>Feature sequence001 1085 507 gene locus_tag LOCUS_00010 1085 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1200 1209 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1839 1420 gene locus_tag LOCUS_00020 1839 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3132 1861 gene locus_tag LOCUS_00030 3132 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00030 4222 3212 gene locus_tag LOCUS_00040 4222 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6199 4328 gene locus_tag LOCUS_00050 6199 4328 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678765.1 protein_id gnl|my_center|LOCUS_00050 8561 6447 gene locus_tag LOCUS_00060 8561 6447 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_00060 9723 8860 gene locus_tag LOCUS_00070 gene fba 9723 8860 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_00070 11339 9846 gene locus_tag LOCUS_00080 gene thrC 11339 9846 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263406.1 protein_id gnl|my_center|LOCUS_00080 11597 12442 gene locus_tag LOCUS_00090 11597 12442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 12611 13336 gene locus_tag LOCUS_00100 gene sfsA 12611 13336 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 protein_id gnl|my_center|LOCUS_00100 13933 13562 gene locus_tag LOCUS_00110 13933 13562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 14227 14421 gene locus_tag LOCUS_00120 14227 14421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15393 14506 gene locus_tag LOCUS_00130 15393 14506 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439840.1 protein_id gnl|my_center|LOCUS_00130 16295 15405 gene locus_tag LOCUS_00140 16295 15405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17520 16333 gene locus_tag LOCUS_00150 17520 16333 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439842.1 protein_id gnl|my_center|LOCUS_00150 17829 17536 gene locus_tag LOCUS_00160 17829 17536 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439843.1 protein_id gnl|my_center|LOCUS_00160 18817 17861 gene locus_tag LOCUS_00170 18817 17861 CDS product 2-keto-3-deoxygluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422586.1 protein_id gnl|my_center|LOCUS_00170 19038 19829 gene locus_tag LOCUS_00180 19038 19829 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002793545.1 protein_id gnl|my_center|LOCUS_00180 19834 20043 gene locus_tag LOCUS_00190 19834 20043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 >Feature sequence002 194 1093 gene locus_tag LOCUS_00200 gene rfbA 194 1093 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364387.1 protein_id gnl|my_center|LOCUS_00200 1115 2137 gene locus_tag LOCUS_00210 gene rfbB 1115 2137 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_00210 2245 3105 gene locus_tag LOCUS_00220 gene rfbD 2245 3105 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664653.1 protein_id gnl|my_center|LOCUS_00220 3150 4502 gene locus_tag LOCUS_00230 gene glmM 3150 4502 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521474.1 protein_id gnl|my_center|LOCUS_00230 4824 6161 gene locus_tag LOCUS_00240 4824 6161 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047747.1 protein_id gnl|my_center|LOCUS_00240 5650 5659 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6333 7322 gene locus_tag LOCUS_00250 6333 7322 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454628.1 protein_id gnl|my_center|LOCUS_00250 7372 8739 gene locus_tag LOCUS_00260 7372 8739 CDS product NAD-binding homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390889.1 protein_id gnl|my_center|LOCUS_00260 9519 8761 gene locus_tag LOCUS_00270 9519 8761 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721684.1 protein_id gnl|my_center|LOCUS_00270 11886 9553 gene locus_tag LOCUS_00280 11886 9553 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983425.1 protein_id gnl|my_center|LOCUS_00280 13139 11871 gene locus_tag LOCUS_00290 13139 11871 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623651.1 protein_id gnl|my_center|LOCUS_00290 13852 13217 gene locus_tag LOCUS_00300 13852 13217 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220164.1 protein_id gnl|my_center|LOCUS_00300 14837 13953 gene locus_tag LOCUS_00310 14837 13953 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286319.1 protein_id gnl|my_center|LOCUS_00310 14970 16442 gene locus_tag LOCUS_00320 14970 16442 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704601.1 protein_id gnl|my_center|LOCUS_00320 >Feature sequence003 327 7 gene locus_tag LOCUS_00330 327 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 540 1409 gene locus_tag LOCUS_00340 540 1409 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438778.1 protein_id gnl|my_center|LOCUS_00340 2281 1427 gene locus_tag LOCUS_00350 2281 1427 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989572.1 protein_id gnl|my_center|LOCUS_00350 3861 2485 gene locus_tag LOCUS_00360 gene rpoN 3861 2485 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054367.1 protein_id gnl|my_center|LOCUS_00360 5952 4027 gene locus_tag LOCUS_00370 5952 4027 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_00370 6981 5974 gene locus_tag LOCUS_00380 6981 5974 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048235.1 protein_id gnl|my_center|LOCUS_00380 7799 6996 gene locus_tag