 gene locus_tag LOCUS_02950 76892 76056 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285996.1 protein_id gnl|my_center|LOCUS_02950 77710 76910 gene locus_tag LOCUS_02960 77710 76910 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185874.1 protein_id gnl|my_center|LOCUS_02960 78830 77988 gene locus_tag LOCUS_02970 gene kduI 78830 77988 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098576.1 protein_id gnl|my_center|LOCUS_02970 81222 78931 gene locus_tag LOCUS_02980 gene gnpA 81222 78931 CDS product 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389475.1 protein_id gnl|my_center|LOCUS_02980 82450 81398 gene locus_tag LOCUS_02990 gene yesR 82450 81398 CDS product rhamnogalacturonyl hydrolase YesR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243366.1 protein_id gnl|my_center|LOCUS_02990 84347 82677 gene locus_tag LOCUS_03000 84347 82677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 85360 84431 gene locus_tag LOCUS_03010 85360 84431 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_03010 86468 85521 gene locus_tag LOCUS_03020 86468 85521 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_03020 87315 86878 gene locus_tag LOCUS_03030 gene dutA 87315 86878 CDS product dUTP diphosphatase DutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245820.1 protein_id gnl|my_center|LOCUS_03030 89470 87344 gene locus_tag LOCUS_03040 gene glgX 89470 87344 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122228.1 protein_id gnl|my_center|LOCUS_03040 98060 89655 gene locus_tag LOCUS_03050 98060 89655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 90651 90750 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 99385 98459 gene locus_tag LOCUS_03060 99385 98459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 99723 100196 gene locus_tag LOCUS_03070 99723 100196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 100193 102277 gene locus_tag LOCUS_03080 100193 102277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 104321 102393 gene locus_tag LOCUS_03090 104321 102393 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811724.1 protein_id gnl|my_center|LOCUS_03090 104697 104395 gene locus_tag LOCUS_03100 104697 104395 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_03100 104945 104691 gene locus_tag LOCUS_03110 104945 104691 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587616.1 protein_id gnl|my_center|LOCUS_03110 106346 105165 gene locus_tag LOCUS_03120 106346 105165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 107025 106591 gene locus_tag LOCUS_03130 107025 106591 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_03130 108253 107015 gene locus_tag LOCUS_03140 108253 107015 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_03140 109720 108458 gene locus_tag LOCUS_03150 109720 108458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 111322 109916 gene locus_tag LOCUS_03160 gene sufB 111322 109916 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_03160 112133 111393 gene locus_tag LOCUS_03170 gene sufC 112133 111393 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_03170 114067 112397 gene locus_tag LOCUS_03180 114067 112397 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_03180 114347 114051 gene locus_tag LOCUS_03190 114347 114051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 115866 114472 gene locus_tag LOCUS_03200 115866 114472 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 protein_id gnl|my_center|LOCUS_03200 117037 116054 gene locus_tag LOCUS_03210 117037 116054 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592064.1 protein_id gnl|my_center|LOCUS_03210 117961 117269 gene locus_tag LOCUS_03220 117961 117269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 118528 118001 gene locus_tag LOCUS_03230 118528 118001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 119393 118503 gene locus_tag LOCUS_03240 119393 118503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 120622 119591 gene locus_tag LOCUS_03250 120622 119591 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_03250 121950 120619 gene locus_tag LOCUS_03260 121950 120619 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_03260 123491 121947 gene locus_tag LOCUS_03270 123491 121947 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_03270 124829 123702 gene locus_tag LOCUS_03280 124829 123702 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459550.1 protein_id gnl|my_center|LOCUS_03280 126042 125122 gene locus_tag LOCUS_03290 126042 125122 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_03290 127072 126122 gene locus_tag LOCUS_03300 127072 126122 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948815.1 protein_id gnl|my_center|LOCUS_03300 127513 128358 gene locus_tag LOCUS_03310 127513 128358 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953624.1 protein_id gnl|my_center|LOCUS_03310 130602 128554 gene locus_tag LOCUS_03320 130602 128554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 131700 131083 gene locus_tag LOCUS_03330 131700 131083 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_03330 132499 131714 gene locus_tag LOCUS_03340 132499 131714 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853290.1 protein_id gnl|my_center|LOCUS_03340 133230 132496 gene locus_tag LOCUS_03350 133230 132496 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853332.1 protein_id gnl|my_center|LOCUS_03350 134394 133519 gene locus_tag LOCUS_03360 134394 133519 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027305.1 protein_id gnl|my_center|LOCUS_03360 135329 134604 gene locus_tag LOCUS_03370 135329 134604 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853259.1 protein_id gnl|my_center|LOCUS_03370 136502 135711 gene locus_tag LOCUS_03380 136502 135711 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029409.1 protein_id gnl|my_center|LOCUS_03380 137671 136577 gene locus_tag LOCUS_03390 137671 136577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 138938 137781 gene locus_tag LOCUS_03400 138938 137781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 140543 138954 gene locus_tag LOCUS_03410 140543 138954 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473139.1 protein_id gnl|my_center|LOCUS_03410 140789 140562 gene locus_tag LOCUS_03420 140789 140562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 142501 140978 gene locus_tag LOCUS_03430 142501 140978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 143628 142621 gene locus_tag LOCUS_03440 143628 142621 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355505.1 protein_id gnl|my_center|LOCUS_03440 143932 143859 gene locus_tag LOCUS_t00040 143932 143859 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 145019 144063 gene locus_tag LOCUS_03450 145019 144063 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_03450 146980 145565 gene locus_tag LOCUS_03460 146980 145565 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017109.1 protein_id gnl|my_center|LOCUS_03460 148333 147173 gene locus_tag LOCUS_03470 148333 147173 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_03470 148759 148370 gene locus_tag LOCUS_03480 148759 148370 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_03480 149741 148776 gene locus_tag LOCUS_03490 149741 148776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 151192 149756 gene locus_tag LOCUS_03500 151192 149756 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392670.1 protein_id gnl|my_center|LOCUS_03500 152609 151530 gene locus_tag LOCUS_03510 gene mnmA 152609 151530 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_03510 154063 152864 gene locus_tag LOCUS_03520 gene nifS 154063 152864 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_03520 154584 154114 gene locus_tag LOCUS_03530 154584 154114 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_03530 155882 154986 gene locus_tag LOCUS_03540 155882 154986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 157650 157201 gene locus_tag LOCUS_03550 157650 157201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 159172 157895 gene locus_tag LOCUS_03560 159172 157895 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964143.1 protein_id gnl|my_center|LOCUS_03560 160263 159238 gene locus_tag LOCUS_03570 160263 159238 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_03570 161924 160590 gene locus_tag LOCUS_03580 161924 160590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 163968 162160 gene locus_tag LOCUS_03590 163968 162160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 165150 164107 gene locus_tag LOCUS_03600 165150 164107 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583936.1 protein_id gnl|my_center|LOCUS_03600 166207 165290 gene locus_tag LOCUS_03610 166207 165290 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_03610 168810 166213 gene locus_tag LOCUS_03620 168810 166213 CDS product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259692.1 protein_id gnl|my_center|LOCUS_03620 169532 168900 gene locus_tag LOCUS_03630 169532 168900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 171056 169533 gene locus_tag LOCUS_03640 171056 169533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03640 171991 171071 gene locus_tag LOCUS_03650 171991 171071 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583940.1 protein_id gnl|my_center|LOCUS_03650 172944 171988 gene locus_tag LOCUS_03660 172944 171988 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583941.1 protein_id gnl|my_center|LOCUS_03660 176049 173065 gene locus_tag LOCUS_03670 176049 173065 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_03670 177018 176233 gene locus_tag LOCUS_03680 177018 176233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 178791 177286 gene locus_tag LOCUS_03690 178791 177286 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582688.1 protein_id gnl|my_center|LOCUS_03690 179360 179459 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 179484 179633 gene locus_tag LOCUS_03700 179484 179633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 179652 180569 gene locus_tag LOCUS_03710 179652 180569 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355307.1 protein_id gnl|my_center|LOCUS_03710 182226 180781 gene locus_tag LOCUS_03720 gene glgA 182226 180781 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_03720 182773 182423 gene locus_tag LOCUS_03730 182773 182423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 184924 182819 gene locus_tag LOCUS_03740 184924 182819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 186163 185042 gene locus_tag LOCUS_03750 186163 185042 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_03750 187291 186269 gene locus_tag LOCUS_03760 187291 186269 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_03760 188250 187432 gene locus_tag LOCUS_03770 188250 187432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 189493 188486 gene locus_tag LOCUS_03780 189493 188486 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363756.1 protein_id gnl|my_center|LOCUS_03780 190981 189986 gene locus_tag LOCUS_03790 190981 189986 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809839.1 protein_id gnl|my_center|LOCUS_03790 192069 190978 gene locus_tag LOCUS_03800 192069 190978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809841.1 protein_id gnl|my_center|LOCUS_03800 193059 192109 gene locus_tag LOCUS_03810 193059 192109 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198966.1 protein_id gnl|my_center|LOCUS_03810 194177 193233 gene locus_tag LOCUS_03820 gene gpr 194177 193233 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964587.1 protein_id gnl|my_center|LOCUS_03820 194521 194715 gene locus_tag LOCUS_03830 194521 194715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 194717 195115 gene locus_tag LOCUS_03840 194717 195115 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812484.1 protein_id gnl|my_center|LOCUS_03840 196356 195118 gene locus_tag LOCUS_03850 196356 195118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 198388 196904 gene locus_tag LOCUS_03860 198388 196904 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_03860 202959 198403 gene locus_tag LOCUS_03870 gene gltB 202959 198403 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_03870 204203 203508 gene locus_tag LOCUS_03880 204203 203508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 205468 204308 gene locus_tag LOCUS_03890 205468 204308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 206603 205488 gene locus_tag LOCUS_03900 206603 205488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 207685 206753 gene locus_tag LOCUS_03910 207685 206753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 208245 209132 gene locus_tag LOCUS_03920 gene hemW 208245 209132 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922247.1 protein_id gnl|my_center|LOCUS_03920 211266 209218 gene locus_tag LOCUS_03930 211266 209218 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809087.1 protein_id gnl|my_center|LOCUS_03930 212784 211453 gene locus_tag LOCUS_03940 212784 211453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 213488 212781 gene locus_tag LOCUS_03950 213488 212781 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813911.1 protein_id gnl|my_center|LOCUS_03950 213767 214348 gene locus_tag LOCUS_03960 213767 214348 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357370.1 protein_id gnl|my_center|LOCUS_03960 214420 214569 gene locus_tag LOCUS_03970 214420 214569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 215646 214645 gene locus_tag LOCUS_03980 215646 214645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 216543 215953 gene locus_tag LOCUS_03990 216543 215953 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948351.1 protein_id gnl|my_center|LOCUS_03990 217677 216718 gene locus_tag LOCUS_04000 217677 216718 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948815.1 protein_id gnl|my_center|LOCUS_04000 218114 217854 gene locus_tag LOCUS_04010 gene spoIIID 218114 217854 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356559.1 protein_id gnl|my_center|LOCUS_04010 219871 218255 gene locus_tag LOCUS_04020 219871 218255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 220304 219918 gene locus_tag LOCUS_04030 220304 219918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 220908 220441 gene locus_tag LOCUS_04040 220908 220441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 221172 221540 gene locus_tag LOCUS_04050 221172 221540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 221961 221662 gene locus_tag LOCUS_04060 221961 221662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 223286 222414 gene locus_tag LOCUS_04070 223286 222414 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528984.1 protein_id gnl|my_center|LOCUS_04070 224172 223279 gene locus_tag LOCUS_04080 224172 223279 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528983.1 protein_id gnl|my_center|LOCUS_04080 225953 224730 gene locus_tag LOCUS_04090 225953 224730 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528982.1 protein_id gnl|my_center|LOCUS_04090 226350 227141 gene locus_tag LOCUS_04100 226350 227141 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678767.1 protein_id gnl|my_center|LOCUS_04100 227381 228694 gene locus_tag LOCUS_04110 227381 228694 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272444.1 protein_id gnl|my_center|LOCUS_04110 229520 228846 gene locus_tag LOCUS_04120 229520 228846 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732773.1 protein_id gnl|my_center|LOCUS_04120 230298 229537 gene locus_tag LOCUS_04130 gene hisF 230298 229537 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949116.1 protein_id gnl|my_center|LOCUS_04130 >Feature sequence003 378 989 gene locus_tag LOCUS_04140 378 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 1686 1261 gene locus_tag LOCUS_04150 gene fabZ 1686 1261 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048424.1 protein_id gnl|my_center|LOCUS_04150 2990 1755 gene locus_tag LOCUS_04160 gene fabF 2990 1755 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099549.1 protein_id gnl|my_center|LOCUS_04160 3992 3252 gene locus_tag LOCUS_04170 gene fabG 3992 3252 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_04170 5058 4060 gene locus_tag LOCUS_04180 gene fabD 5058 4060 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_04180 6051 5128 gene locus_tag LOCUS_04190 gene fabK 6051 5128 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_04190 6284 6051 gene locus_tag LOCUS_04200 gene acpP 6284 6051 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544465.1 protein_id gnl|my_center|LOCUS_04200 6781 6434 gene locus_tag LOCUS_04210 6781 6434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 7338 6778 gene locus_tag LOCUS_04220 7338 6778 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949156.1 protein_id gnl|my_center|LOCUS_04220 8201 7446 gene locus_tag LOCUS_04230 8201 7446 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682287.1 protein_id gnl|my_center|LOCUS_04230 9493 8516 gene locus_tag LOCUS_04240 9493 8516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 12431 9576 gene locus_tag LOCUS_04250 gene mngB 12431 9576 CDS product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989450.1 protein_id gnl|my_center|LOCUS_04250 13411 12470 gene locus_tag LOCUS_04260 gene manA 13411 12470 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232833.1 protein_id gnl|my_center|LOCUS_04260 14279 13443 gene locus_tag LOCUS_04270 14279 13443 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226872.1 protein_id gnl|my_center|LOCUS_04270 15145 14279 gene locus_tag LOCUS_04280 15145 14279 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_04280 16614 15313 gene locus_tag LOCUS_04290 16614 15313 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226870.1 protein_id gnl|my_center|LOCUS_04290 16784 18583 gene locus_tag LOCUS_04300 16784 18583 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289136.1 protein_id gnl|my_center|LOCUS_04300 18558 20108 gene locus_tag LOCUS_04310 18558 20108 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582720.1 protein_id gnl|my_center|LOCUS_04310 20332 23454 gene locus_tag LOCUS_04320 20332 23454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 23582 24304 gene locus_tag LOCUS_04330 23582 24304 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_04330 24810 25880 gene locus_tag LOCUS_04340 24810 25880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 27035 26235 gene locus_tag LOCUS_04350 27035 26235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 28007 27063 gene locus_tag LOCUS_04360 28007 27063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 29502 28177 gene locus_tag LOCUS_04370 29502 28177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 30024 29797 gene locus_tag LOCUS_04380 30024 29797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 30353 30210 gene locus_tag LOCUS_04390 30353 30210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 31062 30304 gene locus_tag LOCUS_04400 31062 30304 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815786.1 protein_id gnl|my_center|LOCUS_04400 31736 31086 gene locus_tag LOCUS_04410 31736 31086 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272546.1 protein_id gnl|my_center|LOCUS_04410 32982 32158 gene locus_tag LOCUS_04420 32982 32158 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_04420 35228 33243 gene locus_tag LOCUS_04430 35228 33243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 36877 35579 gene locus_tag LOCUS_04440 36877 35579 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_04440 37624 37211 gene locus_tag LOCUS_04450 37624 37211 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227791.1 protein_id gnl|my_center|LOCUS_04450 37997 37815 gene locus_tag LOCUS_04460 37997 37815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 39174 38023 gene locus_tag LOCUS_04470 39174 38023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 40498 39341 gene locus_tag LOCUS_04480 40498 39341 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_04480 42061 40547 gene locus_tag LOCUS_04490 42061 40547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 42928 42092 gene locus_tag LOCUS_04500 42928 42092 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296517.1 protein_id gnl|my_center|LOCUS_04500 43103 42921 gene locus_tag LOCUS_04510 43103 42921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 43306 43136 gene locus_tag LOCUS_04520 43306 43136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 43966 43490 gene locus_tag LOCUS_04530 43966 43490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 44062 45294 gene locus_tag LOCUS_04540 44062 45294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 47388 45427 gene locus_tag LOCUS_04550 47388 45427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 47800 47973 gene locus_tag LOCUS_04560 47800 47973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 48473 48063 gene locus_tag LOCUS_04570 48473 48063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 48933 48559 gene locus_tag LOCUS_04580 48933 48559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 50442 49117 gene locus_tag LOCUS_04590 50442 49117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 52110 50557 gene locus_tag LOCUS_04600 52110 50557 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101306.1 protein_id gnl|my_center|LOCUS_04600 53241 52243 gene locus_tag LOCUS_04610 53241 52243 CDS product stealth conserved region 3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207631.1 protein_id gnl|my_center|LOCUS_04610 53725 53405 gene locus_tag LOCUS_04620 53725 53405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 53835 55313 gene locus_tag LOCUS_04630 53835 55313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 56977 55391 gene locus_tag LOCUS_04640 56977 55391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 57948 57142 gene locus_tag LOCUS_04650 57948 57142 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985169.1 protein_id gnl|my_center|LOCUS_04650 59315 58068 gene locus_tag LOCUS_04660 59315 58068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 59700 59245 gene locus_tag LOCUS_04670 59700 59245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 61160 59718 gene locus_tag LOCUS_04680 gene pelG 61160 59718 CDS product exopolysaccharide Pel transporter PelG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964053.1 protein_id gnl|my_center|LOCUS_04680 62708 61236 gene locus_tag LOCUS_04690 gene pelF 62708 61236 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964052.1 protein_id gnl|my_center|LOCUS_04690 64665 62719 gene locus_tag LOCUS_04700 64665 62719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 67391 64821 gene locus_tag LOCUS_04710 67391 64821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 68471 67476 gene locus_tag LOCUS_04720 68471 67476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964050.1 protein_id gnl|my_center|LOCUS_04720 70702 68525 gene locus_tag LOCUS_04730 70702 68525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 71303 71085 gene locus_tag LOCUS_04740 71303 71085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 72494 71316 gene locus_tag LOCUS_04750 72494 71316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 72702 72508 gene locus_tag LOCUS_04760 72702 72508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 72905 72723 gene locus_tag LOCUS_04770 72905 72723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 74968 72932 gene locus_tag LOCUS_04780 74968 72932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 76295 75375 gene locus_tag LOCUS_04790 gene trxB 76295 75375 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564228.1 protein_id gnl|my_center|LOCUS_04790 76533 76336 gene locus_tag LOCUS_04800 76533 76336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 77079 76588 gene locus_tag LOCUS_04810 77079 76588 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461280.1 protein_id gnl|my_center|LOCUS_04810 77289 77104 gene locus_tag LOCUS_04820 77289 77104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 77546 77938 gene locus_tag LOCUS_04830 77546 77938 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_04830 78278 78820 gene locus_tag LOCUS_04840 78278 78820 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_04840 80077 79139 gene locus_tag LOCUS_04850 80077 79139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 80884 80081 gene locus_tag LOCUS_04860 80884 80081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 81288 80887 gene locus_tag LOCUS_04870 81288 80887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 82727 81549 gene locus_tag LOCUS_04880 82727 81549 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_04880 83705 82986 gene locus_tag LOCUS_04890 83705 82986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 85840 84113 gene locus_tag LOCUS_04900 85840 84113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 86538 86305 gene locus_tag LOCUS_04910 86538 86305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 86953 86600 gene locus_tag LOCUS_04920 86953 86600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 87127 87900 gene locus_tag LOCUS_04930 87127 87900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 89813 88227 gene locus_tag LOCUS_04940 gene cls 89813 88227 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262851.1 protein_id gnl|my_center|LOCUS_04940 90312 90046 gene locus_tag LOCUS_04950 90312 90046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 94026 90331 gene locus_tag LOCUS_04960 94026 90331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 95761 94412 gene locus_tag LOCUS_04970 95761 94412 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435635.1 protein_id gnl|my_center|LOCUS_04970 97162 96245 gene locus_tag LOCUS_04980 97162 96245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 97342 97178 gene locus_tag LOCUS_04990 97342 97178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 97618 97863 gene locus_tag LOCUS_05000 97618 97863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 98055 98210 gene locus_tag LOCUS_05010 98055 98210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 98505 98263 gene locus_tag LOCUS_05020 98505 98263 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788104.1 protein_id gnl|my_center|LOCUS_05020 98821 99546 gene locus_tag LOCUS_05030 98821 99546 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965416.1 protein_id gnl|my_center|LOCUS_05030 101286 99814 gene locus_tag LOCUS_05040 101286 99814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 102658 103725 gene locus_tag LOCUS_05050 102658 103725 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987044.1 protein_id gnl|my_center|LOCUS_05050 104558 104025 gene locus_tag LOCUS_05060 104558 104025 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206007.1 protein_id gnl|my_center|LOCUS_05060 104992 104588 gene locus_tag LOCUS_05070 104992 104588 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723834.1 protein_id gnl|my_center|LOCUS_05070 106000 105365 gene locus_tag LOCUS_05080 106000 105365 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254484.1 protein_id gnl|my_center|LOCUS_05080 106265 107101 gene locus_tag LOCUS_05090 106265 107101 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929570.1 protein_id gnl|my_center|LOCUS_05090 109167 107293 gene locus_tag LOCUS_05100 109167 107293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 109735 109160 gene locus_tag LOCUS_05110 109735 109160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 110355 109924 gene locus_tag LOCUS_05120 110355 109924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 111380 110487 gene locus_tag LOCUS_05130 111380 110487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 111583 111356 gene locus_tag LOCUS_05140 111583 111356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 113179 111593 gene locus_tag LOCUS_05150 113179 111593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 113410 113243 gene locus_tag LOCUS_05160 113410 113243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 114836 113448 gene locus_tag LOCUS_05170 114836 113448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 115918 115127 gene locus_tag LOCUS_05180 115918 115127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 117390 116161 gene locus_tag LOCUS_05190 117390 116161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 118399 117383 gene locus_tag LOCUS_05200 118399 117383 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963366.1 protein_id gnl|my_center|LOCUS_05200 119029 118796 gene locus_tag LOCUS_05210 119029 118796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 121062 119002 gene locus_tag LOCUS_05220 121062 119002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 123123 121273 gene locus_tag LOCUS_05230 123123 121273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 124105 123230 gene locus_tag LOCUS_05240 124105 123230 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984240.1 protein_id gnl|my_center|LOCUS_05240 125508 124105 gene locus_tag LOCUS_05250 125508 124105 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357775.1 protein_id gnl|my_center|LOCUS_05250 125772 125548 gene locus_tag LOCUS_05260 125772 125548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 127055 125826 gene locus_tag LOCUS_05270 127055 125826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 128897 127386 gene locus_tag LOCUS_05280 128897 127386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 129806 129270 gene locus_tag LOCUS_05290 gene rplQ 129806 129270 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723675.1 protein_id gnl|my_center|LOCUS_05290 131179 130220 gene locus_tag LOCUS_05300 131179 130220 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_05300 131821 131228 gene locus_tag LOCUS_05310 gene rpsD 131821 131228 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_05310 132238 131840 gene locus_tag LOCUS_05320 gene rpsK 132238 131840 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101799.1 protein_id gnl|my_center|LOCUS_05320 132705 132337 gene locus_tag LOCUS_05330 gene rpsM 132705 132337 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966388.1 protein_id gnl|my_center|LOCUS_05330 135477 133966 gene locus_tag LOCUS_05340 135477 133966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 134197 134296 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 138466 136007 gene locus_tag LOCUS_05350 138466 136007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 139369 138764 gene locus_tag LOCUS_05360 139369 138764 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694643.1 protein_id gnl|my_center|LOCUS_05360 139617 139366 gene locus_tag LOCUS_05370 139617 139366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 140852 139599 gene locus_tag LOCUS_05380 140852 139599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 141077 140859 gene locus_tag LOCUS_05390 gene infA 141077 140859 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029884.1 protein_id gnl|my_center|LOCUS_05390 141553 141161 gene locus_tag LOCUS_05400 141553 141161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 142525 141770 gene locus_tag LOCUS_05410 gene map 142525 141770 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_05410 143231 142527 gene locus_tag LOCUS_05420 143231 142527 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966391.1 protein_id gnl|my_center|LOCUS_05420 144741 143428 gene locus_tag LOCUS_05430 gene secY 144741 143428 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_05430 145183 144743 gene locus_tag LOCUS_05440 gene rplO 145183 144743 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723680.1 protein_id gnl|my_center|LOCUS_05440 145500 145318 gene locus_tag LOCUS_05450 gene rpmD 145500 145318 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129921.1 protein_id gnl|my_center|LOCUS_05450 146043 145528 gene locus_tag LOCUS_05460 gene rpsE 146043 145528 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356219.1 protein_id gnl|my_center|LOCUS_05460 146427 146059 gene locus_tag LOCUS_05470 gene rplR 146427 146059 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_05470 146984 146445 gene locus_tag LOCUS_05480 gene rplF 146984 146445 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_05480 147573 147172 gene locus_tag LOCUS_05490 gene rpsH 147573 147172 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_05490 148094 147909 gene locus_tag LOCUS_05500 148094 147909 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_05500 148646 148107 gene locus_tag LOCUS_05510 gene rplE 148646 148107 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966400.1 protein_id gnl|my_center|LOCUS_05510 148968 148669 gene locus_tag LOCUS_05520 gene rplX 148968 148669 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919138.1 protein_id gnl|my_center|LOCUS_05520 149350 148982 gene locus_tag LOCUS_05530 gene rplN 149350 148982 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558867.1 protein_id gnl|my_center|LOCUS_05530 149623 149369 gene locus_tag LOCUS_05540 gene rpsQ 149623 149369 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421156.1 protein_id gnl|my_center|LOCUS_05540 149927 149724 gene locus_tag LOCUS_05550 gene rpmC 149927 149724 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722500.1 protein_id gnl|my_center|LOCUS_05550 150354 149917 gene locus_tag LOCUS_05560 gene rplP 150354 149917 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_05560 151004 150354 gene locus_tag LOCUS_05570 gene rpsC 151004 150354 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 protein_id gnl|my_center|LOCUS_05570 151402 151016 gene locus_tag LOCUS_05580 151402 151016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 151716 151435 gene locus_tag LOCUS_05590 gene rpsS 151716 151435 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421166.1 protein_id gnl|my_center|LOCUS_05590 152580 151741 gene locus_tag LOCUS_05600 gene rplB 152580 151741 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966409.1 protein_id gnl|my_center|LOCUS_05600 153005 152706 gene locus_tag LOCUS_05610 gene rplW 153005 152706 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966410.1 protein_id gnl|my_center|LOCUS_05610 153625 153005 gene locus_tag LOCUS_05620 gene rplD 153625 153005 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357518.1 protein_id gnl|my_center|LOCUS_05620 154291 153656 gene locus_tag LOCUS_05630 gene rplC 154291 153656 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_05630 154794 154477 gene locus_tag LOCUS_05640 gene rpsJ 154794 154477 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 protein_id gnl|my_center|LOCUS_05640 155464 155991 gene locus_tag LOCUS_05650 155464 155991 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248957.1 protein_id gnl|my_center|LOCUS_05650 158195 156195 gene locus_tag LOCUS_05660 158195 156195 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510954.1 protein_id gnl|my_center|LOCUS_05660 159407 158538 gene locus_tag LOCUS_05670 159407 158538 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_05670 159817 160752 gene locus_tag LOCUS_05680 159817 160752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 161270 161019 gene locus_tag LOCUS_05690 161270 161019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 162850 161276 gene locus_tag LOCUS_05700 162850 161276 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_05700 164588 162834 gene locus_tag LOCUS_05710 164588 162834 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_05710 166275 164605 gene locus_tag LOCUS_05720 166275 164605 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_05720 166700 166467 gene locus_tag LOCUS_05730 166700 166467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 167145 167026 gene locus_tag LOCUS_05740 167145 167026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 167529 167251 gene locus_tag LOCUS_05750 167529 167251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 167953 167498 gene locus_tag LOCUS_05760 167953 167498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 168158 167931 gene locus_tag LOCUS_05770 168158 167931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 168476 168832 gene locus_tag LOCUS_05780 168476 168832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 170934 169993 gene locus_tag LOCUS_05790 170934 169993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 172456 171059 gene locus_tag LOCUS_05800 172456 171059 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891654.1 protein_id gnl|my_center|LOCUS_05800 173359 172595 gene locus_tag LOCUS_05810 173359 172595 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113029.1 protein_id gnl|my_center|LOCUS_05810 175013 173430 gene locus_tag LOCUS_05820 175013 173430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 176347 175067 gene locus_tag LOCUS_05830 176347 175067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 177888 176473 gene locus_tag LOCUS_05840 177888 176473 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860625.1 protein_id gnl|my_center|LOCUS_05840 179060 177975 gene locus_tag LOCUS_05850 179060 177975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 180008 179091 gene locus_tag LOCUS_05860 180008 179091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 181084 180125 gene locus_tag LOCUS_05870 181084 180125 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389891.1 protein_id gnl|my_center|LOCUS_05870 182152 181196 gene locus_tag LOCUS_05880 182152 181196 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389891.1 protein_id gnl|my_center|LOCUS_05880 183132 182182 gene locus_tag LOCUS_05890 183132 182182 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_05890 184118 183132 gene locus_tag LOCUS_05900 184118 183132 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 protein_id gnl|my_center|LOCUS_05900 185011 184133 gene locus_tag LOCUS_05910 185011 184133 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453817.1 protein_id gnl|my_center|LOCUS_05910 185973 185008 gene locus_tag LOCUS_05920 185973 185008 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_05920 187731 186139 gene locus_tag LOCUS_05930 187731 186139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 188698 187982 gene locus_tag LOCUS_05940 188698 187982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 188830 189447 gene locus_tag LOCUS_05950 188830 189447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 189441 189926 gene locus_tag LOCUS_05960 189441 189926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 190275 190150 gene locus_tag LOCUS_05970 190275 190150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 190592 190293 gene locus_tag LOCUS_05980 190592 190293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 190766 190629 gene locus_tag LOCUS_05990 190766 190629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 191080 191502 gene locus_tag LOCUS_06000 191080 191502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 192308 191805 gene locus_tag LOCUS_06010 192308 191805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 193132 192296 gene locus_tag LOCUS_06020 193132 192296 CDS product NAD-dependent deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922343.1 protein_id gnl|my_center|LOCUS_06020 193782 193174 gene locus_tag LOCUS_06030 193782 193174 CDS product DUF3786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768312.1 protein_id gnl|my_center|LOCUS_06030 194771 193800 gene locus_tag LOCUS_06040 194771 193800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_06040 194806 194973 gene locus_tag LOCUS_06050 194806 194973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 194963 195571 gene locus_tag LOCUS_06060 194963 195571 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811525.1 protein_id gnl|my_center|LOCUS_06060 195757 195897 gene locus_tag LOCUS_06070 195757 195897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 196143 196334 gene locus_tag LOCUS_06080 196143 196334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 197853 196435 gene locus_tag LOCUS_06090 197853 196435 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_06090 198840 198223 gene locus_tag LOCUS_06100 198840 198223 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965980.1 protein_id gnl|my_center|LOCUS_06100 200126 198954 gene locus_tag LOCUS_06110 200126 198954 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399531.1 protein_id gnl|my_center|LOCUS_06110 200362 201282 gene locus_tag LOCUS_06120 200362 201282 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 protein_id gnl|my_center|LOCUS_06120 202241 201354 gene locus_tag LOCUS_06130 202241 201354 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_06130 202718 202263 gene locus_tag LOCUS_06140 202718 202263 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288290.1 protein_id gnl|my_center|LOCUS_06140 203018 203494 gene locus_tag LOCUS_06150 203018 203494 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_06150 203514 203642 gene locus_tag LOCUS_06160 203514 203642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 203875 204570 gene locus_tag LOCUS_06170 203875 204570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 >Feature sequence004 402 1934 gene locus_tag LOCUS_06180 402 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 1931 2659 gene locus_tag LOCUS_06190 1931 2659 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_06190 2656 3819 gene locus_tag LOCUS_06200 2656 3819 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931069.1 protein_id gnl|my_center|LOCUS_06200 6300 3826 gene locus_tag LOCUS_06210 6300 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 6751 8247 gene locus_tag LOCUS_06220 gene rbsA 6751 8247 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217684.1 protein_id gnl|my_center|LOCUS_06220 8288 9280 gene locus_tag LOCUS_06230 8288 9280 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896747.1 protein_id gnl|my_center|LOCUS_06230 9348 10526 gene locus_tag LOCUS_06240 9348 10526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 10637 11617 gene locus_tag LOCUS_06250 10637 11617 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523473.1 protein_id gnl|my_center|LOCUS_06250 11674 13425 gene locus_tag LOCUS_06260 11674 13425 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775581.1 protein_id gnl|my_center|LOCUS_06260 13597 15051 gene locus_tag LOCUS_06270 13597 15051 CDS product family 78 glycoside hydrolase catalytic domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054643739.1 protein_id gnl|my_center|LOCUS_06270 15402 16934 gene locus_tag LOCUS_06280 15402 16934 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288004.1 protein_id gnl|my_center|LOCUS_06280 16927 18555 gene locus_tag LOCUS_06290 16927 18555 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_06290 18762 20021 gene locus_tag LOCUS_06300 18762 20021 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455419.1 protein_id gnl|my_center|LOCUS_06300 20184 21074 gene locus_tag LOCUS_06310 20184 21074 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_06310 21071 21904 gene locus_tag LOCUS_06320 21071 21904 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_06320 22022 23974 gene locus_tag LOCUS_06330 22022 23974 CDS product DUF5695 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007753560.1 protein_id gnl|my_center|LOCUS_06330 23967 26117 gene locus_tag LOCUS_06340 gene gnpA 23967 26117 CDS product 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389962.1 protein_id gnl|my_center|LOCUS_06340 26053 26268 gene locus_tag LOCUS_06350 26053 26268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 26483 27220 gene locus_tag LOCUS_06360 26483 27220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 27825 28046 gene locus_tag LOCUS_06370 27825 28046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 28198 28515 gene locus_tag LOCUS_06380 28198 28515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 28838 29995 gene locus_tag LOCUS_06390 28838 29995 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423769.1 protein_id gnl|my_center|LOCUS_06390 29996 31597 gene locus_tag LOCUS_06400 29996 31597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 31694 32305 gene locus_tag LOCUS_06410 31694 32305 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816920.1 protein_id gnl|my_center|LOCUS_06410 32317 32808 gene locus_tag LOCUS_06420 32317 32808 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989714.1 protein_id gnl|my_center|LOCUS_06420 32941 33159 gene locus_tag LOCUS_06430 32941 33159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 33190 33408 gene locus_tag LOCUS_06440 33190 33408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 33435 33950 gene locus_tag LOCUS_06450 gene nusG 33435 33950 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966426.1 protein_id gnl|my_center|LOCUS_06450 34205 34630 gene locus_tag LOCUS_06460 gene rplK 34205 34630 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_06460 34696 35388 gene locus_tag LOCUS_06470 gene rplA 34696 35388 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_06470 35762 36250 gene locus_tag LOCUS_06480 gene rplJ 35762 36250 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421187.1 protein_id gnl|my_center|LOCUS_06480 36354 36731 gene locus_tag LOCUS_06490 gene rplL 36354 36731 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832283.1 protein_id gnl|my_center|LOCUS_06490 36991 40851 gene locus_tag LOCUS_06500 gene rpoB 36991 40851 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048357.1 protein_id gnl|my_center|LOCUS_06500 40873 44859 gene locus_tag LOCUS_06510 gene rpoC 40873 44859 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966420.1 protein_id gnl|my_center|LOCUS_06510 46021 45080 gene locus_tag LOCUS_06520 46021 45080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 46974 46342 gene locus_tag LOCUS_06530 46974 46342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 47307 49379 gene locus_tag LOCUS_06540 gene fusA 47307 49379 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_06540 50406 49618 gene locus_tag LOCUS_06550 50406 49618 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_06550 51153 50575 gene locus_tag LOCUS_06560 gene rsxA 51153 50575 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_06560 51839 51150 gene locus_tag LOCUS_06570 51839 51150 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948148.1 protein_id gnl|my_center|LOCUS_06570 53606 52059 gene locus_tag LOCUS_06580 53606 52059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 54951 53617 gene locus_tag LOCUS_06590 gene rsxC 54951 53617 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_06590 57488 55053 gene locus_tag LOCUS_06600 57488 55053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06600 58327 57560 gene locus_tag LOCUS_06610 gene tatC 58327 57560 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461250.1 protein_id gnl|my_center|LOCUS_06610 58503 58324 gene locus_tag LOCUS_06620 58503 58324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 59123 58560 gene locus_tag LOCUS_06630 59123 58560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 59422 61497 gene locus_tag LOCUS_06640 59422 61497 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272571.1 protein_id gnl|my_center|LOCUS_06640 61548 62282 gene locus_tag LOCUS_06650 61548 62282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 62463 62606 gene locus_tag LOCUS_06660 gene scfA 62463 62606 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_06660 62849 64495 gene locus_tag LOCUS_06670 gene scfB 62849 64495 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_06670 64672 66999 gene locus_tag LOCUS_06680 gene secDF 64672 66999 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723531.1 protein_id gnl|my_center|LOCUS_06680 67147 69102 gene locus_tag LOCUS_06690 gene recJ 67147 69102 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943623.1 protein_id gnl|my_center|LOCUS_06690 69487 71904 gene locus_tag LOCUS_06700 gene leuS 69487 71904 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246072.1 protein_id gnl|my_center|LOCUS_06700 72486 73313 gene locus_tag LOCUS_06710 72486 73313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 73428 75584 gene locus_tag LOCUS_06720 73428 75584 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128975638.1 protein_id gnl|my_center|LOCUS_06720 75786 77054 gene locus_tag LOCUS_06730 75786 77054 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027623.1 protein_id gnl|my_center|LOCUS_06730 77741 77370 gene locus_tag LOCUS_06740 77741 77370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 77656 78078 gene locus_tag LOCUS_06750 gene rpsL 77656 78078 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_06750 78290 78760 gene locus_tag LOCUS_06760 gene rpsG 78290 78760 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357613.1 protein_id gnl|my_center|LOCUS_06760 78812 80929 gene locus_tag LOCUS_06770 gene fusA 78812 80929 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436178.1 protein_id gnl|my_center|LOCUS_06770 81146 82339 gene locus_tag LOCUS_06780 gene tuf 81146 82339 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887863.1 protein_id gnl|my_center|LOCUS_06780 82622 82972 gene locus_tag LOCUS_06790 82622 82972 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393779.1 protein_id gnl|my_center|LOCUS_06790 83122 84471 gene locus_tag LOCUS_06800 gene ffh 83122 84471 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_06800 84587 84832 gene locus_tag LOCUS_06810 gene rpsP 84587 84832 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220815.1 protein_id gnl|my_center|LOCUS_06810 84852 85082 gene locus_tag LOCUS_06820 84852 85082 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_06820 85320 85991 gene locus_tag LOCUS_06830 gene rimM 85320 85991 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889030.1 protein_id gnl|my_center|LOCUS_06830 85988 86899 gene locus_tag LOCUS_06840 gene trmD 85988 86899 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686892.1 protein_id gnl|my_center|LOCUS_06840 87126 87473 gene locus_tag LOCUS_06850 gene rplS 87126 87473 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419350.1 protein_id gnl|my_center|LOCUS_06850 87705 88250 gene locus_tag LOCUS_06860 gene lepB 87705 88250 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460443.1 protein_id gnl|my_center|LOCUS_06860 88315 89190 gene locus_tag LOCUS_06870 gene ylqF 88315 89190 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_06870 89520 89619 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 89639 89971 gene locus_tag LOCUS_06880 89639 89971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 90192 90947 gene locus_tag LOCUS_06890 90192 90947 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_06890 91109 91456 gene locus_tag LOCUS_06900 91109 91456 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948678.1 protein_id gnl|my_center|LOCUS_06900 91634 92545 gene locus_tag LOCUS_06910 gene pgeF 91634 92545 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_06910 92886 93152 gene locus_tag LOCUS_06920 gene rpsO 92886 93152 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419491.1 protein_id gnl|my_center|LOCUS_06920 93411 95501 gene locus_tag LOCUS_06930 gene pnp 93411 95501 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_06930 96190 95585 gene locus_tag LOCUS_06940 96190 95585 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_06940 97809 96430 gene locus_tag LOCUS_06950 gene aroA 97809 96430 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246068.1 protein_id gnl|my_center|LOCUS_06950 99155 98055 gene locus_tag LOCUS_06960 gene tyrA 99155 98055 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228138.1 protein_id gnl|my_center|LOCUS_06960 99504 100448 gene locus_tag LOCUS_06970 99504 100448 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937723.1 protein_id gnl|my_center|LOCUS_06970 100622 100958 gene locus_tag LOCUS_tm00010 100622 100958 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 101143 101820 gene locus_tag LOCUS_06980 101143 101820 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044683.1 protein_id gnl|my_center|LOCUS_06980 101824 103428 gene locus_tag LOCUS_06990 101824 103428 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965729.1 protein_id gnl|my_center|LOCUS_06990 103543 104862 gene locus_tag LOCUS_07000 103543 104862 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_07000 105049 105714 gene locus_tag LOCUS_07010 gene cmk 105049 105714 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700259.1 protein_id gnl|my_center|LOCUS_07010 106117 106971 gene locus_tag LOCUS_07020 106117 106971 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439450.1 protein_id gnl|my_center|LOCUS_07020 106952 108172 gene locus_tag LOCUS_07030 106952 108172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07030 109516 108278 gene locus_tag LOCUS_07040 109516 108278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 110853 109708 gene locus_tag LOCUS_07050 110853 109708 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948151.1 protein_id gnl|my_center|LOCUS_07050 112094 110952 gene locus_tag LOCUS_07060 112094 110952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 113508 112492 gene locus_tag LOCUS_07070 gene galE 113508 112492 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_07070 114617 113805 gene locus_tag LOCUS_07080 114617 113805 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896027.1 protein_id gnl|my_center|LOCUS_07080 115042 116055 gene locus_tag LOCUS_07090 gene gap 115042 116055 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_07090 116139 116309 gene locus_tag LOCUS_07100 116139 116309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 116531 117751 gene locus_tag LOCUS_07110 116531 117751 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_07110 117853 118602 gene locus_tag LOCUS_07120 gene tpiA 117853 118602 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_07120 118746 120431 gene locus_tag LOCUS_07130 118746 120431 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903241.1 protein_id gnl|my_center|LOCUS_07130 121980 120511 gene locus_tag LOCUS_07140 121980 120511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 122903 122304 gene locus_tag LOCUS_07150 122903 122304 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426696.1 protein_id gnl|my_center|LOCUS_07150 123425 124234 gene locus_tag LOCUS_07160 123425 124234 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898260.1 protein_id gnl|my_center|LOCUS_07160 124381 125634 gene locus_tag LOCUS_07170 gene hemA 124381 125634 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392764.1 protein_id gnl|my_center|LOCUS_07170 125624 125767 gene locus_tag LOCUS_07180 125624 125767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 125727 126662 gene locus_tag LOCUS_07190 125727 126662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 126728 128590 gene locus_tag LOCUS_07200 126728 128590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 128701 128952 gene locus_tag LOCUS_07210 128701 128952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948527.1 protein_id gnl|my_center|LOCUS_07210 129131 130228 gene locus_tag LOCUS_07220 gene hemB 129131 130228 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258455.1 protein_id gnl|my_center|LOCUS_07220 130513 131916 gene locus_tag LOCUS_07230 gene hemL 130513 131916 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797681.1 protein_id gnl|my_center|LOCUS_07230 132110 132715 gene locus_tag LOCUS_07240 gene cobU 132110 132715 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964692.1 protein_id gnl|my_center|LOCUS_07240 132777 133556 gene locus_tag LOCUS_07250 132777 133556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 134956 133553 gene locus_tag LOCUS_07260 134956 133553 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_07260 135196 135666 gene locus_tag LOCUS_07270 135196 135666 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_07270 135912 137234 gene locus_tag LOCUS_07280 135912 137234 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 protein_id gnl|my_center|LOCUS_07280 137350 137907 gene locus_tag LOCUS_07290 137350 137907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 137942 138994 gene locus_tag LOCUS_07300 gene cbiB 137942 138994 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989705.1 protein_id gnl|my_center|LOCUS_07300 139799 139158 gene locus_tag LOCUS_07310 139799 139158 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964647.1 protein_id gnl|my_center|LOCUS_07310 140489 139800 gene locus_tag LOCUS_07320 140489 139800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 140704 140480 gene locus_tag LOCUS_07330 140704 140480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 141145 143487 gene locus_tag LOCUS_07340 gene feoB 141145 143487 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_07340 144113 143706 gene locus_tag LOCUS_07350 144113 143706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 144824 144264 gene locus_tag LOCUS_07360 144824 144264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 145160 145534 gene locus_tag LOCUS_07370 145160 145534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 146498 145899 gene locus_tag LOCUS_07380 146498 145899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 146691 148487 gene locus_tag LOCUS_07390 146691 148487 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461398.1 protein_id gnl|my_center|LOCUS_07390 148615 150696 gene locus_tag LOCUS_07400 148615 150696 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461397.1 protein_id gnl|my_center|LOCUS_07400 150925 150767 gene locus_tag LOCUS_07410 150925 150767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 >Feature sequence005 321 1040 gene locus_tag LOCUS_07420 321 1040 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963612.1 protein_id gnl|my_center|LOCUS_07420 1037 2395 gene locus_tag LOCUS_07430 1037 2395 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861297.1 protein_id gnl|my_center|LOCUS_07430 3079 2405 gene locus_tag LOCUS_07440 3079 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 4661 3111 gene locus_tag LOCUS_07450 4661 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 5418 4636 gene locus_tag LOCUS_07460 5418 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 5761 6252 gene locus_tag LOCUS_07470 gene sigX 5761 6252 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230521.1 protein_id gnl|my_center|LOCUS_07470 6255 7010 gene locus_tag LOCUS_07480 6255 7010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 7317 6991 gene locus_tag LOCUS_07490 7317 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 7439 8428 gene locus_tag LOCUS_07500 7439 8428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 8425 8661 gene locus_tag LOCUS_07510 8425 8661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 8658 9029 gene locus_tag LOCUS_07520 8658 9029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 9026 9400 gene locus_tag LOCUS_07530 9026 9400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 10094 9807 gene locus_tag LOCUS_07540 10094 9807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 11236 12027 gene locus_tag LOCUS_07550 11236 12027 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359839.1 protein_id gnl|my_center|LOCUS_07550 12247 12963 gene locus_tag LOCUS_07560 12247 12963 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966072.1 protein_id gnl|my_center|LOCUS_07560 13848 13970 gene locus_tag LOCUS_07570 13848 13970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 14325 14116 gene locus_tag LOCUS_07580 14325 14116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 14407 15342 gene locus_tag LOCUS_07590 14407 15342 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966220.1 protein_id gnl|my_center|LOCUS_07590 15355 15657 gene locus_tag LOCUS_07600 15355 15657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 15863 16165 gene locus_tag LOCUS_07610 15863 16165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 16162 16671 gene locus_tag LOCUS_07620 16162 16671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 16709 17935 gene locus_tag LOCUS_07630 16709 17935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 17970 18107 gene locus_tag LOCUS_07640 17970 18107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 18123 18305 gene locus_tag LOCUS_07650 18123 18305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 18718 18903 gene locus_tag LOCUS_07660 18718 18903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 19405 20040 gene locus_tag LOCUS_07670 19405 20040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 20067 21026 gene locus_tag LOCUS_07680 20067 21026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 21164 22063 gene locus_tag LOCUS_07690 21164 22063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 22119 22544 gene locus_tag LOCUS_07700 22119 22544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 22694 23440 gene locus_tag LOCUS_07710 22694 23440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07710 23559 23711 gene locus_tag LOCUS_07720 23559 23711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 24676 24149 gene locus_tag LOCUS_07730 24676 24149 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391840.1 protein_id gnl|my_center|LOCUS_07730 25132 24695 gene locus_tag LOCUS_07740 25132 24695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 25374 26735 gene locus_tag LOCUS_07750 25374 26735 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102011.1 protein_id gnl|my_center|LOCUS_07750 26749 26958 gene locus_tag LOCUS_07760 26749 26958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 27136 30939 gene locus_tag LOCUS_07770 27136 30939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 31025 31288 gene locus_tag LOCUS_07780 31025 31288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 31851 32858 gene locus_tag LOCUS_07790 31851 32858 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_07790 32890 35196 gene locus_tag LOCUS_07800 32890 35196 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_07800 35766 36524 gene locus_tag LOCUS_07810 35766 36524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 36564 37445 gene locus_tag LOCUS_07820 gene cdaA 36564 37445 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254229.1 protein_id gnl|my_center|LOCUS_07820 37435 38760 gene locus_tag LOCUS_07830 37435 38760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 38766 39023 gene locus_tag LOCUS_07840 38766 39023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 39223 41628 gene locus_tag LOCUS_07850 39223 41628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 41648 42631 gene locus_tag LOCUS_07860 gene pyrF 41648 42631 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_07860 42766 43566 gene locus_tag LOCUS_07870 42766 43566 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989827.1 protein_id gnl|my_center|LOCUS_07870 43633 44541 gene locus_tag LOCUS_07880 43633 44541 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_07880 44936 44757 gene locus_tag LOCUS_07890 44936 44757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 45129 45935 gene locus_tag LOCUS_07900 gene spoIIR 45129 45935 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966181.1 protein_id gnl|my_center|LOCUS_07900 47771 45945 gene locus_tag LOCUS_07910 gene typA 47771 45945 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964991.1 protein_id gnl|my_center|LOCUS_07910 47926 47771 gene locus_tag LOCUS_07920 47926 47771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 48131 48757 gene locus_tag LOCUS_07930 48131 48757 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422086.1 protein_id gnl|my_center|LOCUS_07930 49007 49510 gene locus_tag LOCUS_07940 gene cobO 49007 49510 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942222.1 protein_id gnl|my_center|LOCUS_07940 49712 49849 gene locus_tag LOCUS_07950 49712 49849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 49905 50597 gene locus_tag LOCUS_07960 49905 50597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 52037 50895 gene locus_tag LOCUS_07970 gene glgD 52037 50895 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 protein_id gnl|my_center|LOCUS_07970 53239 52031 gene locus_tag LOCUS_07980 53239 52031 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_07980 53867 54637 gene locus_tag LOCUS_07990 53867 54637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 54648 54827 gene locus_tag LOCUS_08000 54648 54827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 54868 55803 gene locus_tag LOCUS_08010 54868 55803 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776972.1 protein_id gnl|my_center|LOCUS_08010 56028 56687 gene locus_tag LOCUS_08020 56028 56687 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776971.1 protein_id gnl|my_center|LOCUS_08020 56783 57640 gene locus_tag LOCUS_08030 56783 57640 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090302.1 protein_id gnl|my_center|LOCUS_08030 57705 58493 gene locus_tag LOCUS_08040 57705 58493 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004137994.1 protein_id gnl|my_center|LOCUS_08040 58827 60734 gene locus_tag LOCUS_08050 58827 60734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 60838 61737 gene locus_tag LOCUS_08060 60838 61737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 62380 62069 gene locus_tag LOCUS_08070 62380 62069 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461287.1 protein_id gnl|my_center|LOCUS_08070 62655 62377 gene locus_tag LOCUS_08080 62655 62377 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018213496.1 protein_id gnl|my_center|LOCUS_08080 62899 64479 gene locus_tag LOCUS_08090 62899 64479 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_08090 64586 65260 gene locus_tag LOCUS_08100 gene pyrE 64586 65260 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_08100 65279 65437 gene locus_tag LOCUS_08110 65279 65437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 65544 66071 gene locus_tag LOCUS_08120 65544 66071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 66259 66585 gene locus_tag LOCUS_08130 66259 66585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 66843 69239 gene locus_tag LOCUS_08140 66843 69239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 69300 69530 gene locus_tag LOCUS_08150 69300 69530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 70200 69685 gene locus_tag LOCUS_08160 70200 69685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 70570 70139 gene locus_tag LOCUS_08170 70570 70139 CDS product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143885.1 protein_id gnl|my_center|LOCUS_08170 71341 70976 gene locus_tag LOCUS_08180 71341 70976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 74104 71366 gene locus_tag LOCUS_08190 74104 71366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 75596 74226 gene locus_tag LOCUS_08200 75596 74226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 76393 75623 gene locus_tag LOCUS_08210 76393 75623 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_08210 76652 77881 gene locus_tag LOCUS_08220 76652 77881 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_08220 78758 78857 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 78860 80395 gene locus_tag LOCUS_08230 78860 80395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08230 80714 81028 gene locus_tag LOCUS_08240 80714 81028 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263130.1 protein_id gnl|my_center|LOCUS_08240 81104 81952 gene locus_tag LOCUS_08250 81104 81952 CDS product cobalt-precorrin-4 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891957.1 protein_id gnl|my_center|LOCUS_08250 81981 83807 gene locus_tag LOCUS_08260 81981 83807 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583023.1 protein_id gnl|my_center|LOCUS_08260 84104 84604 gene locus_tag LOCUS_08270 84104 84604 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439159.1 protein_id gnl|my_center|LOCUS_08270 84597 86303 gene locus_tag LOCUS_08280 84597 86303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 86770 87510 gene locus_tag LOCUS_08290 86770 87510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 87863 89212 gene locus_tag LOCUS_08300 gene cbiG 87863 89212 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681802.1 protein_id gnl|my_center|LOCUS_08300 89337 90071 gene locus_tag LOCUS_08310 gene cobJ 89337 90071 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392608.1 protein_id gnl|my_center|LOCUS_08310 90334 91662 gene locus_tag LOCUS_08320 90334 91662 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582535.1 protein_id gnl|my_center|LOCUS_08320 91686 93359 gene locus_tag LOCUS_08330 91686 93359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807777.1 protein_id gnl|my_center|LOCUS_08330 93407 94123 gene locus_tag LOCUS_08340 93407 94123 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232924.1 protein_id gnl|my_center|LOCUS_08340 94120 96741 gene locus_tag LOCUS_08350 94120 96741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 98792 96750 gene locus_tag LOCUS_08360 98792 96750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 99468 98764 gene locus_tag LOCUS_08370 99468 98764 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861605.1 protein_id gnl|my_center|LOCUS_08370 100229 102982 gene locus_tag LOCUS_08380 100229 102982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 104011 103031 gene locus_tag LOCUS_08390 104011 