LOCUS_00390 7799 6996 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437555.1 protein_id gnl|my_center|LOCUS_00390 8281 7829 gene locus_tag LOCUS_00400 8281 7829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 8761 8282 gene locus_tag LOCUS_00410 8761 8282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 10406 8748 gene locus_tag LOCUS_00420 10406 8748 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899357.1 protein_id gnl|my_center|LOCUS_00420 11703 10432 gene locus_tag LOCUS_00430 11703 10432 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206705.1 protein_id gnl|my_center|LOCUS_00430 12943 11720 gene locus_tag LOCUS_00440 12943 11720 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989913.1 protein_id gnl|my_center|LOCUS_00440 13860 12958 gene locus_tag LOCUS_00450 13860 12958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00450 14252 13908 gene locus_tag LOCUS_00460 14252 13908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00460 13941 13950 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15019 14267 gene locus_tag LOCUS_00470 15019 14267 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525160.1 protein_id gnl|my_center|LOCUS_00470 15500 15033 gene locus_tag LOCUS_00480 15500 15033 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_00480 16696 15545 gene locus_tag LOCUS_00490 16696 15545 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_00490 >Feature sequence004 1560 184 gene locus_tag LOCUS_00500 1560 184 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242083.1 protein_id gnl|my_center|LOCUS_00500 2344 1730 gene locus_tag LOCUS_00510 2344 1730 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917245.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00510 4143 2428 gene locus_tag LOCUS_00520 4143 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 5146 4265 gene locus_tag LOCUS_00530 5146 4265 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893591.1 protein_id gnl|my_center|LOCUS_00530 6659 5163 gene locus_tag LOCUS_00540 6659 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 9425 6951 gene locus_tag LOCUS_00550 gene recQ 9425 6951 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965975.1 protein_id gnl|my_center|LOCUS_00550 10914 9892 gene locus_tag LOCUS_00560 gene rihB 10914 9892 CDS product ribosylpyrimidine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415440.1 protein_id gnl|my_center|LOCUS_00560 11869 10952 gene locus_tag LOCUS_00570 11869 10952 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869315.1 protein_id gnl|my_center|LOCUS_00570 12945 11866 gene locus_tag LOCUS_00580 12945 11866 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869314.1 protein_id gnl|my_center|LOCUS_00580 14485 12947 gene locus_tag LOCUS_00590 14485 12947 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869313.1 protein_id gnl|my_center|LOCUS_00590 15649 14570 gene locus_tag LOCUS_00600 15649 14570 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869312.1 protein_id gnl|my_center|LOCUS_00600 16650 15712 gene locus_tag LOCUS_00610 16650 15712 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925117.1 protein_id gnl|my_center|LOCUS_00610 >Feature sequence005 1513 53 gene locus_tag LOCUS_00620 1513 53 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459057.1 protein_id gnl|my_center|LOCUS_00620 1804 2523 gene locus_tag LOCUS_00630 1804 2523 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249330.1 protein_id gnl|my_center|LOCUS_00630 2538 3245 gene locus_tag LOCUS_00640 2538 3245 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249330.1 protein_id gnl|my_center|LOCUS_00640 3265 4512 gene locus_tag LOCUS_00650 3265 4512 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083638.1 protein_id gnl|my_center|LOCUS_00650 4492 4501 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4506 4652 gene locus_tag LOCUS_00660 4506 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 4807 6279 gene locus_tag LOCUS_00670 4807 6279 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876596.1 protein_id gnl|my_center|LOCUS_00670 6292 7158 gene locus_tag LOCUS_00680 6292 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00680 6315 6324 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7018 7027 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7044 7553 gene locus_tag LOCUS_00690 7044 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00690 7546 9702 gene locus_tag LOCUS_00700 7546 9702 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861481.1 protein_id gnl|my_center|LOCUS_00700 9702 10223 gene locus_tag LOCUS_00710 9702 10223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 10223 11236 gene locus_tag LOCUS_00720 10223 11236 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960316.1 protein_id gnl|my_center|LOCUS_00720 11407 12810 gene locus_tag LOCUS_00730 11407 12810 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390736.1 protein_id gnl|my_center|LOCUS_00730 12890 14218 gene locus_tag LOCUS_00740 12890 14218 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963927.1 protein_id gnl|my_center|LOCUS_00740 14231 15550 gene locus_tag LOCUS_00750 gene emmdR 14231 15550 CDS product multidrug efflux MATE transporter EmmdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120727113.1 protein_id