103031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 106438 104117 gene locus_tag LOCUS_08400 106438 104117 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459421.1 protein_id gnl|my_center|LOCUS_08400 106756 107664 gene locus_tag LOCUS_08410 106756 107664 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092195.1 protein_id gnl|my_center|LOCUS_08410 107988 108854 gene locus_tag LOCUS_08420 107988 108854 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704391.1 protein_id gnl|my_center|LOCUS_08420 109100 109591 gene locus_tag LOCUS_08430 109100 109591 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168769353.1 protein_id gnl|my_center|LOCUS_08430 109588 110874 gene locus_tag LOCUS_08440 109588 110874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08440 110901 111905 gene locus_tag LOCUS_08450 110901 111905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 112073 113572 gene locus_tag LOCUS_08460 112073 113572 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258422.1 protein_id gnl|my_center|LOCUS_08460 113752 114582 gene locus_tag LOCUS_08470 113752 114582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 114779 115840 gene locus_tag LOCUS_08480 gene cobT 114779 115840 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_08480 116108 116884 gene locus_tag LOCUS_08490 116108 116884 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023383.1 protein_id gnl|my_center|LOCUS_08490 117833 117039 gene locus_tag LOCUS_08500 117833 117039 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393844.1 protein_id gnl|my_center|LOCUS_08500 118825 117830 gene locus_tag LOCUS_08510 118825 117830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 120562 118949 gene locus_tag LOCUS_08520 gene ptsP 120562 118949 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_08520 121516 120584 gene locus_tag LOCUS_08530 gene pfkB 121516 120584 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963555.1 protein_id gnl|my_center|LOCUS_08530 122101 123456 gene locus_tag LOCUS_08540 122101 123456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 123495 124427 gene locus_tag LOCUS_08550 123495 124427 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227020.1 protein_id gnl|my_center|LOCUS_08550 124432 125265 gene locus_tag LOCUS_08560 124432 125265 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287754.1 protein_id gnl|my_center|LOCUS_08560 125449 125685 gene locus_tag LOCUS_08570 125449 125685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 125724 127385 gene locus_tag LOCUS_08580 125724 127385 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357899.1 protein_id gnl|my_center|LOCUS_08580 127382 129352 gene locus_tag LOCUS_08590 127382 129352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 129393 130889 gene locus_tag LOCUS_08600 129393 130889 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387242.1 protein_id gnl|my_center|LOCUS_08600 132921 131044 gene locus_tag LOCUS_08610 132921 131044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 133053 133346 gene locus_tag LOCUS_08620 133053 133346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 133572 134444 gene locus_tag LOCUS_08630 133572 134444 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917245.1 protein_id gnl|my_center|LOCUS_08630 134447 136345 gene locus_tag LOCUS_08640 gene yesM 134447 136345 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_08640 136594 137880 gene locus_tag LOCUS_08650 136594 137880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 138134 139006 gene locus_tag LOCUS_08660 138134 139006 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776866.1 protein_id gnl|my_center|LOCUS_08660 139021 139866 gene locus_tag LOCUS_08670 139021 139866 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256268.1 protein_id gnl|my_center|LOCUS_08670 >Feature sequence006 1857 178 gene locus_tag LOCUS_08680 gene malL 1857 178 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_08680 4013 2175 gene locus_tag LOCUS_08690 gene lepA 4013 2175 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964590.1 protein_id gnl|my_center|LOCUS_08690 4935 4129 gene locus_tag LOCUS_08700 4935 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 6489 5080 gene locus_tag LOCUS_08710 6489 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 6908 7240 gene locus_tag LOCUS_08720 6908 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 7212 7616 gene locus_tag LOCUS_08730 7212 7616 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259070.1 protein_id gnl|my_center|LOCUS_08730 7677 7826 gene locus_tag LOCUS_08740 7677 7826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 10836 7906 gene locus_tag LOCUS_08750 10836 7906 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_08750 11202 10858 gene locus_tag LOCUS_08760 11202 10858 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_08760 12754 11699 gene locus_tag LOCUS_08770 12754 11699 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949052.1 protein_id gnl|my_center|LOCUS_08770 13773 12880 gene locus_tag LOCUS_08780 gene rarD 13773 12880 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002458084.1 protein_id gnl|my_center|LOCUS_08780 14306 14569 gene locus_tag LOCUS_08790 gene rpsT 14306 14569 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258282.1 protein_id gnl|my_center|LOCUS_08790 15406 14801 gene locus_tag LOCUS_08800 gene yihA 15406 14801 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_08800 17980 15680 gene locus_tag LOCUS_08810 gene lon 17980 15680 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229618.1 protein_id gnl|my_center|LOCUS_08810 19573 18284 gene locus_tag LOCUS_08820 gene clpX 19573 18284 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_08820 20430 19849 gene locus_tag LOCUS_08830 gene clpP 20430 19849 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_08830 21976 20636 gene locus_tag LOCUS_08840 gene tig 21976 20636 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460919.1 protein_id gnl|my_center|LOCUS_08840 22641 22093 gene locus_tag LOCUS_08850 22641 22093 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_08850 23017 23460 gene locus_tag LOCUS_08860 23017 23460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 23822 24166 gene locus_tag LOCUS_08870 gene ansR 23822 24166 CDS product HTH-type transcriptional regulator AnsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893569.1 protein_id gnl|my_center|LOCUS_08870 25548 24523 gene locus_tag LOCUS_08880 25548 24523 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902186.1 protein_id gnl|my_center|LOCUS_08880 25741 25589 gene locus_tag LOCUS_08890 25741 25589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 25997 25794 gene locus_tag LOCUS_08900 25997 25794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 26703 26254 gene locus_tag LOCUS_08910 26703 26254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 27610 26882 gene locus_tag LOCUS_08920 27610 26882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 30327 27841 gene locus_tag LOCUS_08930 30327 27841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 31659 31579 gene locus_tag LOCUS_t00050 31659 31579 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 31771 31700 gene locus_tag LOCUS_t00060 31771 31700 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 31902 31828 gene locus_tag LOCUS_t00070 31902 31828 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 32053 31978 gene locus_tag LOCUS_t00080 32053 31978 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 32127 32057 gene locus_tag LOCUS_t00090 32127 32057 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 32223 32146 gene locus_tag LOCUS_t00100 32223 32146 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 32437 32294 gene locus_tag LOCUS_08940 32437 32294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 32982 32464 gene locus_tag LOCUS_08950 32982 32464 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_08950 34345 33167 gene locus_tag LOCUS_08960 34345 33167 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022270.1 protein_id gnl|my_center|LOCUS_08960 35260 34475 gene locus_tag LOCUS_08970 35260 34475 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_08970 36182 35601 gene locus_tag LOCUS_08980 36182 35601 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_08980 37225 36410 gene locus_tag LOCUS_08990 gene spo0A 37225 36410 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110369.1 protein_id gnl|my_center|LOCUS_08990 38014 38649 gene locus_tag LOCUS_09000 38014 38649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 38830 39600 gene locus_tag LOCUS_09010 38830 39600 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_09010 41916 40120 gene locus_tag LOCUS_09020 41916 40120 CDS product aminopeptidase P family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986733.1 protein_id gnl|my_center|LOCUS_09020 43053 42118 gene locus_tag LOCUS_09030 43053 42118 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476523.1 protein_id gnl|my_center|LOCUS_09030 43810 43037 gene locus_tag LOCUS_09040 43810 43037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09040 43849 43948 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45527 44466 gene locus_tag LOCUS_09050 45527 44466 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974099.1 protein_id gnl|my_center|LOCUS_09050 46464 45532 gene locus_tag LOCUS_09060 46464 45532 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534165.1 protein_id gnl|my_center|LOCUS_09060 48209 46566 gene locus_tag LOCUS_09070 48209 46566 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726470.1 protein_id gnl|my_center|LOCUS_09070 50158 48476 gene locus_tag LOCUS_09080 50158 48476 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913630.1 protein_id gnl|my_center|LOCUS_09080 51547 50552 gene locus_tag LOCUS_09090 51547 50552 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812005.1 protein_id gnl|my_center|LOCUS_09090 52722 51544 gene locus_tag LOCUS_09100 52722 51544 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812003.1 protein_id gnl|my_center|LOCUS_09100 54116 52737 gene locus_tag LOCUS_09110 54116 52737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 55067 54120 gene locus_tag LOCUS_09120 55067 54120 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811999.1 protein_id gnl|my_center|LOCUS_09120 56162 55518 gene locus_tag LOCUS_09130 56162 55518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 57118 56414 gene locus_tag LOCUS_09140 57118 56414 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 protein_id gnl|my_center|LOCUS_09140 57921 57130 gene locus_tag LOCUS_09150 57921 57130 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052443.1 protein_id gnl|my_center|LOCUS_09150 58914 57922 gene locus_tag LOCUS_09160 58914 57922 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053882.1 protein_id gnl|my_center|LOCUS_09160 59830 58931 gene locus_tag LOCUS_09170 59830 58931 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052441.1 protein_id gnl|my_center|LOCUS_09170 61348 60197 gene locus_tag LOCUS_09180 61348 60197 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_09180 61614 61345 gene locus_tag LOCUS_09190 61614 61345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 61896 62738 gene locus_tag LOCUS_09200 61896 62738 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964110.1 protein_id gnl|my_center|LOCUS_09200 62909 63643 gene locus_tag LOCUS_09210 gene pxpB 62909 63643 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889166.1 protein_id gnl|my_center|LOCUS_09210 63813 64709 gene locus_tag LOCUS_09220 63813 64709 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016387.1 protein_id gnl|my_center|LOCUS_09220 64741 65535 gene locus_tag LOCUS_09230 64741 65535 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925131.1 protein_id gnl|my_center|LOCUS_09230 65561 66346 gene locus_tag LOCUS_09240 65561 66346 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868110.1 protein_id gnl|my_center|LOCUS_09240 66537 67340 gene locus_tag LOCUS_09250 66537 67340 CDS product DUF4392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249434.1 protein_id gnl|my_center|LOCUS_09250 67453 67525 gene locus_tag LOCUS_t00110 67453 67525 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 69462 67795 gene locus_tag LOCUS_09260 69462 67795 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_09260 70891 69524 gene locus_tag LOCUS_09270 gene radA 70891 69524 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453976.1 protein_id gnl|my_center|LOCUS_09270 71341 70928 gene locus_tag LOCUS_09280 71341 70928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 74066 71616 gene locus_tag LOCUS_09290 74066 71616 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378875.1 protein_id gnl|my_center|LOCUS_09290 74471 74094 gene locus_tag LOCUS_09300 74471 74094 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358748.1 protein_id gnl|my_center|LOCUS_09300 75651 74515 gene locus_tag LOCUS_09310 75651 74515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 77112 75841 gene locus_tag LOCUS_09320 gene purD 77112 75841 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_09320 77994 77359 gene locus_tag LOCUS_09330 gene purN 77994 77359 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_09330 79013 77988 gene locus_tag LOCUS_09340 gene purM 79013 77988 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081095.1 protein_id gnl|my_center|LOCUS_09340 79604 79092 gene locus_tag LOCUS_09350 gene purE 79604 79092 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081520.1 protein_id gnl|my_center|LOCUS_09350 80697 79723 gene locus_tag LOCUS_09360 gene metA 80697 79723 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796420.1 protein_id gnl|my_center|LOCUS_09360 83130 80905 gene locus_tag LOCUS_09370 gene ligA 83130 80905 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443689.1 protein_id gnl|my_center|LOCUS_09370 83955 83209 gene locus_tag LOCUS_09380 83955 83209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 84382 84185 gene locus_tag LOCUS_09390 84382 84185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 85392 84439 gene locus_tag LOCUS_09400 85392 84439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 85773 86330 gene locus_tag LOCUS_09410 gene efp 85773 86330 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_09410 86535 87467 gene locus_tag LOCUS_09420 86535 87467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 87587 87514 gene locus_tag LOCUS_t00120 87587 87514 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 88575 87715 gene locus_tag LOCUS_09430 88575 87715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 88922 88689 gene locus_tag LOCUS_09440 88922 88689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 90485 88974 gene locus_tag LOCUS_09450 90485 88974 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_09450 91605 90502 gene locus_tag LOCUS_09460 91605 90502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 93106 91592 gene locus_tag LOCUS_09470 93106 91592 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_09470 93955 93113 gene locus_tag LOCUS_09480 93955 93113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 94854 94132 gene locus_tag LOCUS_09490 94854 94132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 95528 94932 gene locus_tag LOCUS_09500 95528 94932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 95724 95419 gene locus_tag LOCUS_09510 95724 95419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 96710 95760 gene locus_tag LOCUS_09520 96710 95760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 97040 98398 gene locus_tag LOCUS_09530 97040 98398 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861243.1 protein_id gnl|my_center|LOCUS_09530 99418 98504 gene locus_tag LOCUS_09540 99418 98504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 100438 99521 gene locus_tag LOCUS_09550 100438 99521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 101053 100544 gene locus_tag LOCUS_09560 101053 100544 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583237.1 protein_id gnl|my_center|LOCUS_09560 105706 101111 gene locus_tag LOCUS_09570 gene polC 105706 101111 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966712.1 protein_id gnl|my_center|LOCUS_09570 106704 105847 gene locus_tag LOCUS_09580 106704 105847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 112046 106722 gene locus_tag LOCUS_09590 112046 106722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 106729 106828 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 112815 112081 gene locus_tag LOCUS_09600 112815 112081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 113843 112815 gene locus_tag LOCUS_09610 113843 112815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 115007 113952 gene locus_tag LOCUS_09620 gene ispG 115007 113952 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_09620 117479 115245 gene locus_tag LOCUS_09630 117479 115245 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_09630 119290 117500 gene locus_tag LOCUS_09640 119290 117500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 121011 119494 gene locus_tag LOCUS_09650 121011 119494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 121996 121313 gene locus_tag LOCUS_09660 121996 121313 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_09660 123475 122345 gene locus_tag LOCUS_09670 gene pheA 123475 122345 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_09670 123921 124118 gene locus_tag LOCUS_09680 123921 124118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 124597 124019 gene locus_tag LOCUS_09690 124597 124019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 126178 124988 gene locus_tag LOCUS_09700 gene dnaJ 126178 124988 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048002.1 protein_id gnl|my_center|LOCUS_09700 128544 126664 gene locus_tag LOCUS_09710 gene dnaK 128544 126664 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430934.1 protein_id gnl|my_center|LOCUS_09710 129507 128764 gene locus_tag LOCUS_09720 gene grpE 129507 128764 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_09720 130686 129616 gene locus_tag LOCUS_09730 gene hrcA 130686 129616 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357960.1 protein_id gnl|my_center|LOCUS_09730 130876 130712 gene locus_tag LOCUS_09740 130876 130712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 132750 130957 gene locus_tag LOCUS_09750 132750 130957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 >Feature sequence007 5336 2661 gene locus_tag LOCUS_09760 5336 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 6586 5531 gene locus_tag LOCUS_09770 6586 5531 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767017.1 protein_id gnl|my_center|LOCUS_09770 8861 6708 gene locus_tag LOCUS_09780 8861 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 11598 8848 gene locus_tag LOCUS_09790 11598 8848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 12703 11822 gene locus_tag LOCUS_09800 12703 11822 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727964.1 protein_id gnl|my_center|LOCUS_09800 13593 12715 gene locus_tag LOCUS_09810 13593 12715 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775693.1 protein_id gnl|my_center|LOCUS_09810 15313 13817 gene locus_tag LOCUS_09820 15313 13817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 17081 15456 gene locus_tag LOCUS_09830 17081 15456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 18870 17194 gene locus_tag LOCUS_09840 18870 17194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 19403 19143 gene locus_tag LOCUS_09850 19403 19143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 20099 19422 gene locus_tag LOCUS_09860 gene hypB 20099 19422 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356857.1 protein_id gnl|my_center|LOCUS_09860 20524 20117 gene locus_tag LOCUS_09870 20524 20117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 22168 20660 gene locus_tag LOCUS_09880 22168 20660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 22356 23276 gene locus_tag LOCUS_09890 22356 23276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 23485 23234 gene locus_tag LOCUS_09900 23485 23234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 23681 25015 gene locus_tag LOCUS_09910 23681 25015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 25039 26358 gene locus_tag LOCUS_09920 25039 26358 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938391.1 protein_id gnl|my_center|LOCUS_09920 26407 27066 gene locus_tag LOCUS_09930 26407 27066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 28555 27563 gene locus_tag LOCUS_09940 gene cytR 28555 27563 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841337.1 protein_id gnl|my_center|LOCUS_09940 29739 28714 gene locus_tag LOCUS_09950 29739 28714 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317694.1 protein_id gnl|my_center|LOCUS_09950 31239 29752 gene locus_tag LOCUS_09960 gene rbsA 31239 29752 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546779.1 protein_id gnl|my_center|LOCUS_09960 32421 31363 gene locus_tag LOCUS_09970 32421 31363 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970150.1 protein_id gnl|my_center|LOCUS_09970 33585 32671 gene locus_tag LOCUS_09980 33585 32671 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_09980 34639 33602 gene locus_tag LOCUS_09990 34639 33602 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_09990 35057 34731 gene locus_tag LOCUS_10000 35057 34731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 35129 35671 gene locus_tag LOCUS_10010 35129 35671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 35696 36316 gene locus_tag LOCUS_10020 35696 36316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10020 36377 37030 gene locus_tag LOCUS_10030 36377 37030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 37006 37605 gene locus_tag LOCUS_10040 37006 37605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 38855 37830 gene locus_tag LOCUS_10050 38855 37830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 40097 38868 gene locus_tag LOCUS_10060 40097 38868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 41020 40109 gene locus_tag LOCUS_10070 41020 40109 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288522.1 protein_id gnl|my_center|LOCUS_10070 41274 42815 gene locus_tag LOCUS_10080 41274 42815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 43110 42895 gene locus_tag LOCUS_10090 43110 42895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 45684 43369 gene locus_tag LOCUS_10100 45684 43369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 47790 45742 gene locus_tag LOCUS_10110 47790 45742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 48828 47962 gene locus_tag LOCUS_10120 48828 47962 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_10120 49783 48821 gene locus_tag LOCUS_10130 49783 48821 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_10130 51546 50041 gene locus_tag LOCUS_10140 51546 50041 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_10140 52775 51672 gene locus_tag LOCUS_10150 52775 51672 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811663.1 protein_id gnl|my_center|LOCUS_10150 53046 53696 gene locus_tag LOCUS_10160 53046 53696 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627160.1 protein_id gnl|my_center|LOCUS_10160 54242 53862 gene locus_tag LOCUS_10170 54242 53862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 55299 54370 gene locus_tag LOCUS_10180 55299 54370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 55430 56266 gene locus_tag LOCUS_10190 55430 56266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 56381 57592 gene locus_tag LOCUS_10200 gene rluD 56381 57592 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381266.1 protein_id gnl|my_center|LOCUS_10200 57607 57741 gene locus_tag LOCUS_10210 57607 57741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 58439 57738 gene locus_tag LOCUS_10220 58439 57738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 59157 58510 gene locus_tag LOCUS_10230 59157 58510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 59336 59175 gene locus_tag LOCUS_10240 59336 59175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 59752 59678 gene locus_tag LOCUS_t00130 59752 59678 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 59896 59822 gene locus_tag LOCUS_t00140 59896 59822 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 60721 60035 gene locus_tag LOCUS_10250 60721 60035 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713757.1 protein_id gnl|my_center|LOCUS_10250 61467 60910 gene locus_tag LOCUS_10260 61467 60910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 64042 61961 gene locus_tag LOCUS_10270 64042 61961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 65712 64057 gene locus_tag LOCUS_10280 65712 64057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 64089 64188 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 69772 65717 gene locus_tag LOCUS_10290 69772 65717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 73118 70182 gene locus_tag LOCUS_10300 73118 70182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 76800 73609 gene locus_tag LOCUS_10310 76800 73609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 78996 76900 gene locus_tag LOCUS_10320 78996 76900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 79393 79118 gene locus_tag LOCUS_10330 79393 79118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 79524 79354 gene locus_tag LOCUS_10340 79524 79354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 80642 79827 gene locus_tag LOCUS_10350 80642 79827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 80828 80649 gene locus_tag LOCUS_10360 80828 80649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 81037 80816 gene locus_tag LOCUS_10370 81037 80816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 84208 81080 gene locus_tag LOCUS_10380 84208 81080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 85131 84205 gene locus_tag LOCUS_10390 85131 84205 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889954.1 protein_id gnl|my_center|LOCUS_10390 86055 85342 gene locus_tag LOCUS_10400 86055 85342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 87018 86266 gene locus_tag LOCUS_10410 87018 86266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 88251 87157 gene locus_tag LOCUS_10420 88251 87157 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948845.1 protein_id gnl|my_center|LOCUS_10420 88799 88428 gene locus_tag LOCUS_10430 88799 88428 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805188.1 protein_id gnl|my_center|LOCUS_10430 89381 89890 gene locus_tag LOCUS_10440 89381 89890 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392747.1 protein_id gnl|my_center|LOCUS_10440 93420 90208 gene locus_tag LOCUS_10450 93420 90208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 93747 93520 gene locus_tag LOCUS_10460 93747 93520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 95219 94080 gene locus_tag LOCUS_10470 gene rpoD 95219 94080 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_10470 97360 95378 gene locus_tag LOCUS_10480 97360 95378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 98701 97382 gene locus_tag LOCUS_10490 98701 97382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 99915 98818 gene locus_tag LOCUS_10500 99915 98818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 100923 99919 gene locus_tag LOCUS_10510 100923 99919 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986984.1 protein_id gnl|my_center|LOCUS_10510 101317 101416 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 103393 101903 gene locus_tag LOCUS_10520 103393 101903 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_10520 104498 103539 gene locus_tag LOCUS_10530 104498 103539 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877828.1 protein_id gnl|my_center|LOCUS_10530 106337 104514 gene locus_tag LOCUS_10540 106337 104514 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289076.1 protein_id gnl|my_center|LOCUS_10540 107411 106521 gene locus_tag LOCUS_10550 107411 106521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 108574 107507 gene locus_tag LOCUS_10560 108574 107507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 111222 108592 gene locus_tag LOCUS_10570 111222 108592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 112454 111222 gene locus_tag LOCUS_10580 112454 111222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 113469 112531 gene locus_tag LOCUS_10590 113469 112531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 114824 113475 gene locus_tag LOCUS_10600 114824 113475 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356901.1 protein_id gnl|my_center|LOCUS_10600 115900 115088 gene locus_tag LOCUS_10610 115900 115088 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289081.1 protein_id gnl|my_center|LOCUS_10610 116471 115911 gene locus_tag LOCUS_10620 gene rfbC 116471 115911 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_10620 118097 116505 gene locus_tag LOCUS_10630 118097 116505 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_10630 119452 118361 gene locus_tag LOCUS_10640 gene rfbB 119452 118361 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965629.1 protein_id gnl|my_center|LOCUS_10640 121530 119764 gene locus_tag LOCUS_10650 121530 119764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 122352 121753 gene locus_tag LOCUS_10660 122352 121753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 122895 123410 gene locus_tag LOCUS_10670 122895 123410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 <127099 123562 gene locus_tag LOCUS_10680 <127099 123562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582726.1:glycoside hydrolase family 3 protein >Feature sequence008 670 47 gene locus_tag LOCUS_10690 670 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1091 645 gene locus_tag LOCUS_10700 1091 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 2277 1102 gene locus_tag LOCUS_10710 2277 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 3398 2304 gene locus_tag LOCUS_10720 3398 2304 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115731595.1 protein_id gnl|my_center|LOCUS_10720 4603 3401 gene locus_tag LOCUS_10730 4603 3401 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261147.1 protein_id gnl|my_center|LOCUS_10730 5224 4622 gene locus_tag LOCUS_10740 gene rfbC 5224 4622 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_10740 6157 5243 gene locus_tag LOCUS_10750 gene rfbD 6157 5243 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027245.1 protein_id gnl|my_center|LOCUS_10750 6333 6154 gene locus_tag LOCUS_10760 6333 6154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 7214 6528 gene locus_tag LOCUS_10770 7214 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 8236 7217 gene locus_tag LOCUS_10780 gene rfbB 8236 7217 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_10780 9185 8289 gene locus_tag LOCUS_10790 gene rfbA 9185 8289 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904719.1 protein_id gnl|my_center|LOCUS_10790 10337 9198 gene locus_tag LOCUS_10800 10337 9198 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142191.1 protein_id gnl|my_center|LOCUS_10800 10969 10586 gene locus_tag LOCUS_10810 10969 10586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 11598 11215 gene locus_tag LOCUS_10820 11598 11215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 12110 11601 gene locus_tag LOCUS_10830 12110 11601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 12897 12586 gene locus_tag LOCUS_10840 12897 12586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 13395 12922 gene locus_tag LOCUS_10850 13395 12922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 13984 13682 gene locus_tag LOCUS_10860 13984 13682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 14100 14363 gene locus_tag LOCUS_10870 14100 14363 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272532.1 protein_id gnl|my_center|LOCUS_10870 14360 14692 gene locus_tag LOCUS_10880 14360 14692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 14947 14780 gene locus_tag LOCUS_10890 14947 14780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 15346 16383 gene locus_tag LOCUS_10900 15346 16383 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461029.1 protein_id gnl|my_center|LOCUS_10900 16929 16462 gene locus_tag LOCUS_10910 16929 16462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 17339 17079 gene locus_tag LOCUS_10920 17339 17079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 18031 17768 gene locus_tag LOCUS_10930 18031 17768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 18188 18009 gene locus_tag LOCUS_10940 18188 18009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 18855 18205 gene locus_tag LOCUS_10950 18855 18205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 20287 18884 gene locus_tag LOCUS_10960 20287 18884 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573158.1 protein_id gnl|my_center|LOCUS_10960 21284 20406 gene locus_tag LOCUS_10970 21284 20406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 22242 21343 gene locus_tag LOCUS_10980 22242 21343 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868277.1 protein_id gnl|my_center|LOCUS_10980 22863 22279 gene locus_tag LOCUS_10990 22863 22279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 24877 23612 gene locus_tag LOCUS_11000 24877 23612 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057959.1 protein_id gnl|my_center|LOCUS_11000 25480 24893 gene locus_tag LOCUS_11010 25480 24893 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286451.1 protein_id gnl|my_center|LOCUS_11010 26362 25496 gene locus_tag LOCUS_11020 26362 25496 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686358.1 protein_id gnl|my_center|LOCUS_11020 27490 26387 gene locus_tag LOCUS_11030 27490 26387 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747555.1 protein_id gnl|my_center|LOCUS_11030 27679 27509 gene locus_tag LOCUS_11040 27679 27509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 28049 27627 gene locus_tag LOCUS_11050 28049 27627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 29323 28112 gene locus_tag LOCUS_11060 29323 28112 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609547.1 protein_id gnl|my_center|LOCUS_11060 30012 29365 gene locus_tag LOCUS_11070 30012 29365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 30300 30148 gene locus_tag LOCUS_11080 30300 30148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 30619 30275 gene locus_tag LOCUS_11090 30619 30275 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667012.1 protein_id gnl|my_center|LOCUS_11090 31431 30850 gene locus_tag LOCUS_11100 31431 30850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 31583 32914 gene locus_tag LOCUS_11110 31583 32914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 32916 34262 gene locus_tag LOCUS_11120 32916 34262 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475678.1 protein_id gnl|my_center|LOCUS_11120 34255 34566 gene locus_tag LOCUS_11130 34255 34566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 37135 35132 gene locus_tag LOCUS_11140 37135 35132 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_11140 37648 37508 gene locus_tag LOCUS_11150 37648 37508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 38121 39632 gene locus_tag LOCUS_11160 38121 39632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 41165 39792 gene locus_tag LOCUS_11170 41165 39792 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_11170 41625 41299 gene locus_tag LOCUS_11180 41625 41299 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813638.1 protein_id gnl|my_center|LOCUS_11180 41886 43565 gene locus_tag LOCUS_11190 41886 43565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 43903 43685 gene locus_tag LOCUS_11200 43903 43685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 45423 44398 gene locus_tag LOCUS_11210 45423 44398 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_11210 45629 47419 gene locus_tag LOCUS_11220 45629 47419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 48573 47683 gene locus_tag LOCUS_11230 48573 47683 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808296.1 protein_id gnl|my_center|LOCUS_11230 49898 48903 gene locus_tag LOCUS_11240 49898 48903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 51397 50081 gene locus_tag LOCUS_11250 51397 50081 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986280.1 protein_id gnl|my_center|LOCUS_11250 52383 51625 gene locus_tag LOCUS_11260 gene dapB 52383 51625 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965675.1 protein_id gnl|my_center|LOCUS_11260 53484 52600 gene locus_tag LOCUS_11270 gene dapA 53484 52600 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438799.1 protein_id gnl|my_center|LOCUS_11270 54834 53977 gene locus_tag LOCUS_11280 54834 53977 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_11280 55098 54934 gene locus_tag LOCUS_11290 55098 54934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 57237 55234 gene locus_tag LOCUS_11300 57237 55234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 58516 57503 gene locus_tag LOCUS_11310 58516 57503 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434205.1 protein_id gnl|my_center|LOCUS_11310 59228 58566 gene locus_tag LOCUS_11320 59228 58566 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485216.1 protein_id gnl|my_center|LOCUS_11320 60385 59375 gene locus_tag LOCUS_11330 60385 59375 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817222.1 protein_id gnl|my_center|LOCUS_11330 61662 60790 gene locus_tag LOCUS_11340 61662 60790 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_11340 61970 62218 gene locus_tag LOCUS_11350 61970 62218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 65177 62232 gene locus_tag LOCUS_11360 65177 62232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 65419 66435 gene locus_tag LOCUS_11370 65419 66435 CDS product DUF4325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682079.1 protein_id gnl|my_center|LOCUS_11370 67526 66663 gene locus_tag LOCUS_11380 67526 66663 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804051.1 protein_id gnl|my_center|LOCUS_11380 68503 67526 gene locus_tag LOCUS_11390 68503 67526 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227020.1 protein_id gnl|my_center|LOCUS_11390 70141 68798 gene locus_tag LOCUS_11400 70141 68798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 71332 70328 gene locus_tag LOCUS_11410 71332 70328 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244946.1 protein_id gnl|my_center|LOCUS_11410 72345 71668 gene locus_tag LOCUS_11420 72345 71668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 72616 72359 gene locus_tag LOCUS_11430 72616 72359 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_11430 73584 72613 gene locus_tag LOCUS_11440 gene whiA 73584 72613 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357358.1 protein_id gnl|my_center|LOCUS_11440 74643 73735 gene locus_tag LOCUS_11450 gene murB 74643 73735 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_11450 75954 74776 gene locus_tag LOCUS_11460 75954 74776 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222697.1 protein_id gnl|my_center|LOCUS_11460 76057 75890 gene locus_tag LOCUS_11470 76057 75890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 79047 76021 gene locus_tag LOCUS_11480 79047 76021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 80612 79158 gene locus_tag LOCUS_11490 80612 79158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 84210 80593 gene locus_tag LOCUS_11500 84210 80593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 80647 80746 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 88569 84232 gene locus_tag LOCUS_11510 88569 84232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 91815 88699 gene locus_tag LOCUS_11520 91815 88699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 93513 92401 gene locus_tag LOCUS_11530 gene holA 93513 92401 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320835.1 protein_id gnl|my_center|LOCUS_11530 95394 94036 gene locus_tag LOCUS_11540 95394 94036 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392886.1 protein_id gnl|my_center|LOCUS_11540 95718 96194 gene locus_tag LOCUS_11550 95718 96194 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_11550 96298 96825 gene locus_tag LOCUS_11560 gene thrB 96298 96825 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939791.1 protein_id gnl|my_center|LOCUS_11560 96928 98028 gene locus_tag LOCUS_11570 96928 98028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 100470 98194 gene locus_tag LOCUS_11580 gene gyrA 100470 98194 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703396.1 protein_id gnl|my_center|LOCUS_11580 102516 100480 gene locus_tag LOCUS_11590 gene gyrB 102516 100480 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_11590 103511 102846 gene locus_tag LOCUS_11600 103511 102846 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_11600 105999 103567 gene locus_tag LOCUS_11610 105999 103567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 107798 106380 gene locus_tag LOCUS_11620 107798 106380 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976070.1 protein_id gnl|my_center|LOCUS_11620 109333 107918 gene locus_tag LOCUS_11630 gene rhaB 109333 107918 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379065.1 protein_id gnl|my_center|LOCUS_11630 110893 109805 gene locus_tag LOCUS_11640 110893 109805 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615404.1 protein_id gnl|my_center|LOCUS_11640 112138 111143 gene locus_tag LOCUS_11650 112138 111143 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582801.1 protein_id gnl|my_center|LOCUS_11650 113648 112152 gene locus_tag LOCUS_11660 gene gguA 113648 112152 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_11660 114649 113678 gene locus_tag LOCUS_11670 114649 113678 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582801.1 protein_id gnl|my_center|LOCUS_11670 115918 114929 gene locus_tag LOCUS_11680 115918 114929 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 protein_id gnl|my_center|LOCUS_11680 117775 115928 gene locus_tag LOCUS_11690 117775 115928 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_11690 119588 117777 gene locus_tag LOCUS_11700 119588 117777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 >Feature sequence009 <1 2070 gene locus_tag LOCUS_11710 <1 2070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157860391.1:leucine-rich repeat protein 2267 2584 gene locus_tag LOCUS_11720 2267 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 2591 3838 gene locus_tag LOCUS_11730 2591 3838 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173917.1 protein_id gnl|my_center|LOCUS_11730 5011 4184 gene locus_tag LOCUS_11740 5011 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 5709 6041 gene locus_tag LOCUS_11750 5709 6041 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843587.1 protein_id gnl|my_center|LOCUS_11750 6046 6372 gene locus_tag LOCUS_11760 6046 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 6591 6788 gene locus_tag LOCUS_11770 6591 6788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 6994 7251 gene locus_tag LOCUS_11780 6994 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 7235 7513 gene locus_tag LOCUS_11790 7235 7513 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613391.1 protein_id gnl|my_center|LOCUS_11790 7534 8436 gene locus_tag LOCUS_11800 7534 8436 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813143.1 protein_id gnl|my_center|LOCUS_11800 8484 8569 gene locus_tag LOCUS_t00150 8484 8569 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8801 9922 gene locus_tag LOCUS_11810 8801 9922 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_11810 10032 11075 gene locus_tag LOCUS_11820 10032 11075 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359074.1 protein_id gnl|my_center|LOCUS_11820 11330 12331 gene locus_tag LOCUS_11830 11330 12331 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_11830 12663 13577 gene locus_tag LOCUS_11840 12663 13577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 13615 14748 gene locus_tag LOCUS_11850 gene mutY 13615 14748 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989787.1 protein_id gnl|my_center|LOCUS_11850 14795 15817 gene locus_tag LOCUS_11860 14795 15817 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475456.1 protein_id gnl|my_center|LOCUS_11860 16335 15895 gene locus_tag LOCUS_11870 16335 15895 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_11870 17398 16481 gene locus_tag LOCUS_11880 gene pyrB 17398 16481 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_11880 17716 19878 gene locus_tag LOCUS_11890 17716 19878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 20080 21666 gene locus_tag LOCUS_11900 20080 21666 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_11900 21863 22246 gene locus_tag LOCUS_11910 21863 22246 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965385.1 protein_id gnl|my_center|LOCUS_11910 22246 22668 gene locus_tag LOCUS_11920 gene nusB 22246 22668 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_11920 22738 23976 gene locus_tag LOCUS_11930 gene xseA 22738 23976 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358983.1 protein_id gnl|my_center|LOCUS_11930 24286 24600 gene locus_tag LOCUS_11940 24286 24600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 24572 25477 gene locus_tag LOCUS_11950 24572 25477 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_11950 25491 27380 gene locus_tag LOCUS_11960 gene dxs 25491 27380 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_11960 27529 28548 gene locus_tag LOCUS_11970 27529 28548 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358964.1 protein_id gnl|my_center|LOCUS_11970 28637 29497 gene locus_tag LOCUS_11980 28637 29497 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_11980 29524 29976 gene locus_tag LOCUS_11990 29524 29976 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_11990 30162 31844 gene locus_tag LOCUS_12000 gene recN 30162 31844 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896126.1 protein_id gnl|my_center|LOCUS_12000 31961 33118 gene locus_tag LOCUS_12010 gene spoIVB 31961 33118 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965372.1 protein_id gnl|my_center|LOCUS_12010 33378 35108 gene locus_tag LOCUS_12020 33378 35108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 35178 36386 gene locus_tag LOCUS_12030 35178 36386 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814294.1 protein_id gnl|my_center|LOCUS_12030 36358 36525 gene locus_tag LOCUS_12040 36358 36525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 36584 38044 gene locus_tag LOCUS_12050 36584 38044 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_12050 38195 39490 gene locus_tag LOCUS_12060 38195 39490 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054321935.1 protein_id gnl|my_center|LOCUS_12060 39887 39513 gene locus_tag LOCUS_12070 39887 39513 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_12070 41771 39903 gene locus_tag LOCUS_12080 41771 39903 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796600.1 protein_id gnl|my_center|LOCUS_12080 42194 41976 gene locus_tag LOCUS_12090 42194 41976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 42725 44326 gene locus_tag LOCUS_12100 42725 44326 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_12100 44497 44703 gene locus_tag LOCUS_12110 44497 44703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 44690 46294 gene locus_tag LOCUS_12120 gene pckA 44690 46294 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761973.1 protein_id gnl|my_center|LOCUS_12120 48011 46824 gene locus_tag LOCUS_12130 48011 46824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 49913 48276 gene locus_tag LOCUS_12140 49913 48276 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232344.1 protein_id gnl|my_center|LOCUS_12140 49913 50197 gene locus_tag LOCUS_12150 49913 50197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 50328 52589 gene locus_tag LOCUS_12160 50328 52589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 54326 52704 gene locus_tag LOCUS_12170 54326 52704 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680980.1 protein_id gnl|my_center|LOCUS_12170 54862 54338 gene locus_tag LOCUS_12180 54862 54338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 57777 55024 gene locus_tag LOCUS_12190 57777 55024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 58104 59078 gene locus_tag LOCUS_12200 58104 59078 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389346.1 protein_id gnl|my_center|LOCUS_12200 59299 62844 gene locus_tag LOCUS_12210 gene nifJ 59299 62844 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 protein_id gnl|my_center|LOCUS_12210 63180 64892 gene locus_tag LOCUS_12220 gene pdcB 63180 64892 CDS product phosphodiesterase PdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437448.1 protein_id gnl|my_center|LOCUS_12220 65109 67835 gene locus_tag LOCUS_12230 65109 67835 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390143.1 protein_id gnl|my_center|LOCUS_12230 68090 68785 gene locus_tag LOCUS_12240 gene pyrH 68090 68785 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_12240 68993 69544 gene locus_tag LOCUS_12250 gene frr 68993 69544 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986799.1 protein_id gnl|my_center|LOCUS_12250 69729 70424 gene locus_tag LOCUS_12260 69729 70424 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424529.1 protein_id gnl|my_center|LOCUS_12260 70561 71436 gene locus_tag LOCUS_12270 70561 71436 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_12270 71588 72814 gene locus_tag LOCUS_12280 71588 72814 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_12280 72811 73848 gene locus_tag LOCUS_12290 gene rseP 72811 73848 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430605.1 protein_id gnl|my_center|LOCUS_12290 74370 75650 gene locus_tag LOCUS_12300 gene recA 74370 75650 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_12300 75677 76312 gene locus_tag LOCUS_12310 75677 76312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 76448 76523 gene locus_tag LOCUS_t00160 76448 76523 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 78090 76570 gene locus_tag LOCUS_12320 gene larC 78090 76570 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964092.1 protein_id gnl|my_center|LOCUS_12320 78680 79663 gene locus_tag LOCUS_12330 78680 79663 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964851.1 protein_id gnl|my_center|LOCUS_12330 79863 80192 gene locus_tag LOCUS_12340 79863 80192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 80346 81005 gene locus_tag LOCUS_12350 80346 81005 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_12350 81209 81709 gene locus_tag LOCUS_12360 81209 81709 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_12360 81928 82233 gene locus_tag LOCUS_12370 gene trxA 81928 82233 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016136.1 protein_id gnl|my_center|LOCUS_12370 82243 82464 gene locus_tag LOCUS_12380 82243 82464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 82391 83935 gene locus_tag LOCUS_12390 gene guaA 82391 83935 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_12390 84335 84880 gene locus_tag LOCUS_12400 84335 84880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 85073 85234 gene locus_tag LOCUS_12410 85073 85234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 85293 87188 gene locus_tag LOCUS_12420 85293 87188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 87202 88923 gene locus_tag LOCUS_12430 87202 88923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 88944 90728 gene locus_tag LOCUS_12440 88944 90728 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023602.1 protein_id gnl|my_center|LOCUS_12440 91252 91620 gene locus_tag LOCUS_12450 91252 91620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 91721 92116 gene locus_tag LOCUS_12460 91721 92116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 92142 93896 gene locus_tag LOCUS_12470 92142 93896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459257.1 protein_id gnl|my_center|LOCUS_12470 93938 94861 gene locus_tag LOCUS_12480 93938 94861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 94944 95612 gene locus_tag LOCUS_12490 94944 95612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 95609 96259 gene locus_tag LOCUS_12500 95609 96259 CDS product DUF3786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813269.1 protein_id gnl|my_center|LOCUS_12500 96311 96712 gene locus_tag LOCUS_12510 gene mutT 96311 96712 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_12510 96791 97237 gene locus_tag LOCUS_12520 96791 97237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 97255 98667 gene locus_tag LOCUS_12530 97255 98667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 98664 99347 gene locus_tag LOCUS_12540 98664 99347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 99344 102721 gene locus_tag LOCUS_12550 99344 102721 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392027.1 protein_id gnl|my_center|LOCUS_12550 102828 104054 gene locus_tag LOCUS_12560 102828 104054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 104705 104196 gene locus_tag LOCUS_12570 104705 104196 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205009986.1 protein_id gnl|my_center|LOCUS_12570 105239 104721 gene locus_tag LOCUS_12580 105239 104721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 106099 107862 gene locus_tag LOCUS_12590 gene dnaK 106099 107862 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_12590 109139 108159 gene locus_tag LOCUS_12600 gene pta 109139 108159 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130342.1 protein_id gnl|my_center|LOCUS_12600 110002 110247 gene locus_tag LOCUS_12610 110002 110247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 110253 111071 gene locus_tag LOCUS_12620 110253 111071 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_12620 111031 111969 gene locus_tag LOCUS_12630 111031 111969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 >Feature sequence010 1010 507 gene locus_tag LOCUS_12640 1010 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1471 1190 gene locus_tag LOCUS_12650 1471 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1715 1518 gene locus_tag LOCUS_12660 1715 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 2056 1871 gene locus_tag LOCUS_12670 2056 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 2274 2053 gene locus_tag LOCUS_12680 2274 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 2672 2271 gene locus_tag LOCUS_12690 2672 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 3027 2833 gene locus_tag LOCUS_12700 3027 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 3391 3074 gene locus_tag LOCUS_12710 3391 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 3735 3454 gene locus_tag LOCUS_12720 3735 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 4080 3901 gene locus_tag LOCUS_12730 4080 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 4424 4077 gene locus_tag LOCUS_12740 4424 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 4926 4579 gene locus_tag LOCUS_12750 4926 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 5577 5086 gene locus_tag LOCUS_12760 5577 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 5941 5765 gene locus_tag LOCUS_12770 5941 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 5956 6055 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8549 6930 gene locus_tag LOCUS_12780 8549 6930 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775555.1 protein_id gnl|my_center|LOCUS_12780 10236 8551 gene locus_tag LOCUS_12790 10236 8551 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_12790 11664 10240 gene locus_tag LOCUS_12800 11664 10240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 13295 11652 gene locus_tag LOCUS_12810 13295 11652 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_12810 13864 13592 gene locus_tag LOCUS_12820 13864 13592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 14703 13936 gene locus_tag LOCUS_12830 14703 13936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 16090 14762 gene locus_tag LOCUS_12840 16090 14762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 16442 16134 gene locus_tag LOCUS_12850 16442 16134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 16867 16439 gene locus_tag LOCUS_12860 16867 16439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 17315 16881 gene locus_tag LOCUS_12870 17315 16881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 20745 17428 gene locus_tag LOCUS_12880 20745 17428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 24227 20877 gene locus_tag LOCUS_12890 24227 20877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 24781 24224 gene locus_tag LOCUS_12900 24781 24224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 25013 24756 gene locus_tag LOCUS_12910 25013 24756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 25279 25025 gene locus_tag LOCUS_12920 25279 25025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 27729 25294 gene locus_tag LOCUS_12930 27729 25294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 28507 27749 gene locus_tag LOCUS_12940 28507 27749 CDS product phage tail family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963390.1 protein_id gnl|my_center|LOCUS_12940 33747 29020 gene locus_tag LOCUS_12950 33747 29020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 33979 33815 gene locus_tag LOCUS_12960 33979 33815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 34356 33976 gene locus_tag LOCUS_12970 34356 33976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 35029 34415 gene locus_tag LOCUS_12980 35029 34415 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905720.1 protein_id gnl|my_center|LOCUS_12980 35379 35062 gene locus_tag LOCUS_12990 35379 35062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 35764 35381 gene locus_tag LOCUS_13000 35764 35381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 36108 35764 gene locus_tag LOCUS_13010 36108 35764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 36440 36108 gene locus_tag LOCUS_13020 36440 36108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 37673 36465 gene locus_tag LOCUS_13030 37673 36465 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938792.1 protein_id gnl|my_center|LOCUS_13030 38562 37723 gene locus_tag LOCUS_13040 38562 37723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 39974 38559 gene locus_tag LOCUS_13050 39974 38559 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523689.1 protein_id gnl|my_center|LOCUS_13050 41609 39990 gene locus_tag LOCUS_13060 41609 39990 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443313.1 protein_id gnl|my_center|LOCUS_13060 42111 41602 gene locus_tag LOCUS_13070 42111 41602 CDS product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900701.1 protein_id gnl|my_center|LOCUS_13070 42349 42170 gene locus_tag LOCUS_13080 42349 42170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 42626 42399 gene locus_tag LOCUS_13090 42626 42399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 42970 42788 gene locus_tag LOCUS_13100 42970 42788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 43423 42983 gene locus_tag LOCUS_13110 43423 42983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 43798 43610 gene locus_tag LOCUS_13120 43798 43610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 44514 43801 gene locus_tag LOCUS_13130 44514 43801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 44921 44526 gene locus_tag LOCUS_13140 44921 44526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 45801 44914 gene locus_tag LOCUS_13150 45801 44914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 48119 45999 gene locus_tag LOCUS_13160 48119 45999 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272166.1 protein_id gnl|my_center|LOCUS_13160 49389 48106 gene locus_tag LOCUS_13170 49389 48106 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774201.1 protein_id gnl|my_center|LOCUS_13170 49696 49373 gene locus_tag LOCUS_13180 49696 49373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 50018 49680 gene locus_tag LOCUS_13190 50018 49680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 50506 50141 gene locus_tag LOCUS_13200 50506 50141 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145905.1 protein_id gnl|my_center|LOCUS_13200 52540 50510 gene locus_tag LOCUS_13210 52540 50510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 52916 52521 gene locus_tag LOCUS_13220 52916 52521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 53373 52816 gene locus_tag LOCUS_13230 53373 52816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 54003 53587 gene locus_tag LOCUS_13240 54003 53587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 54556 53909 gene locus_tag LOCUS_13250 54556 53909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 54894 54577 gene locus_tag LOCUS_13260 54894 54577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 55427 55020 gene locus_tag LOCUS_13270 55427 55020 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922068.1 protein_id gnl|my_center|LOCUS_13270 57633 55624 gene locus_tag LOCUS_13280 57633 55624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 59224 57623 gene locus_tag LOCUS_13290 59224 57623 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922064.1 protein_id gnl|my_center|LOCUS_13290 59733 59236 gene locus_tag LOCUS_13300 59733 59236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 60744 59749 gene locus_tag LOCUS_13310 60744 59749 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922060.1 protein_id gnl|my_center|LOCUS_13310 60936 60754 gene locus_tag LOCUS_13320 60936 60754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 61466 60951 gene locus_tag LOCUS_13330 61466 60951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 61713 61495 gene locus_tag LOCUS_13340 61713 61495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 62155 61706 gene locus_tag LOCUS_13350 62155 61706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 62765 62148 gene locus_tag LOCUS_13360 62765 62148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 63071 62781 gene locus_tag LOCUS_13370 63071 62781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 63457 63900 gene locus_tag LOCUS_13380 63457 63900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 65464 64559 gene locus_tag LOCUS_13390 65464 64559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 66046 65621 gene locus_tag LOCUS_13400 66046 65621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 66944 66153 gene locus_tag LOCUS_13410 66944 66153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 67279 67136 gene locus_tag LOCUS_13420 67279 67136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 67905 67561 gene locus_tag LOCUS_13430 67905 67561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 69955 67916 gene locus_tag LOCUS_13440 69955 67916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 71344 70310 gene locus_tag LOCUS_13450 71344 70310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 72644 71307 gene locus_tag LOCUS_13460 72644 71307 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288195.1 protein_id gnl|my_center|LOCUS_13460 73662 72721 gene locus_tag LOCUS_13470 73662 72721 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288197.1 protein_id gnl|my_center|LOCUS_13470 74750 73662 gene locus_tag LOCUS_13480 gene gmd 74750 73662 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107662.1 protein_id gnl|my_center|LOCUS_13480 75058 74897 gene locus_tag LOCUS_13490 75058 74897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 75694 75257 gene locus_tag LOCUS_13500 75694 75257 CDS product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993892.1 protein_id gnl|my_center|LOCUS_13500 78664 75767 gene locus_tag LOCUS_13510 78664 75767 CDS product bifunctional fucokinase/fucose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202940.1 protein_id gnl|my_center|LOCUS_13510 79195 78761 gene locus_tag LOCUS_13520 79195 78761 CDS product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993892.1 protein_id gnl|my_center|LOCUS_13520 80689 79220 gene locus_tag LOCUS_13530 80689 79220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 81841 80894 gene locus_tag LOCUS_13540 81841 80894 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289864.1 protein_id gnl|my_center|LOCUS_13540 82673 82077 gene locus_tag LOCUS_13550 82673 82077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 85876 85121 gene locus_tag LOCUS_13560 85876 85121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 87306 85873 gene locus_tag LOCUS_13570 87306 85873 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767818.1 protein_id gnl|my_center|LOCUS_13570 88600 87311 gene locus_tag LOCUS_13580 88600 87311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 89655 88627 gene locus_tag LOCUS_13590 89655 88627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 89809 89657 gene locus_tag LOCUS_13600 89809 89657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 90623 90087 gene locus_tag LOCUS_13610 90623 90087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 91801 90644 gene locus_tag LOCUS_13620 91801 90644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 92681 91869 gene locus_tag LOCUS_13630 92681 91869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 93852 92686 gene locus_tag LOCUS_13640 93852 92686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 95026 93872 gene locus_tag LOCUS_13650 95026 93872 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267353.1 protein_id gnl|my_center|LOCUS_13650 95641 95042 gene locus_tag LOCUS_13660 gene rfbC 95641 95042 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_13660 96556 95660 gene locus_tag LOCUS_13670 gene rfbD 96556 95660 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027245.1 protein_id gnl|my_center|LOCUS_13670 97610 96591 gene locus_tag LOCUS_13680 gene rfbB 97610 96591 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_13680 98507 97650 gene locus_tag LOCUS_13690 gene rfbA 98507 97650 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857520.1 protein_id gnl|my_center|LOCUS_13690 99844 98597 gene locus_tag LOCUS_13700 99844 98597 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203512.1 protein_id gnl|my_center|LOCUS_13700 101119 99872 gene locus_tag LOCUS_13710 101119 99872 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288208.1 protein_id gnl|my_center|LOCUS_13710 102444 101176 gene locus_tag LOCUS_13720 102444 101176 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403007.