gnl|my_center|LOCUS_00750 >Feature sequence006 <1 1224 gene locus_tag LOCUS_00760 <1 1224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002469221.1:sensor histidine kinase 1995 1210 gene locus_tag LOCUS_00770 1995 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 2760 2032 gene locus_tag LOCUS_00780 2760 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 3397 2813 gene locus_tag LOCUS_00790 3397 2813 CDS product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862020.1 protein_id gnl|my_center|LOCUS_00790 4570 3458 gene locus_tag LOCUS_00800 gene buk 4570 3458 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964967.1 protein_id gnl|my_center|LOCUS_00800 5586 4567 gene locus_tag LOCUS_00810 gene pta 5586 4567 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965049.1 protein_id gnl|my_center|LOCUS_00810 5861 5622 gene locus_tag LOCUS_00820 5861 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 6335 5922 gene locus_tag LOCUS_00830 6335 5922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 7106 6354 gene locus_tag LOCUS_00840 7106 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 7656 7006 gene locus_tag LOCUS_00850 7656 7006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 7118 7127 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7793 9343 gene locus_tag LOCUS_00860 7793 9343 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345596.1 protein_id gnl|my_center|LOCUS_00860 9500 9997 gene locus_tag LOCUS_00870 9500 9997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 10949 10377 gene locus_tag LOCUS_00880 10949 10377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 13053 10963 gene locus_tag LOCUS_00890 13053 10963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 14577 13090 gene locus_tag LOCUS_00900 14577 13090 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102053.1 protein_id gnl|my_center|LOCUS_00900 >Feature sequence007 87 962 gene locus_tag LOCUS_00910 87 962 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262369.1 protein_id gnl|my_center|LOCUS_00910 944 1261 gene locus_tag LOCUS_00920 944 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 1267 2664 gene locus_tag LOCUS_00930 1267 2664 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198738.1 protein_id gnl|my_center|LOCUS_00930 1504 1513 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2872 3474 gene locus_tag LOCUS_00940 2872 3474 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922270.1 protein_id gnl|my_center|LOCUS_00940 3526 4302 gene locus_tag LOCUS_00950 3526 4302 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014635952.1 protein_id gnl|my_center|LOCUS_00950 4289 6103 gene locus_tag LOCUS_00960 4289 6103 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021751.1 protein_id gnl|my_center|LOCUS_00960 6087 6632 gene locus_tag LOCUS_00970 6087 6632 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932755.1 protein_id gnl|my_center|LOCUS_00970 6704 7120 gene locus_tag LOCUS_00980 6704 7120 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_00980 7307 7708 gene locus_tag LOCUS_00990 7307 7708 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461119.1 protein_id gnl|my_center|LOCUS_00990 7680 8066 gene locus_tag LOCUS_01000 7680 8066 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813896.1 protein_id gnl|my_center|LOCUS_01000 10011 8287 gene locus_tag LOCUS_01010 10011 8287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 10886 10095 gene locus_tag LOCUS_01020 10886 10095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 12226 10931 gene locus_tag LOCUS_01030 12226 10931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 12610 13134 gene locus_tag LOCUS_01040 12610 13134 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_01040 13258 13267 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13348 14670 gene locus_tag LOCUS_01050 gene murC 13348 14670 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966501.1 protein_id gnl|my_center|LOCUS_01050 >Feature sequence008 413 1234 gene locus_tag LOCUS_01060 413 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01060 1213 1222 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1592 2713 gene locus_tag LOCUS_01070 1592 2713 CDS product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810586.1 protein_id gnl|my_center|LOCUS_01070 2727 3605 gene locus_tag LOCUS_01080 2727 3605 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460600.1 protein_id gnl|my_center|LOCUS_01080 4292 3630 gene locus_tag LOCUS_01090 4292 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 4574 4401 gene locus_tag LOCUS_01100 4574 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 5531 4710 gene locus_tag LOCUS_01110 5531 4710 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990036.1 protein_id gnl|my_center|LOCUS_01110 6243 5599 gene locus_tag LOCUS_01120 6243 5599 CDS product DUF1062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963383.1 protein_id gnl|my_center|LOCUS_01120 6639 6337 gene locus_tag LOCUS_01130 6639 6337 CDS product CD3324 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437274.1 protein_id gnl|my_center|LOCUS_01130 7621 6860 gene locus_tag LOCUS_01140 7621 6860 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_01140 8104 7625 gene locus_tag LOCUS_01150 8104 