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence011 189 797 gene locus_tag LOCUS_13730 189 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 978 2213 gene locus_tag LOCUS_13740 978 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 2449 2982 gene locus_tag LOCUS_13750 gene recU 2449 2982 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460152.1 protein_id gnl|my_center|LOCUS_13750 4006 2993 gene locus_tag LOCUS_13760 4006 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 4338 5516 gene locus_tag LOCUS_13770 4338 5516 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949109.1 protein_id gnl|my_center|LOCUS_13770 5771 6421 gene locus_tag LOCUS_13780 gene hisG 5771 6421 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964254.1 protein_id gnl|my_center|LOCUS_13780 6434 8068 gene locus_tag LOCUS_13790 gene hisD 6434 8068 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949111.1 protein_id gnl|my_center|LOCUS_13790 6472 6571 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8105 8692 gene locus_tag LOCUS_13800 gene hisB 8105 8692 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_13800 8829 10226 gene locus_tag LOCUS_13810 8829 10226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 10607 12490 gene locus_tag LOCUS_13820 10607 12490 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_13820 12465 13184 gene locus_tag LOCUS_13830 12465 13184 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048024.1 protein_id gnl|my_center|LOCUS_13830 13428 14705 gene locus_tag LOCUS_13840 13428 14705 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546353.1 protein_id gnl|my_center|LOCUS_13840 15491 14928 gene locus_tag LOCUS_13850 15491 14928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 16353 15556 gene locus_tag LOCUS_13860 16353 15556 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207193.1 protein_id gnl|my_center|LOCUS_13860 17134 16373 gene locus_tag LOCUS_13870 17134 16373 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476103.1 protein_id gnl|my_center|LOCUS_13870 18395 17226 gene locus_tag LOCUS_13880 18395 17226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 19092 18382 gene locus_tag LOCUS_13890 19092 18382 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986982.1 protein_id gnl|my_center|LOCUS_13890 19685 19990 gene locus_tag LOCUS_13900 gene rplU 19685 19990 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229668.1 protein_id gnl|my_center|LOCUS_13900 20002 20328 gene locus_tag LOCUS_13910 20002 20328 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816543.1 protein_id gnl|my_center|LOCUS_13910 20332 20619 gene locus_tag LOCUS_13920 gene rpmA 20332 20619 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944957.1 protein_id gnl|my_center|LOCUS_13920 20800 22101 gene locus_tag LOCUS_13930 gene obgE 20800 22101 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_13930 22202 22492 gene locus_tag LOCUS_13940 gene yhbY 22202 22492 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226133.1 protein_id gnl|my_center|LOCUS_13940 22489 23265 gene locus_tag LOCUS_13950 gene nadD 22489 23265 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964574.1 protein_id gnl|my_center|LOCUS_13950 23262 23852 gene locus_tag LOCUS_13960 gene yqeK 23262 23852 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964575.1 protein_id gnl|my_center|LOCUS_13960 23856 24242 gene locus_tag LOCUS_13970 gene rsfS 23856 24242 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416416.1 protein_id gnl|my_center|LOCUS_13970 24229 25029 gene locus_tag LOCUS_13980 24229 25029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 25876 25262 gene locus_tag LOCUS_13990 gene lexA 25876 25262 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_13990 26153 28240 gene locus_tag LOCUS_14000 26153 28240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 28895 29953 gene locus_tag LOCUS_14010 28895 29953 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811557.1 protein_id gnl|my_center|LOCUS_14010 30581 30144 gene locus_tag LOCUS_14020 gene dtd 30581 30144 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460350.1 protein_id gnl|my_center|LOCUS_14020 31826 30837 gene locus_tag LOCUS_14030 31826 30837 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475978.1 protein_id gnl|my_center|LOCUS_14030 32577 32032 gene locus_tag LOCUS_14040 gene lspA 32577 32032 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454916.1 protein_id gnl|my_center|LOCUS_14040 33887 32772 gene locus_tag LOCUS_14050 gene aroB 33887 32772 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958520.1 protein_id gnl|my_center|LOCUS_14050 34831 34004 gene locus_tag LOCUS_14060 34831 34004 CDS product photosystem II S4 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140394.1 protein_id gnl|my_center|LOCUS_14060 35553 34942 gene locus_tag LOCUS_14070 35553 34942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 36349 35654 gene locus_tag LOCUS_14080 36349 35654 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893687.1 protein_id gnl|my_center|LOCUS_14080 37795 36431 gene locus_tag LOCUS_14090 37795 36431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 38001 38210 gene locus_tag LOCUS_14100 38001 38210 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948188.1 protein_id gnl|my_center|LOCUS_14100 38726 38304 gene locus_tag LOCUS_14110 38726 38304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_14110 40032 38950 gene locus_tag LOCUS_14120 40032 38950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 40411 40016 gene locus_tag LOCUS_14130 gene mgsA 40411 40016 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289508.1 protein_id gnl|my_center|LOCUS_14130 41718 40609 gene locus_tag LOCUS_14140 gene rodA 41718 40609 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_14140 41947 41693 gene locus_tag LOCUS_14150 41947 41693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 42872 42078 gene locus_tag LOCUS_14160 gene minD 42872 42078 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419057.1 protein_id gnl|my_center|LOCUS_14160 43828 43088 gene locus_tag LOCUS_14170 43828 43088 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902702.1 protein_id gnl|my_center|LOCUS_14170 46774 43874 gene locus_tag LOCUS_14180 46774 43874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 47297 46800 gene locus_tag LOCUS_14190 47297 46800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 48347 47394 gene locus_tag LOCUS_14200 gene mreC 48347 47394 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546779.1 protein_id gnl|my_center|LOCUS_14200 49497 48490 gene locus_tag LOCUS_14210 49497 48490 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_14210 50321 49575 gene locus_tag LOCUS_14220 gene radC 50321 49575 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964554.1 protein_id gnl|my_center|LOCUS_14220 52729 50501 gene locus_tag LOCUS_14230 52729 50501 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_14230 53274 52726 gene locus_tag LOCUS_14240 53274 52726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 54753 53317 gene locus_tag LOCUS_14250 54753 53317 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_14250 56234 54954 gene locus_tag LOCUS_14260 56234 54954 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_14260 57509 56532 gene locus_tag LOCUS_14270 gene miaA 57509 56532 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_14270 59893 57845 gene locus_tag LOCUS_14280 gene mutL 59893 57845 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459784.1 protein_id gnl|my_center|LOCUS_14280 63361 60413 gene locus_tag LOCUS_14290 gene mutS 63361 60413 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_14290 64887 63529 gene locus_tag LOCUS_14300 64887 63529 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_14300 65305 65901 gene locus_tag LOCUS_14310 65305 65901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 67634 66075 gene locus_tag LOCUS_14320 gene miaB 67634 66075 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_14320 69089 67755 gene locus_tag LOCUS_14330 69089 67755 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287964.1 protein_id gnl|my_center|LOCUS_14330 71567 69411 gene locus_tag LOCUS_14340 71567 69411 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582883.1 protein_id gnl|my_center|LOCUS_14340 72331 71678 gene locus_tag LOCUS_14350 72331 71678 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922815.1 protein_id gnl|my_center|LOCUS_14350 72774 72544 gene locus_tag LOCUS_14360 72774 72544 CDS product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939394.1 protein_id gnl|my_center|LOCUS_14360 74720 73062 gene locus_tag LOCUS_14370 74720 73062 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_14370 75909 74737 gene locus_tag LOCUS_14380 75909 74737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 76597 76079 gene locus_tag LOCUS_14390 gene ybeY 76597 76079 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430894.1 protein_id gnl|my_center|LOCUS_14390 77763 76723 gene locus_tag LOCUS_14400 77763 76723 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_14400 79064 77760 gene locus_tag LOCUS_14410 79064 77760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 79425 79165 gene locus_tag LOCUS_14420 79425 79165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 80543 79704 gene locus_tag LOCUS_14430 80543 79704 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_14430 81916 80699 gene locus_tag LOCUS_14440 gene ilvA 81916 80699 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 protein_id gnl|my_center|LOCUS_14440 82998 82060 gene locus_tag LOCUS_14450 gene ftsY 82998 82060 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965059.1 protein_id gnl|my_center|LOCUS_14450 86715 83155 gene locus_tag LOCUS_14460 gene smc 86715 83155 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 protein_id gnl|my_center|LOCUS_14460 87545 86721 gene locus_tag LOCUS_14470 gene rnc 87545 86721 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989817.1 protein_id gnl|my_center|LOCUS_14470 87891 87661 gene locus_tag LOCUS_14480 gene acpP 87891 87661 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280528.1 protein_id gnl|my_center|LOCUS_14480 89014 88001 gene locus_tag LOCUS_14490 gene plsX 89014 88001 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_14490 89365 89183 gene locus_tag LOCUS_14500 gene rpmF 89365 89183 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_14500 89860 89369 gene locus_tag LOCUS_14510 89860 89369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 91130 89940 gene locus_tag LOCUS_14520 91130 89940 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438096.1 protein_id gnl|my_center|LOCUS_14520 99371 91296 gene locus_tag LOCUS_14530 99371 91296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 97741 97840 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 99701 99919 gene locus_tag LOCUS_14540 99701 99919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 100912 100283 gene locus_tag LOCUS_14550 100912 100283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 101420 101115 gene locus_tag LOCUS_14560 101420 101115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 101667 101425 gene locus_tag LOCUS_14570 101667 101425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 >Feature sequence012 1898 1716 gene locus_tag LOCUS_14580 1898 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 2158 1835 gene locus_tag LOCUS_14590 2158 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 3492 2413 gene locus_tag LOCUS_14600 3492 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 4580 3618 gene locus_tag LOCUS_14610 4580 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 5957 5019 gene locus_tag LOCUS_14620 5957 5019 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_14620 6784 5945 gene locus_tag LOCUS_14630 6784 5945 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_14630 7643 6951 gene locus_tag LOCUS_14640 7643 6951 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262722.1 protein_id gnl|my_center|LOCUS_14640 7911 8010 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11631 8281 gene locus_tag LOCUS_14650 11631 8281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 12939 11707 gene locus_tag LOCUS_14660 12939 11707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 13740 13036 gene locus_tag LOCUS_14670 13740 13036 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721621.1 protein_id gnl|my_center|LOCUS_14670 14066 14587 gene locus_tag LOCUS_14680 14066 14587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 14656 14823 gene locus_tag LOCUS_14690 14656 14823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 15004 16371 gene locus_tag LOCUS_14700 15004 16371 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_14700 17866 16499 gene locus_tag LOCUS_14710 17866 16499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 18795 17908 gene locus_tag LOCUS_14720 18795 17908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 19170 20036 gene locus_tag LOCUS_14730 19170 20036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 21315 20194 gene locus_tag LOCUS_14740 21315 20194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 21532 21783 gene locus_tag LOCUS_14750 21532 21783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 23681 22017 gene locus_tag LOCUS_14760 23681 22017 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860825.1 protein_id gnl|my_center|LOCUS_14760 24609 23779 gene locus_tag LOCUS_14770 24609 23779 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_14770 25493 24606 gene locus_tag LOCUS_14780 25493 24606 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582924.1 protein_id gnl|my_center|LOCUS_14780 26764 25544 gene locus_tag LOCUS_14790 26764 25544 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582923.1 protein_id gnl|my_center|LOCUS_14790 27402 27178 gene locus_tag LOCUS_14800 27402 27178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 28451 27477 gene locus_tag LOCUS_14810 28451 27477 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582922.1 protein_id gnl|my_center|LOCUS_14810 30146 28797 gene locus_tag LOCUS_14820 30146 28797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 32218 30284 gene locus_tag LOCUS_14830 32218 30284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 33138 32275 gene locus_tag LOCUS_14840 33138 32275 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557338.1 protein_id gnl|my_center|LOCUS_14840 34255 33140 gene locus_tag LOCUS_14850 34255 33140 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_14850 34621 35124 gene locus_tag LOCUS_14860 34621 35124 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_14860 36727 35231 gene locus_tag LOCUS_14870 gene araA 36727 35231 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229499.1 protein_id gnl|my_center|LOCUS_14870 37913 37098 gene locus_tag LOCUS_14880 37913 37098 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390165.1 protein_id gnl|my_center|LOCUS_14880 39637 38003 gene locus_tag LOCUS_14890 39637 38003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 41123 39933 gene locus_tag LOCUS_14900 41123 39933 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963530.1 protein_id gnl|my_center|LOCUS_14900 43065 41497 gene locus_tag LOCUS_14910 43065 41497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 43907 45178 gene locus_tag LOCUS_14920 43907 45178 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 protein_id gnl|my_center|LOCUS_14920 49603 45182 gene locus_tag LOCUS_14930 49603 45182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 50250 49672 gene locus_tag LOCUS_14940 gene pth 50250 49672 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226727.1 protein_id gnl|my_center|LOCUS_14940 52057 50312 gene locus_tag LOCUS_14950 52057 50312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 54099 52261 gene locus_tag LOCUS_14960 54099 52261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 56661 54316 gene locus_tag LOCUS_14970 56661 54316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 57581 57405 gene locus_tag LOCUS_14980 57581 57405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 59275 57695 gene locus_tag LOCUS_14990 59275 57695 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_14990 62222 59619 gene locus_tag LOCUS_15000 gene clpB 62222 59619 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009165978.1 protein_id gnl|my_center|LOCUS_15000 62440 62658 gene locus_tag LOCUS_15010 62440 62658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 62726 63079 gene locus_tag LOCUS_15020 62726 63079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 63318 64601 gene locus_tag LOCUS_15030 63318 64601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 65188 64802 gene locus_tag LOCUS_15040 65188 64802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 66832 65591 gene locus_tag LOCUS_15050 66832 65591 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392827.1 protein_id gnl|my_center|LOCUS_15050 67987 66995 gene locus_tag LOCUS_15060 67987 66995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 69888 68191 gene locus_tag LOCUS_15070 69888 68191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 70565 69930 gene locus_tag LOCUS_15080 70565 69930 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462097.1 protein_id gnl|my_center|LOCUS_15080 71311 70772 gene locus_tag LOCUS_15090 71311 70772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 73521 71533 gene locus_tag LOCUS_15100 73521 71533 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460547.1 protein_id gnl|my_center|LOCUS_15100 74386 73751 gene locus_tag LOCUS_15110 74386 73751 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462097.1 protein_id gnl|my_center|LOCUS_15110 75287 74484 gene locus_tag LOCUS_15120 75287 74484 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945346.1 protein_id gnl|my_center|LOCUS_15120 76557 75523 gene locus_tag LOCUS_15130 76557 75523 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814186.1 protein_id gnl|my_center|LOCUS_15130 76846 76652 gene locus_tag LOCUS_15140 76846 76652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 78377 77040 gene locus_tag LOCUS_15150 gene gdhA 78377 77040 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476262.1 protein_id gnl|my_center|LOCUS_15150 80215 78899 gene locus_tag LOCUS_15160 80215 78899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 82098 80800 gene locus_tag LOCUS_15170 82098 80800 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860746.1 protein_id gnl|my_center|LOCUS_15170 82499 82302 gene locus_tag LOCUS_15180 82499 82302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 82825 82598 gene locus_tag LOCUS_15190 82825 82598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 83328 82966 gene locus_tag LOCUS_15200 83328 82966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 83929 83444 gene locus_tag LOCUS_15210 83929 83444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 84901 83966 gene locus_tag LOCUS_15220 84901 83966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 85211 85657 gene locus_tag LOCUS_15230 85211 85657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 85674 86738 gene locus_tag LOCUS_15240 85674 86738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 87320 88267 gene locus_tag LOCUS_15250 87320 88267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 88465 89016 gene locus_tag LOCUS_15260 88465 89016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 92096 89271 gene locus_tag LOCUS_15270 gene inlJ 92096 89271 CDS product class 1 internalin InlJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990081.1 protein_id gnl|my_center|LOCUS_15270 92344 93561 gene locus_tag LOCUS_15280 gene dcm 92344 93561 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222381.1 protein_id gnl|my_center|LOCUS_15280 93562 94737 gene locus_tag LOCUS_15290 93562 94737 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203405.1 protein_id gnl|my_center|LOCUS_15290 94737 95192 gene locus_tag LOCUS_15300 94737 95192 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537483.1 protein_id gnl|my_center|LOCUS_15300 97639 95567 gene locus_tag LOCUS_15310 97639 95567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 98124 97639 gene locus_tag LOCUS_15320 98124 97639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 100213 98288 gene locus_tag LOCUS_15330 100213 98288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 >Feature sequence013 84 1439 gene locus_tag LOCUS_15340 84 1439 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775491.1 protein_id gnl|my_center|LOCUS_15340 1465 1893 gene locus_tag LOCUS_15350 1465 1893 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264782.1 protein_id gnl|my_center|LOCUS_15350 2919 2071 gene locus_tag LOCUS_15360 2919 2071 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453971.1 protein_id gnl|my_center|LOCUS_15360 3439 2993 gene locus_tag LOCUS_15370 3439 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 4558 3902 gene locus_tag LOCUS_15380 4558 3902 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_15380 6138 4774 gene locus_tag LOCUS_15390 6138 4774 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_15390 6258 6357 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6868 9369 gene locus_tag LOCUS_15400 6868 9369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 9397 11904 gene locus_tag LOCUS_15410 9397 11904 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582505.1 protein_id gnl|my_center|LOCUS_15410 12231 14756 gene locus_tag LOCUS_15420 12231 14756 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388658.1 protein_id gnl|my_center|LOCUS_15420 14809 15630 gene locus_tag LOCUS_15430 14809 15630 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901594.1 protein_id gnl|my_center|LOCUS_15430 16087 16941 gene locus_tag LOCUS_15440 16087 16941 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948893.1 protein_id gnl|my_center|LOCUS_15440 16966 18354 gene locus_tag LOCUS_15450 16966 18354 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388669.1 protein_id gnl|my_center|LOCUS_15450 18446 19675 gene locus_tag LOCUS_15460 18446 19675 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_15460 19714 20028 gene locus_tag LOCUS_15470 19714 20028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 20152 20427 gene locus_tag LOCUS_15480 gene pduA 20152 20427 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183618.1 protein_id gnl|my_center|LOCUS_15480 20541 20834 gene locus_tag LOCUS_15490 20541 20834 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634659.1 protein_id gnl|my_center|LOCUS_15490 21294 21572 gene locus_tag LOCUS_15500 gene pduA 21294 21572 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183618.1 protein_id gnl|my_center|LOCUS_15500 21733 22377 gene locus_tag LOCUS_15510 21733 22377 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986618.1 protein_id gnl|my_center|LOCUS_15510 22699 23013 gene locus_tag LOCUS_15520 22699 23013 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003736331.1 protein_id gnl|my_center|LOCUS_15520 23138 24472 gene locus_tag LOCUS_15530 23138 24472 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868840.1 protein_id gnl|my_center|LOCUS_15530 24475 25023 gene locus_tag LOCUS_15540 24475 25023 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815271.1 protein_id gnl|my_center|LOCUS_15540 25312 26097 gene locus_tag LOCUS_15550 gene rhaR 25312 26097 CDS product rhamnose catabolism operon transcriptional regulator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968057.1 protein_id gnl|my_center|LOCUS_15550 26249 27400 gene locus_tag LOCUS_15560 26249 27400 CDS product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861386.1 protein_id gnl|my_center|LOCUS_15560 27632 28141 gene locus_tag LOCUS_15570 27632 28141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 28456 29535 gene locus_tag LOCUS_15580 28456 29535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 29931 31733 gene locus_tag LOCUS_15590 gene fucI 29931 31733 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107686.1 protein_id gnl|my_center|LOCUS_15590 32506 32051 gene locus_tag LOCUS_15600 32506 32051 CDS product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993892.1 protein_id gnl|my_center|LOCUS_15600 36194 33129 gene locus_tag LOCUS_15610 gene uvrA 36194 33129 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401468.1 protein_id gnl|my_center|LOCUS_15610 36373 36472 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38626 36626 gene locus_tag LOCUS_15620 gene uvrB 38626 36626 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_15620 39424 39558 gene locus_tag LOCUS_15630 39424 39558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 40632 39784 gene locus_tag LOCUS_15640 40632 39784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 41090 40797 gene locus_tag LOCUS_15650 41090 40797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 41216 42673 gene locus_tag LOCUS_15660 41216 42673 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936357.1 protein_id gnl|my_center|LOCUS_15660 42868 45348 gene locus_tag LOCUS_15670 42868 45348 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593905.1 protein_id gnl|my_center|LOCUS_15670 45487 47286 gene locus_tag LOCUS_15680 gene aspS 45487 47286 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_15680 48742 47504 gene locus_tag LOCUS_15690 48742 47504 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858561.1 protein_id gnl|my_center|LOCUS_15690 50203 48749 gene locus_tag LOCUS_15700 50203 48749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 50679 51095 gene locus_tag LOCUS_15710 50679 51095 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877456.1 protein_id gnl|my_center|LOCUS_15710 51092 51841 gene locus_tag LOCUS_15720 gene nagB 51092 51841 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_15720 52134 52233 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 52320 53636 gene locus_tag LOCUS_15730 52320 53636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 53851 54672 gene locus_tag LOCUS_15740 53851 54672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 55261 56298 gene locus_tag LOCUS_15750 55261 56298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 56647 57549 gene locus_tag LOCUS_15760 56647 57549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 57579 60320 gene locus_tag LOCUS_15770 57579 60320 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548204.1 protein_id gnl|my_center|LOCUS_15770 60538 61524 gene locus_tag LOCUS_15780 60538 61524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 61565 62479 gene locus_tag LOCUS_15790 61565 62479 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546354.1 protein_id gnl|my_center|LOCUS_15790 62587 63285 gene locus_tag LOCUS_15800 62587 63285 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129648.1 protein_id gnl|my_center|LOCUS_15800 63625 65061 gene locus_tag LOCUS_15810 63625 65061 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242688.1 protein_id gnl|my_center|LOCUS_15810 65409 66260 gene locus_tag LOCUS_15820 65409 66260 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965563.1 protein_id gnl|my_center|LOCUS_15820 66254 66718 gene locus_tag LOCUS_15830 66254 66718 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948564.1 protein_id gnl|my_center|LOCUS_15830 66737 68314 gene locus_tag LOCUS_15840 66737 68314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 68743 68462 gene locus_tag LOCUS_15850 68743 68462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 69096 69509 gene locus_tag LOCUS_15860 69096 69509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 70770 69643 gene locus_tag LOCUS_15870 70770 69643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 71227 74070 gene locus_tag LOCUS_15880 71227 74070 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548204.1 protein_id gnl|my_center|LOCUS_15880 74109 75818 gene locus_tag LOCUS_15890 74109 75818 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775582.1 protein_id gnl|my_center|LOCUS_15890 76185 77051 gene locus_tag LOCUS_15900 76185 77051 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865299.1 protein_id gnl|my_center|LOCUS_15900 77075 79549 gene locus_tag LOCUS_15910 77075 79549 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096414.1 protein_id gnl|my_center|LOCUS_15910 79758 82460 gene locus_tag LOCUS_15920 79758 82460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 83432 83163 gene locus_tag LOCUS_15930 83432 83163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 83605 84585 gene locus_tag LOCUS_15940 83605 84585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 84726 84893 gene locus_tag LOCUS_15950 84726 84893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 85008 87194 gene locus_tag LOCUS_15960 85008 87194 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787402.1 protein_id gnl|my_center|LOCUS_15960 87401 88045 gene locus_tag LOCUS_15970 gene cas5c 87401 88045 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388584.1 protein_id gnl|my_center|LOCUS_15970 88042 89784 gene locus_tag LOCUS_15980 gene cas8c 88042 89784 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388585.1 protein_id gnl|my_center|LOCUS_15980 89785 90672 gene locus_tag LOCUS_15990 gene cas7c 89785 90672 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_15990 90676 91353 gene locus_tag LOCUS_16000 gene cas4 90676 91353 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 protein_id gnl|my_center|LOCUS_16000 91350 92138 gene locus_tag LOCUS_16010 gene cas1c 91350 92138 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16010 92132 92386 gene locus_tag LOCUS_16020 92132 92386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16020 92396 92686 gene locus_tag LOCUS_16030 gene cas2 92396 92686 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 protein_id gnl|my_center|LOCUS_16030 92851 93618 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgctcccttcgcgggagcgtggattgaaat 93924 94367 gene locus_tag LOCUS_16040 93924 94367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 94333 95466 gene locus_tag LOCUS_16050 94333 95466 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460692.1 protein_id gnl|my_center|LOCUS_16050 95832 96422 gene locus_tag LOCUS_16060 95832 96422 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052021.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence014 566 222 gene locus_tag LOCUS_16070 566 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 3506 828 gene locus_tag LOCUS_16080 3506 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 4696 3641 gene locus_tag LOCUS_16090 4696 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 7089 4816 gene locus_tag LOCUS_16100 7089 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 13099 7352 gene locus_tag LOCUS_16110 13099 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 15287 13755 gene locus_tag LOCUS_16120 15287 13755 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 protein_id gnl|my_center|LOCUS_16120 16143 15529 gene locus_tag LOCUS_16130 16143 15529 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965893.1 protein_id gnl|my_center|LOCUS_16130 16701 18443 gene locus_tag LOCUS_16140 16701 18443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 18744 18391 gene locus_tag LOCUS_16150 18744 18391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 18836 20203 gene locus_tag LOCUS_16160 18836 20203 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_16160 21774 20464 gene locus_tag LOCUS_16170 21774 20464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 21961 22060 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22238 22543 gene locus_tag LOCUS_16180 22238 22543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 22892 22692 gene locus_tag LOCUS_16190 22892 22692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 23243 24571 gene locus_tag LOCUS_16200 23243 24571 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_16200 25268 24816 gene locus_tag LOCUS_16210 25268 24816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 25458 25246 gene locus_tag LOCUS_16220 25458 25246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 26334 25513 gene locus_tag LOCUS_16230 gene nifH 26334 25513 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933198.1 protein_id gnl|my_center|LOCUS_16230 27911 26562 gene locus_tag LOCUS_16240 27911 26562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 28509 28090 gene locus_tag LOCUS_16250 28509 28090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 29001 30404 gene locus_tag LOCUS_16260 29001 30404 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567789.1 protein_id gnl|my_center|LOCUS_16260 30531 31547 gene locus_tag LOCUS_16270 30531 31547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 31624 32613 gene locus_tag LOCUS_16280 31624 32613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 32615 33736 gene locus_tag LOCUS_16290 32615 33736 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_16290 33926 35272 gene locus_tag LOCUS_16300 33926 35272 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_16300 36091 35666 gene locus_tag LOCUS_16310 36091 35666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 38276 36330 gene locus_tag LOCUS_16320 38276 36330 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989931.1 protein_id gnl|my_center|LOCUS_16320 41098 38543 gene locus_tag LOCUS_16330 41098 38543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 42816 41257 gene locus_tag LOCUS_16340 42816 41257 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890735.1 protein_id gnl|my_center|LOCUS_16340 44157 42940 gene locus_tag LOCUS_16350 44157 42940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 45258 44239 gene locus_tag LOCUS_16360 45258 44239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 46433 45477 gene locus_tag LOCUS_16370 46433 45477 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_16370 47431 46430 gene locus_tag LOCUS_16380 47431 46430 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 protein_id gnl|my_center|LOCUS_16380 48341 47451 gene locus_tag LOCUS_16390 48341 47451 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_16390 49306 48338 gene locus_tag LOCUS_16400 49306 48338 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_16400 50894 49338 gene locus_tag LOCUS_16410 50894 49338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 51494 54253 gene locus_tag LOCUS_16420 51494 54253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 54389 54904 gene locus_tag LOCUS_16430 54389 54904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 55780 54941 gene locus_tag LOCUS_16440 55780 54941 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_16440 57003 55999 gene locus_tag LOCUS_16450 57003 55999 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_16450 57575 57000 gene locus_tag LOCUS_16460 57575 57000 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818015.1 protein_id gnl|my_center|LOCUS_16460 57795 57667 gene locus_tag LOCUS_16470 57795 57667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 59133 57817 gene locus_tag LOCUS_16480 59133 57817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16480 60468 59446 gene locus_tag LOCUS_16490 60468 59446 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_16490 60710 60453 gene locus_tag LOCUS_16500 60710 60453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 60987 61928 gene locus_tag LOCUS_16510 60987 61928 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_16510 63384 62023 gene locus_tag LOCUS_16520 63384 62023 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_16520 64701 63658 gene locus_tag LOCUS_16530 64701 63658 CDS product RNA ligase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068264228.1 protein_id gnl|my_center|LOCUS_16530 65094 65020 gene locus_tag LOCUS_t00170 65094 65020 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 65904 65242 gene locus_tag LOCUS_16540 65904 65242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 67296 66283 gene locus_tag LOCUS_16550 67296 66283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 68747 67767 gene locus_tag LOCUS_16560 68747 67767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 70841 68748 gene locus_tag LOCUS_16570 70841 68748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 71909 71055 gene locus_tag LOCUS_16580 71909 71055 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814246.1 protein_id gnl|my_center|LOCUS_16580 72768 71968 gene locus_tag LOCUS_16590 72768 71968 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814244.1 protein_id gnl|my_center|LOCUS_16590 75502 72818 gene locus_tag LOCUS_16600 75502 72818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 75848 76546 gene locus_tag LOCUS_16610 75848 76546 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258365.1 protein_id gnl|my_center|LOCUS_16610 76799 78352 gene locus_tag LOCUS_16620 76799 78352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 80567 78840 gene locus_tag LOCUS_16630 80567 78840 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_16630 81075 80560 gene locus_tag LOCUS_16640 gene nrdG 81075 80560 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_16640 81229 81068 gene locus_tag LOCUS_16650 81229 81068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 81427 81260 gene locus_tag LOCUS_16660 81427 81260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 83720 81420 gene locus_tag LOCUS_16670 83720 81420 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459055.1 protein_id gnl|my_center|LOCUS_16670 84892 84017 gene locus_tag LOCUS_16680 84892 84017 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986891.1 protein_id gnl|my_center|LOCUS_16680 90068 85101 gene locus_tag LOCUS_16690 90068 85101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 91811 90471 gene locus_tag LOCUS_16700 91811 90471 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_16700 93506 92070 gene locus_tag LOCUS_16710 93506 92070 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence015 551 1660 gene locus_tag LOCUS_16720 551 1660 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_16720 3423 1741 gene locus_tag LOCUS_16730 3423 1741 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_16730 4004 3738 gene locus_tag LOCUS_16740 4004 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 4539 3976 gene locus_tag LOCUS_16750 4539 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 4811 4536 gene locus_tag LOCUS_16760 4811 4536 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549189.1 protein_id gnl|my_center|LOCUS_16760 6364 4985 gene locus_tag LOCUS_16770 gene mtaB 6364 4985 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_16770 6663 6896 gene locus_tag LOCUS_16780 6663 6896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 8273 6963 gene locus_tag LOCUS_16790 gene thiI 8273 6963 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966254.1 protein_id gnl|my_center|LOCUS_16790 9605 8448 gene locus_tag LOCUS_16800 9605 8448 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895806.1 protein_id gnl|my_center|LOCUS_16800 9944 9627 gene locus_tag LOCUS_16810 9944 9627 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016687.1 protein_id gnl|my_center|LOCUS_16810 10840 10100 gene locus_tag LOCUS_16820 10840 10100 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_16820 11999 10962 gene locus_tag LOCUS_16830 gene prmA 11999 10962 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990133.1 protein_id gnl|my_center|LOCUS_16830 12397 13728 gene locus_tag LOCUS_16840 12397 13728 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_16840 13725 14204 gene locus_tag LOCUS_16850 13725 14204 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_16850 14933 14265 gene locus_tag LOCUS_16860 14933 14265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 16981 14930 gene locus_tag LOCUS_16870 16981 14930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 17938 17186 gene locus_tag LOCUS_16880 17938 17186 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_16880 18277 18627 gene locus_tag LOCUS_16890 18277 18627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 18846 18670 gene locus_tag LOCUS_16900 18846 18670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 19422 19174 gene locus_tag LOCUS_16910 19422 19174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 21125 19560 gene locus_tag LOCUS_16920 21125 19560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 22293 21247 gene locus_tag LOCUS_16930 22293 21247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 23288 22476 gene locus_tag LOCUS_16940 23288 22476 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837623.1 protein_id gnl|my_center|LOCUS_16940 24154 23399 gene locus_tag LOCUS_16950 24154 23399 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393128.1 protein_id gnl|my_center|LOCUS_16950 26348 24450 gene locus_tag LOCUS_16960 26348 24450 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860946.1 protein_id gnl|my_center|LOCUS_16960 27914 26451 gene locus_tag LOCUS_16970 gene gltX 27914 26451 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_16970 29365 28148 gene locus_tag LOCUS_16980 gene ftsW 29365 28148 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965425.1 protein_id gnl|my_center|LOCUS_16980 29531 30514 gene locus_tag LOCUS_16990 29531 30514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 31053 30631 gene locus_tag LOCUS_17000 31053 30631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 31844 31281 gene locus_tag LOCUS_17010 31844 31281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 32192 31905 gene locus_tag LOCUS_17020 32192 31905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 32508 32305 gene locus_tag LOCUS_17030 32508 32305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 33758 32817 gene locus_tag LOCUS_17040 gene tsf 33758 32817 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_17040 34687 33941 gene locus_tag LOCUS_17050 gene rpsB 34687 33941 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111485.1 protein_id gnl|my_center|LOCUS_17050 35256 36533 gene locus_tag LOCUS_17060 gene sleC 35256 36533 CDS product spore cortex-lytic germination protein SleC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425119.1 protein_id gnl|my_center|LOCUS_17060 37093 36644 gene locus_tag LOCUS_17070 gene nrdR 37093 36644 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_17070 38383 37262 gene locus_tag LOCUS_17080 38383 37262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 39383 38475 gene locus_tag LOCUS_17090 39383 38475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 48977 39603 gene locus_tag LOCUS_17100 48977 39603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 50743 48974 gene locus_tag LOCUS_17110 50743 48974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 52480 50765 gene locus_tag LOCUS_17120 52480 50765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 53702 53172 gene locus_tag LOCUS_17130 gene raiA 53702 53172 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_17130 54706 53933 gene locus_tag LOCUS_17140 54706 53933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 55035 54760 gene locus_tag LOCUS_17150 55035 54760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 55414 55016 gene locus_tag LOCUS_17160 55414 55016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 55706 56245 gene locus_tag LOCUS_17170 55706 56245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 57685 56324 gene locus_tag LOCUS_17180 57685 56324 CDS product DUF1576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296334.1 protein_id gnl|my_center|LOCUS_17180 59534 57849 gene locus_tag LOCUS_17190 59534 57849 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_17190 61216 60254 gene locus_tag LOCUS_17200 61216 60254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 61859 61356 gene locus_tag LOCUS_17210 61859 61356 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434936.1 protein_id gnl|my_center|LOCUS_17210 62201 62013 gene locus_tag LOCUS_17220 62201 62013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17220 63516 62209 gene locus_tag LOCUS_17230 63516 62209 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287397.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17230 64312 63701 gene locus_tag LOCUS_17240 64312 63701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 67970 64572 gene locus_tag LOCUS_17250 gene carB 67970 64572 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837069.1 protein_id gnl|my_center|LOCUS_17250 69127 67970 gene locus_tag LOCUS_17260 gene carA 69127 67970 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 protein_id gnl|my_center|LOCUS_17260 70705 69512 gene locus_tag LOCUS_17270 70705 69512 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244568.1 protein_id gnl|my_center|LOCUS_17270 74079 70894 gene locus_tag LOCUS_17280 74079 70894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 74902 74204 gene locus_tag LOCUS_17290 74902 74204 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242701.1 protein_id gnl|my_center|LOCUS_17290 76569 75040 gene locus_tag LOCUS_17300 76569 75040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 78449 77208 gene locus_tag LOCUS_17310 78449 77208 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_17310 78929 80254 gene locus_tag LOCUS_17320 78929 80254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 81498 80251 gene locus_tag LOCUS_17330 gene hisS 81498 80251 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048076.1 protein_id gnl|my_center|LOCUS_17330 82441 81737 gene locus_tag LOCUS_17340 82441 81737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 84258 82438 gene locus_tag LOCUS_17350 84258 82438 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_17350 84991 84365 gene locus_tag LOCUS_17360 84991 84365 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289118.1 protein_id gnl|my_center|LOCUS_17360 87369 84997 gene locus_tag LOCUS_17370 87369 84997 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422921.1 protein_id gnl|my_center|LOCUS_17370 88184 87660 gene locus_tag LOCUS_17380 88184 87660 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357763.1 protein_id gnl|my_center|LOCUS_17380 90235 88532 gene locus_tag LOCUS_17390 90235 88532 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_17390 90922 90431 gene locus_tag LOCUS_17400 90922 90431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 91293 90919 gene locus_tag LOCUS_17410 91293 90919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 91559 91948 gene locus_tag LOCUS_17420 91559 91948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 92147 92062 gene locus_tag LOCUS_t00180 92147 92062 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 92271 92196 gene locus_tag LOCUS_t00190 92271 92196 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 92353 92278 gene locus_tag LOCUS_t00200 92353 92278 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 92429 92356 gene locus_tag LOCUS_t00210 92429 92356 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence016 1827 316 gene locus_tag LOCUS_17430 1827 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17430 2768 2079 gene locus_tag LOCUS_17440 2768 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 4430 2889 gene locus_tag LOCUS_17450 gene gpmI 4430 2889 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_17450 4601 4783 gene locus_tag LOCUS_17460 4601 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 5723 4935 gene locus_tag LOCUS_17470 5723 4935 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071302.1 protein_id gnl|my_center|LOCUS_17470 6772 6050 gene locus_tag LOCUS_17480 6772 6050 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724779.1 protein_id gnl|my_center|LOCUS_17480 7717 7019 gene locus_tag LOCUS_17490 7717 7019 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_17490 8540 8103 gene locus_tag LOCUS_17500 8540 8103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 9323 8601 gene locus_tag LOCUS_17510 9323 8601 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_17510 10061 9528 gene locus_tag LOCUS_17520 10061 9528 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433028.1 protein_id gnl|my_center|LOCUS_17520 11903 10686 gene locus_tag LOCUS_17530 11903 10686 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_17530 12364 12128 gene locus_tag LOCUS_17540 12364 12128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 12954 12577 gene locus_tag LOCUS_17550 12954 12577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 13801 13067 gene locus_tag LOCUS_17560 13801 13067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 13910 13785 gene locus_tag LOCUS_17570 13910 13785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 16089 13945 gene locus_tag LOCUS_17580 16089 13945 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947999.1 protein_id gnl|my_center|LOCUS_17580 16729 16106 gene locus_tag LOCUS_17590 16729 16106 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142413611.1 protein_id gnl|my_center|LOCUS_17590 17263 17892 gene locus_tag LOCUS_17600 17263 17892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 17892 18611 gene locus_tag LOCUS_17610 17892 18611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 19956 18721 gene locus_tag LOCUS_17620 19956 18721 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020191.1 protein_id gnl|my_center|LOCUS_17620 21456 20242 gene locus_tag LOCUS_17630 21456 20242 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_17630 22122 21664 gene locus_tag LOCUS_17640 22122 21664 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_17640 23757 22747 gene locus_tag LOCUS_17650 gene prfB 23757 22747 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181244843.1 protein_id gnl|my_center|LOCUS_17650 26557 23984 gene locus_tag LOCUS_17660 gene secA 26557 23984 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966131.1 protein_id gnl|my_center|LOCUS_17660 27297 26932 gene locus_tag LOCUS_17670 gene rplT 27297 26932 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429730.1 protein_id gnl|my_center|LOCUS_17670 27525 27328 gene locus_tag LOCUS_17680 gene rpmI 27525 27328 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965657.1 protein_id gnl|my_center|LOCUS_17680 28104 27643 gene locus_tag LOCUS_17690 gene infC 28104 27643 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705897.1 protein_id gnl|my_center|LOCUS_17690 29675 28752 gene locus_tag LOCUS_17700 29675 28752 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966232.1 protein_id gnl|my_center|LOCUS_17700 31427 29889 gene locus_tag LOCUS_17710 31427 29889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 32439 31684 gene locus_tag LOCUS_17720 32439 31684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 33366 32671 gene locus_tag LOCUS_17730 33366 32671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 33933 33613 gene locus_tag LOCUS_17740 33933 33613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 35311 34280 gene locus_tag LOCUS_17750 35311 34280 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761587.1 protein_id gnl|my_center|LOCUS_17750 36455 35253 gene locus_tag LOCUS_17760 36455 35253 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228695.1 protein_id gnl|my_center|LOCUS_17760 37693 36458 gene locus_tag LOCUS_17770 37693 36458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 40066 38162 gene locus_tag LOCUS_17780 gene thrS 40066 38162 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_17780 40256 40005 gene locus_tag LOCUS_17790 40256 40005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 40527 40246 gene locus_tag LOCUS_17800 40527 40246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 41210 42085 gene locus_tag LOCUS_17810 41210 42085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 43266 42214 gene locus_tag LOCUS_17820 43266 42214 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_17820 44823 43339 gene locus_tag LOCUS_17830 44823 43339 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_17830 46457 44922 gene locus_tag LOCUS_17840 gene xylB 46457 44922 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_17840 47787 46618 gene locus_tag LOCUS_17850 47787 46618 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288471.1 protein_id gnl|my_center|LOCUS_17850 48299 48087 gene locus_tag LOCUS_17860 48299 48087 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359346.1 protein_id gnl|my_center|LOCUS_17860 48848 49018 gene locus_tag LOCUS_17870 48848 49018 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002559159.1 protein_id gnl|my_center|LOCUS_17870 49292 49116 gene locus_tag LOCUS_17880 49292 49116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 49377 49676 gene locus_tag LOCUS_17890 49377 49676 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944876.1 protein_id gnl|my_center|LOCUS_17890 50622 49855 gene locus_tag LOCUS_17900 50622 49855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 52123 50789 gene locus_tag LOCUS_17910 gene dnaB 52123 50789 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286244.1 protein_id gnl|my_center|LOCUS_17910 52571 52125 gene locus_tag LOCUS_17920 gene rplI 52571 52125 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429267.1 protein_id gnl|my_center|LOCUS_17920 54782 52716 gene locus_tag LOCUS_17930 54782 52716 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_17930 55318 55055 gene locus_tag LOCUS_17940 gene rpsR 55318 55055 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_17940 55913 55425 gene locus_tag LOCUS_17950 55913 55425 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902513.1 protein_id gnl|my_center|LOCUS_17950 56218 55931 gene locus_tag LOCUS_17960 gene rpsF 56218 55931 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_17960 56535 56341 gene locus_tag LOCUS_17970 56535 56341 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_17970 57484 56753 gene locus_tag LOCUS_17980 57484 56753 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_17980 57645 57481 gene locus_tag LOCUS_17990 57645 57481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 58774 57653 gene locus_tag LOCUS_18000 58774 57653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 59918 58743 gene locus_tag LOCUS_18010 59918 58743 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510927.1 protein_id gnl|my_center|LOCUS_18010 60732 59908 gene locus_tag LOCUS_18020 gene vanR 60732 59908 CDS product vancomycin resistance response regulator transcription factor VanR-I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461303.1 protein_id gnl|my_center|LOCUS_18020 62267 60873 gene locus_tag LOCUS_18030 gene asnS 62267 60873 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462263.1 protein_id gnl|my_center|LOCUS_18030 62769 64697 gene locus_tag LOCUS_18040 62769 64697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 64812 65450 gene locus_tag LOCUS_18050 64812 65450 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583630.1 protein_id gnl|my_center|LOCUS_18050 67194 65611 gene locus_tag LOCUS_18060 67194 65611 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_18060 67338 67568 gene locus_tag LOCUS_18070 67338 67568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 69039 67837 gene locus_tag LOCUS_18080 gene nagZ 69039 67837 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_18080 69329 69063 gene locus_tag LOCUS_18090 69329 69063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 72674 69543 gene locus_tag LOCUS_18100 72674 69543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 77677 72935 gene locus_tag LOCUS_18110 77677 72935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 77906 78250 gene locus_tag LOCUS_18120 77906 78250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 78672 78857 gene locus_tag LOCUS_18130 78672 78857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 79010 79357 gene locus_tag LOCUS_18140 79010 79357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 80623 79649 gene locus_tag LOCUS_18150 80623 79649 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970705.1 protein_id gnl|my_center|LOCUS_18150 80976 80620 gene locus_tag LOCUS_18160 80976 80620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 81305 80964 gene locus_tag LOCUS_18170 81305 80964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 82361 81441 gene locus_tag LOCUS_18180 82361 81441 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816612.1 protein_id gnl|my_center|LOCUS_18180 83321 82428 gene locus_tag LOCUS_18190 83321 82428 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811883.1 protein_id gnl|my_center|LOCUS_18190 84720 83542 gene locus_tag LOCUS_18200 84720 83542 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819097.1 protein_id gnl|my_center|LOCUS_18200 85544 84762 gene locus_tag LOCUS_18210 85544 84762 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981011.1 protein_id gnl|my_center|LOCUS_18210 85768 85541 gene locus_tag LOCUS_18220 85768 85541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 87283 85793 gene locus_tag LOCUS_18230 87283 85793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 87474 87280 gene locus_tag LOCUS_18240 87474 87280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 89378 87447 gene locus_tag LOCUS_18250 89378 87447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 90178 89390 gene locus_tag LOCUS_18260 90178 89390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 >Feature sequence017 254 90 gene locus_tag LOCUS_18270 254 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 493 251 gene locus_tag LOCUS_18280 493 251 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115145.1 protein_id gnl|my_center|LOCUS_18280 1176 745 gene locus_tag LOCUS_18290 gene ohrR 1176 745 CDS product organic hydroperoxide resistance transcriptional regulator OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245653.1 protein_id gnl|my_center|LOCUS_18290 1419 2789 gene locus_tag LOCUS_18300 1419 2789 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930806.1 protein_id gnl|my_center|LOCUS_18300 4234 2771 gene locus_tag LOCUS_18310 gene pepT 4234 2771 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359416.1 protein_id gnl|my_center|LOCUS_18310 5450 4614 gene locus_tag LOCUS_18320 gene proC 5450 4614 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836906.1 protein_id gnl|my_center|LOCUS_18320 7245 5614 gene locus_tag LOCUS_18330 7245 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 8159 7365 gene locus_tag LOCUS_18340 gene proB 8159 7365 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723561.1 protein_id gnl|my_center|LOCUS_18340 8182 8281 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8692 8483 gene locus_tag LOCUS_18350 8692 8483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 8708 11527 gene locus_tag LOCUS_18360 8708 11527 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272644.1 protein_id gnl|my_center|LOCUS_18360 13600 11522 gene locus_tag LOCUS_18370 13600 11522 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_18370 13982 13767 gene locus_tag LOCUS_18380 13982 13767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 14358 14038 gene locus_tag LOCUS_18390 14358 14038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 15369 14500 gene locus_tag LOCUS_18400 15369 14500 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_18400 15569 15426 gene locus_tag LOCUS_18410 15569 15426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 15774 16367 gene locus_tag LOCUS_18420 15774 16367 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393868.1 protein_id gnl|my_center|LOCUS_18420 17032 17979 gene locus_tag LOCUS_18430 17032 17979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 18180 18701 gene locus_tag LOCUS_18440 18180 18701 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867510.1 protein_id gnl|my_center|LOCUS_18440 20040 19015 gene locus_tag LOCUS_18450 gene mglB 20040 19015 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036947.1 protein_id gnl|my_center|LOCUS_18450 21397 20414 gene locus_tag LOCUS_18460 21397 20414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 23165 21390 gene locus_tag LOCUS_18470 23165 21390 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_18470 24843 23209 gene locus_tag LOCUS_18480 24843 23209 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304851.1 protein_id gnl|my_center|LOCUS_18480 25295 24975 gene locus_tag LOCUS_18490 25295 24975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 26604 25615 gene locus_tag LOCUS_18500 gene mglC 26604 25615 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275106.1 protein_id gnl|my_center|LOCUS_18500 28134 26623 gene locus_tag LOCUS_18510 gene mglA 28134 26623 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707761.1 protein_id gnl|my_center|LOCUS_18510 29396 28341 gene locus_tag LOCUS_18520 gene mglB 29396 28341 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881084.1 protein_id gnl|my_center|LOCUS_18520 30926 29847 gene locus_tag LOCUS_18530 30926 29847 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 protein_id gnl|my_center|LOCUS_18530 32959 31343 gene locus_tag LOCUS_18540 32959 31343 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_18540 34659 33043 gene locus_tag LOCUS_18550 34659 33043 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_18550 35348 34731 gene locus_tag LOCUS_18560 35348 34731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 43031 35754 gene locus_tag LOCUS_18570 43031 35754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 43652 43242 gene locus_tag LOCUS_18580 43652 43242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 43956 43738 gene locus_tag LOCUS_18590 43956 43738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 44360 43935 gene locus_tag LOCUS_18600 44360 43935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809316.1 protein_id gnl|my_center|LOCUS_18600 45455 44490 gene locus_tag LOCUS_18610 45455 44490 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582805.1 protein_id gnl|my_center|LOCUS_18610 46964 45468 gene locus_tag LOCUS_18620 gene rbsA 46964 45468 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217684.1 protein_id gnl|my_center|LOCUS_18620 47918 46980 gene locus_tag LOCUS_18630 47918 46980 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727629.1 protein_id gnl|my_center|LOCUS_18630 49324 48185 gene locus_tag LOCUS_18640 49324 48185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 51398 49650 gene locus_tag LOCUS_18650 51398 49650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 53387 51522 gene locus_tag LOCUS_18660 53387 51522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 55083 53572 gene locus_tag LOCUS_18670 gene lpdA 55083 53572 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051291.1 protein_id gnl|my_center|LOCUS_18670 56256 55261 gene locus_tag LOCUS_18680 56256 55261 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812232.1 protein_id gnl|my_center|LOCUS_18680 58175 56460 gene locus_tag LOCUS_18690 gene gcvPB 58175 56460 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121465.1 protein_id gnl|my_center|LOCUS_18690 59614 58172 gene locus_tag LOCUS_18700 gene gcvPA 59614 58172 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_18700 60254 59868 gene locus_tag LOCUS_18710 gene gcvH 60254 59868 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831963.1 protein_id gnl|my_center|LOCUS_18710 60451 60251 gene locus_tag LOCUS_18720 60451 60251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 61542 60448 gene locus_tag LOCUS_18730 gene gcvT 61542 60448 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398598.1 protein_id gnl|my_center|LOCUS_18730 63287 62004 gene locus_tag LOCUS_18740 63287 62004 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_18740 63512 65530 gene locus_tag LOCUS_18750 63512 65530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 65310 65409 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 66315 65701 gene locus_tag LOCUS_18760 66315 65701 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_18760 67540 66329 gene locus_tag LOCUS_18770 67540 66329 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068564.1 protein_id gnl|my_center|LOCUS_18770 68567 67476 gene locus_tag LOCUS_18780 68567 67476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 68875 69309 gene locus_tag LOCUS_18790 68875 69309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 69566 69639 gene locus_tag LOCUS_t00220 69566 69639 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 70458 69658 gene locus_tag LOCUS_18800 70458 69658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 70792 70445 gene locus_tag LOCUS_18810 70792 70445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 71476 71000 gene locus_tag LOCUS_18820 71476 71000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 74506 71756 gene locus_tag LOCUS_18830 gene glgB 74506 71756 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_18830 71790 71889 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 76040 74799 gene locus_tag LOCUS_18840 76040 74799 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462038.1 protein_id gnl|my_center|LOCUS_18840 77351 76188 gene locus_tag LOCUS_18850 77351 76188 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_18850 78560 77478 gene locus_tag LOCUS_18860 gene serC 78560 77478 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_18860 80539 78857 gene locus_tag LOCUS_18870 gene ilvB 80539 78857 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_18870 82486 80813 gene locus_tag LOCUS_18880 gene ilvD 82486 80813 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_18880 82819 82577 gene locus_tag LOCUS_18890 82819 82577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 83942 82860 gene locus_tag LOCUS_18900 gene leuB 83942 82860 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_18900 84474 84160 gene locus_tag LOCUS_18910 84474 84160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 86119 84632 gene locus_tag LOCUS_18920 86119 84632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 86601 87692 gene locus_tag LOCUS_18930 86601 87692 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_18930 >Feature sequence018 828 1841 gene locus_tag LOCUS_18940 828 1841 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945303.1 protein_id gnl|my_center|LOCUS_18940 2338 3270 gene locus_tag LOCUS_18950 2338 3270 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461074.1 protein_id gnl|my_center|LOCUS_18950 3313 3412 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3474 4280 gene locus_tag LOCUS_18960 3474 4280 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808997.1 protein_id gnl|my_center|LOCUS_18960 4664 4455 gene locus_tag LOCUS_18970 4664 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 4857 5045 gene locus_tag LOCUS_18980 4857 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 5262 5537 gene locus_tag LOCUS_18990 gene hbs 5262 5537 CDS product non-specific DNA-binding protein Hbs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153447.1 protein_id gnl|my_center|LOCUS_18990 5542 5781 gene locus_tag LOCUS_19000 5542 5781 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226716.1 protein_id gnl|my_center|LOCUS_19000 6179 6394 gene locus_tag LOCUS_19010 6179 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 6391 7062 gene locus_tag LOCUS_19020 6391 7062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 7084 7386 gene locus_tag LOCUS_19030 7084 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 7802 9322 gene locus_tag LOCUS_19040 7802 9322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 9535 11127 gene locus_tag LOCUS_19050 9535 11127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 11394 11921 gene locus_tag LOCUS_19060 gene hpt 11394 11921 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_19060 12233 14041 gene locus_tag LOCUS_19070 gene ftsH 12233 14041 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_19070 14862 14182 gene locus_tag LOCUS_19080 14862 14182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 15249 15680 gene locus_tag LOCUS_19090 15249 15680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 15766 17433 gene locus_tag LOCUS_19100 15766 17433 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_19100 17560 18330 gene locus_tag LOCUS_19110 17560 18330 CDS product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931017.1 protein_id gnl|my_center|LOCUS_19110 18547 19011 gene locus_tag LOCUS_19120 18547 19011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 19138 20397 gene locus_tag LOCUS_19130 19138 20397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 21619 20453 gene locus_tag LOCUS_19140 21619 20453 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_19140 22680 21727 gene locus_tag LOCUS_19150 22680 21727 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973816.1 protein_id gnl|my_center|LOCUS_19150 22898 23380 gene locus_tag LOCUS_19160 22898 23380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 23396 24439 gene locus_tag LOCUS_19170 23396 24439 CDS product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993737.1 protein_id gnl|my_center|LOCUS_19170 24538 25977 gene locus_tag LOCUS_19180 gene proS 24538 25977 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450718.1 protein_id gnl|my_center|LOCUS_19180 26140 27291 gene locus_tag LOCUS_19190 26140 27291 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815196.1 protein_id gnl|my_center|LOCUS_19190 27506 28390 gene locus_tag LOCUS_19200 27506 28390 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_19200 28400 29467 gene locus_tag LOCUS_19210 28400 29467 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815200.1 protein_id gnl|my_center|LOCUS_19210 29469 30230 gene locus_tag LOCUS_19220 29469 30230 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017145.1 protein_id gnl|my_center|LOCUS_19220 30337 31047 gene locus_tag LOCUS_19230 30337 31047 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 protein_id gnl|my_center|LOCUS_19230 31603 32262 gene locus_tag LOCUS_19240 31603 32262 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435157.1 protein_id gnl|my_center|LOCUS_19240 32641 33099 gene locus_tag LOCUS_19250 32641 33099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 33866 35188 gene locus_tag LOCUS_19260 gene tyrS 33866 35188 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_19260 35433 36305 gene locus_tag LOCUS_19270 35433 36305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 36372 36575 gene locus_tag LOCUS_19280 36372 36575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 36722 38041 gene locus_tag LOCUS_19290 36722 38041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 38709 38038 gene locus_tag LOCUS_19300 38709 38038 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391936.1 protein_id gnl|my_center|LOCUS_19300 39413 43519 gene locus_tag LOCUS_19310 39413 43519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 43697 44236 gene locus_tag LOCUS_19320 43697 44236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 45834 44779 gene locus_tag LOCUS_19330 45834 44779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 46223 46717 gene locus_tag LOCUS_19340 46223 46717 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_19340 46813 47517 gene locus_tag LOCUS_19350 46813 47517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 47995 52089 gene locus_tag LOCUS_19360 47995 52089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 52965 52351 gene locus_tag LOCUS_19370 52965 52351 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037615095.1 protein_id gnl|my_center|LOCUS_19370 53231 54946 gene locus_tag LOCUS_19380 53231 54946 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_19380 55095 59402 gene locus_tag LOCUS_19390 55095 59402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19390 59298 59397 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 59672 64225 gene locus_tag LOCUS_19400 59672 64225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 64436 64990 gene locus_tag LOCUS_19410 64436 64990 CDS product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921974.1 protein_id gnl|my_center|LOCUS_19410 65161 67140 gene locus_tag LOCUS_19420 65161 67140 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380507.1 protein_id gnl|my_center|LOCUS_19420 67147 67977 gene locus_tag LOCUS_19430 67147 67977 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641746.1 protein_id gnl|my_center|LOCUS_19430 68098 68397 gene locus_tag LOCUS_19440 68098 68397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 68385 68663 gene locus_tag LOCUS_19450 68385 68663 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165613498.1 protein_id gnl|my_center|LOCUS_19450 70006 68798 gene locus_tag LOCUS_19460 70006 68798 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_19460 71010 70243 gene locus_tag LOCUS_19470 71010 70243 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529927.1 protein_id gnl|my_center|LOCUS_19470 71484 71320 gene locus_tag LOCUS_19480 71484 71320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 71904 72392 gene locus_tag LOCUS_19490 71904 72392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 72526 72663 gene locus_tag LOCUS_19500 72526 72663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 72858 73619 gene locus_tag LOCUS_19510 72858 73619 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062694770.1 protein_id gnl|my_center|LOCUS_19510 73656 74129 gene locus_tag LOCUS_19520 73656 74129 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896384.1 protein_id gnl|my_center|LOCUS_19520 74220 74148 gene locus_tag LOCUS_t00230 74220 74148 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 74483 74411 gene locus_tag LOCUS_t00240 74483 74411 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 74900 74649 gene locus_tag LOCUS_19530 74900 74649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 76151 74949 gene locus_tag LOCUS_19540 76151 74949 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459687.1 protein_id gnl|my_center|LOCUS_19540 76259 76186 gene locus_tag LOCUS_t00250 76259 76186 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 77417 76629 gene locus_tag LOCUS_19550 77417 76629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031057.1 protein_id gnl|my_center|LOCUS_19550 77963 77529 gene locus_tag LOCUS_19560 77963 77529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 78276 78031 gene locus_tag LOCUS_19570 78276 78031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 78731 78321 gene locus_tag LOCUS_19580 78731 78321 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957066.1 protein_id gnl|my_center|LOCUS_19580 79356 78766 gene locus_tag LOCUS_19590 79356 78766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 80043 79462 gene locus_tag LOCUS_19600 80043 79462 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765867.1 protein_id gnl|my_center|LOCUS_19600 80413 80078 gene locus_tag LOCUS_19610 80413 80078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 81723 80446 gene locus_tag LOCUS_19620 81723 80446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 81938 82378 gene locus_tag LOCUS_19630 81938 82378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 82418 82759 gene locus_tag LOCUS_19640 82418 82759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 83782 82976 gene locus_tag LOCUS_19650 83782 82976 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005679031.1 protein_id gnl|my_center|LOCUS_19650 84991 83885 gene locus_tag LOCUS_19660 84991 83885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 85343 85011 gene locus_tag LOCUS_19670 85343 85011 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420359.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence019 280 1152 gene locus_tag LOCUS_19680 gene nudC 280 1152 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102051.1 protein_id gnl|my_center|LOCUS_19680 1188 2363 gene locus_tag LOCUS_19690 1188 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 2820 5459 gene locus_tag LOCUS_19700 gene alaS 2820 5459 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964985.1 protein_id gnl|my_center|LOCUS_19700 5591 5767 gene locus_tag LOCUS_19710 gene rpsU 5591 5767 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964600.1 protein_id gnl|my_center|LOCUS_19710 5976 7565 gene locus_tag LOCUS_19720 gene cls 5976 7565 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461555.1 protein_id gnl|my_center|LOCUS_19720 7828 9021 gene locus_tag LOCUS_19730 gene dacF 7828 9021 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_19730 9146 9946 gene locus_tag LOCUS_19740 9146 9946 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888897.1 protein_id gnl|my_center|LOCUS_19740 10198 10986 gene locus_tag LOCUS_19750 10198 10986 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986419.1 protein_id gnl|my_center|LOCUS_19750 11042 11752 gene locus_tag LOCUS_19760 gene scpB 11042 11752 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965360.1 protein_id gnl|my_center|LOCUS_19760 11879 12502 gene locus_tag LOCUS_19770 11879 12502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 12535 12765 gene locus_tag LOCUS_19780 12535 12765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 12772 13875 gene locus_tag LOCUS_19790 12772 13875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 14337 15221 gene locus_tag LOCUS_19800 gene xerD 14337 15221 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_19800 15294 17828 gene locus_tag LOCUS_19810 15294 17828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 18242 17865 gene locus_tag LOCUS_19820 18242 17865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 18523 19392 gene locus_tag LOCUS_19830 18523 19392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 20073 21758 gene locus_tag LOCUS_19840 20073 21758 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_19840 22320 21838 gene locus_tag LOCUS_19850 22320 21838 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974190.1 protein_id gnl|my_center|LOCUS_19850 22848 24959 gene locus_tag LOCUS_19860 22848 24959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 25229 26233 gene locus_tag LOCUS_19870 25229 26233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 26419 26886 gene locus_tag LOCUS_19880 26419 26886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 26901 28322 gene locus_tag LOCUS_19890 26901 28322 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_19890 28469 29656 gene locus_tag LOCUS_19900 28469 29656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 29757 30242 gene locus_tag LOCUS_19910 29757 30242 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966286.1 protein_id gnl|my_center|LOCUS_19910 30379 31677 gene locus_tag LOCUS_19920 gene eno 30379 31677 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964032.1 protein_id gnl|my_center|LOCUS_19920 32249 33052 gene locus_tag LOCUS_19930 32249 33052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 33283 34788 gene locus_tag LOCUS_19940 gene thrC 33283 34788 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_19940 34785 35138 gene locus_tag LOCUS_19950 34785 35138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 35291 36052 gene locus_tag LOCUS_19960 35291 36052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 36060 38075 gene locus_tag LOCUS_19970 36060 38075 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966001.1 protein_id gnl|my_center|LOCUS_19970 38230 38862 gene locus_tag LOCUS_19980 38230 38862 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_19980 39023 40777 gene locus_tag LOCUS_19990 39023 40777 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880879.1 protein_id gnl|my_center|LOCUS_19990 41021 42235 gene locus_tag LOCUS_20000 gene alr 41021 42235 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437830.1 protein_id gnl|my_center|LOCUS_20000 42418 42762 gene locus_tag LOCUS_20010 gene ndoA 42418 42762 CDS product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156187.1 protein_id gnl|my_center|LOCUS_20010 42894 43622 gene locus_tag LOCUS_20020 42894 43622 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_20020 43734 44504 gene locus_tag LOCUS_20030 43734 44504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 44715 45494 gene locus_tag LOCUS_20040 gene tepA 44715 45494 CDS product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139816.1 protein_id gnl|my_center|LOCUS_20040 46082 46957 gene locus_tag LOCUS_20050 46082 46957 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_20050 47009 50281 gene locus_tag LOCUS_20060 47009 50281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 50800 51693 gene locus_tag LOCUS_20070 50800 51693 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896496.1 protein_id gnl|my_center|LOCUS_20070 51693 53084 gene locus_tag LOCUS_20080 gene gltA 51693 53084 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 protein_id gnl|my_center|LOCUS_20080 53182 53661 gene locus_tag LOCUS_20090 gene rlmH 53182 53661 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811533.1 protein_id gnl|my_center|LOCUS_20090 54182 55507 gene locus_tag LOCUS_20100 54182 55507 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017864221.1 protein_id gnl|my_center|LOCUS_20100 57122 55731 gene locus_tag LOCUS_20110 gene mgtE 57122 55731 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829287.1 protein_id gnl|my_center|LOCUS_20110 57215 57394 gene locus_tag LOCUS_20120 57215 57394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 57884 59062 gene locus_tag LOCUS_20130 57884 59062 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_20130 59067 60563 gene locus_tag LOCUS_20140 59067 60563 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903281.1 protein_id gnl|my_center|LOCUS_20140 60666 61994 gene locus_tag LOCUS_20150 gene der 60666 61994 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_20150 61995 62642 gene locus_tag LOCUS_20160 gene plsY 61995 62642 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_20160 62890 63897 gene locus_tag LOCUS_20170 62890 63897 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_20170 64290 64724 gene locus_tag LOCUS_20180 64290 64724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 65081 65275 gene locus_tag LOCUS_20190 65081 65275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 65388 66167 gene locus_tag LOCUS_20200 65388 66167 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418348.1 protein_id gnl|my_center|LOCUS_20200 66438 68330 gene locus_tag LOCUS_20210 gene cooS 66438 68330 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860935.1 protein_id gnl|my_center|LOCUS_20210 68421 69206 gene locus_tag LOCUS_20220 68421 69206 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888532.1 protein_id gnl|my_center|LOCUS_20220 69355 70206 gene locus_tag LOCUS_20230 69355 70206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 70284 72413 gene locus_tag LOCUS_20240 gene acsB 70284 72413 CDS product acetyl-CoA decarbonylase/synthase complex subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418359.1 protein_id gnl|my_center|LOCUS_20240 72705 73646 gene locus_tag LOCUS_20250 gene acsD 72705 73646 CDS product acetyl-CoA decarbonylase/synthase complex subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432254.1 protein_id gnl|my_center|LOCUS_20250 73719 75062 gene locus_tag LOCUS_20260 gene acsC 73719 75062 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436924.1 protein_id gnl|my_center|LOCUS_20260 75303 76088 gene locus_tag LOCUS_20270 gene acsE 75303 76088 CDS product carbon monoxide dehydrogenase/acetyl-CoA synthase methytransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418356.1 protein_id gnl|my_center|LOCUS_20270 76441 78441 gene locus_tag LOCUS_20280 gene acsV 76441 78441 CDS product corrinoid activation/regeneration protein AcsV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436926.1 protein_id gnl|my_center|LOCUS_20280 78762 80804 gene locus_tag LOCUS_20290 78762 80804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 80806 81423 gene locus_tag LOCUS_20300 80806 81423 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436912.1 protein_id gnl|my_center|LOCUS_20300 81562 82443 gene locus_tag LOCUS_20310 81562 82443 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436920.1 protein_id gnl|my_center|LOCUS_20310 82656 83312 gene locus_tag LOCUS_20320 82656 83312 CDS product DUF3786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437313.1 protein_id gnl|my_center|LOCUS_20320 >Feature sequence020 320 39 gene locus_tag LOCUS_20330 320 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 1678 335 gene locus_tag LOCUS_20340 1678 335 CDS product DUF4041 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860984.1 protein_id gnl|my_center|LOCUS_20340 2125 1742 gene locus_tag LOCUS_20350 2125 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 2606 2376 gene locus_tag LOCUS_20360 2606 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 2702 2941 gene locus_tag LOCUS_20370 2702 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 2974 3450 gene locus_tag LOCUS_20380 2974 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 3461 3655 gene locus_tag LOCUS_20390 3461 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 3660 3887 gene locus_tag LOCUS_20400 3660 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 4042 4605 gene locus_tag LOCUS_20410 4042 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 4592 4762 gene locus_tag LOCUS_20420 4592 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 4776 5153 gene locus_tag LOCUS_20430 4776 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 5326 6474 gene locus_tag LOCUS_20440 5326 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 6471 10301 gene locus_tag LOCUS_20450 6471 10301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 10332 11324 gene locus_tag LOCUS_20460 10332 11324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 11329 12150 gene locus_tag LOCUS_20470 11329 12150 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095238.1 protein_id gnl|my_center|LOCUS_20470 12151 12675 gene locus_tag LOCUS_20480 12151 12675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 12684 14861 gene locus_tag LOCUS_20490 12684 14861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 14861 15055 gene locus_tag LOCUS_20500 14861 15055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 15058 16062 gene locus_tag LOCUS_20510 15058 16062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 16059 16361 gene locus_tag LOCUS_20520 16059 16361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 16348 16902 gene locus_tag LOCUS_20530 16348 16902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 16892 17941 gene locus_tag LOCUS_20540 gene dnaN 16892 17941 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762412.1 protein_id gnl|my_center|LOCUS_20540 18031 18210 gene locus_tag LOCUS_20550 18031 18210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 18207 18578 gene locus_tag LOCUS_20560 18207 18578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 18589 18936 gene locus_tag LOCUS_20570 18589 18936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 18933 19322 gene locus_tag LOCUS_20580 18933 19322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 19325 19954 gene locus_tag LOCUS_20590 19325 19954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 19948 20493 gene locus_tag LOCUS_20600 19948 20493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 20493 20705 gene locus_tag LOCUS_20610 20493 20705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 20683 21225 gene locus_tag LOCUS_20620 20683 21225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 21240 21929 gene locus_tag LOCUS_20630 21240 21929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 21926 22237 gene locus_tag LOCUS_20640 21926 22237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 22230 22628 gene locus_tag LOCUS_20650 22230 22628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 22772 23095 gene locus_tag LOCUS_20660 22772 23095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 23095 23517 gene locus_tag LOCUS_20670 23095 23517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 23510 23701 gene locus_tag LOCUS_20680 23510 23701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 23701 23997 gene locus_tag LOCUS_20690 23701 23997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 24018 24275 gene locus_tag LOCUS_20700 24018 24275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 24383 24685 gene locus_tag LOCUS_20710 24383 24685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 24678 24905 gene locus_tag LOCUS_20720 24678 24905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 24895 25143 gene locus_tag LOCUS_20730 24895 25143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 25198 25761 gene locus_tag LOCUS_20740 25198 25761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 25736 25921 gene locus_tag LOCUS_20750 25736 25921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 25945 27324 gene locus_tag LOCUS_20760 25945 27324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 27314 28096 gene locus_tag LOCUS_20770 27314 28096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 28096 28713 gene locus_tag LOCUS_20780 28096 28713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 28685 29320 gene locus_tag LOCUS_20790 28685 29320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 29311 30456 gene locus_tag LOCUS_20800 29311 30456 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283067.1 protein_id gnl|my_center|LOCUS_20800 30449 30970 gene locus_tag LOCUS_20810 30449 30970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 31071 31859 gene locus_tag LOCUS_20820 31071 31859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 31846 33324 gene locus_tag LOCUS_20830 31846 33324 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626412.1 protein_id gnl|my_center|LOCUS_20830 33296 34753 gene locus_tag LOCUS_20840 33296 34753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 34750 35691 gene locus_tag LOCUS_20850 34750 35691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 35705 36175 gene locus_tag LOCUS_20860 35705 36175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 36257 37552 gene locus_tag LOCUS_20870 36257 37552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 37556 38059 gene locus_tag LOCUS_20880 37556 38059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 38075 39109 gene locus_tag LOCUS_20890 38075 39109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 39122 39550 gene locus_tag LOCUS_20900 39122 39550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 39562 39996 gene locus_tag LOCUS_20910 39562 39996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 39993 40346 gene locus_tag LOCUS_20920 39993 40346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 40343 40786 gene locus_tag LOCUS_20930 40343 40786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 40799 41098 gene locus_tag LOCUS_20940 40799 41098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 41088 41972 gene locus_tag LOCUS_20950 41088 41972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 41981 42292 gene locus_tag LOCUS_20960 41981 42292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 42292 43704 gene locus_tag LOCUS_20970 42292 43704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 43723 44181 gene locus_tag LOCUS_20980 43723 44181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 44283 44789 gene locus_tag LOCUS_20990 44283 44789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 44982 50018 gene locus_tag LOCUS_21000 44982 50018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 50020 50682 gene locus_tag LOCUS_21010 50020 50682 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047652.1 protein_id gnl|my_center|LOCUS_21010 50694 51935 gene locus_tag LOCUS_21020 50694 51935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 51950 52222 gene locus_tag LOCUS_21030 51950 52222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 52235 52675 gene locus_tag LOCUS_21040 52235 52675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 52688 53815 gene locus_tag LOCUS_21050 52688 53815 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438450.1 protein_id gnl|my_center|LOCUS_21050 53815 55161 gene locus_tag LOCUS_21060 53815 55161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 55178 55486 gene locus_tag LOCUS_21070 55178 55486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 55508 55999 gene locus_tag LOCUS_21080 55508 55999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 56002 56211 gene locus_tag LOCUS_21090 56002 56211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 56227 56643 gene locus_tag LOCUS_21100 56227 56643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 56669 57508 gene locus_tag LOCUS_21110 56669 57508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 57577 58212 gene locus_tag LOCUS_21120 57577 58212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 58212 58382 gene locus_tag LOCUS_21130 58212 58382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 58382 58720 gene locus_tag LOCUS_21140 58382 58720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 58724 59845 gene locus_tag LOCUS_21150 58724 59845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 59736 59835 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 60121 61215 gene locus_tag LOCUS_21160 60121 61215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 61218 61445 gene locus_tag LOCUS_21170 61218 61445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 61562 61996 gene locus_tag LOCUS_21180 61562 61996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 62009 62422 gene locus_tag LOCUS_21190 62009 62422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 62427 62744 gene locus_tag LOCUS_21200 62427 62744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 62747 63601 gene locus_tag LOCUS_21210 62747 63601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 63770 64027 gene locus_tag LOCUS_21220 63770 64027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 64518 64060 gene locus_tag LOCUS_21230 64518 64060 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458833.1 protein_id gnl|my_center|LOCUS_21230 65526 64600 gene locus_tag LOCUS_21240 65526 64600 CDS product amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461907.1 protein_id gnl|my_center|LOCUS_21240 65721 65849 gene locus_tag LOCUS_21250 65721 65849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 66032 66268 gene locus_tag LOCUS_21260 66032 66268 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965253.1 protein_id gnl|my_center|LOCUS_21260 66603 66702 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 66759 67109 gene locus_tag LOCUS_21270 66759 67109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 67180 67872 gene locus_tag LOCUS_21280 67180 67872 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250853.1 protein_id gnl|my_center|LOCUS_21280 67973 69298 gene locus_tag LOCUS_21290 67973 69298 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_21290 69530 70372 gene locus_tag LOCUS_21300 69530 70372 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048346.1 protein_id gnl|my_center|LOCUS_21300 70549 71109 gene locus_tag LOCUS_21310 70549 71109 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158303423.1 protein_id gnl|my_center|LOCUS_21310 71142 72767 gene locus_tag LOCUS_21320 71142 72767 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888725.1 protein_id gnl|my_center|LOCUS_21320 72853 73737 gene locus_tag LOCUS_21330 72853 73737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 74159 75916 gene locus_tag LOCUS_21340 74159 75916 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945515.1 protein_id gnl|my_center|LOCUS_21340 76008 77636 gene locus_tag LOCUS_21350 76008 77636 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891874.1 protein_id gnl|my_center|LOCUS_21350 77739 78353 gene locus_tag LOCUS_21360 77739 78353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 78463 79266 gene locus_tag LOCUS_21370 78463 79266 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861671.1 protein_id gnl|my_center|LOCUS_21370 79411 79671 gene locus_tag LOCUS_21380 79411 79671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 80281 80490 gene locus_tag LOCUS_21390 80281 80490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 80468 81439 gene locus_tag LOCUS_21400 80468 81439 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109323.1 protein_id gnl|my_center|LOCUS_21400 82033 81821 gene locus_tag LOCUS_21410 82033 81821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 >Feature sequence021 653 96 gene locus_tag LOCUS_21420 653 96 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884081.1 protein_id gnl|my_center|LOCUS_21420 1330 839 gene locus_tag LOCUS_21430 1330 839 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360775.1 protein_id gnl|my_center|LOCUS_21430 1534 1719 gene locus_tag LOCUS_21440 1534 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 2000 2185 gene locus_tag LOCUS_21450 2000 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 2203 2541 gene locus_tag LOCUS_21460 2203 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 2589 2810 gene locus_tag LOCUS_21470 2589 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 2807 3172 gene locus_tag LOCUS_21480 2807 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 5403 3766 gene locus_tag LOCUS_21490 5403 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 5572 5856 gene locus_tag LOCUS_21500 5572 5856 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906388.1 protein_id gnl|my_center|LOCUS_21500 6565 6236 gene locus_tag LOCUS_21510 6565 6236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 6953 6567 gene locus_tag LOCUS_21520 6953 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 7579 7274 gene locus_tag LOCUS_21530 7579 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 8724 7597 gene locus_tag LOCUS_21540 8724 7597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 9945 8830 gene locus_tag LOCUS_21550 9945 8830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 12206 11016 gene locus_tag LOCUS_21560 12206 11016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399445.1 protein_id gnl|my_center|LOCUS_21560 13105 12485 gene locus_tag LOCUS_21570 13105 12485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 13220 13095 gene locus_tag LOCUS_21580 13220 13095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 13664 13416 gene locus_tag LOCUS_21590 13664 13416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 15577 15290 gene locus_tag LOCUS_21600 15577 15290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 15718 16014 gene locus_tag LOCUS_21610 15718 16014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 17289 16024 gene locus_tag LOCUS_21620 17289 16024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 18541 17291 gene locus_tag LOCUS_21630 18541 17291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 20396 18531 gene locus_tag LOCUS_21640 20396 18531 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095694375.1 protein_id gnl|my_center|LOCUS_21640 20736 20383 gene locus_tag LOCUS_21650 20736 20383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 22146 21289 gene locus_tag LOCUS_21660 gene rsmI 22146 21289 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435873.1 protein_id gnl|my_center|LOCUS_21660 23053 22433 gene locus_tag LOCUS_21670 23053 22433 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836620.1 protein_id gnl|my_center|LOCUS_21670 23569 23898 gene locus_tag LOCUS_21680 23569 23898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 23904 24971 gene locus_tag LOCUS_21690 23904 24971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 24995 26407 gene locus_tag LOCUS_21700 24995 26407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 26565 26786 gene locus_tag LOCUS_21710 gene acpP 26565 26786 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631656.1 protein_id gnl|my_center|LOCUS_21710 26803 28461 gene locus_tag LOCUS_21720 26803 28461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 29272 28757 gene locus_tag LOCUS_21730 29272 28757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 29319 29418 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31696 30164 gene locus_tag LOCUS_21740 31696 30164 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_21740 33111 31696 gene locus_tag LOCUS_21750 33111 31696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 33504 33124 gene locus_tag LOCUS_21760 33504 33124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 35540 33504 gene locus_tag LOCUS_21770 35540 33504 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814052.1 protein_id gnl|my_center|LOCUS_21770 38430 35845 gene locus_tag LOCUS_21780 38430 35845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 39745 38459 gene locus_tag LOCUS_21790 39745 38459 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211654.1 protein_id gnl|my_center|LOCUS_21790 40616 39762 gene locus_tag LOCUS_21800 40616 39762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 41675 40647 gene locus_tag LOCUS_21810 41675 40647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 42708 41746 gene locus_tag LOCUS_21820 42708 41746 CDS product FMN-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254509.1 protein_id gnl|my_center|LOCUS_21820 44619 42940 gene locus_tag LOCUS_21830 44619 42940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 44818 45435 gene locus_tag LOCUS_21840 44818 45435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 45958 45614 gene locus_tag LOCUS_21850 45958 45614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 47029 46070 gene locus_tag LOCUS_21860 47029 46070 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_21860 48015 47029 gene locus_tag LOCUS_21870 48015 47029 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 protein_id gnl|my_center|LOCUS_21870 48923 48033 gene locus_tag LOCUS_21880 48923 48033 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_21880 49873 48929 gene locus_tag LOCUS_21890 49873 48929 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_21890 51100 49925 gene locus_tag LOCUS_21900 51100 49925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 52405 51476 gene locus_tag LOCUS_21910 52405 51476 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102088.1 protein_id gnl|my_center|LOCUS_21910 52541 53821 gene locus_tag LOCUS_21920 52541 53821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102087.1 protein_id gnl|my_center|LOCUS_21920 54391 53927 gene locus_tag LOCUS_21930 54391 53927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 54568 55431 gene locus_tag LOCUS_21940 54568 55431 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267481.1 protein_id gnl|my_center|LOCUS_21940 56489 55644 gene locus_tag LOCUS_21950 56489 55644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 57000 56698 gene locus_tag LOCUS_21960 57000 56698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 58970 56997 gene locus_tag LOCUS_21970 58970 56997 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878960.1 protein_id gnl|my_center|LOCUS_21970 59133 58900 gene locus_tag LOCUS_21980 59133 58900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 61737 59236 gene locus_tag LOCUS_21990 61737 59236 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861274.1 protein_id gnl|my_center|LOCUS_21990 63237 61789 gene locus_tag LOCUS_22000 63237 61789 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930806.1 protein_id gnl|my_center|LOCUS_22000 64199 63462 gene locus_tag LOCUS_22010 64199 63462 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_22010 65408 64359 gene locus_tag LOCUS_22020 65408 64359 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963624.1 protein_id gnl|my_center|LOCUS_22020 66483 65401 gene locus_tag LOCUS_22030 66483 65401 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_22030 66767 66588 gene locus_tag LOCUS_22040 66767 66588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 67023 66745 gene locus_tag LOCUS_22050 67023 66745 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010699606.1 protein_id gnl|my_center|LOCUS_22050 67707 67075 gene locus_tag LOCUS_22060 67707 67075 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963621.1 protein_id gnl|my_center|LOCUS_22060 69587 67950 gene locus_tag LOCUS_22070 69587 67950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 70693 69827 gene locus_tag LOCUS_22080 gene pdaA 70693 69827 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438596.1 protein_id gnl|my_center|LOCUS_22080 72286 70922 gene locus_tag LOCUS_22090 72286 70922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 72807 73346 gene locus_tag LOCUS_22100 72807 73346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 73551 74003 gene locus_tag LOCUS_22110 73551 74003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 73996 74964 gene locus_tag LOCUS_22120 73996 74964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 >Feature sequence022 <1 1202 gene locus_tag LOCUS_22130 <1 1202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002324544.1:site-specific resolvase TndX 1477 2343 gene locus_tag LOCUS_22140 1477 2343 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610323.1 protein_id gnl|my_center|LOCUS_22140 2363 2767 gene locus_tag LOCUS_22150 2363 2767 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861115.1 protein_id gnl|my_center|LOCUS_22150 2718 5165 gene locus_tag LOCUS_22160 2718 5165 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_22160 5155 7221 gene locus_tag LOCUS_22170 5155 7221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 7256 7498 gene locus_tag LOCUS_22180 7256 7498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 7488 8663 gene locus_tag LOCUS_22190 7488 8663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 8746 10830 gene locus_tag LOCUS_22200 8746 10830 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368714.1 protein_id gnl|my_center|LOCUS_22200 10827 11726 gene locus_tag LOCUS_22210 10827 11726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 11723 12028 gene locus_tag LOCUS_22220 11723 12028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 12018 12617 gene locus_tag LOCUS_22230 12018 12617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 12621 12827 gene locus_tag LOCUS_22240 12621 12827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 13311 12856 gene locus_tag LOCUS_22250 13311 12856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 13623 13420 gene locus_tag LOCUS_22260 13623 13420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 13622 13972 gene locus_tag LOCUS_22270 13622 13972 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_22270 14077 21522 gene locus_tag LOCUS_22280 14077 21522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 21522 21860 gene locus_tag LOCUS_22290 gene mobC 21522 21860 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368707.1 protein_id gnl|my_center|LOCUS_22290 22017 22316 gene locus_tag LOCUS_22300 22017 22316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 22393 23796 gene locus_tag LOCUS_22310 22393 23796 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 protein_id gnl|my_center|LOCUS_22310 24101 24967 gene locus_tag LOCUS_22320 24101 24967 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_22320 25106 25456 gene locus_tag LOCUS_22330 25106 25456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 25495 26046 gene locus_tag LOCUS_22340 25495 26046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 26073 27014 gene locus_tag LOCUS_22350 26073 27014 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854796.1 protein_id gnl|my_center|LOCUS_22350 27027 27557 gene locus_tag LOCUS_22360 27027 27557 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107760.1 protein_id gnl|my_center|LOCUS_22360 27578 28057 gene locus_tag LOCUS_22370 27578 28057 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_22370 28078 28614 gene locus_tag LOCUS_22380 28078 28614 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_22380 28628 29350 gene locus_tag LOCUS_22390 28628 29350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 29361 30398 gene locus_tag LOCUS_22400 29361 30398 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200459.1 protein_id gnl|my_center|LOCUS_22400 30418 31185 gene locus_tag LOCUS_22410 30418 31185 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_22410 31702 32499 gene locus_tag LOCUS_22420 31702 32499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 32496 33101 gene locus_tag LOCUS_22430 32496 33101 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287965.1 protein_id gnl|my_center|LOCUS_22430 33218 33895 gene locus_tag LOCUS_22440 33218 33895 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860834.1 protein_id gnl|my_center|LOCUS_22440 33883 35085 gene locus_tag LOCUS_22450 33883 35085 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021366129.1 protein_id gnl|my_center|LOCUS_22450 35195 36502 gene locus_tag LOCUS_22460 35195 36502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 36516 37379 gene locus_tag LOCUS_22470 36516 37379 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861296.1 protein_id gnl|my_center|LOCUS_22470 37387 39810 gene locus_tag LOCUS_22480 37387 39810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 40306 40788 gene locus_tag LOCUS_22490 40306 40788 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972615.1 protein_id gnl|my_center|LOCUS_22490 41005 41805 gene locus_tag LOCUS_22500 41005 41805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 41762 43333 gene locus_tag LOCUS_22510 41762 43333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 43330 44004 gene locus_tag LOCUS_22520 43330 44004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 45370 44012 gene locus_tag LOCUS_22530 45370 44012 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861297.1 protein_id gnl|my_center|LOCUS_22530 46086 45367 gene locus_tag LOCUS_22540 46086 45367 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963612.1 protein_id gnl|my_center|LOCUS_22540 46635 46892 gene locus_tag LOCUS_22550 46635 46892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 47008 48369 gene locus_tag LOCUS_22560 47008 48369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 48756 48944 gene locus_tag LOCUS_22570 48756 48944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 49266 49553 gene locus_tag LOCUS_22580 49266 49553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 49874 50032 gene locus_tag LOCUS_22590 49874 50032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 50034 50690 gene locus_tag LOCUS_22600 50034 50690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 50674 51561 gene locus_tag LOCUS_22610 50674 51561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460980.1 protein_id gnl|my_center|LOCUS_22610 51558 52340 gene locus_tag LOCUS_22620 51558 52340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 52402 52653 gene locus_tag LOCUS_22630 52402 52653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 52817 54442 gene locus_tag LOCUS_22640 52817 54442 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_22640 54457 56217 gene locus_tag LOCUS_22650 54457 56217 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_22650 56214 57833 gene locus_tag LOCUS_22660 56214 57833 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775555.1 protein_id gnl|my_center|LOCUS_22660 57826 58347 gene locus_tag LOCUS_22670 57826 58347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 58387 58722 gene locus_tag LOCUS_22680 58387 58722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 58897 60231 gene locus_tag LOCUS_22690 58897 60231 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_22690 60228 61757 gene locus_tag LOCUS_22700 60228 61757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 61758 63458 gene locus_tag LOCUS_22710 61758 63458 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_22710 63451 65133 gene locus_tag LOCUS_22720 63451 65133 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_22720 65120 65419 gene locus_tag LOCUS_22730 65120 65419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 65479 65919 gene locus_tag LOCUS_22740 65479 65919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 66160 66753 gene locus_tag LOCUS_22750 66160 66753 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287520.1 protein_id gnl|my_center|LOCUS_22750 66928 68421 gene locus_tag LOCUS_22760 66928 68421 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390018.1 protein_id gnl|my_center|LOCUS_22760 68921 68583 gene locus_tag LOCUS_22770 68921 68583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 69178 70182 gene locus_tag LOCUS_22780 69178 70182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 70253 70732 gene locus_tag LOCUS_22790 70253 70732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 70751 72715 gene locus_tag LOCUS_22800 70751 72715 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272533.1 protein_id gnl|my_center|LOCUS_22800 72769 73710 gene locus_tag LOCUS_22810 72769 73710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 73714 74124 gene locus_tag LOCUS_22820 73714 74124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence023 382 1182 gene locus_tag LOCUS_22830 382 1182 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774606.1 protein_id gnl|my_center|LOCUS_22830 1408 1647 gene locus_tag LOCUS_22840 1408 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 2292 1828 gene locus_tag LOCUS_22850 2292 1828 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837227.1 protein_id gnl|my_center|LOCUS_22850 2456 2986 gene locus_tag LOCUS_22860 2456 2986 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948983.1 protein_id gnl|my_center|LOCUS_22860 3202 3924 gene locus_tag LOCUS_22870 3202 3924 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_22870 3937 4683 gene locus_tag LOCUS_22880 gene cobB 3937 4683 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240270.1 protein_id gnl|my_center|LOCUS_22880 4711 5460 gene locus_tag LOCUS_22890 4711 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 5426 6463 gene locus_tag LOCUS_22900 5426 6463 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884064.1 protein_id gnl|my_center|LOCUS_22900 7034 7321 gene locus_tag LOCUS_22910 gene groES 7034 7321 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965991.1 protein_id gnl|my_center|LOCUS_22910 7432 9051 gene locus_tag LOCUS_22920 gene groL 7432 9051 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357641.1 protein_id gnl|my_center|LOCUS_22920 9331 9795 gene locus_tag LOCUS_22930 gene spoVAC 9331 9795 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944604.1 protein_id gnl|my_center|LOCUS_22930 10086 11099 gene locus_tag LOCUS_22940 10086 11099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 11260 11721 gene locus_tag LOCUS_22950 11260 11721 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016462.1 protein_id gnl|my_center|LOCUS_22950 11897 13072 gene locus_tag LOCUS_22960 11897 13072 CDS product pyridoxal phosphate-dependent class II aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812326.1 protein_id gnl|my_center|LOCUS_22960 13231 14811 gene locus_tag LOCUS_22970 13231 14811 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437761.1 protein_id gnl|my_center|LOCUS_22970 15050 16024 gene locus_tag LOCUS_22980 15050 16024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 16188 16874 gene locus_tag LOCUS_22990 16188 16874 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948611.1 protein_id gnl|my_center|LOCUS_22990 17001 17261 gene locus_tag LOCUS_23000 17001 17261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 17254 17511 gene locus_tag LOCUS_23010 17254 17511 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613391.1 protein_id gnl|my_center|LOCUS_23010 17529 19367 gene locus_tag LOCUS_23020 gene glmS 17529 19367 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_23020 19522 19592 gene locus_tag LOCUS_t00260 19522 19592 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 19840 20307 gene locus_tag LOCUS_23030 gene rimP 19840 20307 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460396.1 protein_id gnl|my_center|LOCUS_23030 20326 21684 gene locus_tag LOCUS_23040 gene nusA 20326 21684 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_23040 21686 21967 gene locus_tag LOCUS_23050 21686 21967 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_23050 21954 22256 gene locus_tag LOCUS_23060 21954 22256 CDS product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565784.1 protein_id gnl|my_center|LOCUS_23060 23023 23637 gene locus_tag LOCUS_23070 23023 23637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 23670 25616 gene locus_tag LOCUS_23080 23670 25616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 25613 26002 gene locus_tag LOCUS_23090 gene rbfA 25613 26002 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_23090 26139 27134 gene locus_tag LOCUS_23100 26139 27134 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016831.1 protein_id gnl|my_center|LOCUS_23100 27287 28420 gene locus_tag LOCUS_23110 gene truB 27287 28420 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475825.1 protein_id gnl|my_center|LOCUS_23110 28680 29789 gene locus_tag LOCUS_23120 28680 29789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 29779 30222 gene locus_tag LOCUS_23130 29779 30222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 31590 30424 gene locus_tag LOCUS_23140 31590 30424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 31625 31855 gene locus_tag LOCUS_23150 31625 31855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 32126 32788 gene locus_tag LOCUS_23160 32126 32788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 32918 32769 gene locus_tag LOCUS_23170 32918 32769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 33024 34046 gene locus_tag LOCUS_23180 33024 34046 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_23180 34204 36573 gene locus_tag LOCUS_23190 34204 36573 CDS product formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438022.1 protein_id gnl|my_center|LOCUS_23190 36609 37460 gene locus_tag LOCUS_23200 36609 37460 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896060.1 protein_id gnl|my_center|LOCUS_23200 37494 38744 gene locus_tag LOCUS_23210 37494 38744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 38893 40410 gene locus_tag LOCUS_23220 38893 40410 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_23220 40583 42337 gene locus_tag LOCUS_23230 40583 42337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 42431 43540 gene locus_tag LOCUS_23240 42431 43540 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_23240 47019 43789 gene locus_tag LOCUS_23250 gene carB 47019 43789 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_23250 47320 50427 gene locus_tag LOCUS_23260 47320 50427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 50672 50590 gene locus_tag LOCUS_t00270 50672 50590 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 51636 50914 gene locus_tag LOCUS_23270 51636 50914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 52054 53649 gene locus_tag LOCUS_23280 52054 53649 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_23280 53847 54041 gene locus_tag LOCUS_23290 53847 54041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 54057 54443 gene locus_tag LOCUS_23300 54057 54443 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_23300 55328 54723 gene locus_tag LOCUS_23310 55328 54723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 55391 55609 gene locus_tag LOCUS_23320 55391 55609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 56666 55902 gene locus_tag LOCUS_23330 56666 55902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 57036 58499 gene locus_tag LOCUS_23340 57036 58499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 58614 59111 gene locus_tag LOCUS_23350 58614 59111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 59166 61823 gene locus_tag LOCUS_23360 gene polA 59166 61823 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412819.1 protein_id gnl|my_center|LOCUS_23360 61978 62820 gene locus_tag LOCUS_23370 gene coaE 61978 62820 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_23370 62888 64366 gene locus_tag LOCUS_23380 62888 64366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 64482 66347 gene locus_tag LOCUS_23390 64482 66347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 66628 67425 gene locus_tag LOCUS_23400 66628 67425 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_23400 67706 67978 gene locus_tag LOCUS_23410 67706 67978 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_23410 68100 69464 gene locus_tag LOCUS_23420 68100 69464 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_23420 69695 71287 gene locus_tag LOCUS_23430 69695 71287 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_23430 72720 71296 gene locus_tag LOCUS_23440 72720 71296 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_23440 >Feature sequence024 158 233 gene locus_tag LOCUS_t00280 158 233 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 289 361 gene locus_tag LOCUS_t00290 289 361 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 378 450 gene locus_tag LOCUS_t00300 378 450 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 530 613 gene locus_tag LOCUS_t00310 530 613 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 648 722 gene locus_tag LOCUS_t00320 648 722 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 755 829 gene locus_tag LOCUS_t00330 755 829 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 874 948 gene locus_tag LOCUS_t00340 874 948 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1121 1252 gene locus_tag LOCUS_23450 1121 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 1994 1488 gene locus_tag LOCUS_23460 1994 1488 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895666.1 protein_id gnl|my_center|LOCUS_23460 2284 3261 gene locus_tag LOCUS_23470 2284 3261 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815889.1 protein_id gnl|my_center|LOCUS_23470 3275 4201 gene locus_tag LOCUS_23480 3275 4201 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774964.1 protein_id gnl|my_center|LOCUS_23480 4403 4657 gene locus_tag LOCUS_23490 4403 4657 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_23490 4671 5102 gene locus_tag LOCUS_23500 4671 5102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 5283 5846 gene locus_tag LOCUS_23510 5283 5846 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814019.1 protein_id gnl|my_center|LOCUS_23510 5865 6752 gene locus_tag LOCUS_23520 5865 6752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 7044 7679 gene locus_tag LOCUS_23530 7044 7679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 7962 9317 gene locus_tag LOCUS_23540 7962 9317 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_23540 9652 11646 gene locus_tag LOCUS_23550 gene glgB 9652 11646 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141306.1 protein_id gnl|my_center|LOCUS_23550 12088 13173 gene locus_tag LOCUS_23560 12088 13173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 13678 14181 gene locus_tag LOCUS_23570 13678 14181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 14250 14774 gene locus_tag LOCUS_23580 14250 14774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 14901 16037 gene locus_tag LOCUS_23590 14901 16037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 16486 15980 gene locus_tag LOCUS_23600 16486 15980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 17509 16559 gene locus_tag LOCUS_23610 17509 16559 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 protein_id gnl|my_center|LOCUS_23610 17936 18514 gene locus_tag LOCUS_23620 17936 18514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 18540 18785 gene locus_tag LOCUS_23630 18540 18785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 18932 20242 gene locus_tag LOCUS_23640 18932 20242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 20639 21538 gene locus_tag LOCUS_23650 20639 21538 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289132.1 protein_id gnl|my_center|LOCUS_23650 21531 22358 gene locus_tag LOCUS_23660 21531 22358 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289130.1 protein_id gnl|my_center|LOCUS_23660 22850 23164 gene locus_tag LOCUS_23670 22850 23164 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052490.1 protein_id gnl|my_center|LOCUS_23670 23148 23555 gene locus_tag LOCUS_23680 23148 23555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 23690 27679 gene locus_tag LOCUS_23690 23690 27679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 27704 28006 gene locus_tag LOCUS_23700 27704 28006 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399122.1 protein_id gnl|my_center|LOCUS_23700 28143 29801 gene locus_tag LOCUS_23710 gene galT 28143 29801 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_23710 29968 30909 gene locus_tag LOCUS_23720 gene cysK 29968 30909 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 protein_id gnl|my_center|LOCUS_23720 31064 31489 gene locus_tag LOCUS_23730 31064 31489 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461668.1 protein_id gnl|my_center|LOCUS_23730 32166 32996 gene locus_tag LOCUS_23740 32166 32996 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764454.1 protein_id gnl|my_center|LOCUS_23740 33014 33340 gene locus_tag LOCUS_23750 33014 33340 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212090789.1 protein_id gnl|my_center|LOCUS_23750 33337 33507 gene locus_tag LOCUS_23760 33337 33507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 33480 34022 gene locus_tag LOCUS_23770 33480 34022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 34023 34826 gene locus_tag LOCUS_23780 34023 34826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 34845 35663 gene locus_tag LOCUS_23790 34845 35663 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989966.1 protein_id gnl|my_center|LOCUS_23790 35730 36758 gene locus_tag LOCUS_23800 35730 36758 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812829.1 protein_id gnl|my_center|LOCUS_23800 36785 37246 gene locus_tag LOCUS_23810 36785 37246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 37262 38299 gene locus_tag LOCUS_23820 37262 38299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 38533 40080 gene locus_tag LOCUS_23830 38533 40080 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903785.1 protein_id gnl|my_center|LOCUS_23830 40291 40124 gene locus_tag LOCUS_23840 40291 40124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 40465 41412 gene locus_tag LOCUS_23850 40465 41412 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015650.1 protein_id gnl|my_center|LOCUS_23850 41417 42244 gene locus_tag LOCUS_23860 41417 42244 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903784.1 protein_id gnl|my_center|LOCUS_23860 42269 43141 gene locus_tag LOCUS_23870 42269 43141 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016906.1 protein_id gnl|my_center|LOCUS_23870 43227 44111 gene locus_tag LOCUS_23880 43227 44111 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005975400.1 protein_id gnl|my_center|LOCUS_23880 44139 45335 gene locus_tag LOCUS_23890 44139 45335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 45712 47052 gene locus_tag LOCUS_23900 45712 47052 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_23900 47859 47077 gene locus_tag LOCUS_23910 47859 47077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 48475 47864 gene locus_tag LOCUS_23920 gene ureG 48475 47864 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238762.1 protein_id gnl|my_center|LOCUS_23920 49300 48599 gene locus_tag LOCUS_23930 49300 48599 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357404.1 protein_id gnl|my_center|LOCUS_23930 49860 49381 gene locus_tag LOCUS_23940 gene ureE 49860 49381 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583097.1 protein_id gnl|my_center|LOCUS_23940 50387 49878 gene locus_tag LOCUS_23950 gene ureI 50387 49878 CDS product acid-activated urea channel protein UreI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901247.1 protein_id gnl|my_center|LOCUS_23950 52131 50410 gene locus_tag LOCUS_23960 gene ureB 52131 50410 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724295.1 protein_id gnl|my_center|LOCUS_23960 52503 52144 gene locus_tag LOCUS_23970 52503 52144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23970 52823 52521 gene locus_tag LOCUS_23980 gene ureA 52823 52521 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694143.1 protein_id gnl|my_center|LOCUS_23980 53213 53467 gene locus_tag LOCUS_23990 53213 53467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 53537 55534 gene locus_tag LOCUS_24000 53537 55534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 56558 55539 gene locus_tag LOCUS_24010 56558 55539 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945539.1 protein_id gnl|my_center|LOCUS_24010 57354 56677 gene locus_tag LOCUS_24020 57354 56677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 57696 59330 gene locus_tag LOCUS_24030 57696 59330 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_24030 59522 60400 gene locus_tag LOCUS_24040 59522 60400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 60766 62121 gene locus_tag LOCUS_24050 60766 62121 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_24050 62316 64439 gene locus_tag LOCUS_24060 62316 64439 CDS product alpha-L-rhamnosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695108.1 protein_id gnl|my_center|LOCUS_24060 64587 66293 gene locus_tag LOCUS_24070 64587 66293 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_24070 66576 67061 gene locus_tag LOCUS_24080 66576 67061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 >Feature sequence025 1308 2300 gene locus_tag LOCUS_24090 1308 2300 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_24090 2729 3706 gene locus_tag LOCUS_24100 2729 3706 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549276.1 protein_id gnl|my_center|LOCUS_24100 3699 4493 gene locus_tag LOCUS_24110 3699 4493 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_24110 5776 4766 gene locus_tag LOCUS_24120 5776 4766 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244946.1 protein_id gnl|my_center|LOCUS_24120 6322 8757 gene locus_tag LOCUS_24130 6322 8757 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_24130 8969 8826 gene locus_tag LOCUS_24140 8969 8826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 9232 8966 gene locus_tag LOCUS_24150 9232 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 10042 9239 gene locus_tag LOCUS_24160 10042 9239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 10189 10482 gene locus_tag LOCUS_24170 10189 10482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 11263 10487 gene locus_tag LOCUS_24180 gene sigG 11263 10487 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_24180 12223 11483 gene locus_tag LOCUS_24190 gene sigE 12223 11483 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774280.1 protein_id gnl|my_center|LOCUS_24190 13189 12410 gene locus_tag LOCUS_24200 13189 12410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 14179 13331 gene locus_tag LOCUS_24210 gene aroD 14179 13331 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897376.1 protein_id gnl|my_center|LOCUS_24210 14459 15319 gene locus_tag LOCUS_24220 14459 15319 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704391.1 protein_id gnl|my_center|LOCUS_24220 15694 15428 gene locus_tag LOCUS_24230 15694 15428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 16851 15691 gene locus_tag LOCUS_24240 gene ftsZ 16851 15691 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965000.1 protein_id gnl|my_center|LOCUS_24240 18367 17177 gene locus_tag LOCUS_24250 18367 17177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 19900 18527 gene locus_tag LOCUS_24260 19900 18527 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895048.1 protein_id gnl|my_center|LOCUS_24260 21177 20086 gene locus_tag LOCUS_24270 gene spoVE 21177 20086 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244810.1 protein_id gnl|my_center|LOCUS_24270 23077 21389 gene locus_tag LOCUS_24280 23077 21389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 24220 23183 gene locus_tag LOCUS_24290 gene mraY 24220 23183 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427000.1 protein_id gnl|my_center|LOCUS_24290 26498 24429 gene locus_tag LOCUS_24300 26498 24429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 29009 26697 gene locus_tag LOCUS_24310 29009 26697 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_24310 29599 29084 gene locus_tag LOCUS_24320 29599 29084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 30540 29512 gene locus_tag LOCUS_24330 gene rsmH 30540 29512 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_24330 31070 30636 gene locus_tag LOCUS_24340 gene mraZ 31070 30636 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723756.1 protein_id gnl|my_center|LOCUS_24340 31585 31424 gene locus_tag LOCUS_24350 31585 31424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 32641 31601 gene locus_tag LOCUS_24360 32641 31601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 33839 32742 gene locus_tag LOCUS_24370 gene ychF 33839 32742 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_24370 34664 33957 gene locus_tag LOCUS_24380 gene rpe 34664 33957 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902077.1 protein_id gnl|my_center|LOCUS_24380 35838 34879 gene locus_tag LOCUS_24390 gene rsgA 35838 34879 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_24390 38294 35961 gene locus_tag LOCUS_24400 38294 35961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 39154 38435 gene locus_tag LOCUS_24410 gene prpC 39154 38435 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_24410 40625 39444 gene locus_tag LOCUS_24420 gene rlmN 40625 39444 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_24420 42134 40782 gene locus_tag LOCUS_24430 gene rsmB 42134 40782 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_24430 42829 42131 gene locus_tag LOCUS_24440 42829 42131 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642482.1 protein_id gnl|my_center|LOCUS_24440 43162 43022 gene locus_tag LOCUS_24450 43162 43022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 44379 43432 gene locus_tag LOCUS_24460 gene fmt 44379 43432 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460526.1 protein_id gnl|my_center|LOCUS_24460 45097 44606 gene locus_tag LOCUS_24470 gene def 45097 44606 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965029.1 protein_id gnl|my_center|LOCUS_24470 47809 45302 gene locus_tag LOCUS_24480 47809 45302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 49440 47821 gene locus_tag LOCUS_24490 49440 47821 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049769937.1 protein_id gnl|my_center|LOCUS_24490 50788 49637 gene locus_tag LOCUS_24500 gene tgt 50788 49637 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_24500 51924 50845 gene locus_tag LOCUS_24510 51924 50845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 54872 51921 gene locus_tag LOCUS_24520 54872 51921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 51964 52063 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 55156 59799 gene locus_tag LOCUS_24530 55156 59799 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484061.1 protein_id gnl|my_center|LOCUS_24530 60629 59988 gene locus_tag LOCUS_24540 60629 59988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 61484 61005 gene locus_tag LOCUS_24550 61484 61005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 61963 61433 gene locus_tag LOCUS_24560 61963 61433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 62305 62063 gene locus_tag LOCUS_24570 62305 62063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 62949 62302 gene locus_tag LOCUS_24580 62949 62302 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016982.1 protein_id gnl|my_center|LOCUS_24580 64209 62953 gene locus_tag LOCUS_24590 64209 62953 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_24590 >Feature sequence026 85 243 gene locus_tag LOCUS_24600 85 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 432 3248 gene locus_tag LOCUS_24610 432 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 3728 6409 gene locus_tag LOCUS_24620 3728 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 7800 6724 gene locus_tag LOCUS_24630 gene queA 7800 6724 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_24630 10530 7915 gene locus_tag LOCUS_24640 gene pheT 10530 7915 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_24640 11607 10588 gene locus_tag LOCUS_24650 gene pheS 11607 10588 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965654.1 protein_id gnl|my_center|LOCUS_24650 16581 12307 gene locus_tag LOCUS_24660 16581 12307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 17380 18666 gene locus_tag LOCUS_24670 17380 18666 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_24670 18942 19784 gene locus_tag LOCUS_24680 18942 19784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 20119 20796 gene locus_tag LOCUS_24690 20119 20796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 20783 21526 gene locus_tag LOCUS_24700 20783 21526 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724779.1 protein_id gnl|my_center|LOCUS_24700 21843 21676 gene locus_tag LOCUS_24710 21843 21676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 22150 21824 gene locus_tag LOCUS_24720 22150 21824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 23486 22152 gene locus_tag LOCUS_24730 23486 22152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 25095 23719 gene locus_tag LOCUS_24740 25095 23719 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_24740 25838 25236 gene locus_tag LOCUS_24750 25838 25236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 26669 26025 gene locus_tag LOCUS_24760 26669 26025 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358306.1 protein_id gnl|my_center|LOCUS_24760 26926 26657 gene locus_tag LOCUS_24770 26926 26657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 27795 27361 gene locus_tag LOCUS_24780 27795 27361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 29330 28068 gene locus_tag LOCUS_24790 29330 28068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 30411 29548 gene locus_tag LOCUS_24800 30411 29548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 31229 30426 gene locus_tag LOCUS_24810 31229 30426 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391964.1 protein_id gnl|my_center|LOCUS_24810 32308 31433 gene locus_tag LOCUS_24820 32308 31433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163851494.1 protein_id gnl|my_center|LOCUS_24820 33922 32516 gene locus_tag LOCUS_24830 33922 32516 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987111.1 protein_id gnl|my_center|LOCUS_24830 34180 33980 gene locus_tag LOCUS_24840 34180 33980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 34834 34250 gene locus_tag LOCUS_24850 34834 34250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 36005 35049 gene locus_tag LOCUS_24860 36005 35049 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_24860 36986 36009 gene locus_tag LOCUS_24870 36986 36009 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 protein_id gnl|my_center|LOCUS_24870 37945 37001 gene locus_tag LOCUS_24880 37945 37001 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810093.1 protein_id gnl|my_center|LOCUS_24880 38902 37946 gene locus_tag LOCUS_24890 38902 37946 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_24890 40859 39267 gene locus_tag LOCUS_24900 40859 39267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 41077 40865 gene locus_tag LOCUS_24910 41077 40865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 42282 41383 gene locus_tag LOCUS_24920 42282 41383 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257188.1 protein_id gnl|my_center|LOCUS_24920 42816 42640 gene locus_tag LOCUS_24930 42816 42640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 44050 42971 gene locus_tag LOCUS_24940 44050 42971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 45450 44323 gene locus_tag LOCUS_24950 45450 44323 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583075.1 protein_id gnl|my_center|LOCUS_24950 46540 45593 gene locus_tag LOCUS_24960 46540 45593 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583074.1 protein_id gnl|my_center|LOCUS_24960 46878 46636 gene locus_tag LOCUS_24970 46878 46636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 48971 47148 gene locus_tag LOCUS_24980 48971 47148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 51061 49202 gene locus_tag LOCUS_24990 gene uidA 51061 49202 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583888.1 protein_id gnl|my_center|LOCUS_24990 54280 51125 gene locus_tag LOCUS_25000 54280 51125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 52643 52742 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 54720 54277 gene locus_tag LOCUS_25010 54720 54277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 56873 54930 gene locus_tag LOCUS_25020 56873 54930 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969218.1 protein_id gnl|my_center|LOCUS_25020 57479 57114 gene locus_tag LOCUS_25030 57479 57114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 58426 57632 gene locus_tag LOCUS_25040 58426 