7625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 8518 8153 gene locus_tag LOCUS_01160 8518 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 8952 8647 gene locus_tag LOCUS_01170 8952 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 9310 8897 gene locus_tag LOCUS_01180 9310 8897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 9851 9372 gene locus_tag LOCUS_01190 gene rlmH 9851 9372 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053094.1 protein_id gnl|my_center|LOCUS_01190 10355 9855 gene locus_tag LOCUS_01200 10355 9855 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890795.1 protein_id gnl|my_center|LOCUS_01200 11152 10445 gene locus_tag LOCUS_01210 11152 10445 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_01210 11919 11212 gene locus_tag LOCUS_01220 11919 11212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 12440 12015 gene locus_tag LOCUS_01230 12440 12015 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966812.1 protein_id gnl|my_center|LOCUS_01230 12575 13345 gene locus_tag LOCUS_01240 12575 13345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 13406 13834 gene locus_tag LOCUS_01250 13406 13834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 13958 14488 gene locus_tag LOCUS_01260 13958 14488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 >Feature sequence009 1007 237 gene locus_tag LOCUS_01270 1007 237 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964806.1 protein_id gnl|my_center|LOCUS_01270 2038 1007 gene locus_tag LOCUS_01280 2038 1007 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964805.1 protein_id gnl|my_center|LOCUS_01280 2314 2150 gene locus_tag LOCUS_01290 2314 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 2738 2382 gene locus_tag LOCUS_01300 2738 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 4321 2822 gene locus_tag LOCUS_01310 4321 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 4943 4644 gene locus_tag LOCUS_01320 4943 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01320 5799 4921 gene locus_tag LOCUS_01330 5799 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01330 6314 5865 gene locus_tag LOCUS_01340 6314 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 8502 6340 gene locus_tag LOCUS_01350 8502 6340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 9972 8521 gene locus_tag LOCUS_01360 9972 8521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01360 11708 9969 gene locus_tag LOCUS_01370 11708 9969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01370 9977 9986 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13989 11884 gene locus_tag LOCUS_01380 13989 11884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 >Feature sequence010 1429 323 gene locus_tag LOCUS_01390 gene fliY 1429 323 CDS product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392326.1 protein_id gnl|my_center|LOCUS_01390 2304 1444 gene locus_tag LOCUS_01400 2304 1444 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870068.1 protein_id gnl|my_center|LOCUS_01400 2555 2349 gene locus_tag LOCUS_01410 2555 2349 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556881.1 protein_id gnl|my_center|LOCUS_01410 4351 2675 gene locus_tag LOCUS_01420 4351 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 4157 4166 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4821 4423 gene locus_tag LOCUS_01430 4821 4423 CDS product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941086.1 protein_id gnl|my_center|LOCUS_01430 5534 4893 gene locus_tag LOCUS_01440 5534 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 7034 5562 gene locus_tag LOCUS_01450 7034 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 7566 7117 gene locus_tag LOCUS_01460 7566 7117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 8893 7577 gene locus_tag LOCUS_01470 gene fliI 8893 7577 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082899.1 protein_id gnl|my_center|LOCUS_01470 9697 8906 gene locus_tag LOCUS_01480 9697 8906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 10697 9690 gene locus_tag LOCUS_01490 gene fliG 10697 9690 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460758.1 protein_id gnl|my_center|LOCUS_01490 12312 10699 gene locus_tag LOCUS_01500 12312 10699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 12648 12343 gene locus_tag LOCUS_01510 12648 12343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 14106 12904 gene locus_tag LOCUS_01520 14106 12904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 >Feature sequence011 51 1406 gene locus_tag LOCUS_01530 51 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 1502 3364 gene locus_tag LOCUS_01540 1502 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 3426 4937 gene locus_tag LOCUS_01550 3426 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 4983 5756 gene locus_tag LOCUS_01560 gene rfbF 4983 5756 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088721.1 protein_id gnl|my_center|LOCUS_01560 6146 7204 gene locus_tag LOCUS_01570 gene rfbG 6146 7204 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_01570 7411 8766 gene locus_tag LOCUS_01580 gene rfbH 7411 8766 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208596.1 protein_id gnl|my_center|LOCUS_01580 8835 9677 gene locus_tag LOCUS_01590 8835 9677 