57632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 60233 58761 gene locus_tag LOCUS_25050 60233 58761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 61126 60269 gene locus_tag LOCUS_25060 61126 60269 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303949.1 protein_id gnl|my_center|LOCUS_25060 62055 61141 gene locus_tag LOCUS_25070 62055 61141 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_25070 63748 62468 gene locus_tag LOCUS_25080 63748 62468 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359868.1 protein_id gnl|my_center|LOCUS_25080 >Feature sequence027 443 2491 gene locus_tag LOCUS_25090 443 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 2279 2378 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2457 8087 gene locus_tag LOCUS_25100 2457 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 7972 11148 gene locus_tag LOCUS_25110 7972 11148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 7980 8079 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11624 12886 gene locus_tag LOCUS_25120 11624 12886 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047742.1 protein_id gnl|my_center|LOCUS_25120 13245 15185 gene locus_tag LOCUS_25130 13245 15185 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047743.1 protein_id gnl|my_center|LOCUS_25130 15608 15949 gene locus_tag LOCUS_25140 15608 15949 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_25140 15949 16545 gene locus_tag LOCUS_25150 gene recR 15949 16545 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359478.1 protein_id gnl|my_center|LOCUS_25150 16632 16964 gene locus_tag LOCUS_25160 16632 16964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 17078 17335 gene locus_tag LOCUS_25170 17078 17335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 17473 17688 gene locus_tag LOCUS_25180 17473 17688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 17830 18297 gene locus_tag LOCUS_25190 17830 18297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 18294 20282 gene locus_tag LOCUS_25200 18294 20282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 20286 22055 gene locus_tag LOCUS_25210 20286 22055 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_25210 22238 23905 gene locus_tag LOCUS_25220 22238 23905 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_25220 25151 24003 gene locus_tag LOCUS_25230 25151 24003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 25604 26974 gene locus_tag LOCUS_25240 25604 26974 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_25240 27178 27336 gene locus_tag LOCUS_25250 27178 27336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 27333 28994 gene locus_tag LOCUS_25260 27333 28994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 29313 29642 gene locus_tag LOCUS_25270 29313 29642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 29629 30231 gene locus_tag LOCUS_25280 gene spoIIAB 29629 30231 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357714.1 protein_id gnl|my_center|LOCUS_25280 30271 30996 gene locus_tag LOCUS_25290 gene sigF 30271 30996 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350729.1 protein_id gnl|my_center|LOCUS_25290 31351 33600 gene locus_tag LOCUS_25300 gene bglX 31351 33600 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658134.1 protein_id gnl|my_center|LOCUS_25300 33911 35254 gene locus_tag LOCUS_25310 33911 35254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 35551 37452 gene locus_tag LOCUS_25320 35551 37452 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104219.1 protein_id gnl|my_center|LOCUS_25320 38206 37721 gene locus_tag LOCUS_25330 gene ybaK 38206 37721 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437064.1 protein_id gnl|my_center|LOCUS_25330 38563 39477 gene locus_tag LOCUS_25340 38563 39477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 39748 42228 gene locus_tag LOCUS_25350 39748 42228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 42840 44774 gene locus_tag LOCUS_25360 42840 44774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 44814 45185 gene locus_tag LOCUS_25370 44814 45185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 45182 46819 gene locus_tag LOCUS_25380 45182 46819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 47595 47053 gene locus_tag LOCUS_25390 47595 47053 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940892.1 protein_id gnl|my_center|LOCUS_25390 48170 49201 gene locus_tag LOCUS_25400 48170 49201 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682287.1 protein_id gnl|my_center|LOCUS_25400 49380 49562 gene locus_tag LOCUS_25410 49380 49562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 49872 51254 gene locus_tag LOCUS_25420 49872 51254 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_25420 51543 53123 gene locus_tag LOCUS_25430 51543 53123 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_25430 54156 53179 gene locus_tag LOCUS_25440 54156 53179 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965979.1 protein_id gnl|my_center|LOCUS_25440 54528 55193 gene locus_tag LOCUS_25450 54528 55193 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986243.1 protein_id gnl|my_center|LOCUS_25450 55681 56028 gene locus_tag LOCUS_25460 55681 56028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 56060 56239 gene locus_tag LOCUS_25470 56060 56239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 56295 56666 gene locus_tag LOCUS_25480 56295 56666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 56551 56940 gene locus_tag LOCUS_25490 56551 56940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 57836 60475 gene locus_tag LOCUS_25500 57836 60475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 60491 62332 gene locus_tag LOCUS_25510 60491 62332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 >Feature sequence028 2185 62 gene locus_tag LOCUS_25520 2185 62 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120563.1 protein_id gnl|my_center|LOCUS_25520 3272 2253 gene locus_tag LOCUS_25530 gene hslO 3272 2253 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048141.1 protein_id gnl|my_center|LOCUS_25530 3950 3759 gene locus_tag LOCUS_25540 3950 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 5207 4086 gene locus_tag LOCUS_25550 5207 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 7085 5439 gene locus_tag LOCUS_25560 7085 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 8061 7204 gene locus_tag LOCUS_25570 8061 7204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 10263 8488 gene locus_tag LOCUS_25580 gene argS 10263 8488 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020254.1 protein_id gnl|my_center|LOCUS_25580 10958 10284 gene locus_tag LOCUS_25590 10958 10284 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_25590 12196 11009 gene locus_tag LOCUS_25600 12196 11009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 14085 12343 gene locus_tag LOCUS_25610 14085 12343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 14754 14293 gene locus_tag LOCUS_25620 14754 14293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 15068 15817 gene locus_tag LOCUS_25630 15068 15817 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813911.1 protein_id gnl|my_center|LOCUS_25630 15811 17142 gene locus_tag LOCUS_25640 15811 17142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 17344 18888 gene locus_tag LOCUS_25650 gene malQ 17344 18888 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_25650 19018 19761 gene locus_tag LOCUS_25660 19018 19761 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616577.1 protein_id gnl|my_center|LOCUS_25660 20072 19917 gene locus_tag LOCUS_25670 20072 19917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 20310 20035 gene locus_tag LOCUS_25680 gene spoVG 20310 20035 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_25680 21490 20384 gene locus_tag LOCUS_25690 gene glgD 21490 20384 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_25690 23010 21502 gene locus_tag LOCUS_25700 23010 21502 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082942.1 protein_id gnl|my_center|LOCUS_25700 23423 24841 gene locus_tag LOCUS_25710 gene murC 23423 24841 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_25710 26114 24936 gene locus_tag LOCUS_25720 26114 24936 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_25720 27311 26199 gene locus_tag LOCUS_25730 27311 26199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 28608 27412 gene locus_tag LOCUS_25740 28608 27412 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132280311.1 protein_id gnl|my_center|LOCUS_25740 28768 28550 gene locus_tag LOCUS_25750 28768 28550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 30611 28974 gene locus_tag LOCUS_25760 30611 28974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 31696 30644 gene locus_tag LOCUS_25770 31696 30644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 32079 32519 gene locus_tag LOCUS_25780 gene mscL 32079 32519 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_25780 33451 32720 gene locus_tag LOCUS_25790 33451 32720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 34544 33435 gene locus_tag LOCUS_25800 34544 33435 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_25800 34958 34551 gene locus_tag LOCUS_25810 34958 34551 CDS product Zn-finger containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964917.1 protein_id gnl|my_center|LOCUS_25810 37750 35240 gene locus_tag LOCUS_25820 37750 35240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 38448 37750 gene locus_tag LOCUS_25830 38448 37750 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_25830 40158 38719 gene locus_tag LOCUS_25840 gene pyk 40158 38719 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_25840 41261 40422 gene locus_tag LOCUS_25850 41261 40422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 42880 41492 gene locus_tag LOCUS_25860 42880 41492 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_25860 44924 43035 gene locus_tag LOCUS_25870 44924 43035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 46128 45166 gene locus_tag LOCUS_25880 46128 45166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 46691 46335 gene locus_tag LOCUS_25890 gene spoVAE 46691 46335 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811048.1 protein_id gnl|my_center|LOCUS_25890 48237 47020 gene locus_tag LOCUS_25900 48237 47020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 50818 48560 gene locus_tag LOCUS_25910 50818 48560 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584017.1 protein_id gnl|my_center|LOCUS_25910 51789 50836 gene locus_tag LOCUS_25920 51789 50836 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963896.1 protein_id gnl|my_center|LOCUS_25920 53507 51777 gene locus_tag LOCUS_25930 53507 51777 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_25930 54963 53752 gene locus_tag LOCUS_25940 54963 53752 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108595.1 protein_id gnl|my_center|LOCUS_25940 55997 54975 gene locus_tag LOCUS_25950 55997 54975 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080062.1 protein_id gnl|my_center|LOCUS_25950 56740 56102 gene locus_tag LOCUS_25960 56740 56102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 57783 56941 gene locus_tag LOCUS_25970 57783 56941 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030752.1 protein_id gnl|my_center|LOCUS_25970 58781 57783 gene locus_tag LOCUS_25980 58781 57783 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030753.1 protein_id gnl|my_center|LOCUS_25980 60307 58934 gene locus_tag LOCUS_25990 60307 58934 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030754.1 protein_id gnl|my_center|LOCUS_25990 61612 60587 gene locus_tag LOCUS_26000 61612 60587 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083018.1 protein_id gnl|my_center|LOCUS_26000 >Feature sequence029 628 428 gene locus_tag LOCUS_26010 628 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 4214 813 gene locus_tag LOCUS_26020 4214 813 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948403.1 protein_id gnl|my_center|LOCUS_26020 5036 4281 gene locus_tag LOCUS_26030 5036 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101009.1 protein_id gnl|my_center|LOCUS_26030 5975 5037 gene locus_tag LOCUS_26040 5975 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 7159 6083 gene locus_tag LOCUS_26050 7159 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 7499 7173 gene locus_tag LOCUS_26060 7499 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 9409 7877 gene locus_tag LOCUS_26070 9409 7877 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_26070 11067 10216 gene locus_tag LOCUS_26080 11067 10216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26080 11629 12207 gene locus_tag LOCUS_26090 11629 12207 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234129.1 protein_id gnl|my_center|LOCUS_26090 13227 12541 gene locus_tag LOCUS_26100 13227 12541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 14111 13224 gene locus_tag LOCUS_26110 14111 13224 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966679.1 protein_id gnl|my_center|LOCUS_26110 14281 16311 gene locus_tag LOCUS_26120 14281 16311 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101721463.1 protein_id gnl|my_center|LOCUS_26120 16617 16483 gene locus_tag LOCUS_26130 16617 16483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 17559 16882 gene locus_tag LOCUS_26140 17559 16882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 17863 17741 gene locus_tag LOCUS_26150 17863 17741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 19385 18429 gene locus_tag LOCUS_26160 19385 18429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 19852 19448 gene locus_tag LOCUS_26170 19852 19448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 20339 19980 gene locus_tag LOCUS_26180 20339 19980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 21181 20534 gene locus_tag LOCUS_26190 21181 20534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 21605 21375 gene locus_tag LOCUS_26200 21605 21375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 21878 21654 gene locus_tag LOCUS_26210 21878 21654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 27962 21981 gene locus_tag LOCUS_26220 27962 21981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 28632 28057 gene locus_tag LOCUS_26230 28632 28057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 29463 29200 gene locus_tag LOCUS_26240 29463 29200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 29704 32112 gene locus_tag LOCUS_26250 gene yicI 29704 32112 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703824.1 protein_id gnl|my_center|LOCUS_26250 33602 32211 gene locus_tag LOCUS_26260 33602 32211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 33910 34815 gene locus_tag LOCUS_26270 33910 34815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 35294 34950 gene locus_tag LOCUS_26280 35294 34950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 35360 36727 gene locus_tag LOCUS_26290 35360 36727 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 protein_id gnl|my_center|LOCUS_26290 36870 37727 gene locus_tag LOCUS_26300 36870 37727 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052964.1 protein_id gnl|my_center|LOCUS_26300 37727 38644 gene locus_tag LOCUS_26310 37727 38644 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068636.1 protein_id gnl|my_center|LOCUS_26310 38837 40342 gene locus_tag LOCUS_26320 gene malQ 38837 40342 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262974.1 protein_id gnl|my_center|LOCUS_26320 40532 41560 gene locus_tag LOCUS_26330 40532 41560 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_26330 43989 41611 gene locus_tag LOCUS_26340 gene glgP 43989 41611 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950133.1 protein_id gnl|my_center|LOCUS_26340 50014 44438 gene locus_tag LOCUS_26350 50014 44438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 50068 50167 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51571 50999 gene locus_tag LOCUS_26360 gene lepB 51571 50999 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014917214.1 protein_id gnl|my_center|LOCUS_26360 52211 51564 gene locus_tag LOCUS_26370 52211 51564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 53032 52388 gene locus_tag LOCUS_26380 53032 52388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 53822 53034 gene locus_tag LOCUS_26390 53822 53034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 54739 53819 gene locus_tag LOCUS_26400 54739 53819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 56608 54986 gene locus_tag LOCUS_26410 56608 54986 CDS product isopeptide-forming domain-containing fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837257.1 protein_id gnl|my_center|LOCUS_26410 58213 57071 gene locus_tag LOCUS_26420 58213 57071 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 protein_id gnl|my_center|LOCUS_26420 58884 59822 gene locus_tag LOCUS_26430 58884 59822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 61361 60684 gene locus_tag LOCUS_26440 61361 60684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814794.1 protein_id gnl|my_center|LOCUS_26440 >Feature sequence030 175 101 gene locus_tag LOCUS_t00350 175 101 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 458 321 gene locus_tag LOCUS_26450 458 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 3274 755 gene locus_tag LOCUS_26460 3274 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 3809 3588 gene locus_tag LOCUS_26470 3809 3588 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_26470 4036 3827 gene locus_tag LOCUS_26480 4036 3827 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_26480 4196 4579 gene locus_tag LOCUS_26490 4196 4579 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949091.1 protein_id gnl|my_center|LOCUS_26490 4901 6799 gene locus_tag LOCUS_26500 4901 6799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 7467 7213 gene locus_tag LOCUS_26510 7467 7213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 8516 7677 gene locus_tag LOCUS_26520 8516 7677 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219921.1 protein_id gnl|my_center|LOCUS_26520 8749 9252 gene locus_tag LOCUS_26530 8749 9252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 9725 11971 gene locus_tag LOCUS_26540 9725 11971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 12582 12181 gene locus_tag LOCUS_26550 12582 12181 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719050.1 protein_id gnl|my_center|LOCUS_26550 14192 12798 gene locus_tag LOCUS_26560 gene atpD 14192 12798 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_26560 15642 14458 gene locus_tag LOCUS_26570 15642 14458 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056240.1 protein_id gnl|my_center|LOCUS_26570 17209 15680 gene locus_tag LOCUS_26580 gene atpA 17209 15680 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421367.1 protein_id gnl|my_center|LOCUS_26580 17827 17288 gene locus_tag LOCUS_26590 gene atpH 17827 17288 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142900.1 protein_id gnl|my_center|LOCUS_26590 18327 17824 gene locus_tag LOCUS_26600 gene atpF 18327 17824 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393859.1 protein_id gnl|my_center|LOCUS_26600 18788 18510 gene locus_tag LOCUS_26610 18788 18510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 19766 19008 gene locus_tag LOCUS_26620 gene atpB 19766 19008 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437836.1 protein_id gnl|my_center|LOCUS_26620 20335 19919 gene locus_tag LOCUS_26630 20335 19919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 20756 20490 gene locus_tag LOCUS_26640 20756 20490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 20908 20768 gene locus_tag LOCUS_26650 20908 20768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 21760 21266 gene locus_tag LOCUS_26660 21760 21266 CDS product EutP/PduV family microcompartment system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189433.1 protein_id gnl|my_center|LOCUS_26660 22344 21913 gene locus_tag LOCUS_26670 22344 21913 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904036.1 protein_id gnl|my_center|LOCUS_26670 22894 22532 gene locus_tag LOCUS_26680 gene pduU 22894 22532 CDS product propanediol utilization microcompartment protein PduU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168417.1 protein_id gnl|my_center|LOCUS_26680 23242 23063 gene locus_tag LOCUS_26690 23242 23063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 24656 23337 gene locus_tag LOCUS_26700 gene eno 24656 23337 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898301.1 protein_id gnl|my_center|LOCUS_26700 26873 25035 gene locus_tag LOCUS_26710 26873 25035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 41893 27344 gene locus_tag LOCUS_26720 41893 27344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 55431 42442 gene locus_tag LOCUS_26730 55431 42442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 59618 55353 gene locus_tag LOCUS_26740 59618 55353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 55539 55638 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence031 <1 636 gene locus_tag LOCUS_26750 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009896027.1:histidinol-phosphatase HisJ family protein 1277 927 gene locus_tag LOCUS_26760 1277 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 1433 2077 gene locus_tag LOCUS_26770 1433 2077 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964066.1 protein_id gnl|my_center|LOCUS_26770 2074 2439 gene locus_tag LOCUS_26780 2074 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 2473 3279 gene locus_tag LOCUS_26790 2473 3279 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242998.1 protein_id gnl|my_center|LOCUS_26790 3458 3336 gene locus_tag LOCUS_26800 3458 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 4784 3465 gene locus_tag LOCUS_26810 4784 3465 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017176.1 protein_id gnl|my_center|LOCUS_26810 5372 4911 gene locus_tag LOCUS_26820 5372 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 5691 5509 gene locus_tag LOCUS_26830 5691 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 5953 5714 gene locus_tag LOCUS_26840 5953 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 6614 6030 gene locus_tag LOCUS_26850 6614 6030 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764887.1 protein_id gnl|my_center|LOCUS_26850 7346 6663 gene locus_tag LOCUS_26860 7346 6663 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987124.1 protein_id gnl|my_center|LOCUS_26860 7938 7507 gene locus_tag LOCUS_26870 7938 7507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 8009 8236 gene locus_tag LOCUS_26880 8009 8236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26880 8300 8935 gene locus_tag LOCUS_26890 8300 8935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26890 9073 9486 gene locus_tag LOCUS_26900 9073 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 9946 9530 gene locus_tag LOCUS_26910 9946 9530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 10614 10940 gene locus_tag LOCUS_26920 10614 10940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 12594 11215 gene locus_tag LOCUS_26930 12594 11215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 14013 12619 gene locus_tag LOCUS_26940 14013 12619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 14185 14790 gene locus_tag LOCUS_26950 14185 14790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 15402 14824 gene locus_tag LOCUS_26960 15402 14824 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_26960 15701 16102 gene locus_tag LOCUS_26970 15701 16102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 17719 16397 gene locus_tag LOCUS_26980 17719 16397 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_26980 18467 17733 gene locus_tag LOCUS_26990 18467 17733 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020814.1 protein_id gnl|my_center|LOCUS_26990 18936 19238 gene locus_tag LOCUS_27000 gene ureA 18936 19238 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694143.1 protein_id gnl|my_center|LOCUS_27000 19256 19615 gene locus_tag LOCUS_27010 19256 19615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27010 19628 21349 gene locus_tag LOCUS_27020 gene ureB 19628 21349 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724295.1 protein_id gnl|my_center|LOCUS_27020 21372 21881 gene locus_tag LOCUS_27030 gene ureI 21372 21881 CDS product acid-activated urea channel protein UreI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901247.1 protein_id gnl|my_center|LOCUS_27030 21948 22427 gene locus_tag LOCUS_27040 gene ureE 21948 22427 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583097.1 protein_id gnl|my_center|LOCUS_27040 22547 23278 gene locus_tag LOCUS_27050 22547 23278 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357404.1 protein_id gnl|my_center|LOCUS_27050 23388 23999 gene locus_tag LOCUS_27060 gene ureG 23388 23999 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238762.1 protein_id gnl|my_center|LOCUS_27060 24005 24787 gene locus_tag LOCUS_27070 24005 24787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 25859 25266 gene locus_tag LOCUS_27080 25859 25266 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023233.1 protein_id gnl|my_center|LOCUS_27080 27527 26340 gene locus_tag LOCUS_27090 27527 26340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 28535 27555 gene locus_tag LOCUS_27100 28535 27555 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005975400.1 protein_id gnl|my_center|LOCUS_27100 29328 28525 gene locus_tag LOCUS_27110 29328 28525 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903786.1 protein_id gnl|my_center|LOCUS_27110 30216 29389 gene locus_tag LOCUS_27120 30216 29389 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903784.1 protein_id gnl|my_center|LOCUS_27120 31360 30221 gene locus_tag LOCUS_27130 31360 30221 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015650.1 protein_id gnl|my_center|LOCUS_27130 33201 31654 gene locus_tag LOCUS_27140 33201 31654 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903785.1 protein_id gnl|my_center|LOCUS_27140 33573 33256 gene locus_tag LOCUS_27150 33573 33256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 34010 33576 gene locus_tag LOCUS_27160 34010 33576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 35372 34431 gene locus_tag LOCUS_27170 35372 34431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 35882 35616 gene locus_tag LOCUS_27180 35882 35616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 36738 35986 gene locus_tag LOCUS_27190 36738 35986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 37457 37071 gene locus_tag LOCUS_27200 37457 37071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 38346 37585 gene locus_tag LOCUS_27210 38346 37585 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681078.1 protein_id gnl|my_center|LOCUS_27210 38925 38362 gene locus_tag LOCUS_27220 38925 38362 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_27220 39038 39373 gene locus_tag LOCUS_27230 39038 39373 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420359.1 protein_id gnl|my_center|LOCUS_27230 39772 39500 gene locus_tag LOCUS_27240 39772 39500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 39941 40369 gene locus_tag LOCUS_27250 39941 40369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 41843 40467 gene locus_tag LOCUS_27260 41843 40467 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987111.1 protein_id gnl|my_center|LOCUS_27260 42357 41911 gene locus_tag LOCUS_27270 42357 41911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 44757 42706 gene locus_tag LOCUS_27280 44757 42706 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_27280 47939 44847 gene locus_tag LOCUS_27290 47939 44847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 48315 48004 gene locus_tag LOCUS_27300 48315 48004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 48704 48513 gene locus_tag LOCUS_27310 48704 48513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 48796 49380 gene locus_tag LOCUS_27320 48796 49380 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_27320 49651 49463 gene locus_tag LOCUS_27330 49651 49463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 49985 50188 gene locus_tag LOCUS_27340 49985 50188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 50269 50856 gene locus_tag LOCUS_27350 50269 50856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 50816 51316 gene locus_tag LOCUS_27360 50816 51316 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674090.1 protein_id gnl|my_center|LOCUS_27360 51443 51871 gene locus_tag LOCUS_27370 51443 51871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 53033 52188 gene locus_tag LOCUS_27380 53033 52188 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101946.1 protein_id gnl|my_center|LOCUS_27380 53726 53091 gene locus_tag LOCUS_27390 53726 53091 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459715.1 protein_id gnl|my_center|LOCUS_27390 53888 54436 gene locus_tag LOCUS_27400 53888 54436 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642400.1 protein_id gnl|my_center|LOCUS_27400 55331 54576 gene locus_tag LOCUS_27410 55331 54576 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_27410 >Feature sequence032 369 13 gene locus_tag LOCUS_27420 369 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 927 2033 gene locus_tag LOCUS_27430 927 2033 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 protein_id gnl|my_center|LOCUS_27430 2258 2330 gene locus_tag LOCUS_t00360 2258 2330 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2820 3386 gene locus_tag LOCUS_27440 2820 3386 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924525.1 protein_id gnl|my_center|LOCUS_27440 3722 4468 gene locus_tag LOCUS_27450 3722 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 4594 4693 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5000 5824 gene locus_tag LOCUS_27460 5000 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 6029 7015 gene locus_tag LOCUS_27470 6029 7015 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986367.1 protein_id gnl|my_center|LOCUS_27470 7311 7685 gene locus_tag LOCUS_27480 7311 7685 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_27480 7710 7943 gene locus_tag LOCUS_27490 7710 7943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 8147 11839 gene locus_tag LOCUS_27500 8147 11839 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_27500 11990 12964 gene locus_tag LOCUS_27510 gene pfkA 11990 12964 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_27510 12961 13917 gene locus_tag LOCUS_27520 12961 13917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 13946 14449 gene locus_tag LOCUS_27530 gene greA 13946 14449 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965725.1 protein_id gnl|my_center|LOCUS_27530 14659 14826 gene locus_tag LOCUS_27540 14659 14826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 14882 16801 gene locus_tag LOCUS_27550 gene uvrC 14882 16801 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_27550 16909 17850 gene locus_tag LOCUS_27560 gene hprK 16909 17850 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_27560 18049 18984 gene locus_tag LOCUS_27570 18049 18984 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_27570 19105 19296 gene locus_tag LOCUS_27580 19105 19296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 19611 21266 gene locus_tag LOCUS_27590 19611 21266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 21346 22488 gene locus_tag LOCUS_27600 21346 22488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 22579 23061 gene locus_tag LOCUS_27610 22579 23061 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_27610 23058 24224 gene locus_tag LOCUS_27620 23058 24224 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459619.1 protein_id gnl|my_center|LOCUS_27620 24417 24911 gene locus_tag LOCUS_27630 gene trmL 24417 24911 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016664.1 protein_id gnl|my_center|LOCUS_27630 25564 25196 gene locus_tag LOCUS_27640 25564 25196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 25707 27638 gene locus_tag LOCUS_27650 25707 27638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 27966 28151 gene locus_tag LOCUS_27660 27966 28151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 28167 33239 gene locus_tag LOCUS_27670 28167 33239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 33495 33569 gene locus_tag LOCUS_t00370 33495 33569 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 34940 33708 gene locus_tag LOCUS_27680 34940 33708 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358446.1 protein_id gnl|my_center|LOCUS_27680 35217 35026 gene locus_tag LOCUS_27690 35217 35026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 35276 35479 gene locus_tag LOCUS_27700 35276 35479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 35509 35772 gene locus_tag LOCUS_27710 35509 35772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 37762 36020 gene locus_tag LOCUS_27720 37762 36020 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_27720 38494 39834 gene locus_tag LOCUS_27730 38494 39834 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896573.1 protein_id gnl|my_center|LOCUS_27730 40088 40222 gene locus_tag LOCUS_27740 40088 40222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 40380 40502 gene locus_tag LOCUS_27750 40380 40502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 40734 41894 gene locus_tag LOCUS_27760 40734 41894 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_27760 42014 43342 gene locus_tag LOCUS_27770 gene dsdA 42014 43342 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658347.1 protein_id gnl|my_center|LOCUS_27770 43373 43534 gene locus_tag LOCUS_27780 43373 43534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 43467 44489 gene locus_tag LOCUS_27790 43467 44489 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_27790 45000 46691 gene locus_tag LOCUS_27800 45000 46691 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_27800 48185 47298 gene locus_tag LOCUS_27810 48185 47298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27810 48566 48252 gene locus_tag LOCUS_27820 48566 48252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27820 48895 48710 gene locus_tag LOCUS_27830 48895 48710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 50875 48956 gene locus_tag LOCUS_27840 50875 48956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 51304 51101 gene locus_tag LOCUS_27850 51304 51101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 51503 51288 gene locus_tag LOCUS_27860 51503 51288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 51787 52782 gene locus_tag LOCUS_27870 51787 52782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 52957 54225 gene locus_tag LOCUS_27880 52957 54225 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266386.1 protein_id gnl|my_center|LOCUS_27880 54228 54875 gene locus_tag LOCUS_27890 54228 54875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 >Feature sequence033 520 230 gene locus_tag LOCUS_27900 520 230 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679825.1 protein_id gnl|my_center|LOCUS_27900 1474 713 gene locus_tag LOCUS_27910 1474 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 1773 1522 gene locus_tag LOCUS_27920 1773 1522 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476650.1 protein_id gnl|my_center|LOCUS_27920 1922 1788 gene locus_tag LOCUS_27930 1922 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 2280 1936 gene locus_tag LOCUS_27940 2280 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 3382 2624 gene locus_tag LOCUS_27950 3382 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 3495 4475 gene locus_tag LOCUS_27960 3495 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 4853 5239 gene locus_tag LOCUS_27970 4853 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 6549 5581 gene locus_tag LOCUS_27980 6549 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 6956 9388 gene locus_tag LOCUS_27990 6956 9388 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019639497.1 protein_id gnl|my_center|LOCUS_27990 9892 9473 gene locus_tag LOCUS_28000 9892 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 12008 9903 gene locus_tag LOCUS_28010 12008 9903 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068658.1 protein_id gnl|my_center|LOCUS_28010 13973 12060 gene locus_tag LOCUS_28020 13973 12060 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616027.1 protein_id gnl|my_center|LOCUS_28020 15526 14000 gene locus_tag LOCUS_28030 15526 14000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 16691 15675 gene locus_tag LOCUS_28040 16691 15675 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230210.1 protein_id gnl|my_center|LOCUS_28040 17897 17049 gene locus_tag LOCUS_28050 17897 17049 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_28050 18775 17897 gene locus_tag LOCUS_28060 18775 17897 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582924.1 protein_id gnl|my_center|LOCUS_28060 18902 18753 gene locus_tag LOCUS_28070 18902 18753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 20219 18915 gene locus_tag LOCUS_28080 20219 18915 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582923.1 protein_id gnl|my_center|LOCUS_28080 22169 21039 gene locus_tag LOCUS_28090 22169 21039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 23305 22607 gene locus_tag LOCUS_28100 23305 22607 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_28100 24140 23298 gene locus_tag LOCUS_28110 24140 23298 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262678.1 protein_id gnl|my_center|LOCUS_28110 25216 24137 gene locus_tag LOCUS_28120 25216 24137 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080270.1 protein_id gnl|my_center|LOCUS_28120 26116 25232 gene locus_tag LOCUS_28130 26116 25232 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_28130 27662 26505 gene locus_tag LOCUS_28140 27662 26505 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869387.1 protein_id gnl|my_center|LOCUS_28140 29113 27914 gene locus_tag LOCUS_28150 29113 27914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 30467 29265 gene locus_tag LOCUS_28160 30467 29265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 31470 30622 gene locus_tag LOCUS_28170 31470 30622 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030752.1 protein_id gnl|my_center|LOCUS_28170 32493 31474 gene locus_tag LOCUS_28180 32493 31474 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030753.1 protein_id gnl|my_center|LOCUS_28180 34063 32705 gene locus_tag LOCUS_28190 34063 32705 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030754.1 protein_id gnl|my_center|LOCUS_28190 34519 35463 gene locus_tag LOCUS_28200 34519 35463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 36433 35405 gene locus_tag LOCUS_28210 36433 35405 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852489.1 protein_id gnl|my_center|LOCUS_28210 37245 36442 gene locus_tag LOCUS_28220 37245 36442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 38660 37380 gene locus_tag LOCUS_28230 38660 37380 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_28230 39708 38689 gene locus_tag LOCUS_28240 39708 38689 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052632.1 protein_id gnl|my_center|LOCUS_28240 40504 39881 gene locus_tag LOCUS_28250 40504 39881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 42071 40731 gene locus_tag LOCUS_28260 42071 40731 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_28260 42598 43995 gene locus_tag LOCUS_28270 42598 43995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 44344 44544 gene locus_tag LOCUS_28280 44344 44544 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293303.1 protein_id gnl|my_center|LOCUS_28280 45188 44766 gene locus_tag LOCUS_28290 45188 44766 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902921.1 protein_id gnl|my_center|LOCUS_28290 46317 45370 gene locus_tag LOCUS_28300 46317 45370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 46781 46497 gene locus_tag LOCUS_28310 46781 46497 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890712.1 protein_id gnl|my_center|LOCUS_28310 48414 47158 gene locus_tag LOCUS_28320 48414 47158 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583022.1 protein_id gnl|my_center|LOCUS_28320 48850 49371 gene locus_tag LOCUS_28330 48850 49371 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_28330 49766 49428 gene locus_tag LOCUS_28340 49766 49428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 50741 49842 gene locus_tag LOCUS_28350 50741 49842 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382347.1 protein_id gnl|my_center|LOCUS_28350 53537 51030 gene locus_tag LOCUS_28360 53537 51030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 51524 51623 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence034 1082 768 gene locus_tag LOCUS_28370 1082 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 1371 1072 gene locus_tag LOCUS_28380 1371 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 1827 2636 gene locus_tag LOCUS_28390 1827 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 3117 5888 gene locus_tag LOCUS_28400 3117 5888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 6703 6224 gene locus_tag LOCUS_28410 6703 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 7145 6693 gene locus_tag LOCUS_28420 7145 6693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 9138 7336 gene locus_tag LOCUS_28430 9138 7336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 10312 9212 gene locus_tag LOCUS_28440 gene prfA 10312 9212 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_28440 11465 10428 gene locus_tag LOCUS_28450 gene prmC 11465 10428 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_28450 12787 11642 gene locus_tag LOCUS_28460 12787 11642 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943726.1 protein_id gnl|my_center|LOCUS_28460 13057 12857 gene locus_tag LOCUS_28470 gene rpmE 13057 12857 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966172.1 protein_id gnl|my_center|LOCUS_28470 13958 13374 gene locus_tag LOCUS_28480 13958 13374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894741.1 protein_id gnl|my_center|LOCUS_28480 14143 13955 gene locus_tag LOCUS_28490 14143 13955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 14466 14314 gene locus_tag LOCUS_28500 14466 14314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 14947 14429 gene locus_tag LOCUS_28510 14947 14429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 16529 14928 gene locus_tag LOCUS_28520 16529 14928 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_28520 16957 16721 gene locus_tag LOCUS_28530 16957 16721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 19254 17125 gene locus_tag LOCUS_28540 19254 17125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 19784 20536 gene locus_tag LOCUS_28550 19784 20536 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922420.1 protein_id gnl|my_center|LOCUS_28550 21603 20590 gene locus_tag LOCUS_28560 21603 20590 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721854.1 protein_id gnl|my_center|LOCUS_28560 22562 21648 gene locus_tag LOCUS_28570 gene truA 22562 21648 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_28570 23392 22556 gene locus_tag LOCUS_28580 23392 22556 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_28580 24581 23736 gene locus_tag LOCUS_28590 24581 23736 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_28590 25644 24754 gene locus_tag LOCUS_28600 25644 24754 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_28600 26326 29088 gene locus_tag LOCUS_28610 26326 29088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 29119 30840 gene locus_tag LOCUS_28620 29119 30840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 32220 30922 gene locus_tag LOCUS_28630 32220 30922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 32923 33906 gene locus_tag LOCUS_28640 32923 33906 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682246.1 protein_id gnl|my_center|LOCUS_28640 34906 34145 gene locus_tag LOCUS_28650 gene deoC 34906 34145 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453154.1 protein_id gnl|my_center|LOCUS_28650 36482 35187 gene locus_tag LOCUS_28660 gene kbaZ 36482 35187 CDS product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098887.1 protein_id gnl|my_center|LOCUS_28660 36759 37781 gene locus_tag LOCUS_28670 36759 37781 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976169.1 protein_id gnl|my_center|LOCUS_28670 38580 37801 gene locus_tag LOCUS_28680 38580 37801 CDS product D-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723195.1 protein_id gnl|my_center|LOCUS_28680 39684 38662 gene locus_tag LOCUS_28690 39684 38662 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582778.1 protein_id gnl|my_center|LOCUS_28690 40695 39787 gene locus_tag LOCUS_28700 40695 39787 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707230.1 protein_id gnl|my_center|LOCUS_28700 40810 40589 gene locus_tag LOCUS_28710 40810 40589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 41797 40814 gene locus_tag LOCUS_28720 41797 40814 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573417.1 protein_id gnl|my_center|LOCUS_28720 43301 41787 gene locus_tag LOCUS_28730 43301 41787 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392224.1 protein_id gnl|my_center|LOCUS_28730 44262 43321 gene locus_tag LOCUS_28740 44262 43321 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582777.1 protein_id gnl|my_center|LOCUS_28740 45234 44350 gene locus_tag LOCUS_28750 45234 44350 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974125.1 protein_id gnl|my_center|LOCUS_28750 47592 45871 gene locus_tag LOCUS_28760 47592 45871 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601692.1 protein_id gnl|my_center|LOCUS_28760 48661 47786 gene locus_tag LOCUS_28770 48661 47786 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355144.1 protein_id gnl|my_center|LOCUS_28770 49584 48676 gene locus_tag LOCUS_28780 49584 48676 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949070.1 protein_id gnl|my_center|LOCUS_28780 50857 49739 gene locus_tag LOCUS_28790 50857 49739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 51515 52429 gene locus_tag LOCUS_28800 51515 52429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 >Feature sequence035 270 608 gene locus_tag LOCUS_28810 270 608 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869636.1 protein_id gnl|my_center|LOCUS_28810 598 1017 gene locus_tag LOCUS_28820 598 1017 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393073.1 protein_id gnl|my_center|LOCUS_28820 2617 1103 gene locus_tag LOCUS_28830 2617 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28830 2963 3133 gene locus_tag LOCUS_28840 2963 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 3386 3165 gene locus_tag LOCUS_28850 3386 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 3972 3607 gene locus_tag LOCUS_28860 3972 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28860 4441 3923 gene locus_tag LOCUS_28870 4441 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 4716 4444 gene locus_tag LOCUS_28880 4716 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 5161 4727 gene locus_tag LOCUS_28890 5161 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 5570 5187 gene locus_tag LOCUS_28900 5570 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 6490 5567 gene locus_tag LOCUS_28910 6490 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 6998 6777 gene locus_tag LOCUS_28920 6998 6777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 9091 6962 gene locus_tag LOCUS_28930 9091 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 9429 9644 gene locus_tag LOCUS_28940 9429 9644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 11426 9852 gene locus_tag LOCUS_28950 11426 9852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 9860 9959 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11607 11410 gene locus_tag LOCUS_28960 11607 11410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 12114 11614 gene locus_tag LOCUS_28970 12114 11614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 12500 12138 gene locus_tag LOCUS_28980 12500 12138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 13046 12801 gene locus_tag LOCUS_28990 13046 12801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 13226 13059 gene locus_tag LOCUS_29000 13226 13059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 13879 13247 gene locus_tag LOCUS_29010 13879 13247 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262698.1 protein_id gnl|my_center|LOCUS_29010 14314 13994 gene locus_tag LOCUS_29020 14314 13994 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262697.1 protein_id gnl|my_center|LOCUS_29020 15158 14400 gene locus_tag LOCUS_29030 15158 14400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 17406 15265 gene locus_tag LOCUS_29040 17406 15265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 18211 17561 gene locus_tag LOCUS_29050 18211 17561 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460105.1 protein_id gnl|my_center|LOCUS_29050 19144 18302 gene locus_tag LOCUS_29060 19144 18302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 21070 19379 gene locus_tag LOCUS_29070 21070 19379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 21487 21305 gene locus_tag LOCUS_29080 21487 21305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 22500 21598 gene locus_tag LOCUS_29090 22500 21598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 24256 22667 gene locus_tag LOCUS_29100 24256 22667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 25233 24481 gene locus_tag LOCUS_29110 25233 24481 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_29110 25604 25413 gene locus_tag LOCUS_29120 25604 25413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 26661 25558 gene locus_tag LOCUS_29130 gene tnpB 26661 25558 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861290.1 protein_id gnl|my_center|LOCUS_29130 27042 26677 gene locus_tag LOCUS_29140 gene tnpA 27042 26677 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034376438.1 protein_id gnl|my_center|LOCUS_29140 27319 27131 gene locus_tag LOCUS_29150 27319 27131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 28080 27364 gene locus_tag LOCUS_29160 28080 27364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 28731 28165 gene locus_tag LOCUS_29170 28731 28165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 29169 29699 gene locus_tag LOCUS_29180 29169 29699 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439159.1 protein_id gnl|my_center|LOCUS_29180 29714 31246 gene locus_tag LOCUS_29190 29714 31246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 31458 31952 gene locus_tag LOCUS_29200 31458 31952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 32745 32239 gene locus_tag LOCUS_29210 32745 32239 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964041.1 protein_id gnl|my_center|LOCUS_29210 32893 33033 gene locus_tag LOCUS_29220 32893 33033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 33030 34007 gene locus_tag LOCUS_29230 33030 34007 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815889.1 protein_id gnl|my_center|LOCUS_29230 34022 34948 gene locus_tag LOCUS_29240 34022 34948 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774964.1 protein_id gnl|my_center|LOCUS_29240 35445 35050 gene locus_tag LOCUS_29250 35445 35050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 35877 35545 gene locus_tag LOCUS_29260 35877 35545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 36377 36060 gene locus_tag LOCUS_29270 36377 36060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 36675 36421 gene locus_tag LOCUS_29280 36675 36421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 36827 36675 gene locus_tag LOCUS_29290 36827 36675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 38319 37027 gene locus_tag LOCUS_29300 38319 37027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 39013 38312 gene locus_tag LOCUS_29310 39013 38312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 39226 39837 gene locus_tag LOCUS_29320 39226 39837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 40144 40350 gene locus_tag LOCUS_29330 40144 40350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 42895 40517 gene locus_tag LOCUS_29340 42895 40517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 44242 43049 gene locus_tag LOCUS_29350 44242 43049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 45849 44239 gene locus_tag LOCUS_29360 45849 44239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 46749 45904 gene locus_tag LOCUS_29370 46749 45904 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963985.1 protein_id gnl|my_center|LOCUS_29370 47392 46778 gene locus_tag LOCUS_29380 47392 46778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 47729 47541 gene locus_tag LOCUS_29390 47729 47541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 48073 48756 gene locus_tag LOCUS_29400 48073 48756 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238594.1 protein_id gnl|my_center|LOCUS_29400 48757 50064 gene locus_tag LOCUS_29410 48757 50064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 50364 50513 gene locus_tag LOCUS_29420 50364 50513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 50839 51651 gene locus_tag LOCUS_29430 50839 51651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 52261 51971 gene locus_tag LOCUS_29440 52261 51971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 >Feature sequence036 141 908 gene locus_tag LOCUS_29450 141 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 2298 1009 gene locus_tag LOCUS_29460 2298 1009 CDS product M20 peptidase aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157892.1 protein_id gnl|my_center|LOCUS_29460 3491 2451 gene locus_tag LOCUS_29470 3491 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 4448 3501 gene locus_tag LOCUS_29480 4448 3501 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678777.1 protein_id gnl|my_center|LOCUS_29480 5583 4441 gene locus_tag LOCUS_29490 5583 4441 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_29490 6724 5741 gene locus_tag LOCUS_29500 6724 5741 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034325.1 protein_id gnl|my_center|LOCUS_29500 8459 6855 gene locus_tag LOCUS_29510 8459 6855 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384717.1 protein_id gnl|my_center|LOCUS_29510 8835 9512 gene locus_tag LOCUS_29520 8835 9512 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459616.1 protein_id gnl|my_center|LOCUS_29520 9537 10715 gene locus_tag LOCUS_29530 9537 10715 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080839.1 protein_id gnl|my_center|LOCUS_29530 10960 12243 gene locus_tag LOCUS_29540 10960 12243 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_29540 12413 13168 gene locus_tag LOCUS_29550 12413 13168 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_29550 13554 14630 gene locus_tag LOCUS_29560 gene cytR 13554 14630 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224452.1 protein_id gnl|my_center|LOCUS_29560 14627 15847 gene locus_tag LOCUS_29570 14627 15847 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390206.1 protein_id gnl|my_center|LOCUS_29570 16160 18235 gene locus_tag LOCUS_29580 16160 18235 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114166.1 protein_id gnl|my_center|LOCUS_29580 18380 19405 gene locus_tag LOCUS_29590 18380 19405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 19512 21803 gene locus_tag LOCUS_29600 19512 21803 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022605.1 protein_id gnl|my_center|LOCUS_29600 21946 22755 gene locus_tag LOCUS_29610 21946 22755 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931033.1 protein_id gnl|my_center|LOCUS_29610 22875 23870 gene locus_tag LOCUS_29620 22875 23870 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_29620 23892 25175 gene locus_tag LOCUS_29630 23892 25175 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150981032.1 protein_id gnl|my_center|LOCUS_29630 25346 26005 gene locus_tag LOCUS_29640 25346 26005 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384107.1 protein_id gnl|my_center|LOCUS_29640 25986 26675 gene locus_tag LOCUS_29650 25986 26675 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154147.1 protein_id gnl|my_center|LOCUS_29650 26677 27444 gene locus_tag LOCUS_29660 26677 27444 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005000.1 protein_id gnl|my_center|LOCUS_29660 27637 28524 gene locus_tag LOCUS_29670 27637 28524 CDS product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056925.1 protein_id gnl|my_center|LOCUS_29670 28698 29858 gene locus_tag LOCUS_29680 28698 29858 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963712.1 protein_id gnl|my_center|LOCUS_29680 30055 31269 gene locus_tag LOCUS_29690 30055 31269 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966253.1 protein_id gnl|my_center|LOCUS_29690 31517 32788 gene locus_tag LOCUS_29700 31517 32788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 33140 34639 gene locus_tag LOCUS_29710 33140 34639 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_29710 34680 35468 gene locus_tag LOCUS_29720 34680 35468 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014636209.1 protein_id gnl|my_center|LOCUS_29720 35444 36235 gene locus_tag LOCUS_29730 35444 36235 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775424.1 protein_id gnl|my_center|LOCUS_29730 36431 37432 gene locus_tag LOCUS_29740 36431 37432 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921803.1 protein_id gnl|my_center|LOCUS_29740 37676 38287 gene locus_tag LOCUS_29750 37676 38287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 38478 40016 gene locus_tag LOCUS_29760 38478 40016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 40316 41506 gene locus_tag LOCUS_29770 40316 41506 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_29770 41547 42743 gene locus_tag LOCUS_29780 41547 42743 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094666698.1 protein_id gnl|my_center|LOCUS_29780 43204 42824 gene locus_tag LOCUS_29790 43204 42824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 43497 43159 gene locus_tag LOCUS_29800 43497 43159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 43672 43944 gene locus_tag LOCUS_29810 43672 43944 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666876.1 protein_id gnl|my_center|LOCUS_29810 43941 44345 gene locus_tag LOCUS_29820 43941 44345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956671.1 protein_id gnl|my_center|LOCUS_29820 45572 45021 gene locus_tag LOCUS_29830 45572 45021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 47068 45686 gene locus_tag LOCUS_29840 47068 45686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 47517 47068 gene locus_tag LOCUS_29850 47517 47068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 47837 47986 gene locus_tag LOCUS_29860 47837 47986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 48093 48395 gene locus_tag LOCUS_29870 48093 48395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 48385 48993 gene locus_tag LOCUS_29880 48385 48993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 50283 49528 gene locus_tag LOCUS_29890 50283 49528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 50777 50286 gene locus_tag LOCUS_29900 gene sigX 50777 50286 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230521.1 protein_id gnl|my_center|LOCUS_29900 >Feature sequence037 608 1993 gene locus_tag LOCUS_29910 608 1993 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016772.1 protein_id gnl|my_center|LOCUS_29910 1983 2585 gene locus_tag LOCUS_29920 1983 2585 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_29920 2669 2812 gene locus_tag LOCUS_29930 2669 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 2833 3162 gene locus_tag LOCUS_29940 2833 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 3388 6903 gene locus_tag LOCUS_29950 3388 6903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 7201 8805 gene locus_tag LOCUS_29960 7201 8805 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_29960 9972 9118 gene locus_tag LOCUS_29970 gene dapF 9972 9118 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_29970 11159 10374 gene locus_tag LOCUS_29980 11159 10374 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258574.1 protein_id gnl|my_center|LOCUS_29980 11833 11270 gene locus_tag LOCUS_29990 11833 11270 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_29990 12131 11913 gene locus_tag LOCUS_30000 12131 11913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 12257 15328 gene locus_tag LOCUS_30010 12257 15328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 15695 16069 gene locus_tag LOCUS_30020 15695 16069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 16076 16588 gene locus_tag LOCUS_30030 16076 16588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 16536 17597 gene locus_tag LOCUS_30040 16536 17597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 17832 18590 gene locus_tag LOCUS_30050 17832 18590 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263190.1 protein_id gnl|my_center|LOCUS_30050 18916 18776 gene locus_tag LOCUS_30060 18916 18776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 19067 20626 gene locus_tag LOCUS_30070 19067 20626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 20623 24243 gene locus_tag LOCUS_30080 20623 24243 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027705.1 protein_id gnl|my_center|LOCUS_30080 24681 26300 gene locus_tag LOCUS_30090 24681 26300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 26447 26821 gene locus_tag LOCUS_30100 26447 26821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 26857 27036 gene locus_tag LOCUS_30110 26857 27036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 27088 28506 gene locus_tag LOCUS_30120 27088 28506 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_30120 29025 28543 gene locus_tag LOCUS_30130 29025 28543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 29504 29884 gene locus_tag LOCUS_30140 29504 29884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 29868 31157 gene locus_tag LOCUS_30150 29868 31157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 31247 32467 gene locus_tag LOCUS_30160 31247 32467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 32599 32841 gene locus_tag LOCUS_30170 32599 32841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 32828 33160 gene locus_tag LOCUS_30180 32828 33160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 33520 33657 gene locus_tag LOCUS_30190 33520 33657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 33659 36592 gene locus_tag LOCUS_30200 33659 36592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30200 36468 36567 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36616 39684 gene locus_tag LOCUS_30210 36616 39684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30210 42256 40112 gene locus_tag LOCUS_30220 42256 40112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 43863 42253 gene locus_tag LOCUS_30230 43863 42253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 46072 43898 gene locus_tag LOCUS_30240 46072 43898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 46716 46069 gene locus_tag LOCUS_30250 46716 46069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 47922 47494 gene locus_tag LOCUS_30260 47922 47494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 48097 48282 gene locus_tag LOCUS_30270 48097 48282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 <50551 49548 gene locus_tag LOCUS_30280 <50551 49548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157860391.1:leucine-rich repeat protein >Feature sequence038 908 201 gene locus_tag LOCUS_30290 908 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 1101 1421 gene locus_tag LOCUS_30300 1101 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 2312 1776 gene locus_tag LOCUS_30310 gene pgsA 2312 1776 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965120.1 protein_id gnl|my_center|LOCUS_30310 3702 2296 gene locus_tag LOCUS_30320 gene rimO 3702 2296 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986784.1 protein_id gnl|my_center|LOCUS_30320 4862 3699 gene locus_tag LOCUS_30330 4862 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 5447 5184 gene locus_tag LOCUS_30340 5447 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 6225 5587 gene locus_tag LOCUS_30350 gene gmk 6225 5587 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263045.1 protein_id gnl|my_center|LOCUS_30350 6828 6508 gene locus_tag LOCUS_30360 6828 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 7825 6947 gene locus_tag LOCUS_30370 7825 6947 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_30370 13217 8253 gene locus_tag LOCUS_30380 13217 8253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 14891 13626 gene locus_tag LOCUS_30390 14891 13626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 15257 15859 gene locus_tag LOCUS_30400 15257 15859 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166986.1 protein_id gnl|my_center|LOCUS_30400 15863 16870 gene locus_tag LOCUS_30410 15863 16870 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013448020.1 protein_id gnl|my_center|LOCUS_30410 18223 16910 gene locus_tag LOCUS_30420 18223 16910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 18661 18386 gene locus_tag LOCUS_30430 18661 18386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 19226 18774 gene locus_tag LOCUS_30440 19226 18774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 21251 19497 gene locus_tag LOCUS_30450 21251 19497 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_30450 23322 21493 gene locus_tag LOCUS_30460 gene pepV 23322 21493 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371462.1 protein_id gnl|my_center|LOCUS_30460 24281 23337 gene locus_tag LOCUS_30470 24281 23337 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968826.1 protein_id gnl|my_center|LOCUS_30470 25739 24435 gene locus_tag LOCUS_30480 25739 24435 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_30480 27412 26039 gene locus_tag LOCUS_30490 27412 26039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 29049 27487 gene locus_tag LOCUS_30500 29049 27487 CDS product MBOAT family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035887521.1 protein_id gnl|my_center|LOCUS_30500 30160 29231 gene locus_tag LOCUS_30510 30160 29231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 31940 30408 gene locus_tag LOCUS_30520 31940 30408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 33199 32321 gene locus_tag LOCUS_30530 33199 32321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 34649 33216 gene locus_tag LOCUS_30540 gene gatB 34649 33216 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_30540 36312 34651 gene locus_tag LOCUS_30550 gene gatA 36312 34651 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_30550 36843 36550 gene locus_tag LOCUS_30560 gene gatC 36843 36550 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_30560 38469 37072 gene locus_tag LOCUS_30570 38469 37072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 40110 38779 gene locus_tag LOCUS_30580 gene aspS 40110 38779 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948698.1 protein_id gnl|my_center|LOCUS_30580 40888 41067 gene locus_tag LOCUS_30590 40888 41067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 47797 41267 gene locus_tag LOCUS_30600 47797 41267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 48394 48534 gene locus_tag LOCUS_30610 48394 48534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 48522 48794 gene locus_tag LOCUS_30620 48522 48794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30620 >Feature sequence039 1104 511 gene locus_tag LOCUS_30630 1104 511 CDS product Abortive infection protein AbiEi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072726816.1 protein_id gnl|my_center|LOCUS_30630 3081 1702 gene locus_tag LOCUS_30640 3081 1702 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964224.1 protein_id gnl|my_center|LOCUS_30640 3358 3056 gene locus_tag LOCUS_30650 3358 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 4134 3409 gene locus_tag LOCUS_30660 4134 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 5478 4264 gene locus_tag LOCUS_30670 5478 4264 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461084.1 protein_id gnl|my_center|LOCUS_30670 6767 5655 gene locus_tag LOCUS_30680 6767 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 7443 6892 gene locus_tag LOCUS_30690 7443 6892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 9144 7813 gene locus_tag LOCUS_30700 gene glnA 9144 7813 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392811.1 protein_id gnl|my_center|LOCUS_30700 11142 9493 gene locus_tag LOCUS_30710 11142 9493 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_30710 12556 11537 gene locus_tag LOCUS_30720 gene yjfF 12556 11537 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704198.1 protein_id gnl|my_center|LOCUS_30720 13622 12558 gene locus_tag LOCUS_30730 13622 12558 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 protein_id gnl|my_center|LOCUS_30730 15135 13615 gene locus_tag LOCUS_30740 15135 13615 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_30740 