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641097.1 protein_id gnl|my_center|LOCUS_01590 9701 10636 gene locus_tag LOCUS_01600 9701 10636 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_01600 10845 11519 gene locus_tag LOCUS_01610 10845 11519 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287269.1 protein_id gnl|my_center|LOCUS_01610 11516 12751 gene locus_tag LOCUS_01620 11516 12751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 12784 14025 gene locus_tag LOCUS_01630 12784 14025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 >Feature sequence012 68 3199 gene locus_tag LOCUS_01640 68 3199 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989870.1 protein_id gnl|my_center|LOCUS_01640 3214 4221 gene locus_tag LOCUS_01650 3214 4221 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_01650 4252 5409 gene locus_tag LOCUS_01660 4252 5409 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391959.1 protein_id gnl|my_center|LOCUS_01660 5442 6410 gene locus_tag LOCUS_01670 5442 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_01670 6426 7448 gene locus_tag LOCUS_01680 6426 7448 CDS product bifunctional ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258219.1 protein_id gnl|my_center|LOCUS_01680 7448 8263 gene locus_tag LOCUS_01690 7448 8263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 8441 8280 gene locus_tag LOCUS_01700 8441 8280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 9034 8441 gene locus_tag LOCUS_01710 9034 8441 CDS product Abortive infection protein AbiEi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072726816.1 protein_id gnl|my_center|LOCUS_01710 9890 9285 gene locus_tag LOCUS_01720 9890 9285 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963621.1 protein_id gnl|my_center|LOCUS_01720 11331 9895 gene locus_tag LOCUS_01730 11331 9895 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048125.1 protein_id gnl|my_center|LOCUS_01730 12510 11494 gene locus_tag LOCUS_01740 12510 11494 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969316.1 protein_id gnl|my_center|LOCUS_01740 13928 12507 gene locus_tag LOCUS_01750 13928 12507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 >Feature sequence013 1198 794 gene locus_tag LOCUS_01760 1198 794 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213348.1 protein_id gnl|my_center|LOCUS_01760 1447 2298 gene locus_tag LOCUS_01770 1447 2298 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289273.1 protein_id gnl|my_center|LOCUS_01770 3424 2501 gene locus_tag LOCUS_01780 3424 2501 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_01780 5014 3491 gene locus_tag LOCUS_01790 gene nadB 5014 3491 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583120.1 protein_id gnl|my_center|LOCUS_01790 5592 5146 gene locus_tag LOCUS_01800 5592 5146 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964154.1 protein_id gnl|my_center|LOCUS_01800 6365 5604 gene locus_tag LOCUS_01810 gene fabG 6365 5604 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933770.1 protein_id gnl|my_center|LOCUS_01810 8275 6362 gene locus_tag LOCUS_01820 8275 6362 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_01820 9419 8307 gene locus_tag LOCUS_01830 9419 8307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 10504 9416 gene locus_tag LOCUS_01840 gene pdxA 10504 9416 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392248.1 protein_id gnl|my_center|LOCUS_01840 11400 10498 gene locus_tag LOCUS_01850 11400 10498 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126955.1 protein_id gnl|my_center|LOCUS_01850 12725 11565 gene locus_tag LOCUS_01860 12725 11565 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234754.1 protein_id gnl|my_center|LOCUS_01860 <13893 12719 gene locus_tag LOCUS_01870 <13893 12719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000783298.1:D-threonate kinase >Feature sequence014 539 390 gene locus_tag LOCUS_01880 539 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 1042 1311 gene locus_tag LOCUS_01890 1042 1311 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392904.1 protein_id gnl|my_center|LOCUS_01890 1315 1932 gene locus_tag LOCUS_01900 1315 1932 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964647.1 protein_id gnl|my_center|LOCUS_01900 3210 2047 gene locus_tag LOCUS_01910 3210 2047 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272859.1 protein_id gnl|my_center|LOCUS_01910 3838 3368 gene locus_tag LOCUS_01920 3838 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814545.1 protein_id gnl|my_center|LOCUS_01920 5430 3850 gene locus_tag LOCUS_01930 5430 3850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 6469 5915 gene locus_tag LOCUS_01940 6469 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 6665 7505 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatccacacagccctcgcaggctgtgac 9497 7905 gene locus_tag LOCUS_01950 9497 7905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 10413 9607 gene locus_tag LOCUS_01960 10413 9607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 10640 10452 gene locus_tag LOCUS_01970 10640 10452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01970 12224 10770 gene locus_tag LOCUS_01980 gene guaB 12224 10770 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965988.1 protein_id gnl|my_center|LOCUS_01980 13566 12460 gene locus_tag LOCUS_01990 13566 12460 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922787.1 protein_id gnl|my_center|LOCUS_01990 >Feature sequence015 954 2105 gene locus_tag LOCUS_02000 954 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 2159 3319 gene locus_tag LOCUS_02010 2159 3319 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891864.1 protein_id gnl|my_center|LOCUS_02010 3214 3429 gene locus_tag LOCUS_02020 3214 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 3574 3583 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4609 3707 gene locus_tag LOCUS_02030 4609 3707 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893591.1 protein_id gnl|my_center|LOCUS_02030 4826 5719 gene locus_tag LOCUS_02040 4826 5719 CDS product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007717423.1 protein_id gnl|my_center|LOCUS_02040 5759 6508 gene locus_tag LOCUS_02050 5759 6508 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969450.1 protein_id gnl|my_center|LOCUS_02050 6530 7198 gene locus_tag LOCUS_02060 6530 7198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 7221 7904 gene locus_tag LOCUS_02070 7221 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 7916 8590 gene locus_tag LOCUS_02080 7916 8590 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066872391.1 protein_id gnl|my_center|LOCUS_02080 8624 9496 gene locus_tag LOCUS_02090 8624 9496 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086624.1 protein_id gnl|my_center|LOCUS_02090 9541 11319 gene locus_tag LOCUS_02100 gene iorA 9541 11319 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430808.1 protein_id gnl|my_center|LOCUS_02100 11336 11914 gene locus_tag LOCUS_02110 11336 11914 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430806.1 protein_id gnl|my_center|LOCUS_02110 11946 13004 gene locus_tag LOCUS_02120 gene buk 11946 13004 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454677.1 protein_id gnl|my_center|LOCUS_02120 >Feature sequence016 1017 85 gene locus_tag LOCUS_02130 1017 85 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013329.1 protein_id gnl|my_center|LOCUS_02130 1876 1043 gene locus_tag LOCUS_02140 1876 1043 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256268.1 protein_id gnl|my_center|LOCUS_02140 2754 1885 gene locus_tag LOCUS_02150 2754 1885 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256269.1 protein_id gnl|my_center|LOCUS_02150 4172 2787 gene locus_tag LOCUS_02160 4172 2787 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310853.1 protein_id gnl|my_center|LOCUS_02160 5047 4202 gene locus_tag LOCUS_02170 5047 4202 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306772.1 protein_id gnl|my_center|LOCUS_02170 4918 4927 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6714 5152 gene locus_tag LOCUS_02180 6714 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 8435 6711 gene locus_tag LOCUS_02190 8435 6711 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831067.1 protein_id gnl|my_center|LOCUS_02190 10158 8617 gene locus_tag LOCUS_02200 gene gpmI 10158 8617 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_02200 11003 10251 gene locus_tag LOCUS_02210 gene tpiA 11003 10251 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_02210 12306 11092 gene locus_tag LOCUS_02220 12306 11092 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_02220 13445 12414 gene locus_tag LOCUS_02230 gene gap 13445 12414 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_02230 >Feature sequence017 72 497 gene locus_tag LOCUS_02240 72 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 566 1078 gene locus_tag LOCUS_02250 566 1078 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861759.1 protein_id gnl|my_center|LOCUS_02250 1721 1053 gene locus_tag LOCUS_02260 1721 1053 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289151.1 protein_id gnl|my_center|LOCUS_02260 3076 1784 gene locus_tag LOCUS_02270 3076 1784 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582679.1 protein_id gnl|my_center|LOCUS_02270 3277 4809 gene locus_tag LOCUS_02280 3277 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 4802 5500 gene locus_tag LOCUS_02290 4802 5500 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966938.1 protein_id gnl|my_center|LOCUS_02290 5702 6010 gene locus_tag LOCUS_02300 5702 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 6013 6216 gene locus_tag LOCUS_02310 6013 6216 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461361.1 protein_id gnl|my_center|LOCUS_02310 6216 6662 gene locus_tag LOCUS_02320 6216 6662 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964324.1 protein_id gnl|my_center|LOCUS_02320 8086 6785 gene locus_tag LOCUS_02330 8086 6785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 9446 8091 gene locus_tag LOCUS_02340 9446 8091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 10760 9546 gene locus_tag LOCUS_02350 10760 9546 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812525.1 protein_id gnl|my_center|LOCUS_02350 10974 10750 gene locus_tag LOCUS_02360 10974 10750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02360 11640 11029 gene locus_tag LOCUS_02370 11640 11029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02370 <13113 11654 gene locus_tag LOCUS_02380 <13113 11654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393835.