16425 15415 gene locus_tag LOCUS_30750 16425 15415 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877170.1 protein_id gnl|my_center|LOCUS_30750 16882 18057 gene locus_tag LOCUS_30760 gene araR 16882 18057 CDS product arabinose utilization transcriptional regulator AraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243070.1 protein_id gnl|my_center|LOCUS_30760 19186 18155 gene locus_tag LOCUS_30770 19186 18155 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877170.1 protein_id gnl|my_center|LOCUS_30770 20980 19493 gene locus_tag LOCUS_30780 20980 19493 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288002.1 protein_id gnl|my_center|LOCUS_30780 22645 21002 gene locus_tag LOCUS_30790 22645 21002 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_30790 22791 22639 gene locus_tag LOCUS_30800 22791 22639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 25444 22775 gene locus_tag LOCUS_30810 25444 22775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 25861 25960 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26056 26553 gene locus_tag LOCUS_30820 26056 26553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 27649 26669 gene locus_tag LOCUS_30830 27649 26669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 28722 27661 gene locus_tag LOCUS_30840 gene hisC 28722 27661 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905826.1 protein_id gnl|my_center|LOCUS_30840 29764 28937 gene locus_tag LOCUS_30850 29764 28937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 31768 30041 gene locus_tag LOCUS_30860 31768 30041 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_30860 33507 32113 gene locus_tag LOCUS_30870 gene glmM 33507 32113 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234946.1 protein_id gnl|my_center|LOCUS_30870 34425 33655 gene locus_tag LOCUS_30880 gene rlmB 34425 33655 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_30880 34899 34447 gene locus_tag LOCUS_30890 34899 34447 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293091.1 protein_id gnl|my_center|LOCUS_30890 36529 35006 gene locus_tag LOCUS_30900 gene cysS 36529 35006 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399682.1 protein_id gnl|my_center|LOCUS_30900 37272 36688 gene locus_tag LOCUS_30910 gene ispF 37272 36688 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963756.1 protein_id gnl|my_center|LOCUS_30910 38467 37310 gene locus_tag LOCUS_30920 38467 37310 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_30920 39659 38715 gene locus_tag LOCUS_30930 39659 38715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 40061 39939 gene locus_tag LOCUS_30940 40061 39939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 40617 41429 gene locus_tag LOCUS_30950 40617 41429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 41573 41728 gene locus_tag LOCUS_30960 41573 41728 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670545.1 protein_id gnl|my_center|LOCUS_30960 42476 41838 gene locus_tag LOCUS_30970 gene pgmB 42476 41838 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965902.1 protein_id gnl|my_center|LOCUS_30970 44103 42883 gene locus_tag LOCUS_30980 44103 42883 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101954.1 protein_id gnl|my_center|LOCUS_30980 44980 44132 gene locus_tag LOCUS_30990 44980 44132 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101955.1 protein_id gnl|my_center|LOCUS_30990 46906 45005 gene locus_tag LOCUS_31000 46906 45005 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257959.1 protein_id gnl|my_center|LOCUS_31000 49185 46897 gene locus_tag LOCUS_31010 49185 46897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 >Feature sequence040 2787 1852 gene locus_tag LOCUS_31020 2787 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 5067 2815 gene locus_tag LOCUS_31030 5067 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 5364 5702 gene locus_tag LOCUS_31040 5364 5702 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435155.1 protein_id gnl|my_center|LOCUS_31040 6082 5873 gene locus_tag LOCUS_31050 6082 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 6744 8090 gene locus_tag LOCUS_31060 6744 8090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 8233 9597 gene locus_tag LOCUS_31070 8233 9597 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989529.1 protein_id gnl|my_center|LOCUS_31070 10070 9609 gene locus_tag LOCUS_31080 10070 9609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 10609 10253 gene locus_tag LOCUS_31090 10609 10253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 11520 10606 gene locus_tag LOCUS_31100 11520 10606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 12158 11805 gene locus_tag LOCUS_31110 12158 11805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 12435 12178 gene locus_tag LOCUS_31120 12435 12178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31120 12650 12522 gene locus_tag LOCUS_31130 12650 12522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 13171 13098 gene locus_tag LOCUS_t00380 13171 13098 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 13410 14876 gene locus_tag LOCUS_31140 13410 14876 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427657.1 protein_id gnl|my_center|LOCUS_31140 17825 15657 gene locus_tag LOCUS_31150 17825 15657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 18156 17974 gene locus_tag LOCUS_31160 18156 17974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 18481 19029 gene locus_tag LOCUS_31170 gene spoVT 18481 19029 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_31170 19218 19290 gene locus_tag LOCUS_t00390 19218 19290 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 20133 19717 gene locus_tag LOCUS_31180 20133 19717 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393073.1 protein_id gnl|my_center|LOCUS_31180 20482 20123 gene locus_tag LOCUS_31190 20482 20123 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080550.1 protein_id gnl|my_center|LOCUS_31190 20806 20504 gene locus_tag LOCUS_31200 20806 20504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 22586 20910 gene locus_tag LOCUS_31210 22586 20910 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_31210 22846 22667 gene locus_tag LOCUS_31220 22846 22667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 23591 22887 gene locus_tag LOCUS_31230 23591 22887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 24068 23730 gene locus_tag LOCUS_31240 24068 23730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 24743 24168 gene locus_tag LOCUS_31250 24743 24168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 25444 24794 gene locus_tag LOCUS_31260 25444 24794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 25826 25431 gene locus_tag LOCUS_31270 25826 25431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 26215 25823 gene locus_tag LOCUS_31280 26215 25823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 26737 26405 gene locus_tag LOCUS_31290 26737 26405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 27140 26793 gene locus_tag LOCUS_31300 27140 26793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 28146 27166 gene locus_tag LOCUS_31310 28146 27166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 29131 28184 gene locus_tag LOCUS_31320 29131 28184 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398673.1 protein_id gnl|my_center|LOCUS_31320 29542 29318 gene locus_tag LOCUS_31330 29542 29318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 30632 29700 gene locus_tag LOCUS_31340 30632 29700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 30841 31098 gene locus_tag LOCUS_31350 30841 31098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 33327 31393 gene locus_tag LOCUS_31360 33327 31393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 33568 33413 gene locus_tag LOCUS_31370 33568 33413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 34016 34237 gene locus_tag LOCUS_31380 34016 34237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 34723 34379 gene locus_tag LOCUS_31390 34723 34379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 35250 34720 gene locus_tag LOCUS_31400 35250 34720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 35549 35238 gene locus_tag LOCUS_31410 35549 35238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 35731 35952 gene locus_tag LOCUS_31420 35731 35952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 35955 36149 gene locus_tag LOCUS_31430 35955 36149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 36976 36335 gene locus_tag LOCUS_31440 36976 36335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 37264 39894 gene locus_tag LOCUS_31450 37264 39894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 41464 40289 gene locus_tag LOCUS_31460 41464 40289 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 protein_id gnl|my_center|LOCUS_31460 41763 41536 gene locus_tag LOCUS_31470 41763 41536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 42806 41778 gene locus_tag LOCUS_31480 42806 41778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 43926 42742 gene locus_tag LOCUS_31490 43926 42742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 44659 43913 gene locus_tag LOCUS_31500 44659 43913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 45015 46601 gene locus_tag LOCUS_31510 45015 46601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 46858 46787 gene locus_tag LOCUS_t00400 46858 46787 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 47052 46979 gene locus_tag LOCUS_t00410 47052 46979 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence041 911 264 gene locus_tag LOCUS_31520 911 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 1608 967 gene locus_tag LOCUS_31530 1608 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 3408 1630 gene locus_tag LOCUS_31540 3408 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 4000 3380 gene locus_tag LOCUS_31550 4000 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 6302 4008 gene locus_tag LOCUS_31560 6302 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 6454 6299 gene locus_tag LOCUS_31570 6454 6299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 6578 6414 gene locus_tag LOCUS_31580 6578 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 7719 6682 gene locus_tag LOCUS_31590 7719 6682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 8656 7697 gene locus_tag LOCUS_31600 8656 7697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 9862 8684 gene locus_tag LOCUS_31610 9862 8684 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389911.1 protein_id gnl|my_center|LOCUS_31610 11117 9930 gene locus_tag LOCUS_31620 11117 9930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 12034 11234 gene locus_tag LOCUS_31630 12034 11234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 12288 12085 gene locus_tag LOCUS_31640 12288 12085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 13475 12330 gene locus_tag LOCUS_31650 13475 12330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 16052 13656 gene locus_tag LOCUS_31660 16052 13656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 16584 16375 gene locus_tag LOCUS_31670 16584 16375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 17307 16792 gene locus_tag LOCUS_31680 17307 16792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 18233 17286 gene locus_tag LOCUS_31690 18233 17286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 19269 18250 gene locus_tag LOCUS_31700 19269 18250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 19627 19262 gene locus_tag LOCUS_31710 19627 19262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 20444 19641 gene locus_tag LOCUS_31720 20444 19641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 21201 20437 gene locus_tag LOCUS_31730 21201 20437 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877622.1 protein_id gnl|my_center|LOCUS_31730 22329 21529 gene locus_tag LOCUS_31740 22329 21529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 22955 22380 gene locus_tag LOCUS_31750 gene rfbC 22955 22380 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877392.1 protein_id gnl|my_center|LOCUS_31750 23872 22976 gene locus_tag LOCUS_31760 23872 22976 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987005.1 protein_id gnl|my_center|LOCUS_31760 24855 23869 gene locus_tag LOCUS_31770 24855 23869 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_31770 25913 24852 gene locus_tag LOCUS_31780 gene rfbG 25913 24852 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167723.1 protein_id gnl|my_center|LOCUS_31780 26696 25917 gene locus_tag LOCUS_31790 gene rfbF 26696 25917 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816687.1 protein_id gnl|my_center|LOCUS_31790 27888 26851 gene locus_tag LOCUS_31800 27888 26851 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986974.1 protein_id gnl|my_center|LOCUS_31800 29509 27908 gene locus_tag LOCUS_31810 29509 27908 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986975.1 protein_id gnl|my_center|LOCUS_31810 30162 29536 gene locus_tag LOCUS_31820 30162 29536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 30275 30451 gene locus_tag LOCUS_31830 30275 30451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 30441 30626 gene locus_tag LOCUS_31840 30441 30626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 32220 30994 gene locus_tag LOCUS_31850 32220 30994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986976.1 protein_id gnl|my_center|LOCUS_31850 33382 32255 gene locus_tag LOCUS_31860 33382 32255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779455.1 protein_id gnl|my_center|LOCUS_31860 34257 33439 gene locus_tag LOCUS_31870 34257 33439 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837622.1 protein_id gnl|my_center|LOCUS_31870 35001 34330 gene locus_tag LOCUS_31880 35001 34330 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202264.1 protein_id gnl|my_center|LOCUS_31880 35902 35018 gene locus_tag LOCUS_31890 35902 35018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 37176 35899 gene locus_tag LOCUS_31900 37176 35899 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280808.1 protein_id gnl|my_center|LOCUS_31900 38558 37224 gene locus_tag LOCUS_31910 38558 37224 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166162679.1 protein_id gnl|my_center|LOCUS_31910 39248 38577 gene locus_tag LOCUS_31920 39248 38577 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403380.1 protein_id gnl|my_center|LOCUS_31920 40060 39245 gene locus_tag LOCUS_31930 40060 39245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 41946 40132 gene locus_tag LOCUS_31940 41946 40132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 42651 42046 gene locus_tag LOCUS_31950 42651 42046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 43277 42657 gene locus_tag LOCUS_31960 43277 42657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 45146 43332 gene locus_tag LOCUS_31970 45146 43332 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_31970 45895 45629 gene locus_tag LOCUS_31980 45895 45629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 >Feature sequence042 426 1016 gene locus_tag LOCUS_31990 426 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 1003 1581 gene locus_tag LOCUS_32000 1003 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 1584 1910 gene locus_tag LOCUS_32010 1584 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 1903 2868 gene locus_tag LOCUS_32020 1903 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 3034 3411 gene locus_tag LOCUS_32030 3034 3411 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_32030 3411 4916 gene locus_tag LOCUS_32040 3411 4916 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_32040 4942 6666 gene locus_tag LOCUS_32050 4942 6666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 6938 8791 gene locus_tag LOCUS_32060 6938 8791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 8305 8404 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8833 11367 gene locus_tag LOCUS_32070 8833 11367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 11668 14379 gene locus_tag LOCUS_32080 11668 14379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 16795 14399 gene locus_tag LOCUS_32090 16795 14399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 17088 17861 gene locus_tag LOCUS_32100 17088 17861 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_32100 17879 18742 gene locus_tag LOCUS_32110 gene rsmA 17879 18742 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129621.1 protein_id gnl|my_center|LOCUS_32110 18809 19816 gene locus_tag LOCUS_32120 gene asnA 18809 19816 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549578.1 protein_id gnl|my_center|LOCUS_32120 22152 20047 gene locus_tag LOCUS_32130 22152 20047 CDS product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271984.1 protein_id gnl|my_center|LOCUS_32130 22518 24797 gene locus_tag LOCUS_32140 gene lon 22518 24797 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963778.1 protein_id gnl|my_center|LOCUS_32140 25377 24823 gene locus_tag LOCUS_32150 gene cobO 25377 24823 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867207.1 protein_id gnl|my_center|LOCUS_32150 26408 25554 gene locus_tag LOCUS_32160 26408 25554 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_32160 26668 27738 gene locus_tag LOCUS_32170 26668 27738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 28093 28800 gene locus_tag LOCUS_32180 gene deoD 28093 28800 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829961.1 protein_id gnl|my_center|LOCUS_32180 28903 30078 gene locus_tag LOCUS_32190 28903 30078 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_32190 30283 30702 gene locus_tag LOCUS_32200 30283 30702 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357963.1 protein_id gnl|my_center|LOCUS_32200 31031 32347 gene locus_tag LOCUS_32210 31031 32347 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082160.1 protein_id gnl|my_center|LOCUS_32210 32375 34072 gene locus_tag LOCUS_32220 32375 34072 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_32220 34082 34774 gene locus_tag LOCUS_32230 34082 34774 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840898.1 protein_id gnl|my_center|LOCUS_32230 35423 36715 gene locus_tag LOCUS_32240 35423 36715 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966804.1 protein_id gnl|my_center|LOCUS_32240 40196 37884 gene locus_tag LOCUS_32250 gene ggaB 40196 37884 CDS product poly(glucosyl N-acetylgalactosamine 1-phosphate) glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227939.1 protein_id gnl|my_center|LOCUS_32250 40152 40334 gene locus_tag LOCUS_32260 40152 40334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 40838 43930 gene locus_tag LOCUS_32270 40838 43930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 44118 44729 gene locus_tag LOCUS_32280 44118 44729 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_32280 >Feature sequence043 3 77 gene locus_tag LOCUS_t00420 3 77 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 635 892 gene locus_tag LOCUS_32290 635 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 968 1819 gene locus_tag LOCUS_32300 968 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 1816 2649 gene locus_tag LOCUS_32310 1816 2649 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047835.1 protein_id gnl|my_center|LOCUS_32310 2713 3546 gene locus_tag LOCUS_32320 2713 3546 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355976.1 protein_id gnl|my_center|LOCUS_32320 3922 4905 gene locus_tag LOCUS_32330 3922 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 4944 5447 gene locus_tag LOCUS_32340 4944 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 5447 12643 gene locus_tag LOCUS_32350 5447 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 12802 12993 gene locus_tag LOCUS_32360 12802 12993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 13320 13535 gene locus_tag LOCUS_32370 13320 13535 CDS product Maff2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610321.1 protein_id gnl|my_center|LOCUS_32370 13618 14484 gene locus_tag LOCUS_32380 13618 14484 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610323.1 protein_id gnl|my_center|LOCUS_32380 14503 14970 gene locus_tag LOCUS_32390 14503 14970 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861115.1 protein_id gnl|my_center|LOCUS_32390 14858 16942 gene locus_tag LOCUS_32400 14858 16942 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_32400 16954 22086 gene locus_tag LOCUS_32410 16954 22086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 22086 22424 gene locus_tag LOCUS_32420 gene mobC 22086 22424 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368707.1 protein_id gnl|my_center|LOCUS_32420 22551 22844 gene locus_tag LOCUS_32430 22551 22844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 22887 23153 gene locus_tag LOCUS_32440 22887 23153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 23238 23387 gene locus_tag LOCUS_32450 23238 23387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 23537 23740 gene locus_tag LOCUS_32460 23537 23740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 23798 24511 gene locus_tag LOCUS_32470 23798 24511 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760196.1 protein_id gnl|my_center|LOCUS_32470 24894 26348 gene locus_tag LOCUS_32480 24894 26348 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 protein_id gnl|my_center|LOCUS_32480 26655 26434 gene locus_tag LOCUS_32490 26655 26434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 27439 26684 gene locus_tag LOCUS_32500 27439 26684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 27933 27442 gene locus_tag LOCUS_32510 gene sigX 27933 27442 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230521.1 protein_id gnl|my_center|LOCUS_32510 28225 29277 gene locus_tag LOCUS_32520 28225 29277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 29274 29699 gene locus_tag LOCUS_32530 29274 29699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 29744 30022 gene locus_tag LOCUS_32540 29744 30022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 31175 30171 gene locus_tag LOCUS_32550 31175 30171 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089142.1 protein_id gnl|my_center|LOCUS_32550 31487 32374 gene locus_tag LOCUS_32560 31487 32374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 32429 33304 gene locus_tag LOCUS_32570 32429 33304 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286319.1 protein_id gnl|my_center|LOCUS_32570 33416 34534 gene locus_tag LOCUS_32580 33416 34534 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705577.1 protein_id gnl|my_center|LOCUS_32580 35081 37813 gene locus_tag LOCUS_32590 35081 37813 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_32590 37847 38092 gene locus_tag LOCUS_32600 37847 38092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 39116 38316 gene locus_tag LOCUS_32610 39116 38316 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458995.1 protein_id gnl|my_center|LOCUS_32610 39398 39688 gene locus_tag LOCUS_32620 39398 39688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 39828 40025 gene locus_tag LOCUS_32630 39828 40025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 40022 40219 gene locus_tag LOCUS_32640 40022 40219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 40216 41880 gene locus_tag LOCUS_32650 40216 41880 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248185.1 protein_id gnl|my_center|LOCUS_32650 41898 42212 gene locus_tag LOCUS_32660 41898 42212 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396712.1 protein_id gnl|my_center|LOCUS_32660 42443 44044 gene locus_tag LOCUS_32670 42443 44044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 >Feature sequence044 1215 205 gene locus_tag LOCUS_32680 1215 205 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547992.1 protein_id gnl|my_center|LOCUS_32680 2395 1346 gene locus_tag LOCUS_32690 gene gatD 2395 1346 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844177.1 protein_id gnl|my_center|LOCUS_32690 4026 2500 gene locus_tag LOCUS_32700 gene xylB 4026 2500 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_32700 5264 4242 gene locus_tag LOCUS_32710 5264 4242 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_32710 6422 5562 gene locus_tag LOCUS_32720 6422 5562 CDS product tagatose-bisphosphate aldolase subunit GatY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861804.1 protein_id gnl|my_center|LOCUS_32720 8915 6960 gene locus_tag LOCUS_32730 8915 6960 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671107.1 protein_id gnl|my_center|LOCUS_32730 10747 8909 gene locus_tag LOCUS_32740 10747 8909 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679271.1 protein_id gnl|my_center|LOCUS_32740 11404 12393 gene locus_tag LOCUS_32750 11404 12393 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_32750 12515 13186 gene locus_tag LOCUS_32760 12515 13186 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_32760 13183 13773 gene locus_tag LOCUS_32770 13183 13773 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337595.1 protein_id gnl|my_center|LOCUS_32770 13952 13770 gene locus_tag LOCUS_32780 13952 13770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 14100 13972 gene locus_tag LOCUS_32790 14100 13972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 14714 14100 gene locus_tag LOCUS_32800 14714 14100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 15177 14641 gene locus_tag LOCUS_32810 15177 14641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 17146 15317 gene locus_tag LOCUS_32820 17146 15317 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_32820 18206 17430 gene locus_tag LOCUS_32830 gene trpA 18206 17430 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966434.1 protein_id gnl|my_center|LOCUS_32830 19380 18199 gene locus_tag LOCUS_32840 gene trpB 19380 18199 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 protein_id gnl|my_center|LOCUS_32840 20215 19469 gene locus_tag LOCUS_32850 20215 19469 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460913.1 protein_id gnl|my_center|LOCUS_32850 21118 20237 gene locus_tag LOCUS_32860 21118 20237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 22153 21143 gene locus_tag LOCUS_32870 gene trpD 22153 21143 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_32870 22977 22276 gene locus_tag LOCUS_32880 22977 22276 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601934.1 protein_id gnl|my_center|LOCUS_32880 24467 22974 gene locus_tag LOCUS_32890 gene trpE 24467 22974 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_32890 25599 25003 gene locus_tag LOCUS_32900 25599 25003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 26013 25768 gene locus_tag LOCUS_32910 26013 25768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 29000 25992 gene locus_tag LOCUS_32920 29000 25992 CDS product bifunctional fucokinase/fucose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202940.1 protein_id gnl|my_center|LOCUS_32920 30032 29223 gene locus_tag LOCUS_32930 30032 29223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 31440 30016 gene locus_tag LOCUS_32940 31440 30016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 33104 31521 gene locus_tag LOCUS_32950 33104 31521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 33929 33549 gene locus_tag LOCUS_32960 33929 33549 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287076.1 protein_id gnl|my_center|LOCUS_32960 34809 34273 gene locus_tag LOCUS_32970 34809 34273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 35840 35253 gene locus_tag LOCUS_32980 35840 35253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 37166 36147 gene locus_tag LOCUS_32990 37166 36147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 37757 37404 gene locus_tag LOCUS_33000 37757 37404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 >Feature sequence045 171 803 gene locus_tag LOCUS_33010 171 803 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948818.1 protein_id gnl|my_center|LOCUS_33010 937 1794 gene locus_tag LOCUS_33020 937 1794 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902122.1 protein_id gnl|my_center|LOCUS_33020 2038 2304 gene locus_tag LOCUS_33030 2038 2304 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289551.1 protein_id gnl|my_center|LOCUS_33030 2443 3150 gene locus_tag LOCUS_33040 2443 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 4124 5725 gene locus_tag LOCUS_33050 gene spoIVA 4124 5725 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392832.1 protein_id gnl|my_center|LOCUS_33050 6012 7145 gene locus_tag LOCUS_33060 6012 7145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 7332 7700 gene locus_tag LOCUS_33070 7332 7700 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416526.1 protein_id gnl|my_center|LOCUS_33070 7700 8188 gene locus_tag LOCUS_33080 7700 8188 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399375.1 protein_id gnl|my_center|LOCUS_33080 8279 8887 gene locus_tag LOCUS_33090 gene ruvA 8279 8887 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965583.1 protein_id gnl|my_center|LOCUS_33090 8953 9945 gene locus_tag LOCUS_33100 gene ruvB 8953 9945 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_33100 9999 10400 gene locus_tag LOCUS_33110 9999 10400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 10412 12910 gene locus_tag LOCUS_33120 10412 12910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 12914 14716 gene locus_tag LOCUS_33130 12914 14716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 14806 16335 gene locus_tag LOCUS_33140 14806 16335 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048310.1 protein_id gnl|my_center|LOCUS_33140 16575 17027 gene locus_tag LOCUS_33150 16575 17027 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416968.1 protein_id gnl|my_center|LOCUS_33150 17189 17518 gene locus_tag LOCUS_33160 17189 17518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 17535 18854 gene locus_tag LOCUS_33170 17535 18854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 19118 19519 gene locus_tag LOCUS_33180 19118 19519 CDS product spore germination protein GerW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461818.1 protein_id gnl|my_center|LOCUS_33180 19729 19866 gene locus_tag LOCUS_33190 19729 19866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 20397 20753 gene locus_tag LOCUS_33200 20397 20753 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813375.1 protein_id gnl|my_center|LOCUS_33200 20769 22589 gene locus_tag LOCUS_33210 20769 22589 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965042.1 protein_id gnl|my_center|LOCUS_33210 22611 22820 gene locus_tag LOCUS_33220 22611 22820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 22768 24996 gene locus_tag LOCUS_33230 gene recG 22768 24996 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_33230 25275 25670 gene locus_tag LOCUS_33240 25275 25670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 26473 26066 gene locus_tag LOCUS_33250 gene mgsA 26473 26066 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_33250 26781 27770 gene locus_tag LOCUS_33260 26781 27770 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902145.1 protein_id gnl|my_center|LOCUS_33260 28521 28297 gene locus_tag LOCUS_33270 28521 28297 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_33270 28714 29322 gene locus_tag LOCUS_33280 gene rsmD 28714 29322 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_33280 29319 29804 gene locus_tag LOCUS_33290 gene coaD 29319 29804 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_33290 30043 30642 gene locus_tag LOCUS_33300 30043 30642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 31718 30675 gene locus_tag LOCUS_33310 31718 30675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 31976 32797 gene locus_tag LOCUS_33320 31976 32797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 33092 33907 gene locus_tag LOCUS_33330 33092 33907 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417310.1 protein_id gnl|my_center|LOCUS_33330 33919 35403 gene locus_tag LOCUS_33340 gene rsmF 33919 35403 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228642.1 protein_id gnl|my_center|LOCUS_33340 35458 36165 gene locus_tag LOCUS_33350 35458 36165 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_33350 >Feature sequence046 <1 583 gene locus_tag LOCUS_33360 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816655.1:3-deoxy-7-phosphoheptulonate synthase 1938 631 gene locus_tag LOCUS_33370 gene thiC 1938 631 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966296.1 protein_id gnl|my_center|LOCUS_33370 2638 1997 gene locus_tag LOCUS_33380 gene thiE 2638 1997 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436488.1 protein_id gnl|my_center|LOCUS_33380 3885 2884 gene locus_tag LOCUS_33390 3885 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 4447 3926 gene locus_tag LOCUS_33400 gene thiW 4447 3926 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829480.1 protein_id gnl|my_center|LOCUS_33400 6401 5442 gene locus_tag LOCUS_33410 6401 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 9136 6860 gene locus_tag LOCUS_33420 9136 6860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 10140 9253 gene locus_tag LOCUS_33430 10140 9253 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828081.1 protein_id gnl|my_center|LOCUS_33430 11160 10192 gene locus_tag LOCUS_33440 11160 10192 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774996.1 protein_id gnl|my_center|LOCUS_33440 12770 11274 gene locus_tag LOCUS_33450 12770 11274 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_33450 13087 12773 gene locus_tag LOCUS_33460 13087 12773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 13770 13273 gene locus_tag LOCUS_33470 13770 13273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 15226 14519 gene locus_tag LOCUS_33480 15226 14519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 15910 15713 gene locus_tag LOCUS_33490 15910 15713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 17855 16191 gene locus_tag LOCUS_33500 17855 16191 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068613.1 protein_id gnl|my_center|LOCUS_33500 19808 18171 gene locus_tag LOCUS_33510 19808 18171 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390379.1 protein_id gnl|my_center|LOCUS_33510 33407 20244 gene locus_tag LOCUS_33520 33407 20244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 34153 34971 gene locus_tag LOCUS_33530 34153 34971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 35426 35238 gene locus_tag LOCUS_33540 35426 35238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 35598 35440 gene locus_tag LOCUS_33550 35598 35440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 35934 36194 gene locus_tag LOCUS_33560 35934 36194 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214020.1 protein_id gnl|my_center|LOCUS_33560 <37204 36461 gene locus_tag LOCUS_33570 <37204 36461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000393283.1:GTPase HflX >Feature sequence047 39 785 gene locus_tag LOCUS_33580 39 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 1311 880 gene locus_tag LOCUS_33590 1311 880 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933626.1 protein_id gnl|my_center|LOCUS_33590 3255 1867 gene locus_tag LOCUS_33600 3255 1867 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 protein_id gnl|my_center|LOCUS_33600 5900 3555 gene locus_tag LOCUS_33610 gene glgP 5900 3555 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950133.1 protein_id gnl|my_center|LOCUS_33610 6935 7034 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7253 7690 gene locus_tag LOCUS_33620 7253 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 7656 7835 gene locus_tag LOCUS_33630 7656 7835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 8254 7808 gene locus_tag LOCUS_33640 8254 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 9779 8271 gene locus_tag LOCUS_33650 9779 8271 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057658.1 protein_id gnl|my_center|LOCUS_33650 10188 11675 gene locus_tag LOCUS_33660 10188 11675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 14192 11964 gene locus_tag LOCUS_33670 14192 11964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 15027 17003 gene locus_tag LOCUS_33680 15027 17003 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193735789.1 protein_id gnl|my_center|LOCUS_33680 17970 17083 gene locus_tag LOCUS_33690 17970 17083 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003266758.1 protein_id gnl|my_center|LOCUS_33690 18775 19212 gene locus_tag LOCUS_33700 18775 19212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 19746 19213 gene locus_tag LOCUS_33710 19746 19213 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963792.1 protein_id gnl|my_center|LOCUS_33710 24146 19884 gene locus_tag LOCUS_33720 24146 19884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 24913 24284 gene locus_tag LOCUS_33730 gene upp 24913 24284 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815407.1 protein_id gnl|my_center|LOCUS_33730 25827 25396 gene locus_tag LOCUS_33740 gene rpiB 25827 25396 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430700.1 protein_id gnl|my_center|LOCUS_33740 26288 25821 gene locus_tag LOCUS_33750 26288 25821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 27472 26426 gene locus_tag LOCUS_33760 27472 26426 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947984.1 protein_id gnl|my_center|LOCUS_33760 28158 29300 gene locus_tag LOCUS_33770 28158 29300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 30355 29438 gene locus_tag LOCUS_33780 30355 29438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 32798 30762 gene locus_tag LOCUS_33790 32798 30762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 33014 33676 gene locus_tag LOCUS_33800 gene trmB 33014 33676 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286189.1 protein_id gnl|my_center|LOCUS_33800 33948 34021 gene locus_tag LOCUS_t00430 33948 34021 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 35572 34262 gene locus_tag LOCUS_33810 35572 34262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 >Feature sequence048 <1 5396 gene locus_tag LOCUS_33820 <1 5396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010774229.1:DEAD/DEAH box helicase family protein 5460 5729 gene locus_tag LOCUS_33830 5460 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 5735 7330 gene locus_tag LOCUS_33840 5735 7330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 7350 7562 gene locus_tag LOCUS_33850 7350 7562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 7555 8706 gene locus_tag LOCUS_33860 7555 8706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 8901 9272 gene locus_tag LOCUS_33870 8901 9272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 9241 9840 gene locus_tag LOCUS_33880 9241 9840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 9837 11477 gene locus_tag LOCUS_33890 9837 11477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 11494 12024 gene locus_tag LOCUS_33900 11494 12024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 12076 14373 gene locus_tag LOCUS_33910 12076 14373 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680024.1 protein_id gnl|my_center|LOCUS_33910 14379 14600 gene locus_tag LOCUS_33920 14379 14600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 14676 15455 gene locus_tag LOCUS_33930 14676 15455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 15707 16558 gene locus_tag LOCUS_33940 15707 16558 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860782.1 protein_id gnl|my_center|LOCUS_33940 16652 16951 gene locus_tag LOCUS_33950 16652 16951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 17049 17333 gene locus_tag LOCUS_33960 17049 17333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 17411 17605 gene locus_tag LOCUS_33970 17411 17605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 17654 19348 gene locus_tag LOCUS_33980 17654 19348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 19424 19630 gene locus_tag LOCUS_33990 19424 19630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 19772 20449 gene locus_tag LOCUS_34000 19772 20449 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_34000 21839 20385 gene locus_tag LOCUS_34010 21839 20385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 22582 21836 gene locus_tag LOCUS_34020 22582 21836 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223487.1 protein_id gnl|my_center|LOCUS_34020 22752 23192 gene locus_tag LOCUS_34030 22752 23192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 23660 24592 gene locus_tag LOCUS_34040 23660 24592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 24630 25244 gene locus_tag LOCUS_34050 24630 25244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 25414 25956 gene locus_tag LOCUS_34060 25414 25956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 25999 26685 gene locus_tag LOCUS_34070 25999 26685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 26809 27474 gene locus_tag LOCUS_34080 26809 27474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 27617 28285 gene locus_tag LOCUS_34090 27617 28285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 28400 28894 gene locus_tag LOCUS_34100 28400 28894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 28899 30401 gene locus_tag LOCUS_34110 28899 30401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 31952 30804 gene locus_tag LOCUS_34120 31952 30804 CDS product IS630-like element ISMsm5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894950.1 protein_id gnl|my_center|LOCUS_34120 32299 33810 gene locus_tag LOCUS_34130 32299 33810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 33863 34312 gene locus_tag LOCUS_34140 33863 34312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 34385 34921 gene locus_tag LOCUS_34150 34385 34921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 35655 35104 gene locus_tag LOCUS_34160 35655 35104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 >Feature sequence049 800 931 gene locus_tag LOCUS_34170 800 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 951 1595 gene locus_tag LOCUS_34180 951 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 1634 2371 gene locus_tag LOCUS_34190 1634 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 2371 4116 gene locus_tag LOCUS_34200 2371 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 4245 4529 gene locus_tag LOCUS_34210 4245 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 4522 6111 gene locus_tag LOCUS_34220 4522 6111 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775555.1 protein_id gnl|my_center|LOCUS_34220 6188 6373 gene locus_tag LOCUS_34230 6188 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 6606 8792 gene locus_tag LOCUS_34240 gene ftsH 6606 8792 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963922.1 protein_id gnl|my_center|LOCUS_34240 9237 10655 gene locus_tag LOCUS_34250 9237 10655 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_34250 10860 15200 gene locus_tag LOCUS_34260 10860 15200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 15433 17556 gene locus_tag LOCUS_34270 15433 17556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 17844 19385 gene locus_tag LOCUS_34280 17844 19385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 19409 20431 gene locus_tag LOCUS_34290 19409 20431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 20665 21876 gene locus_tag LOCUS_34300 20665 21876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 21963 24326 gene locus_tag LOCUS_34310 21963 24326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 24640 26139 gene locus_tag LOCUS_34320 24640 26139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 26259 26696 gene locus_tag LOCUS_34330 26259 26696 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475872.1 protein_id gnl|my_center|LOCUS_34330 26756 28000 gene locus_tag LOCUS_34340 26756 28000 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_34340 28542 28453 gene locus_tag LOCUS_t00440 28542 28453 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 29810 28641 gene locus_tag LOCUS_34350 29810 28641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 >Feature sequence050 1754 264 gene locus_tag LOCUS_34360 1754 264 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963640.1 protein_id gnl|my_center|LOCUS_34360 1921 1796 gene locus_tag LOCUS_34370 1921 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 3422 2145 gene locus_tag LOCUS_34380 gene metK 3422 2145 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_34380 4774 4055 gene locus_tag LOCUS_34390 4774 4055 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392510.1 protein_id gnl|my_center|LOCUS_34390 6459 4813 gene locus_tag LOCUS_34400 6459 4813 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582440.1 protein_id gnl|my_center|LOCUS_34400 9290 6678 gene locus_tag LOCUS_34410 gene gyrA 9290 6678 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_34410 11672 9456 gene locus_tag LOCUS_34420 gene gyrB 11672 9456 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_34420 12899 11793 gene locus_tag LOCUS_34430 gene recF 12899 11793 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963333.1 protein_id gnl|my_center|LOCUS_34430 13350 13114 gene locus_tag LOCUS_34440 13350 13114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 14629 13526 gene locus_tag LOCUS_34450 gene dnaN 14629 13526 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_34450 16508 15138 gene locus_tag LOCUS_34460 gene dnaA 16508 15138 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_34460 17490 17867 gene locus_tag LOCUS_34470 gene rnpA 17490 17867 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966998.1 protein_id gnl|my_center|LOCUS_34470 17864 18073 gene locus_tag LOCUS_34480 gene yidD 17864 18073 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966997.1 protein_id gnl|my_center|LOCUS_34480 18126 19412 gene locus_tag LOCUS_34490 18126 19412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 19424 20770 gene locus_tag LOCUS_34500 19424 20770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 20888 22288 gene locus_tag LOCUS_34510 gene mnmE 20888 22288 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966994.1 protein_id gnl|my_center|LOCUS_34510 22518 24389 gene locus_tag LOCUS_34520 gene mnmG 22518 24389 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_34520 24575 25555 gene locus_tag LOCUS_34530 24575 25555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 26994 26056 gene locus_tag LOCUS_34540 26994 26056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 27911 28429 gene locus_tag LOCUS_34550 27911 28429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 28939 29715 gene locus_tag LOCUS_34560 28939 29715 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 protein_id gnl|my_center|LOCUS_34560 29706 30629 gene locus_tag LOCUS_34570 29706 30629 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_34570 30723 30953 gene locus_tag LOCUS_34580 30723 30953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 30943 31467 gene locus_tag LOCUS_34590 30943 31467 CDS product DUF4446 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393987.1 protein_id gnl|my_center|LOCUS_34590 31469 32755 gene locus_tag LOCUS_34600 gene serS 31469 32755 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_34600 32986 33861 gene locus_tag LOCUS_34610 32986 33861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 >Feature sequence051 1728 76 gene locus_tag LOCUS_34620 1728 76 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_34620 1968 1801 gene locus_tag LOCUS_34630 1968 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 3642 2236 gene locus_tag LOCUS_34640 3642 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 4255 3554 gene locus_tag LOCUS_34650 4255 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 5496 4252 gene locus_tag LOCUS_34660 5496 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 6263 5958 gene locus_tag LOCUS_34670 6263 5958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 6540 6247 gene locus_tag LOCUS_34680 6540 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 6901 7749 gene locus_tag LOCUS_34690 6901 7749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 7996 7802 gene locus_tag LOCUS_34700 7996 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 8388 8005 gene locus_tag LOCUS_34710 8388 8005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 10128 8479 gene locus_tag LOCUS_34720 10128 8479 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_34720 10631 10125 gene locus_tag LOCUS_34730 10631 10125 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861118.1 protein_id gnl|my_center|LOCUS_34730 11555 10650 gene locus_tag LOCUS_34740 11555 10650 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368732.1 protein_id gnl|my_center|LOCUS_34740 11713 11594 gene locus_tag LOCUS_34750 11713 11594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 12774 12151 gene locus_tag LOCUS_34760 12774 12151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 13075 12950 gene locus_tag LOCUS_34770 13075 12950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 13727 13344 gene locus_tag LOCUS_34780 13727 13344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 15297 13927 gene locus_tag LOCUS_34790 15297 13927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 15813 15448 gene locus_tag LOCUS_34800 15813 15448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 16681 16028 gene locus_tag LOCUS_34810 16681 16028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 17079 16864 gene locus_tag LOCUS_34820 17079 16864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 18345 17122 gene locus_tag LOCUS_34830 18345 17122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 19882 18386 gene locus_tag LOCUS_34840 19882 18386 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060458416.1 protein_id gnl|my_center|LOCUS_34840 20631 20017 gene locus_tag LOCUS_34850 20631 20017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 21547 20678 gene locus_tag LOCUS_34860 21547 20678 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_34860 21913 21695 gene locus_tag LOCUS_34870 21913 21695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 24240 22774 gene locus_tag LOCUS_34880 24240 22774 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128519551.1 protein_id gnl|my_center|LOCUS_34880 25586 24342 gene locus_tag LOCUS_34890 25586 24342 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107236.1 protein_id gnl|my_center|LOCUS_34890 26723 26031 gene locus_tag LOCUS_34900 26723 26031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34900 27660 26770 gene locus_tag LOCUS_34910 27660 26770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 28583 27663 gene locus_tag LOCUS_34920 28583 27663 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454111.1 protein_id gnl|my_center|LOCUS_34920 29881 28625 gene locus_tag LOCUS_34930 29881 28625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 30629 29904 gene locus_tag LOCUS_34940 30629 29904 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475869.1 protein_id gnl|my_center|LOCUS_34940 31249 30638 gene locus_tag LOCUS_34950 gene udk 31249 30638 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830824.1 protein_id gnl|my_center|LOCUS_34950 32291 31314 gene locus_tag LOCUS_34960 32291 31314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 33530 32325 gene locus_tag LOCUS_34970 33530 32325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 33695 33543 gene locus_tag LOCUS_34980 33695 33543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 >Feature sequence052 3084 2608 gene locus_tag LOCUS_34990 3084 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 3608 3171 gene locus_tag LOCUS_35000 3608 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 4957 3623 gene locus_tag LOCUS_35010 4957 3623 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245369.1 protein_id gnl|my_center|LOCUS_35010 5231 4959 gene locus_tag LOCUS_35020 5231 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 5817 5263 gene locus_tag LOCUS_35030 5817 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 6356 5832 gene locus_tag LOCUS_35040 6356 5832 CDS product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245226.1 protein_id gnl|my_center|LOCUS_35040 6721 6356 gene locus_tag LOCUS_35050 6721 6356 CDS product YqbH/XkdH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967053.1 protein_id gnl|my_center|LOCUS_35050 7136 6735 gene locus_tag LOCUS_35060 7136 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 7499 7155 gene locus_tag LOCUS_35070 7499 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 8489 7518 gene locus_tag LOCUS_35080 8489 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 9762 8512 gene locus_tag LOCUS_35090 9762 8512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 10018 9776 gene locus_tag LOCUS_35100 10018 9776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 10020 10211 gene locus_tag LOCUS_35110 10020 10211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 11206 10238 gene locus_tag LOCUS_35120 11206 10238 CDS product phage head morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398748.1 protein_id gnl|my_center|LOCUS_35120 11498 11313 gene locus_tag LOCUS_35130 11498 11313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 11880 11602 gene locus_tag LOCUS_35140 11880 11602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 13785 11893 gene locus_tag LOCUS_35150 13785 11893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 13790 13889 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14285 15541 gene locus_tag LOCUS_35160 14285 15541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 16984 15572 gene locus_tag LOCUS_35170 16984 15572 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626412.1 protein_id gnl|my_center|LOCUS_35170 17417 16968 gene locus_tag LOCUS_35180 17417 16968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 18010 17531 gene locus_tag LOCUS_35190 18010 17531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 19281 18007 gene locus_tag LOCUS_35200 19281 18007 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113850176.1 protein_id gnl|my_center|LOCUS_35200 19759 19370 gene locus_tag LOCUS_35210 19759 19370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 20039 19749 gene locus_tag LOCUS_35220 20039 19749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 23110 20438 gene locus_tag LOCUS_35230 23110 20438 CDS product VapE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714181.1 protein_id gnl|my_center|LOCUS_35230 20625 20724 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23532 23110 gene locus_tag LOCUS_35240 23532 23110 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355957.1 protein_id gnl|my_center|LOCUS_35240 23863 23519 gene locus_tag LOCUS_35250 23863 23519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 24267 23863 gene locus_tag LOCUS_35260 gene dut 24267 23863 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928788.1 protein_id gnl|my_center|LOCUS_35260 24574 24281 gene locus_tag LOCUS_35270 24574 24281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 25337 24567 gene locus_tag LOCUS_35280 25337 24567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 25641 25324 gene locus_tag LOCUS_35290 25641 25324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 27605 25647 gene locus_tag LOCUS_35300 27605 25647 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399687.1 protein_id gnl|my_center|LOCUS_35300 28108 27596 gene locus_tag LOCUS_35310 28108 27596 CDS product NUMOD4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006993.1 protein_id gnl|my_center|LOCUS_35310 28685 28113 gene locus_tag LOCUS_35320 28685 28113 CDS product DUF2815 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399690.1 protein_id gnl|my_center|LOCUS_35320 29310 28744 gene locus_tag LOCUS_35330 29310 28744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 30500 29328 gene locus_tag LOCUS_35340 30500 29328 CDS product DUF2800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144597911.1 protein_id gnl|my_center|LOCUS_35340 30939 30493 gene locus_tag LOCUS_35350 30939 30493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 31039 30914 gene locus_tag LOCUS_35360 31039 30914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 31333 31106 gene locus_tag LOCUS_35370 31333 31106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 31571 31990 gene locus_tag LOCUS_35380 31571 31990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 >Feature sequence053 300 1307 gene locus_tag LOCUS_35390 300 1307 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 protein_id gnl|my_center|LOCUS_35390 1875 1312 gene locus_tag LOCUS_35400 1875 1312 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_35400 2016 2348 gene locus_tag LOCUS_35410 2016 2348 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420359.1 protein_id gnl|my_center|LOCUS_35410 2397 2597 gene locus_tag LOCUS_35420 2397 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 2704 3510 gene locus_tag LOCUS_35430 2704 3510 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005679031.1 protein_id gnl|my_center|LOCUS_35430 3561 3725 gene locus_tag LOCUS_35440 3561 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 4675 3905 gene locus_tag LOCUS_35450 4675 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 5156 4719 gene locus_tag LOCUS_35460 5156 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350140.1 protein_id gnl|my_center|LOCUS_35460 5205 5414 gene locus_tag LOCUS_35470 5205 5414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 5411 5935 gene locus_tag LOCUS_35480 5411 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 7799 6402 gene locus_tag LOCUS_35490 7799 6402 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_35490 8001 8891 gene locus_tag LOCUS_35500 8001 8891 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948372.1 protein_id gnl|my_center|LOCUS_35500 9805 9167 gene locus_tag LOCUS_35510 9805 9167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 11490 9802 gene locus_tag LOCUS_35520 11490 9802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 13929 11569 gene locus_tag LOCUS_35530 13929 11569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 15973 14036 gene locus_tag LOCUS_35540 15973 14036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 18088 16160 gene locus_tag LOCUS_35550 18088 16160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 18444 18187 gene locus_tag LOCUS_35560 18444 18187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 18450 18549 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19017 18694 gene locus_tag LOCUS_35570 19017 18694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 19459 19130 gene locus_tag LOCUS_35580 19459 19130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 21575 19530 gene locus_tag LOCUS_35590 21575 19530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 22007 21717 gene locus_tag LOCUS_35600 22007 21717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 22414 22079 gene locus_tag LOCUS_35610 22414 22079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 22745 22428 gene locus_tag LOCUS_35620 22745 22428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 23279 22947 gene locus_tag LOCUS_35630 23279 22947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 23516 23325 gene locus_tag LOCUS_35640 23516 23325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 25632 23428 gene locus_tag LOCUS_35650 25632 23428 CDS product NHLP bacteriocin export ABC transporter permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458930.1 protein_id gnl|my_center|LOCUS_35650 27952 25646 gene locus_tag LOCUS_35660 27952 25646 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_35660 28595 28125 gene locus_tag LOCUS_35670 28595 28125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 30863 28767 gene locus_tag LOCUS_35680 30863 28767 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114166.1 protein_id gnl|my_center|LOCUS_35680 32880 31276 gene locus_tag LOCUS_35690 32880 31276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 33323 33027 gene locus_tag LOCUS_35700 33323 33027 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176701.1 protein_id gnl|my_center|LOCUS_35700 >Feature sequence054 1352 54 gene locus_tag LOCUS_35710 1352 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 1951 1427 gene locus_tag LOCUS_35720 1951 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 4758 1951 gene locus_tag LOCUS_35730 4758 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 6159 4795 gene locus_tag LOCUS_35740 6159 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 7995 6229 gene locus_tag LOCUS_35750 gene thrS 7995 6229 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435143.1 protein_id gnl|my_center|LOCUS_35750 8472 8047 gene locus_tag LOCUS_35760 8472 8047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 8612 8968 gene locus_tag LOCUS_35770 8612 8968 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435954.1 protein_id gnl|my_center|LOCUS_35770 9051 9524 gene locus_tag LOCUS_35780 9051 9524 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905907.1 protein_id gnl|my_center|LOCUS_35780 9538 9990 gene locus_tag LOCUS_35790 gene ohrR 9538 9990 CDS product organic hydroperoxide resistance transcriptional regulator OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245653.1 protein_id gnl|my_center|LOCUS_35790 10594 9980 gene locus_tag LOCUS_35800 10594 9980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 10832 13309 gene locus_tag LOCUS_35810 10832 13309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 13468 15039 gene locus_tag LOCUS_35820 13468 15039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 15107 16081 gene locus_tag LOCUS_35830 15107 16081 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_35830 16074 16985 gene locus_tag LOCUS_35840 16074 16985 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_35840 16999 17988 gene locus_tag LOCUS_35850 16999 17988 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 protein_id gnl|my_center|LOCUS_35850 17991 18953 gene locus_tag LOCUS_35860 17991 18953 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_35860 18970 20112 gene locus_tag LOCUS_35870 18970 20112 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 protein_id gnl|my_center|LOCUS_35870 20133 21281 gene locus_tag LOCUS_35880 20133 21281 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211654.1 protein_id gnl|my_center|LOCUS_35880 21923 21297 gene locus_tag LOCUS_35890 21923 21297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 22203 23093 gene locus_tag LOCUS_35900 22203 23093 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102088.1 protein_id gnl|my_center|LOCUS_35900 23311 24498 gene locus_tag LOCUS_35910 23311 24498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 24526 25287 gene locus_tag LOCUS_35920 24526 25287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 25284 27182 gene locus_tag LOCUS_35930 25284 27182 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878960.1 protein_id gnl|my_center|LOCUS_35930 27179 27400 gene locus_tag LOCUS_35940 27179 27400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 27417 27920 gene locus_tag LOCUS_35950 27417 27920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 27963 30377 gene locus_tag LOCUS_35960 27963 30377 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117776984.1 protein_id gnl|my_center|LOCUS_35960 30451 31296 gene locus_tag LOCUS_35970 30451 31296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 >Feature sequence055 722 1468 gene locus_tag LOCUS_35980 722 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 2753 1530 gene locus_tag LOCUS_35990 2753 1530 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_35990 3177 4217 gene locus_tag LOCUS_36000 gene argC 3177 4217 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851634.1 protein_id gnl|my_center|LOCUS_36000 4575 5933 gene locus_tag LOCUS_36010 gene argJ 4575 5933 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082329.1 protein_id gnl|my_center|LOCUS_36010 5971 6873 gene locus_tag LOCUS_36020 gene argB 5971 6873 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864194.1 protein_id gnl|my_center|LOCUS_36020 6980 8248 gene locus_tag LOCUS_36030 6980 8248 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_36030 8479 8907 gene locus_tag LOCUS_36040 8479 8907 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966812.1 protein_id gnl|my_center|LOCUS_36040 9203 9391 gene locus_tag LOCUS_36050 9203 9391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 9418 9822 gene locus_tag LOCUS_36060 9418 9822 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812484.1 protein_id gnl|my_center|LOCUS_36060 10177 10398 gene locus_tag LOCUS_36070 10177 10398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 10433 11203 gene locus_tag LOCUS_36080 10433 11203 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392107.1 protein_id gnl|my_center|LOCUS_36080 11324 12013 gene locus_tag LOCUS_36090 gene yycF 11324 12013 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658889.1 protein_id gnl|my_center|LOCUS_36090 12099 13430 gene locus_tag LOCUS_36100 12099 13430 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461512.1 protein_id gnl|my_center|LOCUS_36100 13631 14803 gene locus_tag LOCUS_36110 13631 14803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 15084 17741 gene locus_tag LOCUS_36120 15084 17741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 18033 19040 gene locus_tag LOCUS_36130 18033 19040 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_36130 19134 20921 gene locus_tag LOCUS_36140 gene dnaG 19134 20921 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357766.1 protein_id gnl|my_center|LOCUS_36140 21053 22240 gene locus_tag LOCUS_36150 gene rpoD 21053 22240 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 protein_id gnl|my_center|LOCUS_36150 22419 23273 gene locus_tag LOCUS_36160 22419 23273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 23505 25307 gene locus_tag LOCUS_36170 23505 25307 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080960.1 protein_id gnl|my_center|LOCUS_36170 25829 27325 gene locus_tag LOCUS_36180 gene glpK 25829 27325 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987067.1 protein_id gnl|my_center|LOCUS_36180 27491 28729 gene locus_tag LOCUS_36190 27491 28729 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204864755.1 protein_id gnl|my_center|LOCUS_36190 29399 30133 gene locus_tag LOCUS_36200 29399 30133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 >Feature sequence056 280 1845 gene locus_tag LOCUS_36210 280 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 1842 3641 gene locus_tag LOCUS_36220 1842 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 4156 3782 gene locus_tag LOCUS_36230 4156 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 4650 4153 gene locus_tag LOCUS_36240 4650 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 5576 4746 gene locus_tag LOCUS_36250 gene rhaD 5576 4746 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179764.1 protein_id gnl|my_center|LOCUS_36250 6067 5873 gene locus_tag LOCUS_36260 6067 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 6262 7776 gene locus_tag LOCUS_36270 6262 7776 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582804.1 protein_id gnl|my_center|LOCUS_36270 7776 8771 gene locus_tag LOCUS_36280 7776 8771 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533601.1 protein_id gnl|my_center|LOCUS_36280 8774 9784 gene locus_tag LOCUS_36290 8774 9784 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533602.1 protein_id gnl|my_center|LOCUS_36290 10071 11090 gene locus_tag LOCUS_36300 gene rhaS 10071 11090 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226381.1 protein_id gnl|my_center|LOCUS_36300 11274 11585 gene locus_tag LOCUS_36310 gene rhaM 11274 11585 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379067.1 protein_id gnl|my_center|LOCUS_36310 12399 11806 gene locus_tag LOCUS_36320 12399 11806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 12754 13959 gene locus_tag LOCUS_36330 12754 13959 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_36330 14950 13964 gene locus_tag LOCUS_36340 14950 13964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 15321 14986 gene locus_tag LOCUS_36350 15321 14986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 15672 15600 gene locus_tag LOCUS_t00450 15672 15600 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 17390 15885 gene locus_tag LOCUS_36360 gene ypwA 17390 15885 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398513.1 protein_id gnl|my_center|LOCUS_36360 17718 21695 gene locus_tag LOCUS_36370 17718 21695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 21705 23018 gene locus_tag LOCUS_36380 21705 23018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 23042 23905 gene locus_tag LOCUS_36390 23042 23905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 24036 25631 gene locus_tag LOCUS_36400 gene purF 24036 25631 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047942.1 protein_id gnl|my_center|LOCUS_36400 25671 27104 gene locus_tag LOCUS_36410 gene purB 25671 27104 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_36410 27252 28526 gene locus_tag LOCUS_36420 27252 28526 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_36420 