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence018 <1 631 gene locus_tag LOCUS_02390 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003971641.1:sugar ABC transporter permease 628 1476 gene locus_tag LOCUS_02400 628 1476 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_02400 1583 2920 gene locus_tag LOCUS_02410 gene ugpB 1583 2920 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339187.1 protein_id gnl|my_center|LOCUS_02410 4242 2908 gene locus_tag LOCUS_02420 4242 2908 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250842.1 protein_id gnl|my_center|LOCUS_02420 7123 4340 gene locus_tag LOCUS_02430 7123 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 6477 6486 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7860 7423 gene locus_tag LOCUS_02440 7860 7423 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902921.1 protein_id gnl|my_center|LOCUS_02440 8490 7873 gene locus_tag LOCUS_02450 8490 7873 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_02450 8692 9582 gene locus_tag LOCUS_02460 8692 9582 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454143.1 protein_id gnl|my_center|LOCUS_02460 10079 9663 gene locus_tag LOCUS_02470 10079 9663 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068046.1 protein_id gnl|my_center|LOCUS_02470 11512 10112 gene locus_tag LOCUS_02480 gene atpD 11512 10112 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_02480 12313 11531 gene locus_tag LOCUS_02490 gene atpG 12313 11531 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_02490 12176 12185 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <12912 12333 gene locus_tag LOCUS_02500 <12912 12333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851836.1:F0F1 ATP synthase subunit alpha >Feature sequence019 53 1456 gene locus_tag LOCUS_02510 53 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 1456 1743 gene locus_tag LOCUS_02520 1456 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 1815 2900 gene locus_tag LOCUS_02530 1815 2900 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114147.1 protein_id gnl|my_center|LOCUS_02530 2945 4846 gene locus_tag LOCUS_02540 2945 4846 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957058.1 protein_id gnl|my_center|LOCUS_02540 4843 5502 gene locus_tag LOCUS_02550 gene fsa 4843 5502 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964656.1 protein_id gnl|my_center|LOCUS_02550 5522 6340 gene locus_tag LOCUS_02560 5522 6340 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_02560 6343 7275 gene locus_tag LOCUS_02570 6343 7275 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_02570 7313 8197 gene locus_tag LOCUS_02580 7313 8197 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339520.1 protein_id gnl|my_center|LOCUS_02580 8214 9041 gene locus_tag LOCUS_02590 8214 9041 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339519.1 protein_id gnl|my_center|LOCUS_02590 9178 10569 gene locus_tag LOCUS_02600 9178 10569 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339521.1 protein_id gnl|my_center|LOCUS_02600 10580 10978 gene locus_tag LOCUS_02610 10580 10978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966763.1 protein_id gnl|my_center|LOCUS_02610 11032 11373 gene locus_tag LOCUS_02620 11032 11373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 11621 12751 gene locus_tag LOCUS_02630 11621 12751 CDS product TIGR00529 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867137.1 protein_id gnl|my_center|LOCUS_02630 >Feature sequence020 984 241 gene locus_tag LOCUS_02640 gene phnF 984 241 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194085.1 protein_id gnl|my_center|LOCUS_02640 2183 1152 gene locus_tag LOCUS_02650 2183 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 3775 2471 gene locus_tag LOCUS_02660 3775 2471 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811706.1 protein_id gnl|my_center|LOCUS_02660 4289 3768 gene locus_tag LOCUS_02670 4289 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 5499 4348 gene locus_tag LOCUS_02680 5499 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 5748 5566 gene locus_tag LOCUS_02690 5748 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 5875 6246 gene locus_tag LOCUS_02700 5875 6246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 6561 6334 gene locus_tag LOCUS_02710 6561 6334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 6693 7022 gene locus_tag LOCUS_02720 6693 7022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 8121 7087 gene locus_tag LOCUS_02730 8121 7087 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731241.1 protein_id gnl|my_center|LOCUS_02730 9856 8141 gene locus_tag LOCUS_02740 9856 8141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 10856 10065 gene locus_tag LOCUS_02750 gene fabG 10856 10065 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_02750 12655 11057 gene locus_tag LOCUS_02760 12655 11057 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 protein_id gnl|my_center|LOCUS_02760 >Feature sequence021 182 499 gene locus_tag LOCUS_02770 gene rpsJ 182 499 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966413.1 protein_id gnl|my_center|LOCUS_02770 704 1339 gene locus_tag LOCUS_02780 gene rplC 704 1339 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_02780 