28694 29776 gene locus_tag LOCUS_36430 28694 29776 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114722.1 protein_id gnl|my_center|LOCUS_36430 29992 30501 gene locus_tag LOCUS_36440 gene nusG 29992 30501 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_36440 >Feature sequence057 2214 865 gene locus_tag LOCUS_36450 gene rfbH 2214 865 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208596.1 protein_id gnl|my_center|LOCUS_36450 3280 2228 gene locus_tag LOCUS_36460 gene rfbG 3280 2228 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_36460 4065 3283 gene locus_tag LOCUS_36470 gene rfbF 4065 3283 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816687.1 protein_id gnl|my_center|LOCUS_36470 5181 4078 gene locus_tag LOCUS_36480 5181 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 5540 5184 gene locus_tag LOCUS_36490 5540 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 7597 6596 gene locus_tag LOCUS_36500 7597 6596 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383750.1 protein_id gnl|my_center|LOCUS_36500 7827 7594 gene locus_tag LOCUS_36510 7827 7594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 8071 8080 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9918 8797 gene locus_tag LOCUS_36520 9918 8797 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203004.1 protein_id gnl|my_center|LOCUS_36520 10931 9942 gene locus_tag LOCUS_36530 10931 9942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 12026 10959 gene locus_tag LOCUS_36540 gene epsG 12026 10959 CDS product biofilm exopolysaccharide biosynthesis protein EpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228259.1 protein_id gnl|my_center|LOCUS_36540 12849 12034 gene locus_tag LOCUS_36550 gene epsE 12849 12034 CDS product glycosyltransferase EpsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244557.1 protein_id gnl|my_center|LOCUS_36550 13976 12867 gene locus_tag LOCUS_36560 13976 12867 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895560.1 protein_id gnl|my_center|LOCUS_36560 14872 13973 gene locus_tag LOCUS_36570 14872 13973 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048420.1 protein_id gnl|my_center|LOCUS_36570 15026 14874 gene locus_tag LOCUS_36580 15026 14874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 15315 15034 gene locus_tag LOCUS_36590 15315 15034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 16703 15879 gene locus_tag LOCUS_36600 16703 15879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 17390 16716 gene locus_tag LOCUS_36610 17390 16716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 17705 17451 gene locus_tag LOCUS_36620 17705 17451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 19231 17873 gene locus_tag LOCUS_36630 19231 17873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 19802 19224 gene locus_tag LOCUS_36640 19802 19224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 22380 20680 gene locus_tag LOCUS_36650 22380 20680 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_36650 24116 22377 gene locus_tag LOCUS_36660 24116 22377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 24608 24117 gene locus_tag LOCUS_36670 24608 24117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 26316 24661 gene locus_tag LOCUS_36680 26316 24661 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_36680 26638 26348 gene locus_tag LOCUS_36690 26638 26348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 27029 28921 gene locus_tag LOCUS_36700 27029 28921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 >Feature sequence058 171 296 gene locus_tag LOCUS_36710 171 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 283 3411 gene locus_tag LOCUS_36720 283 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 5144 3555 gene locus_tag LOCUS_36730 5144 3555 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_36730 5374 5748 gene locus_tag LOCUS_36740 5374 5748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 5959 7521 gene locus_tag LOCUS_36750 gene abfB 5959 7521 CDS product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 protein_id gnl|my_center|LOCUS_36750 7781 8041 gene locus_tag LOCUS_36760 7781 8041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 8471 10066 gene locus_tag LOCUS_36770 8471 10066 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_36770 10163 10615 gene locus_tag LOCUS_36780 10163 10615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 11554 10634 gene locus_tag LOCUS_36790 11554 10634 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287299.1 protein_id gnl|my_center|LOCUS_36790 12049 13008 gene locus_tag LOCUS_36800 12049 13008 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964837.1 protein_id gnl|my_center|LOCUS_36800 14003 13092 gene locus_tag LOCUS_36810 14003 13092 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287299.1 protein_id gnl|my_center|LOCUS_36810 14399 15751 gene locus_tag LOCUS_36820 14399 15751 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399072.1 protein_id gnl|my_center|LOCUS_36820 16041 16955 gene locus_tag LOCUS_36830 16041 16955 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229507.1 protein_id gnl|my_center|LOCUS_36830 16958 17872 gene locus_tag LOCUS_36840 gene araQ 16958 17872 CDS product arabinose ABC transporter permease AraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229508.1 protein_id gnl|my_center|LOCUS_36840 18278 19795 gene locus_tag LOCUS_36850 gene abfA 18278 19795 CDS product alpha-L-arabinofuranosidase AbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398747.1 protein_id gnl|my_center|LOCUS_36850 21759 19855 gene locus_tag LOCUS_36860 21759 19855 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_36860 23510 21762 gene locus_tag LOCUS_36870 23510 21762 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_36870 24467 23925 gene locus_tag LOCUS_36880 24467 23925 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_36880 24714 26186 gene locus_tag LOCUS_36890 24714 26186 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661024.1 protein_id gnl|my_center|LOCUS_36890 26316 27191 gene locus_tag LOCUS_36900 gene speE 26316 27191 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366713.1 protein_id gnl|my_center|LOCUS_36900 27586 27389 gene locus_tag LOCUS_36910 27586 27389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 27857 27576 gene locus_tag LOCUS_36920 27857 27576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 29510 28041 gene locus_tag LOCUS_36930 29510 28041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 >Feature sequence059 550 215 gene locus_tag LOCUS_36940 550 215 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_36940 804 938 gene locus_tag LOCUS_36950 804 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 1065 2192 gene locus_tag LOCUS_36960 1065 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 2196 2390 gene locus_tag LOCUS_36970 2196 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 2508 2783 gene locus_tag LOCUS_36980 2508 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36980 2802 3038 gene locus_tag LOCUS_36990 2802 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 3058 3861 gene locus_tag LOCUS_37000 3058 3861 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_37000 3782 4843 gene locus_tag LOCUS_37010 3782 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_37010 5456 4818 gene locus_tag LOCUS_37020 5456 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 6708 5446 gene locus_tag LOCUS_37030 6708 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 6932 6705 gene locus_tag LOCUS_37040 6932 6705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 7011 7184 gene locus_tag LOCUS_37050 7011 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 7181 7468 gene locus_tag LOCUS_37060 7181 7468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37060 7960 7613 gene locus_tag LOCUS_37070 7960 7613 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135200.1 protein_id gnl|my_center|LOCUS_37070 9788 8730 gene locus_tag LOCUS_37080 9788 8730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 10506 9790 gene locus_tag LOCUS_37090 10506 9790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 10817 10692 gene locus_tag LOCUS_37100 10817 10692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 12936 11014 gene locus_tag LOCUS_37110 12936 11014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 14090 13143 gene locus_tag LOCUS_37120 14090 13143 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_37120 14795 14310 gene locus_tag LOCUS_37130 14795 14310 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_37130 15053 14892 gene locus_tag LOCUS_37140 15053 14892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 15235 15627 gene locus_tag LOCUS_37150 15235 15627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 16006 18423 gene locus_tag LOCUS_37160 16006 18423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 19503 18697 gene locus_tag LOCUS_37170 19503 18697 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963435.1 protein_id gnl|my_center|LOCUS_37170 20248 19478 gene locus_tag LOCUS_37180 20248 19478 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963434.1 protein_id gnl|my_center|LOCUS_37180 21372 20278 gene locus_tag LOCUS_37190 21372 20278 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963433.1 protein_id gnl|my_center|LOCUS_37190 21632 22957 gene locus_tag LOCUS_37200 21632 22957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 23914 23213 gene locus_tag LOCUS_37210 23914 23213 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811072.1 protein_id gnl|my_center|LOCUS_37210 24607 25221 gene locus_tag LOCUS_37220 gene udk 24607 25221 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225916.1 protein_id gnl|my_center|LOCUS_37220 25877 25305 gene locus_tag LOCUS_37230 25877 25305 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862458.1 protein_id gnl|my_center|LOCUS_37230 26726 27154 gene locus_tag LOCUS_37240 gene rplM 26726 27154 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918559.1 protein_id gnl|my_center|LOCUS_37240 27172 27564 gene locus_tag LOCUS_37250 gene rpsI 27172 27564 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357662.1 protein_id gnl|my_center|LOCUS_37250 27886 27743 gene locus_tag LOCUS_37260 27886 27743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 >Feature sequence060 52 1056 gene locus_tag LOCUS_37270 gene trpS 52 1056 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048270.1 protein_id gnl|my_center|LOCUS_37270 2512 1289 gene locus_tag LOCUS_37280 2512 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 3197 2682 gene locus_tag LOCUS_37290 3197 2682 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434028.1 protein_id gnl|my_center|LOCUS_37290 3352 4413 gene locus_tag LOCUS_37300 gene pgl 3352 4413 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244689.1 protein_id gnl|my_center|LOCUS_37300 5676 4576 gene locus_tag LOCUS_37310 gene aroC 5676 4576 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_37310 5766 5951 gene locus_tag LOCUS_37320 5766 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 7806 5986 gene locus_tag LOCUS_37330 7806 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 7983 8810 gene locus_tag LOCUS_37340 7983 8810 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594027.1 protein_id gnl|my_center|LOCUS_37340 8819 9901 gene locus_tag LOCUS_37350 8819 9901 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254020.1 protein_id gnl|my_center|LOCUS_37350 9979 10845 gene locus_tag LOCUS_37360 9979 10845 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674362.1 protein_id gnl|my_center|LOCUS_37360 10854 11666 gene locus_tag LOCUS_37370 10854 11666 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674361.1 protein_id gnl|my_center|LOCUS_37370 11667 16220 gene locus_tag LOCUS_37380 11667 16220 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352208.1 protein_id gnl|my_center|LOCUS_37380 16234 16602 gene locus_tag LOCUS_37390 16234 16602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 16870 17235 gene locus_tag LOCUS_37400 16870 17235 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459275.1 protein_id gnl|my_center|LOCUS_37400 17340 20345 gene locus_tag LOCUS_37410 17340 20345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 20624 22906 gene locus_tag LOCUS_37420 gene recQ 20624 22906 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948677.1 protein_id gnl|my_center|LOCUS_37420 22896 23093 gene locus_tag LOCUS_37430 22896 23093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 23411 23770 gene locus_tag LOCUS_37440 23411 23770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 23943 24227 gene locus_tag LOCUS_37450 23943 24227 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 protein_id gnl|my_center|LOCUS_37450 24414 24986 gene locus_tag LOCUS_37460 24414 24986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 25118 26047 gene locus_tag LOCUS_37470 25118 26047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 26266 26111 gene locus_tag LOCUS_37480 26266 26111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 26472 26651 gene locus_tag LOCUS_37490 26472 26651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 26833 27108 gene locus_tag LOCUS_37500 26833 27108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 27126 27347 gene locus_tag LOCUS_37510 27126 27347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 27507 27881 gene locus_tag LOCUS_37520 27507 27881 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384878.1 protein_id gnl|my_center|LOCUS_37520 >Feature sequence061 262 1728 gene locus_tag LOCUS_37530 262 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 1875 2069 gene locus_tag LOCUS_37540 1875 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 2473 11385 gene locus_tag LOCUS_37550 2473 11385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 11534 11866 gene locus_tag LOCUS_37560 11534 11866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 11907 12806 gene locus_tag LOCUS_37570 11907 12806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 13093 13881 gene locus_tag LOCUS_37580 13093 13881 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965626.1 protein_id gnl|my_center|LOCUS_37580 13926 14513 gene locus_tag LOCUS_37590 13926 14513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 14510 16996 gene locus_tag LOCUS_37600 14510 16996 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_37600 17770 19164 gene locus_tag LOCUS_37610 17770 19164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 19233 20063 gene locus_tag LOCUS_37620 19233 20063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 20075 21343 gene locus_tag LOCUS_37630 20075 21343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 21356 22780 gene locus_tag LOCUS_37640 21356 22780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 22860 23789 gene locus_tag LOCUS_37650 22860 23789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 23915 24259 gene locus_tag LOCUS_37660 23915 24259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 24313 24594 gene locus_tag LOCUS_37670 24313 24594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 25056 25493 gene locus_tag LOCUS_37680 25056 25493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 25498 26583 gene locus_tag LOCUS_37690 25498 26583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 >Feature sequence062 52 408 gene locus_tag LOCUS_37700 52 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 481 657 gene locus_tag LOCUS_37710 481 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 786 1265 gene locus_tag LOCUS_37720 786 1265 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_37720 2201 2905 gene locus_tag LOCUS_37730 2201 2905 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226990.1 protein_id gnl|my_center|LOCUS_37730 2987 3466 gene locus_tag LOCUS_37740 2987 3466 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_37740 4120 3539 gene locus_tag LOCUS_37750 gene eamB 4120 3539 CDS product cysteine/O-acetylserine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189206.1 protein_id gnl|my_center|LOCUS_37750 4250 5134 gene locus_tag LOCUS_37760 4250 5134 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704467.1 protein_id gnl|my_center|LOCUS_37760 6247 5378 gene locus_tag LOCUS_37770 6247 5378 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059810.1 protein_id gnl|my_center|LOCUS_37770 6485 7924 gene locus_tag LOCUS_37780 6485 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 7998 8777 gene locus_tag LOCUS_37790 7998 8777 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047711.1 protein_id gnl|my_center|LOCUS_37790 10025 9168 gene locus_tag LOCUS_37800 10025 9168 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 protein_id gnl|my_center|LOCUS_37800 10521 10045 gene locus_tag LOCUS_37810 10521 10045 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_37810 10694 11131 gene locus_tag LOCUS_37820 10694 11131 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288290.1 protein_id gnl|my_center|LOCUS_37820 11248 11595 gene locus_tag LOCUS_37830 11248 11595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 11683 11943 gene locus_tag LOCUS_37840 11683 11943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 11978 13102 gene locus_tag LOCUS_37850 11978 13102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 13481 13771 gene locus_tag LOCUS_37860 13481 13771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 13753 14742 gene locus_tag LOCUS_37870 13753 14742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 14960 15172 gene locus_tag LOCUS_37880 14960 15172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 15175 15360 gene locus_tag LOCUS_37890 15175 15360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 15706 16296 gene locus_tag LOCUS_37900 15706 16296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 16333 16791 gene locus_tag LOCUS_37910 16333 16791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 16814 17197 gene locus_tag LOCUS_37920 16814 17197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 17465 17650 gene locus_tag LOCUS_37930 17465 17650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 17644 17784 gene locus_tag LOCUS_37940 17644 17784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 17798 18835 gene locus_tag LOCUS_37950 17798 18835 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202293.1 protein_id gnl|my_center|LOCUS_37950 19011 19394 gene locus_tag LOCUS_37960 19011 19394 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682186.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37960 19456 20292 gene locus_tag LOCUS_37970 19456 20292 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679543.1 protein_id gnl|my_center|LOCUS_37970 20296 20697 gene locus_tag LOCUS_37980 20296 20697 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890780.1 protein_id gnl|my_center|LOCUS_37980 22815 20887 gene locus_tag LOCUS_37990 gene cydC 22815 20887 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667625.1 protein_id gnl|my_center|LOCUS_37990 24941 22812 gene locus_tag LOCUS_38000 24941 22812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 25291 25686 gene locus_tag LOCUS_38010 25291 25686 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986162.1 protein_id gnl|my_center|LOCUS_38010 25896 26477 gene locus_tag LOCUS_38020 25896 26477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 >Feature sequence063 946 461 gene locus_tag LOCUS_38030 gene leuD 946 461 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_38030 1255 965 gene locus_tag LOCUS_38040 1255 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 2527 1265 gene locus_tag LOCUS_38050 gene leuC 2527 1265 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_38050 3729 2710 gene locus_tag LOCUS_38060 gene ilvC 3729 2710 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142651.1 protein_id gnl|my_center|LOCUS_38060 4516 4019 gene locus_tag LOCUS_38070 gene ilvN 4516 4019 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061054.1 protein_id gnl|my_center|LOCUS_38070 6315 4654 gene locus_tag LOCUS_38080 6315 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 6735 8189 gene locus_tag LOCUS_38090 6735 8189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 8267 8452 gene locus_tag LOCUS_38100 8267 8452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 9644 8622 gene locus_tag LOCUS_38110 gene rfbD 9644 8622 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664667.1 protein_id gnl|my_center|LOCUS_38110 10387 9764 gene locus_tag LOCUS_38120 10387 9764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 12624 10885 gene locus_tag LOCUS_38130 12624 10885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 13762 12797 gene locus_tag LOCUS_38140 13762 12797 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_38140 15485 14019 gene locus_tag LOCUS_38150 15485 14019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 15894 16661 gene locus_tag LOCUS_38160 15894 16661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 18040 16793 gene locus_tag LOCUS_38170 18040 16793 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288208.1 protein_id gnl|my_center|LOCUS_38170 20303 18384 gene locus_tag LOCUS_38180 20303 18384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 22246 20546 gene locus_tag LOCUS_38190 22246 20546 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338467.1 protein_id gnl|my_center|LOCUS_38190 24206 22533 gene locus_tag LOCUS_38200 24206 22533 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_38200 24582 24932 gene locus_tag LOCUS_38210 24582 24932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 25238 25059 gene locus_tag LOCUS_38220 25238 25059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 25539 25357 gene locus_tag LOCUS_38230 25539 25357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 25954 25532 gene locus_tag LOCUS_38240 25954 25532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 >Feature sequence064 621 79 gene locus_tag LOCUS_38250 621 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 1226 942 gene locus_tag LOCUS_38260 1226 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 1624 1331 gene locus_tag LOCUS_38270 1624 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 2569 1718 gene locus_tag LOCUS_38280 2569 1718 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860782.1 protein_id gnl|my_center|LOCUS_38280 3588 2821 gene locus_tag LOCUS_38290 3588 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 3885 3664 gene locus_tag LOCUS_38300 3885 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 6188 3891 gene locus_tag LOCUS_38310 6188 3891 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680024.1 protein_id gnl|my_center|LOCUS_38310 6770 6240 gene locus_tag LOCUS_38320 6770 6240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 7653 6787 gene locus_tag LOCUS_38330 7653 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 8406 7672 gene locus_tag LOCUS_38340 8406 7672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 8984 8403 gene locus_tag LOCUS_38350 8984 8403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 12861 8971 gene locus_tag LOCUS_38360 12861 8971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 13256 12912 gene locus_tag LOCUS_38370 13256 12912 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_38370 15433 14996 gene locus_tag LOCUS_38380 15433 14996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 15677 15387 gene locus_tag LOCUS_38390 15677 15387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 17214 15973 gene locus_tag LOCUS_38400 17214 15973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 17496 17215 gene locus_tag LOCUS_38410 17496 17215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 17964 17626 gene locus_tag LOCUS_38420 17964 17626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 18915 18007 gene locus_tag LOCUS_38430 18915 18007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 19437 18991 gene locus_tag LOCUS_38440 19437 18991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 21645 19450 gene locus_tag LOCUS_38450 21645 19450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 21813 21652 gene locus_tag LOCUS_38460 21813 21652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 25460 21756 gene locus_tag LOCUS_38470 25460 21756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 >Feature sequence065 87 1049 gene locus_tag LOCUS_38480 87 1049 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246640.1 protein_id gnl|my_center|LOCUS_38480 1359 1458 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1909 2925 gene locus_tag LOCUS_38490 1909 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 2934 3116 gene locus_tag LOCUS_38500 2934 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 3774 3265 gene locus_tag LOCUS_38510 3774 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 4061 3756 gene locus_tag LOCUS_38520 4061 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 4279 4461 gene locus_tag LOCUS_38530 4279 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 4624 5748 gene locus_tag LOCUS_38540 4624 5748 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459687.1 protein_id gnl|my_center|LOCUS_38540 5807 6397 gene locus_tag LOCUS_38550 gene prfH 5807 6397 CDS product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107793.1 protein_id gnl|my_center|LOCUS_38550 6650 6937 gene locus_tag LOCUS_38560 6650 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 7141 7278 gene locus_tag LOCUS_38570 7141 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 7767 7955 gene locus_tag LOCUS_38580 7767 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 8329 7988 gene locus_tag LOCUS_38590 8329 7988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 8556 10061 gene locus_tag LOCUS_38600 8556 10061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 10179 12716 gene locus_tag LOCUS_38610 10179 12716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 12736 12945 gene locus_tag LOCUS_38620 12736 12945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 13000 13929 gene locus_tag LOCUS_38630 13000 13929 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 protein_id gnl|my_center|LOCUS_38630 14044 14268 gene locus_tag LOCUS_38640 14044 14268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 14430 15359 gene locus_tag LOCUS_38650 14430 15359 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398673.1 protein_id gnl|my_center|LOCUS_38650 15371 15808 gene locus_tag LOCUS_38660 gene ssb 15371 15808 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721668.1 protein_id gnl|my_center|LOCUS_38660 15829 16152 gene locus_tag LOCUS_38670 15829 16152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 16156 16917 gene locus_tag LOCUS_38680 16156 16917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965239.1 protein_id gnl|my_center|LOCUS_38680 17033 17941 gene locus_tag LOCUS_38690 17033 17941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 18111 18659 gene locus_tag LOCUS_38700 18111 18659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 18652 18828 gene locus_tag LOCUS_38710 18652 18828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 18818 19192 gene locus_tag LOCUS_38720 18818 19192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 19155 19838 gene locus_tag LOCUS_38730 19155 19838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 19970 22606 gene locus_tag LOCUS_38740 19970 22606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 22899 22663 gene locus_tag LOCUS_38750 22899 22663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 24698 22902 gene locus_tag LOCUS_38760 24698 22902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 >Feature sequence066 <1 1253 gene locus_tag LOCUS_38770 <1 1253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002324544.1:site-specific resolvase TndX 1536 2408 gene locus_tag LOCUS_38780 1536 2408 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610323.1 protein_id gnl|my_center|LOCUS_38780 2486 2866 gene locus_tag LOCUS_38790 2486 2866 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861115.1 protein_id gnl|my_center|LOCUS_38790 2850 5270 gene locus_tag LOCUS_38800 2850 5270 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_38800 5257 5541 gene locus_tag LOCUS_38810 5257 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 5573 9232 gene locus_tag LOCUS_38820 5573 9232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 9321 9653 gene locus_tag LOCUS_38830 9321 9653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 9613 10305 gene locus_tag LOCUS_38840 9613 10305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 10402 12522 gene locus_tag LOCUS_38850 10402 12522 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861108.1 protein_id gnl|my_center|LOCUS_38850 12587 21991 gene locus_tag LOCUS_38860 12587 21991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 22061 22534 gene locus_tag LOCUS_38870 22061 22534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031233.1 protein_id gnl|my_center|LOCUS_38870 >Feature sequence067 <1 2891 gene locus_tag LOCUS_38880 <1 2891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011837563.1:Cna B-type domain-containing protein 3297 3794 gene locus_tag LOCUS_38890 3297 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 3791 4237 gene locus_tag LOCUS_38900 3791 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 4333 5166 gene locus_tag LOCUS_38910 4333 5166 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810083.1 protein_id gnl|my_center|LOCUS_38910 5245 6261 gene locus_tag LOCUS_38920 5245 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 7498 6437 gene locus_tag LOCUS_38930 7498 6437 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861983.1 protein_id gnl|my_center|LOCUS_38930 8239 7514 gene locus_tag LOCUS_38940 8239 7514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 8703 8236 gene locus_tag LOCUS_38950 8703 8236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 9207 8725 gene locus_tag LOCUS_38960 9207 8725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 9818 9489 gene locus_tag LOCUS_38970 9818 9489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 10893 9853 gene locus_tag LOCUS_38980 10893 9853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 11856 10915 gene locus_tag LOCUS_38990 11856 10915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 12617 13597 gene locus_tag LOCUS_39000 12617 13597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 14559 13807 gene locus_tag LOCUS_39010 14559 13807 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068637.1 protein_id gnl|my_center|LOCUS_39010 15033 18719 gene locus_tag LOCUS_39020 15033 18719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 19051 21531 gene locus_tag LOCUS_39030 19051 21531 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680347.1 protein_id gnl|my_center|LOCUS_39030 21744 22046 gene locus_tag LOCUS_39040 21744 22046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 22036 22365 gene locus_tag LOCUS_39050 22036 22365 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460590.1 protein_id gnl|my_center|LOCUS_39050 23695 22370 gene locus_tag LOCUS_39060 gene melB 23695 22370 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028114.1 protein_id gnl|my_center|LOCUS_39060 >Feature sequence068 1124 126 gene locus_tag LOCUS_39070 1124 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 4324 1121 gene locus_tag LOCUS_39080 4324 1121 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870273.1 protein_id gnl|my_center|LOCUS_39080 4852 4340 gene locus_tag LOCUS_39090 4852 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 5390 4881 gene locus_tag LOCUS_39100 5390 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 6715 5462 gene locus_tag LOCUS_39110 6715 5462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 7245 6712 gene locus_tag LOCUS_39120 7245 6712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 9080 7512 gene locus_tag LOCUS_39130 9080 7512 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870275.1 protein_id gnl|my_center|LOCUS_39130 9300 9073 gene locus_tag LOCUS_39140 9300 9073 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985621.1 protein_id gnl|my_center|LOCUS_39140 9711 9415 gene locus_tag LOCUS_39150 9711 9415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 10733 9906 gene locus_tag LOCUS_39160 10733 9906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 11153 10854 gene locus_tag LOCUS_39170 11153 10854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 11543 11166 gene locus_tag LOCUS_39180 11543 11166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 11772 11515 gene locus_tag LOCUS_39190 11772 11515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 12082 11924 gene locus_tag LOCUS_39200 12082 11924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 14123 12372 gene locus_tag LOCUS_39210 14123 12372 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_39210 14608 14120 gene locus_tag LOCUS_39220 14608 14120 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 protein_id gnl|my_center|LOCUS_39220 15349 14714 gene locus_tag LOCUS_39230 15349 14714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 15848 15360 gene locus_tag LOCUS_39240 15848 15360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 16837 15959 gene locus_tag LOCUS_39250 16837 15959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 17684 16851 gene locus_tag LOCUS_39260 17684 16851 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860782.1 protein_id gnl|my_center|LOCUS_39260 18588 17905 gene locus_tag LOCUS_39270 18588 17905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 20055 19720 gene locus_tag LOCUS_39280 20055 19720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 20500 20222 gene locus_tag LOCUS_39290 20500 20222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 20911 21303 gene locus_tag LOCUS_39300 20911 21303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 21275 22921 gene locus_tag LOCUS_39310 21275 22921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 >Feature sequence069 460 50 gene locus_tag LOCUS_39320 460 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 1710 454 gene locus_tag LOCUS_39330 1710 454 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141151.1 protein_id gnl|my_center|LOCUS_39330 4667 2037 gene locus_tag LOCUS_39340 gene ppdK 4667 2037 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_39340 5716 4976 gene locus_tag LOCUS_39350 5716 4976 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948617.1 protein_id gnl|my_center|LOCUS_39350 7224 5977 gene locus_tag LOCUS_39360 7224 5977 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_39360 9064 7676 gene locus_tag LOCUS_39370 9064 7676 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_39370 9901 9155 gene locus_tag LOCUS_39380 9901 9155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 10718 10047 gene locus_tag LOCUS_39390 10718 10047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 12222 10855 gene locus_tag LOCUS_39400 12222 10855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 15646 12326 gene locus_tag LOCUS_39410 15646 12326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 16354 15659 gene locus_tag LOCUS_39420 16354 15659 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437518.1 protein_id gnl|my_center|LOCUS_39420 16902 16750 gene locus_tag LOCUS_39430 16902 16750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 20362 16892 gene locus_tag LOCUS_39440 20362 16892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 21860 20760 gene locus_tag LOCUS_39450 21860 20760 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_39450 22610 22137 gene locus_tag LOCUS_39460 22610 22137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 >Feature sequence070 1 75 gene locus_tag LOCUS_t00460 1 75 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 337 104 gene locus_tag LOCUS_39470 337 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 393 953 gene locus_tag LOCUS_39480 393 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 950 1852 gene locus_tag LOCUS_39490 950 1852 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017657068.1 protein_id gnl|my_center|LOCUS_39490 1827 3797 gene locus_tag LOCUS_39500 1827 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 4071 4574 gene locus_tag LOCUS_39510 4071 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 4574 5164 gene locus_tag LOCUS_39520 4574 5164 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_39520 5314 5496 gene locus_tag LOCUS_39530 5314 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 5432 7390 gene locus_tag LOCUS_39540 5432 7390 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294013.1 protein_id gnl|my_center|LOCUS_39540 7387 9345 gene locus_tag LOCUS_39550 7387 9345 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811591.1 protein_id gnl|my_center|LOCUS_39550 9675 9860 gene locus_tag LOCUS_39560 9675 9860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 9939 10388 gene locus_tag LOCUS_39570 9939 10388 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437174.1 protein_id gnl|my_center|LOCUS_39570 10385 11317 gene locus_tag LOCUS_39580 10385 11317 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_39580 11342 12328 gene locus_tag LOCUS_39590 gene argF 11342 12328 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_39590 12339 12629 gene locus_tag LOCUS_39600 12339 12629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 12752 13966 gene locus_tag LOCUS_39610 12752 13966 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_39610 14105 14479 gene locus_tag LOCUS_39620 14105 14479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 14674 15630 gene locus_tag LOCUS_39630 gene dusB 14674 15630 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_39630 15989 16450 gene locus_tag LOCUS_39640 gene greA 15989 16450 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_39640 16474 17979 gene locus_tag LOCUS_39650 gene lysS 16474 17979 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861998.1 protein_id gnl|my_center|LOCUS_39650 18367 19026 gene locus_tag LOCUS_39660 18367 19026 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_39660 19156 20544 gene locus_tag LOCUS_39670 gene argH 19156 20544 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_39670 21171 22256 gene locus_tag LOCUS_39680 gene asd 21171 22256 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699652.1 protein_id gnl|my_center|LOCUS_39680 >Feature sequence071 72 542 gene locus_tag LOCUS_39690 72 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 539 1525 gene locus_tag LOCUS_39700 gene yclO 539 1525 CDS product petrobactin ABC transporter permease YclO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246705.1 protein_id gnl|my_center|LOCUS_39700 1619 2371 gene locus_tag LOCUS_39710 1619 2371 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889549.1 protein_id gnl|my_center|LOCUS_39710 2451 3395 gene locus_tag LOCUS_39720 2451 3395 CDS product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287908.1 protein_id gnl|my_center|LOCUS_39720 3841 4731 gene locus_tag LOCUS_39730 3841 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 4778 5494 gene locus_tag LOCUS_39740 4778 5494 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897697.1 protein_id gnl|my_center|LOCUS_39740 5690 6871 gene locus_tag LOCUS_39750 5690 6871 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994748.1 protein_id gnl|my_center|LOCUS_39750 6873 7067 gene locus_tag LOCUS_39760 6873 7067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 6988 7590 gene locus_tag LOCUS_39770 6988 7590 CDS product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072772897.1 protein_id gnl|my_center|LOCUS_39770 7683 8270 gene locus_tag LOCUS_39780 7683 8270 CDS product nitrogenase iron protein NifH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461208.1 protein_id gnl|my_center|LOCUS_39780 8288 8632 gene locus_tag LOCUS_39790 8288 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 8790 9164 gene locus_tag LOCUS_39800 8790 9164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 9169 9987 gene locus_tag LOCUS_39810 9169 9987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 10022 10804 gene locus_tag LOCUS_39820 10022 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 11114 11323 gene locus_tag LOCUS_39830 11114 11323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 13181 11571 gene locus_tag LOCUS_39840 13181 11571 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461242.1 protein_id gnl|my_center|LOCUS_39840 13861 13178 gene locus_tag LOCUS_39850 13861 13178 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681221.1 protein_id gnl|my_center|LOCUS_39850 14454 13858 gene locus_tag LOCUS_39860 14454 13858 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666370.1 protein_id gnl|my_center|LOCUS_39860 15712 14729 gene locus_tag LOCUS_39870 15712 14729 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986747.1 protein_id gnl|my_center|LOCUS_39870 17618 15882 gene locus_tag LOCUS_39880 17618 15882 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809002.1 protein_id gnl|my_center|LOCUS_39880 19601 17622 gene locus_tag LOCUS_39890 19601 17622 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461147.1 protein_id gnl|my_center|LOCUS_39890 19943 20629 gene locus_tag LOCUS_39900 19943 20629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 20723 21574 gene locus_tag LOCUS_39910 20723 21574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 >Feature sequence072 299 209 gene locus_tag LOCUS_t00470 299 209 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 424 337 gene locus_tag LOCUS_t00480 424 337 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1380 592 gene locus_tag LOCUS_39920 gene ispD 1380 592 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966461.1 protein_id gnl|my_center|LOCUS_39920 2437 1382 gene locus_tag LOCUS_39930 gene tsaD 2437 1382 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_39930 3498 2590 gene locus_tag LOCUS_39940 3498 2590 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_39940 3868 3650 gene locus_tag LOCUS_39950 3868 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 4512 4030 gene locus_tag LOCUS_39960 gene rimI 4512 4030 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434429.1 protein_id gnl|my_center|LOCUS_39960 5282 4575 gene locus_tag LOCUS_39970 gene tsaB 5282 4575 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966124.1 protein_id gnl|my_center|LOCUS_39970 5751 5323 gene locus_tag LOCUS_39980 gene tsaE 5751 5323 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048261.1 protein_id gnl|my_center|LOCUS_39980 6689 5898 gene locus_tag LOCUS_39990 6689 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 7382 8149 gene locus_tag LOCUS_40000 7382 8149 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_40000 9372 8419 gene locus_tag LOCUS_40010 9372 8419 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963416.1 protein_id gnl|my_center|LOCUS_40010 9687 9929 gene locus_tag LOCUS_40020 9687 9929 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816044.1 protein_id gnl|my_center|LOCUS_40020 10984 9995 gene locus_tag LOCUS_40030 10984 9995 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122039.1 protein_id gnl|my_center|LOCUS_40030 11335 11147 gene locus_tag LOCUS_40040 11335 11147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 11870 11460 gene locus_tag LOCUS_40050 11870 11460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 13746 11818 gene locus_tag LOCUS_40060 13746 11818 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047851.1 protein_id gnl|my_center|LOCUS_40060 13964 14149 gene locus_tag LOCUS_40070 13964 14149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 15219 14218 gene locus_tag LOCUS_40080 15219 14218 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027505.1 protein_id gnl|my_center|LOCUS_40080 16095 15298 gene locus_tag LOCUS_40090 16095 15298 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682019.1 protein_id gnl|my_center|LOCUS_40090 17153 16104 gene locus_tag LOCUS_40100 17153 16104 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837220.1 protein_id gnl|my_center|LOCUS_40100 18918 17131 gene locus_tag LOCUS_40110 18918 17131 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141301.1 protein_id gnl|my_center|LOCUS_40110 20692 18908 gene locus_tag LOCUS_40120 20692 18908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141300.1 protein_id gnl|my_center|LOCUS_40120 21304 20714 gene locus_tag LOCUS_40130 21304 20714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 >Feature sequence073 742 464 gene locus_tag LOCUS_40140 742 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 656 1423 gene locus_tag LOCUS_40150 656 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 2242 1802 gene locus_tag LOCUS_40160 2242 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 4275 2239 gene locus_tag LOCUS_40170 4275 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 5105 4272 gene locus_tag LOCUS_40180 5105 4272 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_40180 5565 5131 gene locus_tag LOCUS_40190 5565 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 6675 5572 gene locus_tag LOCUS_40200 6675 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 7672 6680 gene locus_tag LOCUS_40210 7672 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 8515 7682 gene locus_tag LOCUS_40220 8515 7682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 14562 8512 gene locus_tag LOCUS_40230 14562 8512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 14911 14585 gene locus_tag LOCUS_40240 14911 14585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 15665 15360 gene locus_tag LOCUS_40250 15665 15360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 17491 15947 gene locus_tag LOCUS_40260 17491 15947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 17722 17537 gene locus_tag LOCUS_40270 17722 17537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 18771 18043 gene locus_tag LOCUS_40280 18771 18043 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392279.1 protein_id gnl|my_center|LOCUS_40280 19974 18841 gene locus_tag LOCUS_40290 gene neuC 19974 18841 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963387.1 protein_id gnl|my_center|LOCUS_40290 21025 19985 gene locus_tag LOCUS_40300 21025 19985 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963388.1 protein_id gnl|my_center|LOCUS_40300 >Feature sequence074 73 1314 gene locus_tag LOCUS_40310 73 1314 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081447092.1 protein_id gnl|my_center|LOCUS_40310 1311 2987 gene locus_tag LOCUS_40320 1311 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40320 3056 4336 gene locus_tag LOCUS_40330 3056 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40330 4385 4909 gene locus_tag LOCUS_40340 4385 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 4909 5490 gene locus_tag LOCUS_40350 4909 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 5560 6153 gene locus_tag LOCUS_40360 5560 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 6295 6828 gene locus_tag LOCUS_40370 6295 6828 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304258.1 protein_id gnl|my_center|LOCUS_40370 7106 7564 gene locus_tag LOCUS_40380 7106 7564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 7568 8107 gene locus_tag LOCUS_40390 7568 8107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 8134 8580 gene locus_tag LOCUS_40400 8134 8580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 8601 9443 gene locus_tag LOCUS_40410 8601 9443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 9770 10258 gene locus_tag LOCUS_40420 9770 10258 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_40420 10642 11064 gene locus_tag LOCUS_40430 10642 11064 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814175.1 protein_id gnl|my_center|LOCUS_40430 11095 13815 gene locus_tag LOCUS_40440 11095 13815 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_40440 13812 14183 gene locus_tag LOCUS_40450 13812 14183 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774977.1 protein_id gnl|my_center|LOCUS_40450 14351 15112 gene locus_tag LOCUS_40460 14351 15112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 15139 15432 gene locus_tag LOCUS_40470 15139 15432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 15464 16528 gene locus_tag LOCUS_40480 15464 16528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 16593 17057 gene locus_tag LOCUS_40490 16593 17057 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966110.1 protein_id gnl|my_center|LOCUS_40490 17088 17528 gene locus_tag LOCUS_40500 17088 17528 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974303.1 protein_id gnl|my_center|LOCUS_40500 17543 18457 gene locus_tag LOCUS_40510 17543 18457 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102581.1 protein_id gnl|my_center|LOCUS_40510 19438 18770 gene locus_tag LOCUS_40520 19438 18770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 <21335 19512 gene locus_tag LOCUS_40530 <21335 19512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007054447.1:ABC transporter ATP-binding protein/permease >Feature sequence075 200 1273 gene locus_tag LOCUS_40540 200 1273 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_40540 1731 3488 gene locus_tag LOCUS_40550 1731 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 4992 3883 gene locus_tag LOCUS_40560 4992 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 5293 5967 gene locus_tag LOCUS_40570 5293 5967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 7229 6294 gene locus_tag LOCUS_40580 7229 6294 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102088.1 protein_id gnl|my_center|LOCUS_40580 8798 7644 gene locus_tag LOCUS_40590 8798 7644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 9375 10694 gene locus_tag LOCUS_40600 9375 10694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 10676 11347 gene locus_tag LOCUS_40610 10676 11347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 11441 12520 gene locus_tag LOCUS_40620 11441 12520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 12739 13686 gene locus_tag LOCUS_40630 12739 13686 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929426.1 protein_id gnl|my_center|LOCUS_40630 13871 14821 gene locus_tag LOCUS_40640 13871 14821 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143966.1 protein_id gnl|my_center|LOCUS_40640 16850 15234 gene locus_tag LOCUS_40650 16850 15234 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_40650 18116 17673 gene locus_tag LOCUS_40660 18116 17673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 18840 18226 gene locus_tag LOCUS_40670 18840 18226 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893583.1 protein_id gnl|my_center|LOCUS_40670 19328 18891 gene locus_tag LOCUS_40680 19328 18891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 >Feature sequence076 2758 1412 gene locus_tag LOCUS_40690 2758 1412 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459580.1 protein_id gnl|my_center|LOCUS_40690 3411 2995 gene locus_tag LOCUS_40700 3411 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 4185 3535 gene locus_tag LOCUS_40710 4185 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 4511 4368 gene locus_tag LOCUS_40720 4511 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 10234 4907 gene locus_tag LOCUS_40730 10234 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 10411 10268 gene locus_tag LOCUS_40740 10411 10268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 10786 10514 gene locus_tag LOCUS_40750 10786 10514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 10668 11624 gene locus_tag LOCUS_40760 10668 11624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 12338 11628 gene locus_tag LOCUS_40770 12338 11628 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963642.1 protein_id gnl|my_center|LOCUS_40770 13860 12427 gene locus_tag LOCUS_40780 13860 12427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 14153 13914 gene locus_tag LOCUS_40790 14153 13914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 16350 14503 gene locus_tag LOCUS_40800 16350 14503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 17861 16347 gene locus_tag LOCUS_40810 17861 16347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 >Feature sequence077 1222 659 gene locus_tag LOCUS_40820 1222 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 2238 1369 gene locus_tag LOCUS_40830 2238 1369 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_40830 2725 2288 gene locus_tag LOCUS_40840 2725 2288 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288290.1 protein_id gnl|my_center|LOCUS_40840 2996 3457 gene locus_tag LOCUS_40850 2996 3457 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_40850 3492 4355 gene locus_tag LOCUS_40860 3492 4355 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 protein_id gnl|my_center|LOCUS_40860 6407 4917 gene locus_tag LOCUS_40870 6407 4917 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358244.1 protein_id gnl|my_center|LOCUS_40870 7258 6677 gene locus_tag LOCUS_40880 7258 6677 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294657.1 protein_id gnl|my_center|LOCUS_40880 10123 7352 gene locus_tag LOCUS_40890 10123 7352 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566079.1 protein_id gnl|my_center|LOCUS_40890 10821 10348 gene locus_tag LOCUS_40900 10821 10348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 11510 11073 gene locus_tag LOCUS_40910 11510 11073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 11825 11550 gene locus_tag LOCUS_40920 11825 11550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 12378 12920 gene locus_tag LOCUS_40930 gene dhaS 12378 12920 CDS product dihydroxyacetone kinase transcriptional activator DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204220.1 protein_id gnl|my_center|LOCUS_40930 13988 12966 gene locus_tag LOCUS_40940 13988 12966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 15978 14149 gene locus_tag LOCUS_40950 gene ftsH 15978 14149 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_40950 16196 16002 gene locus_tag LOCUS_40960 16196 16002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 17539 16370 gene locus_tag LOCUS_40970 17539 16370 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262240.1 protein_id gnl|my_center|LOCUS_40970 17850 19205 gene locus_tag LOCUS_40980 17850 19205 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_40980 >Feature sequence078 193 1635 gene locus_tag LOCUS_40990 193 1635 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016772.1 protein_id gnl|my_center|LOCUS_40990 1866 2369 gene locus_tag LOCUS_41000 1866 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 3215 2475 gene locus_tag LOCUS_41010 3215 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 3969 3250 gene locus_tag LOCUS_41020 3969 3250 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666599.1 protein_id gnl|my_center|LOCUS_41020 4363 4001 gene locus_tag LOCUS_41030 4363 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 5383 8073 gene locus_tag LOCUS_41040 5383 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 8990 9439 gene locus_tag LOCUS_41050 8990 9439 CDS product UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686635.1 protein_id gnl|my_center|LOCUS_41050 9474 9968 gene locus_tag LOCUS_41060 9474 9968 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578443.1 protein_id gnl|my_center|LOCUS_41060 10023 11183 gene locus_tag LOCUS_41070 10023 11183 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594817.1 protein_id gnl|my_center|LOCUS_41070 11183 11614 gene locus_tag LOCUS_41080 11183 11614 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930108.1 protein_id gnl|my_center|LOCUS_41080 11653 12786 gene locus_tag LOCUS_41090 11653 12786 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224434606.1 protein_id gnl|my_center|LOCUS_41090 12807 13301 gene locus_tag LOCUS_41100 12807 13301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 13335 13880 gene locus_tag LOCUS_41110 13335 13880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 13901 14842 gene locus_tag LOCUS_41120 13901 14842 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908873.1 protein_id gnl|my_center|LOCUS_41120 14874 16148 gene locus_tag LOCUS_41130 14874 16148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 16167 17228 gene locus_tag LOCUS_41140 16167 17228 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203004.1 protein_id gnl|my_center|LOCUS_41140 17266 18684 gene locus_tag LOCUS_41150 17266 18684 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091276.1 protein_id gnl|my_center|LOCUS_41150 >Feature sequence079 129 228 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1265 426 gene locus_tag LOCUS_41160 gene murI 1265 426 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_41160 2382 1606 gene locus_tag LOCUS_41170 2382 1606 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303217.1 protein_id gnl|my_center|LOCUS_41170 2698 6168 gene locus_tag LOCUS_41180 2698 6168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 7545 6454 gene locus_tag LOCUS_41190 7545 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 7852 7514 gene locus_tag LOCUS_41200 7852 7514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 8732 7956 gene locus_tag LOCUS_41210 8732 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 9839 10306 gene locus_tag LOCUS_41220 gene tadA 9839 10306 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832295.1 protein_id gnl|my_center|LOCUS_41220 10532 10750 gene locus_tag LOCUS_41230 10532 10750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 <18169 10872 gene locus_tag LOCUS_41240 <18169 10872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068088.1:FctA domain-containing protein >Feature sequence080 1330 239 gene locus_tag LOCUS_41250 1330 239 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107344.1 protein_id gnl|my_center|LOCUS_41250 2582 1344 gene locus_tag LOCUS_41260 2582 1344 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288208.1 protein_id gnl|my_center|LOCUS_41260 4066 3026 gene locus_tag LOCUS_41270 4066 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 4685 4116 gene locus_tag LOCUS_41280 4685 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 5916 5200 gene locus_tag LOCUS_41290 5916 5200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 7948 6860 gene locus_tag LOCUS_41300 7948 6860 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772519.1 protein_id gnl|my_center|LOCUS_41300 9119 7938 gene locus_tag LOCUS_41310 9119 7938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 10220 9129 gene locus_tag LOCUS_41320 10220 9129 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476426.1 protein_id gnl|my_center|LOCUS_41320 10964 10239 gene locus_tag LOCUS_41330 10964 10239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 11477 11172 gene locus_tag LOCUS_41340 11477 11172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 12850 11747 gene locus_tag LOCUS_41350 12850 11747 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_41350 14024 12918 gene locus_tag LOCUS_41360 14024 12918 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107244.1 protein_id gnl|my_center|LOCUS_41360 14643 14050 gene locus_tag LOCUS_41370 14643 14050 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 protein_id gnl|my_center|LOCUS_41370 14863 14675 gene locus_tag LOCUS_41380 14863 14675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 15937 16203 gene locus_tag LOCUS_41390 15937 16203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 16085 17665 gene locus_tag LOCUS_41400 16085 17665 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_41400 >Feature sequence081 1482 586 gene locus_tag LOCUS_41410 1482 586 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101570.1 protein_id gnl|my_center|LOCUS_41410 1966 1553 gene locus_tag LOCUS_41420 1966 1553 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816173.1 protein_id gnl|my_center|LOCUS_41420 3074 2115 gene locus_tag LOCUS_41430 gene moeB 3074 2115 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460729.1 protein_id gnl|my_center|LOCUS_41430 3280 3074 gene locus_tag LOCUS_41440 gene thiS 3280 3074 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945026.1 protein_id gnl|my_center|LOCUS_41440 3735 3400 gene locus_tag LOCUS_41450 gene trxA 3735 3400 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878779.1 protein_id gnl|my_center|LOCUS_41450 4172 3930 gene locus_tag LOCUS_41460 4172 3930 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816171.1 protein_id gnl|my_center|LOCUS_41460 5103 4237 gene locus_tag LOCUS_41470 5103 4237 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460728.1 protein_id gnl|my_center|LOCUS_41470 7154 5340 gene locus_tag LOCUS_41480 gene cysN 7154 5340 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 protein_id gnl|my_center|LOCUS_41480 8055 7156 gene locus_tag LOCUS_41490 gene cysD 8055 7156 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532711.1 protein_id gnl|my_center|LOCUS_41490 8616 8275 gene locus_tag LOCUS_41500 8616 8275 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963432.1 protein_id gnl|my_center|LOCUS_41500 10708 8873 gene locus_tag LOCUS_41510 10708 8873 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963431.1 protein_id gnl|my_center|LOCUS_41510 11887 10784 gene locus_tag LOCUS_41520 11887 10784 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701047.1 protein_id gnl|my_center|LOCUS_41520 12917 12084 gene locus_tag LOCUS_41530 gene cysW 12917 12084 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534651.1 protein_id gnl|my_center|LOCUS_41530 13951 13112 gene locus_tag LOCUS_41540 gene cysT 13951 13112 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227884.1 protein_id gnl|my_center|LOCUS_41540 15239 14193 gene locus_tag LOCUS_41550 15239 14193 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208965.1 protein_id gnl|my_center|LOCUS_41550 17251 15872 gene locus_tag LOCUS_41560 17251 15872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 17645 17469 gene locus_tag LOCUS_41570 17645 17469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 >Feature sequence082 1260 859 gene locus_tag LOCUS_41580 1260 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 1948 3162 gene locus_tag LOCUS_41590 1948 3162 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478434.1 protein_id gnl|my_center|LOCUS_41590 3162 3821 gene locus_tag LOCUS_41600 3162 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207502.1 protein_id gnl|my_center|LOCUS_41600 7097 4110 gene locus_tag LOCUS_41610 7097 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 7813 7445 gene locus_tag LOCUS_41620 7813 7445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 9665 7956 gene locus_tag LOCUS_41630 9665 7956 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_41630 9867 11636 gene locus_tag LOCUS_41640 9867 11636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 12238 12017 gene locus_tag LOCUS_41650 12238 12017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 14382 12427 gene locus_tag LOCUS_41660 14382 12427 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878960.1 protein_id gnl|my_center|LOCUS_41660 14809 15033 gene locus_tag LOCUS_41670 14809 15033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 <17681 15174 gene locus_tag LOCUS_41680 <17681 15174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989425.1:lmo0331 family class 1 internalin >Feature sequence083 1566 1240 gene locus_tag LOCUS_41690 1566 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 3481 2171 gene locus_tag LOCUS_41700 gene ltrA 3481 2171 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393716.1 protein_id gnl|my_center|LOCUS_41700 4825 4178 gene locus_tag LOCUS_41710 4825 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 5008 5337 gene locus_tag LOCUS_41720 5008 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 6249 6464 gene locus_tag LOCUS_41730 6249 6464 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704279.1 protein_id gnl|my_center|LOCUS_41730 6461 6886 gene locus_tag LOCUS_41740 6461 6886 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476617.1 protein_id gnl|my_center|LOCUS_41740 7982 7563 gene locus_tag LOCUS_41750 7982 7563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 8496 8368 gene locus_tag LOCUS_41760 8496 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 9355 8480 gene locus_tag LOCUS_41770 9355 8480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 9645 9382 gene locus_tag LOCUS_41780 9645 9382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 10693 10202 gene locus_tag LOCUS_41790 10693 10202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 10994 10674 gene locus_tag LOCUS_41800 10994 10674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 12391 11264 gene locus_tag LOCUS_41810 12391 11264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 13043 12873 gene locus_tag LOCUS_41820 13043 12873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 14175 13324 gene locus_tag LOCUS_41830 14175 13324 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_41830 14505 14287 gene locus_tag LOCUS_41840 14505 14287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 15479 14511 gene locus_tag LOCUS_41850 15479 14511 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107236.1 protein_id gnl|my_center|LOCUS_41850 16543 15479 gene locus_tag LOCUS_41860 16543 15479 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766018.1 protein_id gnl|my_center|LOCUS_41860 >Feature sequence084 1623 82 gene locus_tag LOCUS_41870 1623 82 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103238290.1 protein_id gnl|my_center|LOCUS_41870 2769 1651 gene locus_tag LOCUS_41880 gene glf 2769 1651 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057797519.1 protein_id gnl|my_center|LOCUS_41880 3790 2774 gene locus_tag LOCUS_41890 3790 2774 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475868.1 protein_id gnl|my_center|LOCUS_41890 4855 3842 gene locus_tag LOCUS_41900 4855 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 5858 4887 gene locus_tag LOCUS_41910 5858 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 7181 5919 gene locus_tag LOCUS_41920 7181 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 8160 7210 gene locus_tag LOCUS_41930 8160 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203008.1 protein_id gnl|my_center|LOCUS_41930 9371 8190 gene locus_tag LOCUS_41940 9371 8190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 10539 9463 gene locus_tag LOCUS_41950 10539 9463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 11855 10548 gene locus_tag LOCUS_41960 11855 10548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 12690 11869 gene locus_tag LOCUS_41970 12690 11869 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203012.1 protein_id gnl|my_center|LOCUS_41970 13634 12732 gene locus_tag LOCUS_41980 13634 12732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203008.1 protein_id gnl|my_center|LOCUS_41980 14745 13636 gene locus_tag LOCUS_41990 14745 13636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 15173 14757 gene locus_tag LOCUS_42000 15173 14757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 15663 15310 gene locus_tag LOCUS_42010 15663 15310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 15812 16039 gene locus_tag LOCUS_42020 15812 16039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 17186 16308 gene locus_tag LOCUS_42030 17186 16308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 >Feature sequence085 1289 216 gene locus_tag LOCUS_42040 1289 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 1719 1420 gene locus_tag LOCUS_42050 1719 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 1952 1716 gene locus_tag LOCUS_42060 1952 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 5623 1949 gene locus_tag LOCUS_42070 5623 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 14819 5802 gene locus_tag LOCUS_42080 14819 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 16930 14945 gene locus_tag LOCUS_42090 16930 14945 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368714.1 protein_id gnl|my_center|LOCUS_42090 >Feature sequence086 211 122 gene locus_tag LOCUS_t00490 211 122 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1575 463 gene locus_tag LOCUS_42100 gene ugpC 1575 463 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_42100 1934 2902 gene locus_tag LOCUS_42110 1934 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 3962 3225 gene locus_tag LOCUS_42120 3962 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 5735 3993 gene locus_tag LOCUS_42130 5735 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 6050 6817 gene locus_tag LOCUS_42140 gene truA 6050 6817 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986454.1 protein_id gnl|my_center|LOCUS_42140 7456 6821 gene locus_tag LOCUS_42150 7456 6821 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_42150 7747 7562 gene locus_tag LOCUS_42160 7747 7562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 8856 7852 gene locus_tag LOCUS_42170 8856 7852 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_42170 9752 8877 gene locus_tag LOCUS_42180 9752 8877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 10693 9884 gene locus_tag LOCUS_42190 10693 9884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 12475 11225 gene locus_tag LOCUS_42200 gene nagA 12475 11225 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830343.1 protein_id gnl|my_center|LOCUS_42200 14922 12745 gene locus_tag LOCUS_42210 14922 12745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 16541 15099 gene locus_tag LOCUS_42220 16541 15099 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065307.1 protein_id gnl|my_center|LOCUS_42220 >Feature sequence087 126 3674 gene locus_tag LOCUS_42230 gene brxC 126 3674 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459229.1 protein_id gnl|my_center|LOCUS_42230 3692 5143 gene locus_tag LOCUS_42240 3692 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 5156 8623 gene locus_tag LOCUS_42250 gene pglX 5156 8623 CDS product BREX-1 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022345.1 protein_id gnl|my_center|LOCUS_42250 8645 8968 gene locus_tag LOCUS_42260 8645 8968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 8988 11597 gene locus_tag LOCUS_42270 gene pglZ 8988 11597 CDS product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459232.1 protein_id gnl|my_center|LOCUS_42270 11627 11848 gene locus_tag LOCUS_42280 11627 11848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 11922 12155 gene locus_tag LOCUS_42290 11922 12155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 12173 14233 gene locus_tag LOCUS_42300 gene brxL 12173 14233 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459233.1 protein_id gnl|my_center|LOCUS_42300 14272 15222 gene locus_tag LOCUS_42310 14272 15222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 15246 15401 gene locus_tag LOCUS_42320 15246 15401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 15428 15709 gene locus_tag LOCUS_42330 15428 15709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 16159 15737 gene locus_tag LOCUS_42340 16159 15737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 >Feature sequence088 <1 753 gene locus_tag LOCUS_42350 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023395.1:class I SAM-dependent methyltransferase 750 1247 gene locus_tag LOCUS_42360 750 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 1278 1532 gene locus_tag LOCUS_42370 1278 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 1529 1801 gene locus_tag LOCUS_42380 1529 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 5844 1981 gene locus_tag LOCUS_42390 5844 1981 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460558.1 protein_id gnl|my_center|LOCUS_42390 5988 6677 gene locus_tag LOCUS_42400 5988 6677 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811882.1 protein_id gnl|my_center|LOCUS_42400 6869 7537 gene locus_tag LOCUS_42410 6869 7537 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896158.1 protein_id gnl|my_center|LOCUS_42410 7807 7607 gene locus_tag LOCUS_42420 7807 7607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 8603 7980 gene locus_tag LOCUS_42430 8603 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 9320 8619 gene locus_tag LOCUS_42440 9320 8619 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_42440 9490 10149 gene locus_tag LOCUS_42450 9490 10149 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459526.1 protein_id gnl|my_center|LOCUS_42450 10280 10624 gene locus_tag LOCUS_42460 10280 10624 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459318.1 protein_id gnl|my_center|LOCUS_42460 10621 10980 gene locus_tag LOCUS_42470 10621 10980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 11282 12076 gene locus_tag LOCUS_42480 11282 12076 CDS product 2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964779.1 protein_id gnl|my_center|LOCUS_42480 12410 14077 gene locus_tag LOCUS_42490 12410 14077 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_42490 15262 14444 gene locus_tag LOCUS_42500 gene larE 15262 14444 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584116.1 protein_id gnl|my_center|LOCUS_42500 15585 15869 gene locus_tag LOCUS_42510 15585 15869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 >Feature sequence089 1177 53 gene locus_tag LOCUS_42520 1177 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 1623 3419 gene locus_tag LOCUS_42530 1623 3419 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461398.1 protein_id gnl|my_center|LOCUS_42530 3542 5536 gene locus_tag LOCUS_42540 3542 5536 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461397.1 protein_id gnl|my_center|LOCUS_42540 5797 6474 gene locus_tag LOCUS_42550 5797 6474 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044826408.1 protein_id gnl|my_center|LOCUS_42550 6467 7519 gene locus_tag LOCUS_42560 6467 7519 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928176.1 protein_id gnl|my_center|LOCUS_42560 7571 9535 gene locus_tag LOCUS_42570 gene ftsH 7571 9535 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963922.1 protein_id gnl|my_center|LOCUS_42570 9573 11300 gene locus_tag LOCUS_42580 9573 11300 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989494.1 protein_id gnl|my_center|LOCUS_42580 11419 11865 gene locus_tag LOCUS_42590 11419 11865 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202636.1 protein_id gnl|my_center|LOCUS_42590 11996 12451 gene locus_tag LOCUS_42600 11996 12451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 12424 12705 gene locus_tag LOCUS_42610 12424 12705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 12937 15108 gene locus_tag LOCUS_42620 12937 15108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42620 15533 15808 gene locus_tag LOCUS_42630 15533 15808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 >Feature sequence090 207 5123 gene locus_tag LOCUS_42640 gene essC 207 5123 CDS product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963368.1 protein_id gnl|my_center|LOCUS_42640 5283 5867 gene locus_tag LOCUS_42650 5283 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 6122 6370 gene locus_tag LOCUS_42660 6122 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 6537 6839 gene locus_tag LOCUS_42670 6537 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 6934 7272 gene locus_tag LOCUS_42680 6934 7272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 7495 7812 gene locus_tag LOCUS_42690 7495 7812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 8125 8424 gene locus_tag LOCUS_42700 8125 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 8715 9035 gene locus_tag LOCUS_42710 8715 9035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 9059 9601 gene locus_tag LOCUS_42720 9059 9601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 9598 9732 gene locus_tag LOCUS_42730 9598 9732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 9725 15199 gene locus_tag LOCUS_42740 9725 15199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 >Feature sequence091 199 1119 gene locus_tag LOCUS_42750 199 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_42750 1132 2142 gene locus_tag LOCUS_42760 1132 2142 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 protein_id gnl|my_center|LOCUS_42760 3212 2223 gene locus_tag LOCUS_42770 3212 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 3625 3437 gene locus_tag LOCUS_42780 3625 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 4324 3701 gene locus_tag LOCUS_42790 4324 3701 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287965.1 protein_id gnl|my_center|LOCUS_42790 5309 4326 gene locus_tag LOCUS_42800 5309 4326 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459857.1 protein_id gnl|my_center|LOCUS_42800 5908 5687 gene locus_tag LOCUS_42810 5908 5687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 6146 5892 gene locus_tag LOCUS_42820 6146 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 6924 6592 gene locus_tag LOCUS_42830 6924 6592 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155673.1 protein_id gnl|my_center|LOCUS_42830 8486 7842 gene locus_tag LOCUS_42840 8486 7842 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065188.1 protein_id gnl|my_center|LOCUS_42840 8768 8520 gene locus_tag LOCUS_42850 8768 8520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 9239 8895 gene locus_tag LOCUS_42860 9239 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 9811 9272 gene locus_tag LOCUS_42870 9811 9272 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905720.1 protein_id gnl|my_center|LOCUS_42870 10493 11173 gene locus_tag LOCUS_42880 10493 11173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814794.1 protein_id gnl|my_center|LOCUS_42880 11729 11316 gene locus_tag LOCUS_42890 11729 11316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42890 12463 11750 gene locus_tag LOCUS_42900 12463 11750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 12937 12647 gene locus_tag LOCUS_42910 12937 12647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 13559 13230 gene locus_tag LOCUS_42920 13559 13230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 13726 14079 gene locus_tag LOCUS_42930 13726 14079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 >Feature sequence092 2235 1144 gene locus_tag LOCUS_42940 2235 1144 CDS product acyl-protein synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707830.1 protein_id gnl|my_center|LOCUS_42940 2956 2264 gene locus_tag LOCUS_42950 2956 2264 CDS product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172947.1 protein_id gnl|my_center|LOCUS_42950 4358 2949 gene locus_tag LOCUS_42960 4358 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 4584 4345 gene locus_tag LOCUS_42970 4584 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 5635 4604 gene locus_tag LOCUS_42980 5635 4604 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044860.1 protein_id gnl|my_center|LOCUS_42980 7432 5648 gene locus_tag LOCUS_42990 gene ilvB 7432 5648 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182646.1 protein_id gnl|my_center|LOCUS_42990 7918 7439 gene locus_tag LOCUS_43000 gene fabZ 7918 7439 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723457.1 protein_id gnl|my_center|LOCUS_43000 9002 7935 gene locus_tag LOCUS_43010 9002 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 10045 9080 gene locus_tag LOCUS_43020 10045 9080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 11394 10267 gene locus_tag LOCUS_43030 11394 10267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 12941 11397 gene locus_tag LOCUS_43040 12941 11397 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103238290.1 protein_id gnl|my_center|LOCUS_43040 14554 13037 gene locus_tag LOCUS_43050 14554 13037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 >Feature sequence093 1304 396 gene locus_tag LOCUS_43060 1304 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 1418 2215 gene locus_tag LOCUS_43070 1418 2215 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 protein_id gnl|my_center|LOCUS_43070 2237 2746 gene locus_tag LOCUS_43080 2237 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 2786 3436 gene locus_tag LOCUS_43090 2786 3436 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208082.1 protein_id gnl|my_center|LOCUS_43090 3506 4843 gene locus_tag LOCUS_43100 3506 4843 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_43100 6347 5142 gene locus_tag LOCUS_43110 6347 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 9381 6352 gene locus_tag LOCUS_43120 9381 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 10487 9486 gene locus_tag LOCUS_43130 10487 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 10791 10462 gene locus_tag LOCUS_43140 10791 10462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 11937 11317 gene locus_tag LOCUS_43150 11937 11317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 12266 11910 gene locus_tag LOCUS_43160 12266 11910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 13428 13084 gene locus_tag LOCUS_43170 13428 13084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 13961 13584 gene locus_tag LOCUS_43180 13961 13584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 >Feature sequence094 90 893 gene locus_tag LOCUS_43190 90 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 1685 2023 gene locus_tag LOCUS_43200 1685 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 2182 2334 gene locus_tag LOCUS_43210 2182 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 2578 4047 gene locus_tag LOCUS_43220 2578 4047 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195154.1 protein_id gnl|my_center|LOCUS_43220 4087 5343 gene locus_tag LOCUS_43230 4087 5343 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436123.1 protein_id gnl|my_center|LOCUS_43230 5585 7120 gene locus_tag LOCUS_43240 5585 7120 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861709.1 protein_id gnl|my_center|LOCUS_43240 7117 7791 gene locus_tag LOCUS_43250 7117 7791 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436119.1 protein_id gnl|my_center|LOCUS_43250 7853 9187 gene locus_tag LOCUS_43260 gene dsdA 7853 9187 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658347.1 protein_id gnl|my_center|LOCUS_43260 10197 9310 gene locus_tag LOCUS_43270 gene rpoD 10197 9310 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254377.1 protein_id gnl|my_center|LOCUS_43270 10512 11183 gene locus_tag LOCUS_43280 10512 11183 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271956.1 protein_id gnl|my_center|LOCUS_43280 11533 13374 gene locus_tag LOCUS_43290 11533 13374 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_43290 <13971 13453 gene locus_tag LOCUS_43300 <13971 13453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003321939.1:tyrosine-type recombinase/integrase >Feature sequence095 732 385 gene locus_tag LOCUS_43310 732 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 3667 1478 gene locus_tag LOCUS_43320 gene nrdD 3667 1478 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187775.1 protein_id gnl|my_center|LOCUS_43320 4182 4379 gene locus_tag LOCUS_43330 4182 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 4351 4788 gene locus_tag LOCUS_43340 4351 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 5050 5181 gene locus_tag LOCUS_43350 5050 5181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 5178 5993 gene locus_tag LOCUS_43360 5178 5993 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_43360 5953 6903 gene locus_tag LOCUS_43370 5953 6903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 7056 7493 gene locus_tag LOCUS_43380 7056 7493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 7600 8832 gene locus_tag LOCUS_43390 7600 8832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 8909 9082 gene locus_tag LOCUS_43400 8909 9082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 9092 9664 gene locus_tag LOCUS_43410 9092 9664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 9723 11303 gene locus_tag LOCUS_43420 9723 11303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 11573 12421 gene locus_tag LOCUS_43430 gene srtB 11573 12421 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989918.1 protein_id gnl|my_center|LOCUS_43430 13460 12702 gene locus_tag LOCUS_43440 13460 12702 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890462.1 protein_id gnl|my_center|LOCUS_43440 >Feature sequence096 1059 622 gene locus_tag LOCUS_43450 1059 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 1309 1187 gene locus_tag LOCUS_43460 1309 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 1925 1311 gene locus_tag LOCUS_43470 1925 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 2527 1940 gene locus_tag LOCUS_43480 2527 1940 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065212.1 protein_id gnl|my_center|LOCUS_43480 3579 2530 gene locus_tag LOCUS_43490 3579 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 3879 3706 gene locus_tag LOCUS_43500 3879 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 4116 4466 gene locus_tag LOCUS_43510 4116 4466 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_43510 4601 4873 gene locus_tag LOCUS_43520 4601 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 5005 6591 gene locus_tag LOCUS_43530 5005 6591 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_43530 6584 8086 gene locus_tag LOCUS_43540 6584 8086 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_43540 8448 8134 gene locus_tag LOCUS_43550 8448 8134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 8636 9151 gene locus_tag LOCUS_43560 8636 9151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 9191 9862 gene locus_tag LOCUS_43570 9191 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 11240 10473 gene locus_tag LOCUS_43580 11240 10473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 11974 12843 gene locus_tag LOCUS_43590 gene thiD 11974 12843 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_43590 >Feature sequence097 725 135 gene locus_tag LOCUS_43600 725 135 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949129.1 protein_id gnl|my_center|LOCUS_43600 1096 1326 gene locus_tag LOCUS_43610 1096 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 1323 1547 gene locus_tag LOCUS_43620 1323 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 1656 4541 gene locus_tag LOCUS_43630 1656 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 4871 5281 gene locus_tag LOCUS_43640 4871 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 5606 7072 gene locus_tag LOCUS_43650 gene rlmD 5606 7072 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021134739.1 protein_id gnl|my_center|LOCUS_43650 7367 7600 gene locus_tag LOCUS_43660 7367 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 7636 8016 gene locus_tag LOCUS_43670 7636 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 8013 8177 gene locus_tag LOCUS_43680 8013 8177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 8377 9168 gene locus_tag LOCUS_43690 8377 9168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 9278 10678 gene locus_tag LOCUS_43700 9278 10678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 10639 11592 gene locus_tag LOCUS_43710 10639 11592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43710 11477 11947 gene locus_tag LOCUS_43720 11477 11947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43720 11941 12282 gene locus_tag LOCUS_43730 11941 12282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 12438 12701 gene locus_tag LOCUS_43740 12438 12701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 >Feature sequence098 344 21 gene locus_tag LOCUS_43750 344 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 1963 371 gene locus_tag LOCUS_43760 1963 371 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_43760 3665 1965 gene locus_tag LOCUS_43770 3665 1965 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_43770 5179 3683 gene locus_tag LOCUS_43780 5179 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 6825 5176 gene locus_tag LOCUS_43790 6825 5176 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_43790 7316 7044 gene locus_tag LOCUS_43800 7316 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 7888 8280 gene locus_tag LOCUS_43810 7888 8280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 8252 9922 gene locus_tag LOCUS_43820 8252 9922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 10707 9991 gene locus_tag LOCUS_43830 10707 9991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 11791 10751 gene locus_tag LOCUS_43840 11791 10751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 >Feature sequence099 1331 291 gene locus_tag LOCUS_43850 1331 291 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256572.1 protein_id gnl|my_center|LOCUS_43850 3393 1801 gene locus_tag LOCUS_43860 3393 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 3734 3486 gene locus_tag LOCUS_43870 3734 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 4772 4011 gene locus_tag LOCUS_43880 4772 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 5931 4762 gene locus_tag LOCUS_43890 5931 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 6202 6023 gene locus_tag LOCUS_43900 6202 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 11115 6448 gene locus_tag LOCUS_43910 11115 6448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 11349 11218 gene locus_tag LOCUS_43920 11349 11218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 <12324 11309 gene locus_tag LOCUS_43930 <12324 11309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000031832.1:recombinase family protein >Feature sequence100 733 278 gene locus_tag LOCUS_43940 733 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 2169 730 gene locus_tag LOCUS_43950 2169 730 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525355.1 protein_id gnl|my_center|LOCUS_43950 3065 2172 gene locus_tag LOCUS_43960 3065 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 4215 3058 gene locus_tag LOCUS_43970 4215 3058 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066004.1 protein_id gnl|my_center|LOCUS_43970 4566 4276 gene locus_tag LOCUS_43980 4566 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 5814 4582 gene locus_tag LOCUS_43990 5814 4582 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225872.1 protein_id gnl|my_center|LOCUS_43990 6703 5804 gene locus_tag LOCUS_44000 6703 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 9285 6760 gene locus_tag LOCUS_44010 9285 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 11401 9689 gene locus_tag LOCUS_44020 11401 9689 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_44020 >Feature sequence101 36 725 gene locus_tag LOCUS_44030 36 725 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545344.1 protein_id gnl|my_center|LOCUS_44030 826 1068 gene locus_tag LOCUS_44040 826 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 1094 1372 gene locus_tag LOCUS_44050 1094 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 1406 1834 gene locus_tag LOCUS_44060 1406 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 1958 2608 gene locus_tag LOCUS_44070 1958 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 2627 3301 gene locus_tag LOCUS_44080 2627 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 3302 3436 gene locus_tag LOCUS_44090 3302 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 4057 5265 gene locus_tag LOCUS_44100 4057 5265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 5337 6287 gene locus_tag LOCUS_44110 5337 6287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 6300 8687 gene locus_tag LOCUS_44120 6300 8687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 8997 8818 gene locus_tag LOCUS_44130 8997 8818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 9225 9019 gene locus_tag LOCUS_44140 9225 9019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 10312 9212 gene locus_tag LOCUS_44150 10312 9212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 10600 11052 gene locus_tag LOCUS_44160 10600 11052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 11879 11154 gene locus_tag LOCUS_44170 11879 11154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 >Feature sequence102 140 1207 gene locus_tag LOCUS_44180 140 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 1281 1736 gene locus_tag LOCUS_44190 1281 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 1974 1780 gene locus_tag LOCUS_44200 1974 1780 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_44200 2233 1976 gene locus_tag LOCUS_44210 2233 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 2511 2260 gene locus_tag LOCUS_44220 2511 2260 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_44220 2717 2514 gene locus_tag LOCUS_44230 2717 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 3043 3312 gene locus_tag LOCUS_44240 3043 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 3328 3546 gene locus_tag LOCUS_44250 3328 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 3816 3652 gene locus_tag LOCUS_44260 3816 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 4234 3839 gene locus_tag LOCUS_44270 4234 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 4695 4369 gene locus_tag LOCUS_44280 4695 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 5573 4722 gene locus_tag LOCUS_44290 5573 4722 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965236.1 protein_id gnl|my_center|LOCUS_44290 5839 5570 gene locus_tag LOCUS_44300 5839 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 6308 5823 gene locus_tag LOCUS_44310 6308 5823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 6645 6358 gene locus_tag LOCUS_44320 6645 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 7522 6635 gene locus_tag LOCUS_44330 7522 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 8055 7537 gene locus_tag LOCUS_44340 8055 7537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 8249 8052 gene locus_tag LOCUS_44350 8249 8052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 8454 9056 gene locus_tag LOCUS_44360 8454 9056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 10349 9363 gene locus_tag LOCUS_44370 10349 9363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 11202 10918 gene locus_tag LOCUS_44380 11202 10918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 11542 11192 gene locus_tag LOCUS_44390 11542 11192 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461083.1 protein_id gnl|my_center|LOCUS_44390 >Feature sequence103 170 562 gene locus_tag LOCUS_44400 170 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 608 1168 gene locus_tag LOCUS_44410 608 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 1295 1651 gene locus_tag LOCUS_44420 1295 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 2550 2798 gene locus_tag LOCUS_44430 2550 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 3096 2857 gene locus_tag LOCUS_44440 3096 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 3505 4125 gene locus_tag LOCUS_44450 3505 4125 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_44450 4663 4962 gene locus_tag LOCUS_44460 4663 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 4959 5702 gene locus_tag LOCUS_44470 4959 5702 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262663.1 protein_id gnl|my_center|LOCUS_44470 5707 6102 gene locus_tag LOCUS_44480 5707 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 6099 6386 gene locus_tag LOCUS_44490 6099 6386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 6451 6606 gene locus_tag LOCUS_44500 6451 6606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 6826 6966 gene locus_tag LOCUS_44510 6826 6966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 7622 7906 gene locus_tag LOCUS_44520 7622 7906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 7972 8439 gene locus_tag LOCUS_44530 7972 8439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44530 8426 9088 gene locus_tag LOCUS_44540 8426 9088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44540 9082 9477 gene locus_tag LOCUS_44550 9082 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 9938 10318 gene locus_tag LOCUS_44560 9938 10318 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459154.1 protein_id gnl|my_center|LOCUS_44560 11318 10536 gene locus_tag LOCUS_44570 11318 10536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 >Feature sequence104 1543 347 gene locus_tag LOCUS_44580 1543 347 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287705.1 protein_id gnl|my_center|LOCUS_44580 2912 1698 gene locus_tag LOCUS_44590 2912 1698 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531626.1 protein_id gnl|my_center|LOCUS_44590 3229 2981 gene locus_tag LOCUS_44600 3229 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 3749 3219 gene locus_tag LOCUS_44610 3749 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 4735 4283 gene locus_tag LOCUS_44620 4735 4283 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272720.1 protein_id gnl|my_center|LOCUS_44620 5255 5587 gene locus_tag LOCUS_44630 5255 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 6396 5701 gene locus_tag LOCUS_44640 6396 5701 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929879.1 protein_id gnl|my_center|LOCUS_44640 7314 6412 gene locus_tag LOCUS_44650 7314 6412 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020423.1 protein_id gnl|my_center|LOCUS_44650 8384 7326 gene locus_tag LOCUS_44660 8384 7326 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_44660 9353 8406 gene locus_tag LOCUS_44670 9353 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 10198 9506 gene locus_tag LOCUS_44680 10198 9506 CDS product DUF4405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211250.1 protein_id gnl|my_center|LOCUS_44680 >Feature sequence105 2994 442 gene locus_tag LOCUS_44690 2994 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 3100 3993 gene locus_tag LOCUS_44700 3100 3993 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262369.1 protein_id gnl|my_center|LOCUS_44700 4421 3966 gene locus_tag LOCUS_44710 4421 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 4380 4835 gene locus_tag LOCUS_44720 4380 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 4828 6072 gene locus_tag LOCUS_44730 4828 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 7582 6215 gene locus_tag LOCUS_44740 7582 6215 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 protein_id gnl|my_center|LOCUS_44740 8493 8005 gene locus_tag LOCUS_44750 8493 8005 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_44750 8635 8453 gene locus_tag LOCUS_44760 8635 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 8892 9779 gene locus_tag LOCUS_44770 8892 9779 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_44770 >Feature sequence106 186 584 gene locus_tag LOCUS_44780 186 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 598 1239 gene locus_tag LOCUS_44790 gene thyX 598 1239 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393959.1 protein_id gnl|my_center|LOCUS_44790 1385 2353 gene locus_tag LOCUS_44800 1385 2353 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798895.1 protein_id gnl|my_center|LOCUS_44800 2728 4839 gene locus_tag LOCUS_44810 2728 4839 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_44810 5180 6268 gene locus_tag LOCUS_44820 5180 6268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 6490 6630 gene locus_tag LOCUS_44830 6490 6630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 6852 7718 gene locus_tag LOCUS_44840 6852 7718 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428191.1 protein_id gnl|my_center|LOCUS_44840 7825 8019 gene locus_tag LOCUS_44850 7825 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 7931 9598 gene locus_tag LOCUS_44860 7931 9598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 >Feature sequence107 1955 180 gene locus_tag LOCUS_44870 1955 180 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918506.1 protein_id gnl|my_center|LOCUS_44870 3299 2160 gene locus_tag LOCUS_44880 3299 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 3844 3335 gene locus_tag LOCUS_44890 3844 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 4143 3841 gene locus_tag LOCUS_44900 4143 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 5059 4340 gene locus_tag LOCUS_44910 5059 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 6010 5735 gene locus_tag LOCUS_44920 6010 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 7069 6059 gene locus_tag LOCUS_44930 7069 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 8755 7217 gene locus_tag LOCUS_44940 8755 7217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 9449 8745 gene locus_tag LOCUS_44950 9449 8745 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426384.1 protein_id gnl|my_center|LOCUS_44950 >Feature sequence108 318 758 gene locus_tag LOCUS_44960 318 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 760 1212 gene locus_tag LOCUS_44970 760 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 1224 1382 gene locus_tag LOCUS_44980 1224 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 1824 3056 gene locus_tag LOCUS_44990 gene tyrS 1824 3056 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_44990 3328 3603 gene locus_tag LOCUS_45000 3328 3603 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458924.1 protein_id gnl|my_center|LOCUS_45000 3769 5649 gene locus_tag LOCUS_45010 3769 5649 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458920.1 protein_id gnl|my_center|LOCUS_45010 5649 5825 gene locus_tag LOCUS_45020 5649 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 6122 6931 gene locus_tag LOCUS_45030 6122 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 6955 8673 gene locus_tag LOCUS_45040 6955 8673 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458957.1 protein_id gnl|my_center|LOCUS_45040 8973 9617 gene locus_tag LOCUS_45050 8973 9617 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068399.1 protein_id gnl|my_center|LOCUS_45050 9844 9680 gene locus_tag LOCUS_45060 9844 9680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 >Feature sequence109 3716 1920 gene locus_tag LOCUS_45070 3716 1920 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814583.1 protein_id gnl|my_center|LOCUS_45070 4021 3827 gene locus_tag LOCUS_45080 4021 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 5202 3985 gene locus_tag LOCUS_45090 5202 3985 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45090 5356 5219 gene locus_tag LOCUS_45100 5356 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 5669 6256 gene locus_tag LOCUS_45110 5669 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 6498 6271 gene locus_tag LOCUS_45120 6498 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 7014 6763 gene locus_tag LOCUS_45130 7014 6763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 8290 7082 gene locus_tag LOCUS_45140 8290 7082 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020479.1 protein_id gnl|my_center|LOCUS_45140 9289 8462 gene locus_tag LOCUS_45150 9289 8462 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861832.1 protein_id gnl|my_center|LOCUS_45150 >Feature sequence110 76 288 gene locus_tag LOCUS_45160 76 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160 1070 450 gene locus_tag LOCUS_45170 1070 450 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_45170 1826 1233 gene locus_tag LOCUS_45180 1826 1233 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656771.1 protein_id gnl|my_center|LOCUS_45180 2004 1810 gene locus_tag LOCUS_45190 2004 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 2113 3027 gene locus_tag LOCUS_45200 2113 3027 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461396.1 protein_id gnl|my_center|LOCUS_45200 3024 4046 gene locus_tag LOCUS_45210 3024 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45210 4046 5227 gene locus_tag LOCUS_45220 4046 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 5508 6329 gene locus_tag LOCUS_45230 5508 6329 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_45230 7143 8024 gene locus_tag LOCUS_45240 7143 8024 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758846.1 protein_id gnl|my_center|LOCUS_45240 8067 9182 gene locus_tag LOCUS_45250 8067 9182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 >Feature sequence111 310 1275 gene locus_tag LOCUS_45260 310 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 1262 2392 gene locus_tag LOCUS_45270 1262 2392 CDS product DNA methyltransferase C1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545124.1 protein_id gnl|my_center|LOCUS_45270 2395 3882 gene locus_tag LOCUS_45280 2395 3882 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057779.1 protein_id gnl|my_center|LOCUS_45280 3885 4967 gene locus_tag LOCUS_45290 3885 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 5699 6064 gene locus_tag LOCUS_45300 5699 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 6309 6139 gene locus_tag LOCUS_45310 6309 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 6532 6302 gene locus_tag LOCUS_45320 6532 6302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 7223 6516 gene locus_tag LOCUS_45330 7223 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 7416 7736 gene locus_tag LOCUS_45340 7416 7736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 7957 8286 gene locus_tag LOCUS_45350 7957 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 8327 8791 gene locus_tag LOCUS_45360 8327 8791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 >Feature sequence112 975 1601 gene locus_tag LOCUS_45370 975 1601 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291702.1 protein_id gnl|my_center|LOCUS_45370 1868 2533 gene locus_tag LOCUS_45380 1868 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 2530 3435 gene locus_tag LOCUS_45390 2530 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 3446 4042 gene locus_tag LOCUS_45400 3446 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 4126 4944 gene locus_tag LOCUS_45410 4126 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 5008 5505 gene locus_tag LOCUS_45420 5008 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675099.1 protein_id gnl|my_center|LOCUS_45420 5528 5758 gene locus_tag LOCUS_45430 5528 5758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 5901 6689 gene locus_tag LOCUS_45440 5901 6689 CDS product 2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964779.1 protein_id gnl|my_center|LOCUS_45440 7597 8313 gene locus_tag LOCUS_45450 7597 8313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45450 >Feature sequence113 67 3780 gene locus_tag LOCUS_45460 67 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 4698 3994 gene locus_tag LOCUS_45470 4698 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 5101 4700 gene locus_tag LOCUS_45480 5101 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 5543 5091 gene locus_tag LOCUS_45490 5543 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 6335 5847 gene locus_tag LOCUS_45500 6335 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45500 6708 6340 gene locus_tag LOCUS_45510 6708 6340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45510 7903 6902 gene locus_tag LOCUS_45520 7903 6902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 >Feature sequence114 490 155 gene locus_tag LOCUS_45530 490 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 1023 487 gene locus_tag LOCUS_45540 1023 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 1348 1043 gene locus_tag LOCUS_45550 1348 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 2042 1353 gene locus_tag LOCUS_45560 2042 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 3159 2029 gene locus_tag LOCUS_45570 3159 2029 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229940.1 protein_id gnl|my_center|LOCUS_45570 3619 3161 gene locus_tag LOCUS_45580 3619 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 4005 3619 gene locus_tag LOCUS_45590 4005 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 5255 4017 gene locus_tag LOCUS_45600 5255 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 5936 5271 gene locus_tag LOCUS_45610 5936 5271 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047652.1 protein_id gnl|my_center|LOCUS_45610 6150 5926 gene locus_tag LOCUS_45620 6150 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 6270 6369 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence115 25 124 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 312 1001 gene locus_tag LOCUS_45630 312 1001 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_45630 2015 1062 gene locus_tag LOCUS_45640 2015 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 >Feature sequence116 1173 1009 gene locus_tag LOCUS_45650 1173 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 1407 1252 gene locus_tag LOCUS_45660 1407 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 1614 2207 gene locus_tag LOCUS_45670 1614 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 2260 4197 gene locus_tag LOCUS_45680 2260 4197 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951079.1 protein_id gnl|my_center|LOCUS_45680 4209 7100 gene locus_tag LOCUS_45690 4209 7100 CDS product type III restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689015.1 protein_id gnl|my_center|LOCUS_45690 >Feature sequence117 113 484 gene locus_tag LOCUS_45700 113 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 2478 781 gene locus_tag LOCUS_45710 gene tndX 2478 781 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_45710 2730 5045 gene locus_tag LOCUS_45720 2730 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 5148 4936 gene locus_tag LOCUS_45730 5148 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 5294 5476 gene locus_tag LOCUS_45740 5294 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 5473 6396 gene locus_tag LOCUS_45750 5473 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 6393 6785 gene locus_tag LOCUS_45760 6393 6785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 >Feature sequence118 256 1596 gene locus_tag LOCUS_45770 256 1596 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861931.1 protein_id gnl|my_center|LOCUS_45770 1723 3117 gene locus_tag LOCUS_45780 1723 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 3176 4036 gene locus_tag LOCUS_45790 3176 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 4190 5746 gene locus_tag LOCUS_45800 4190 5746 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890805.1 protein_id gnl|my_center|LOCUS_45800 6767 5772 gene locus_tag LOCUS_45810 6767 5772 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815867.1 protein_id gnl|my_center|LOCUS_45810 >Feature sequence119 64 243 gene locus_tag LOCUS_45820 64 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 352 1215 gene locus_tag LOCUS_45830 352 1215 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132680.1 protein_id gnl|my_center|LOCUS_45830 1227 1559 gene locus_tag LOCUS_45840 1227 1559 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355924.1 protein_id gnl|my_center|LOCUS_45840 1573 2406 gene locus_tag LOCUS_45850 1573 2406 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_45850 2882 2520 gene locus_tag LOCUS_45860 2882 2520 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_45860 3077 3706 gene locus_tag LOCUS_45870 3077 3706 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068494.1 protein_id gnl|my_center|LOCUS_45870 3796 4404 gene locus_tag LOCUS_45880 3796 4404 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066132.1 protein_id gnl|my_center|LOCUS_45880 4419 5327 gene locus_tag LOCUS_45890 4419 5327 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682144.1 protein_id gnl|my_center|LOCUS_45890 5348 6121 gene locus_tag LOCUS_45900 5348 6121 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_45900 6072 6773 gene locus_tag LOCUS_45910 6072 6773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 >Feature sequence120 1763 1257 gene locus_tag LOCUS_45920 1763 1257 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964041.1 protein_id gnl|my_center|LOCUS_45920 2035 3552 gene locus_tag LOCUS_45930 2035 3552 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966490.1 protein_id gnl|my_center|LOCUS_45930 3587 4507 gene locus_tag LOCUS_45940 3587 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 4544 4792 gene locus_tag LOCUS_45950 4544 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 4849 5778 gene locus_tag LOCUS_45960 4849 5778 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774964.1 protein_id gnl|my_center|LOCUS_45960 5920 6570 gene locus_tag LOCUS_45970 5920 6570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 >Feature sequence121 1999 1412 gene locus_tag LOCUS_45980 1999 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 3015 2170 gene locus_tag LOCUS_45990 3015 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 3520 4758 gene locus_tag LOCUS_46000 3520 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 4936 5196 gene locus_tag LOCUS_46010 4936 5196 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994775.1 protein_id gnl|my_center|LOCUS_46010 5186 5500 gene locus_tag LOCUS_46020 5186 5500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 >Feature sequence122 37 897 gene locus_tag LOCUS_46030 37 897 CDS product radical SAM mobile pair protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679438.1 protein_id gnl|my_center|LOCUS_46030 919 1545 gene locus_tag LOCUS_46040 919 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 1672 3510 gene locus_tag LOCUS_46050 1672 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 3507 4277 gene locus_tag LOCUS_46060 3507 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 4353 4979 gene locus_tag LOCUS_46070 4353 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 5188 5514 gene locus_tag LOCUS_46080 5188 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 5511 5762 gene locus_tag LOCUS_46090 5511 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 >Feature sequence123 357 19 gene locus_tag LOCUS_46100 357 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 1094 504 gene locus_tag LOCUS_46110 1094 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143443.1 protein_id gnl|my_center|LOCUS_46110 1291 1100 gene locus_tag LOCUS_46120 1291 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 1468 1638 gene locus_tag LOCUS_46130 1468 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 2023 2220 gene locus_tag LOCUS_46140 2023 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 2237 3571 gene locus_tag LOCUS_46150 2237 3571 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775456.1 protein_id gnl|my_center|LOCUS_46150 4125 5693 gene locus_tag LOCUS_46160 4125 5693 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870275.1 protein_id gnl|my_center|LOCUS_46160 5690 6019 gene locus_tag LOCUS_46170 5690 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 >Feature sequence124 <1 1062 gene locus_tag LOCUS_46180 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164996215.1:RNA-directed DNA polymerase 1031 1360 gene locus_tag LOCUS_46190 1031 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46190 1373 1714 gene locus_tag LOCUS_46200 1373 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 1732 3270 gene locus_tag LOCUS_46210 1732 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 3446 3853 gene locus_tag LOCUS_46220 3446 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 4073 4492 gene locus_tag LOCUS_46230 4073 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 4544 4915 gene locus_tag LOCUS_46240 4544 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 5066 5701 gene locus_tag LOCUS_46250 5066 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 5718 5957 gene locus_tag LOCUS_46260 5718 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 5954 6142 gene locus_tag LOCUS_46270 5954 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 6139 6387 gene locus_tag LOCUS_46280 6139 6387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 >Feature sequence125 2223 1879 gene locus_tag LOCUS_46290 2223 1879 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_46290 4193 3267 gene locus_tag LOCUS_46300 4193 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 5712 4141 gene locus_tag LOCUS_46310 5712 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 6295 5783 gene locus_tag LOCUS_46320 6295 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 >Feature sequence126 574 1287 gene locus_tag LOCUS_46330 574 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 1353 1559 gene locus_tag LOCUS_46340 1353 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 2036 1737 gene locus_tag LOCUS_46350 2036 1737 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389326.1 protein_id gnl|my_center|LOCUS_46350 2331 2065 gene locus_tag LOCUS_46360 2331 2065 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301196.1 protein_id gnl|my_center|LOCUS_46360 3770 2982 gene locus_tag LOCUS_46370 3770 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 3950 4049 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5576 5220 gene locus_tag LOCUS_46380 5576 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 >Feature sequence127 851 414 gene locus_tag LOCUS_46390 851 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 997 2655 gene locus_tag LOCUS_46400 997 2655 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_46400 <5558 3014 gene locus_tag LOCUS_46410 <5558 3014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157860391.1:leucine-rich repeat protein >Feature sequence128 123 875 gene locus_tag LOCUS_46420 123 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 1389 916 gene locus_tag LOCUS_46430 1389 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 1705 2184 gene locus_tag LOCUS_46440 1705 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 2166 2324 gene locus_tag LOCUS_46450 2166 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 2321 2671 gene locus_tag LOCUS_46460 2321 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 2685 3368 gene locus_tag LOCUS_46470 2685 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 3385 4260 gene locus_tag LOCUS_46480 3385 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 4308 4673 gene locus_tag LOCUS_46490 4308 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 >Feature sequence129 <1 608 gene locus_tag LOCUS_46500 <1 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860781.1:replication initiator protein A 605 1438 gene locus_tag LOCUS_46510 605 1438 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099498.1 protein_id gnl|my_center|LOCUS_46510 1660 1881 gene locus_tag LOCUS_46520 1660 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 2266 3981 gene locus_tag LOCUS_46530 2266 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 4475 4131 gene locus_tag LOCUS_46540 4475 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 4835 4488 gene locus_tag LOCUS_46550 4835 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 >Feature sequence130 209 709 gene locus_tag LOCUS_46560 209 709 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674090.1 protein_id gnl|my_center|LOCUS_46560 2281 812 gene locus_tag LOCUS_46570 2281 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 2645 2286 gene locus_tag LOCUS_46580 2645 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 2961 2818 gene locus_tag LOCUS_46590 2961 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 3996 3043 gene locus_tag LOCUS_46600 gene noc 3996 3043 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742837.1 protein_id gnl|my_center|LOCUS_46600 4774 3956 gene locus_tag LOCUS_46610 4774 3956 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_46610 4902 4771 gene locus_tag LOCUS_46620 4902 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 >Feature sequence131 <1 1564 gene locus_tag LOCUS_46630 <1 1564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898122.1:AAA family ATPase 2282 2821 gene locus_tag LOCUS_46640 2282 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 2818 3279 gene locus_tag LOCUS_46650 2818 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 3456 3587 gene locus_tag LOCUS_46660 3456 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 3652 4206 gene locus_tag LOCUS_46670 3652 4206 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909489.1 protein_id gnl|my_center|LOCUS_46670 4206 4463 gene locus_tag LOCUS_46680 4206 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 >Feature sequence132 <1 1516 gene locus_tag LOCUS_46690 <1 1516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898122.1:AAA family ATPase 1665 2912 gene locus_tag LOCUS_46700 1665 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 3021 3332 gene locus_tag LOCUS_46710 3021 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 4001 4756 gene locus_tag LOCUS_46720 4001 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 4753 4884 gene locus_tag LOCUS_46730 4753 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 >Feature sequence133 618 52 gene locus_tag LOCUS_46740 618 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 1229 609 gene locus_tag LOCUS_46750 1229 609 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287520.1 protein_id gnl|my_center|LOCUS_46750 1855 1364 gene locus_tag LOCUS_46760 1855 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46760 3071 2187 gene locus_tag LOCUS_46770 3071 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_46770 3493 3074 gene locus_tag LOCUS_46780 3493 3074 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510187.1 protein_id gnl|my_center|LOCUS_46780 <4847 3490 gene locus_tag LOCUS_46790 <4847 3490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461951.1:recombinase family protein >Feature sequence134 >Feature sequence135 1800 919 gene locus_tag LOCUS_46800 1800 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 2053 3939 gene locus_tag LOCUS_46810 2053 3939 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187364788.1 protein_id gnl|my_center|LOCUS_46810 4437 4084 gene locus_tag LOCUS_46820 4437 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 4606 4370 gene locus_tag LOCUS_46830 4606 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 >Feature sequence136 620 1495 gene locus_tag LOCUS_46840 620 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 1527 2222 gene locus_tag LOCUS_46850 1527 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 2246 2455 gene locus_tag LOCUS_46860 2246 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 2607 2852 gene locus_tag LOCUS_46870 2607 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 3013 3162 gene locus_tag LOCUS_46880 3013 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 3176 3334 gene locus_tag LOCUS_46890 3176 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 3351 3578 gene locus_tag LOCUS_46900 3351 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 3575 3916 gene locus_tag LOCUS_46910 3575 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 3927 4109 gene locus_tag LOCUS_46920 3927 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 4126 4542 gene locus_tag LOCUS_46930 4126 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 >Feature sequence137 90 545 gene locus_tag LOCUS_46940 90 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 1373 738 gene locus_tag LOCUS_46950 1373 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46950 1661 2269 gene locus_tag LOCUS_46960 1661 2269 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964398.1 protein_id gnl|my_center|LOCUS_46960 3741 2305 gene locus_tag LOCUS_46970 3741 2305 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366380.1 protein_id gnl|my_center|LOCUS_46970 3886 3761 gene locus_tag LOCUS_46980 3886 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 4341 3901 gene locus_tag LOCUS_46990 4341 3901 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391820.1 protein_id gnl|my_center|LOCUS_46990 >Feature sequence138 1071 493 gene locus_tag LOCUS_47000 1071 493 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674190.1 protein_id gnl|my_center|LOCUS_47000 1646 1350 gene locus_tag LOCUS_47010 1646 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 1972 2778 gene locus_tag LOCUS_47020 1972 2778 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173514171.1 protein_id gnl|my_center|LOCUS_47020 2830 3978 gene locus_tag LOCUS_47030 2830 3978 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192012225.1 protein_id gnl|my_center|LOCUS_47030 >Feature sequence139 1731 697 gene locus_tag LOCUS_47040 1731 697 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882674.1 protein_id gnl|my_center|LOCUS_47040 2686 1718 gene locus_tag LOCUS_47050 2686 1718 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053138.1 protein_id gnl|my_center|LOCUS_47050 3561 2683 gene locus_tag LOCUS_47060 gene xerD 3561 2683 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408401.1 protein_id gnl|my_center|LOCUS_47060 >Feature sequence140 288 1802 gene locus_tag LOCUS_47070 288 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47070 4071 1780 gene locus_tag LOCUS_47080 4071 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 >Feature sequence141 2709 2942 gene locus_tag LOCUS_47090 2709 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 2939 3787 gene locus_tag LOCUS_47100 2939 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 >Feature sequence142 530 856 gene locus_tag LOCUS_47110 530 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 1337 1008 gene locus_tag LOCUS_47120 gene azlD 1337 1008 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_47120 2029 1334 gene locus_tag LOCUS_47130 gene azlC 2029 1334 CDS product azaleucine resistance protein AzlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969035.1 protein_id gnl|my_center|LOCUS_47130 2600 2136 gene locus_tag LOCUS_47140 2600 2136 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911193.1 protein_id gnl|my_center|LOCUS_47140 3273 2710 gene locus_tag LOCUS_47150 3273 2710 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893583.1 protein_id gnl|my_center|LOCUS_47150 3915 3394 gene locus_tag LOCUS_47160 3915 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 >Feature sequence143 412 53 gene locus_tag LOCUS_47170 412 53 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420359.1 protein_id gnl|my_center|LOCUS_47170 535 1092 gene locus_tag LOCUS_47180 535 1092 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_47180 1089 1655 gene locus_tag LOCUS_47190 1089 1655 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023565.1 protein_id gnl|my_center|LOCUS_47190 1670 2203 gene locus_tag LOCUS_47200 1670 2203 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_47200 2207 2797 gene locus_tag LOCUS_47210 2207 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 2997 3245 gene locus_tag LOCUS_47220 2997 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 3260 3562 gene locus_tag LOCUS_47230 3260 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 3752 3910 gene locus_tag LOCUS_47240 3752 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 >Feature sequence144 1430 777 gene locus_tag LOCUS_47250 1430 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 2013 1435 gene locus_tag LOCUS_47260 2013 1435 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656771.1 protein_id gnl|my_center|LOCUS_47260 2400 2047 gene locus_tag LOCUS_47270 2400 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 3498 2488 gene locus_tag LOCUS_47280 3498 2488 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228883.1 protein_id gnl|my_center|LOCUS_47280 >Feature sequence145 354 363 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 482 601 gene locus_tag LOCUS_47290 482 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 2078 711 gene locus_tag LOCUS_47300 2078 711 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582535.1 protein_id gnl|my_center|LOCUS_47300 2609 2154 gene locus_tag LOCUS_47310 2609 2154 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966683.1 protein_id gnl|my_center|LOCUS_47310 3271 2774 gene locus_tag LOCUS_47320 3271 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 3785 3540 gene locus_tag LOCUS_47330 3785 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 >Feature sequence146 405 414 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1578 1138 gene locus_tag LOCUS_47340 1578 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 1883 1755 gene locus_tag LOCUS_47350 1883 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 3416 2127 gene locus_tag LOCUS_47360 3416 2127 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551899.1 protein_id gnl|my_center|LOCUS_47360 >Feature sequence147 83 1066 gene locus_tag LOCUS_47370 83 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460980.1 protein_id gnl|my_center|LOCUS_47370 1063 1854 gene locus_tag LOCUS_47380 1063 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 1868 2389 gene locus_tag LOCUS_47390 1868 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 2439 2645 gene locus_tag LOCUS_47400 2439 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 2766 3575 gene locus_tag LOCUS_47410 2766 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 >Feature sequence148 2789 861 gene locus_tag LOCUS_47420 2789 861 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031832.1 protein_id gnl|my_center|LOCUS_47420 3170 2985 gene locus_tag LOCUS_47430 3170 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 3563 3402 gene locus_tag LOCUS_47440 3563 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 >Feature sequence149 1983 940 gene locus_tag LOCUS_47450 1983 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 2714 1980 gene locus_tag LOCUS_47460 2714 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 3059 3466 gene locus_tag LOCUS_47470 3059 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 >Feature sequence150 1023 655 gene locus_tag LOCUS_47480 1023 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 1464 1123 gene locus_tag LOCUS_47490 1464 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 2347 1784 gene locus_tag LOCUS_47500 2347 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 2885 2244 gene locus_tag LOCUS_47510 2885 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47510 >Feature sequence151 596 1669 gene locus_tag LOCUS_47520 596 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47520 2237 1890 gene locus_tag LOCUS_47530 2237 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 2578 2252 gene locus_tag LOCUS_47540 2578 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 >Feature sequence152 451 74 gene locus_tag LOCUS_47550 451 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 968 444 gene locus_tag LOCUS_47560 968 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 2383 896 gene locus_tag LOCUS_47570 2383 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47570 3507 2383 gene locus_tag LOCUS_47580 3507 2383 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706213.1 protein_id gnl|my_center|LOCUS_47580 >Feature sequence153 <1 703 gene locus_tag LOCUS_47590 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001264517.1:response regulator transcription factor 781 2244 gene locus_tag LOCUS_47600 781 2244 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110230.1 protein_id gnl|my_center|LOCUS_47600 2465 3496 gene locus_tag LOCUS_47610 2465 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 >Feature sequence154 758 57 gene locus_tag LOCUS_47620 gene hisH 758 57 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_47620 1165 878 gene locus_tag LOCUS_47630 1165 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47630 2112 1159 gene locus_tag LOCUS_47640 2112 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 2333 2725 gene locus_tag LOCUS_47650 2333 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47650 2761 3132 gene locus_tag LOCUS_47660 2761 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 3140 3304 gene locus_tag LOCUS_47670 3140 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 >Feature sequence155 104 1360 gene locus_tag LOCUS_47680 104 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 1347 2333 gene locus_tag LOCUS_47690 1347 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 2320 3342 gene locus_tag LOCUS_47700 2320 3342 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967849.1 protein_id gnl|my_center|LOCUS_47700 >Feature sequence156 42 965 gene locus_tag LOCUS_47710 42 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 1120 1803 gene locus_tag LOCUS_47720 1120 1803 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987124.1 protein_id gnl|my_center|LOCUS_47720 1888 2520 gene locus_tag LOCUS_47730 1888 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 2517 3107 gene locus_tag LOCUS_47740 2517 3107 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203642.1 protein_id gnl|my_center|LOCUS_47740 >Feature sequence157 148 1374 gene locus_tag LOCUS_47750 148 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47750 1371 2312 gene locus_tag LOCUS_47760 1371 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 2411 3340 gene locus_tag LOCUS_47770 2411 3340 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003321939.1 protein_id gnl|my_center|LOCUS_47770 >Feature sequence158 269 2479 gene locus_tag LOCUS_47780 269 2479 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116444.1 protein_id gnl|my_center|LOCUS_47780 3138 2734 gene locus_tag LOCUS_47790 3138 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 >Feature sequence159 342 1721 gene locus_tag LOCUS_47800 342 1721 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016772.1 protein_id gnl|my_center|LOCUS_47800 2528 1722 gene locus_tag LOCUS_47810 2528 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 2527 2646 gene locus_tag LOCUS_47820 2527 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 3260 2880 gene locus_tag LOCUS_47830 3260 2880 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964778.1 protein_id gnl|my_center|LOCUS_47830 >Feature sequence160 <1 545 gene locus_tag LOCUS_47840 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640585.1:phage major capsid protein 856 1017 gene locus_tag LOCUS_47850 856 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 1091 2734 gene locus_tag LOCUS_47860 1091 2734 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680024.1 protein_id gnl|my_center|LOCUS_47860 3243 2848 gene locus_tag LOCUS_47870 3243 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 >Feature sequence161 96 1034 gene locus_tag LOCUS_47880 96 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 1087 1332 gene locus_tag LOCUS_47890 1087 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 2086 1637 gene locus_tag LOCUS_47900 2086 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47900 2436 2065 gene locus_tag LOCUS_47910 2436 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47910 >Feature sequence162 1106 456 gene locus_tag LOCUS_47920 1106 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 1670 1290 gene locus_tag LOCUS_47930 1670 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 3038 1911 gene locus_tag LOCUS_47940 3038 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 >Feature sequence163 1033 227 gene locus_tag LOCUS_47950 1033 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 2298 1033 gene locus_tag LOCUS_47960 2298 1033 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144956692.1 protein_id gnl|my_center|LOCUS_47960 2574 2936 gene locus_tag LOCUS_47970 2574 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47970 >Feature sequence164 535 239 gene locus_tag LOCUS_47980 535 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 702 532 gene locus_tag LOCUS_47990 702 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 2050 794 gene locus_tag LOCUS_48000 2050 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 2595 2047 gene locus_tag LOCUS_48010 2595 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 >Feature sequence165 990 406 gene locus_tag LOCUS_48020 990 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894741.1 protein_id gnl|my_center|LOCUS_48020 1175 987 gene locus_tag LOCUS_48030 1175 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 1600 1370 gene locus_tag LOCUS_48040 1600 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 >Feature sequence166 934 125 gene locus_tag LOCUS_48050 934 125 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_48050 2342 927 gene locus_tag LOCUS_48060 2342 927 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917061.1 protein_id gnl|my_center|LOCUS_48060 2835 2416 gene locus_tag LOCUS_48070 2835 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 >Feature sequence167 173 550 gene locus_tag LOCUS_48080 173 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48080 652 897 gene locus_tag LOCUS_48090 652 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48090 1183 2889 gene locus_tag LOCUS_48100 1183 2889 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461096.1 protein_id gnl|my_center|LOCUS_48100 >Feature sequence168 322 38 gene locus_tag LOCUS_48110 322 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 1482 319 gene locus_tag LOCUS_48120 1482 319 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399531.1 protein_id gnl|my_center|LOCUS_48120 1596 2486 gene locus_tag LOCUS_48130 1596 2486 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_48130 >Feature sequence169 140 1642 gene locus_tag LOCUS_48140 gene istA 140 1642 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083940014.1 protein_id gnl|my_center|LOCUS_48140 1635 2372 gene locus_tag LOCUS_48150 gene istB 1635 2372 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289053.1 protein_id gnl|my_center|LOCUS_48150 >Feature sequence170 2043 373 gene locus_tag LOCUS_48160 2043 373 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_48160 >Feature sequence171 1504 260 gene locus_tag LOCUS_48170 1504 260 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040680916.1 protein_id gnl|my_center|LOCUS_48170 2372 1494 gene locus_tag LOCUS_48180 2372 1494 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173514171.1 protein_id gnl|my_center|LOCUS_48180 >Feature sequence172 212 1159 gene locus_tag LOCUS_48190 212 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 1156 1734 gene locus_tag LOCUS_48200 1156 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 1715 1924 gene locus_tag LOCUS_48210 1715 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48210 2368 2135 gene locus_tag LOCUS_48220 2368 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48220 >Feature sequence173 1423 275 gene locus_tag LOCUS_48230 1423 275 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040680916.1 protein_id gnl|my_center|LOCUS_48230 2282 1416 gene locus_tag LOCUS_48240 2282 1416 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173514171.1 protein_id gnl|my_center|LOCUS_48240