1368 1988 gene locus_tag LOCUS_02790 gene rplD 1368 1988 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_02790 1988 2287 gene locus_tag LOCUS_02800 gene rplW 1988 2287 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_02800 2529 3374 gene locus_tag LOCUS_02810 gene rplB 2529 3374 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966409.1 protein_id gnl|my_center|LOCUS_02810 3395 3679 gene locus_tag LOCUS_02820 gene rpsS 3395 3679 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124453.1 protein_id gnl|my_center|LOCUS_02820 3711 4097 gene locus_tag LOCUS_02830 3711 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 4107 4763 gene locus_tag LOCUS_02840 gene rpsC 4107 4763 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 protein_id gnl|my_center|LOCUS_02840 4763 5200 gene locus_tag LOCUS_02850 gene rplP 4763 5200 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_02850 5190 5393 gene locus_tag LOCUS_02860 gene rpmC 5190 5393 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722500.1 protein_id gnl|my_center|LOCUS_02860 5393 5665 gene locus_tag LOCUS_02870 gene rpsQ 5393 5665 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_02870 5691 6059 gene locus_tag LOCUS_02880 gene rplN 5691 6059 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421155.1 protein_id gnl|my_center|LOCUS_02880 6073 6378 gene locus_tag LOCUS_02890 gene rplX 6073 6378 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156486.1 protein_id gnl|my_center|LOCUS_02890 6402 6941 gene locus_tag LOCUS_02900 gene rplE 6402 6941 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435673.1 protein_id gnl|my_center|LOCUS_02900 6959 7144 gene locus_tag LOCUS_02910 6959 7144 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549037.1 protein_id gnl|my_center|LOCUS_02910 7177 7578 gene locus_tag LOCUS_02920 gene rpsH 7177 7578 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357687.1 protein_id gnl|my_center|LOCUS_02920 7737 8279 gene locus_tag LOCUS_02930 gene rplF 7737 8279 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_02930 8297 8665 gene locus_tag LOCUS_02940 gene rplR 8297 8665 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_02940 8681 9190 gene locus_tag LOCUS_02950 gene rpsE 8681 9190 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421138.1 protein_id gnl|my_center|LOCUS_02950 9206 9388 gene locus_tag LOCUS_02960 gene rpmD 9206 9388 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057241.1 protein_id gnl|my_center|LOCUS_02960 9414 9854 gene locus_tag LOCUS_02970 gene rplO 9414 9854 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966393.1 protein_id gnl|my_center|LOCUS_02970 9854 11170 gene locus_tag LOCUS_02980 gene secY 9854 11170 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_02980 11270 11914 gene locus_tag LOCUS_02990 11270 11914 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966391.1 protein_id gnl|my_center|LOCUS_02990 >Feature sequence022 <1 692 gene locus_tag LOCUS_03000 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000113632.1:FadR/GntR family transcriptional regulator 883 1455 gene locus_tag LOCUS_03010 883 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03010 1416 1979 gene locus_tag LOCUS_03020 1416 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 2184 3020 gene locus_tag LOCUS_03030 2184 3020 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964760.1 protein_id gnl|my_center|LOCUS_03030 3192 4721 gene locus_tag LOCUS_03040 gene xylB 3192 4721 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170324985.1 protein_id gnl|my_center|LOCUS_03040 4789 5409 gene locus_tag LOCUS_03050 4789 5409 CDS product DUF4867 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965899.1 protein_id gnl|my_center|LOCUS_03050 5528 7012 gene locus_tag LOCUS_03060 5528 7012 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_03060 7360 8385 gene locus_tag LOCUS_03070 7360 8385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 8348 8524 gene locus_tag LOCUS_03080 8348 8524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 8517 10028 gene locus_tag LOCUS_03090 8517 10028 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288002.1 protein_id gnl|my_center|LOCUS_03090 10006 11592 gene locus_tag LOCUS_03100 10006 11592 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_03100 >Feature sequence023 114 560 gene locus_tag LOCUS_03110 114 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 607 1917 gene locus_tag LOCUS_03120 607 1917 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250842.1 protein_id gnl|my_center|LOCUS_03120 2040 2789 gene locus_tag LOCUS_03130 2040 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 2806 5133 gene locus_tag LOCUS_03140 gene xdhA 2806 5133 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393458.1 protein_id gnl|my_center|LOCUS_03140 5185 6075 gene locus_tag LOCUS_03150 gene xdhB 5185 6075 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393457.1 protein_id gnl|my_center|LOCUS_03150 6068 6553 gene locus_tag LOCUS_03160 6068 6553 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393456.1 protein_id gnl|my_center|LOCUS_03160 7264 6608 gene locus_tag LOCUS_03170 7264 6608 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627160.1 protein_id gnl|my_center|LOCUS_03170 7456 8865 gene locus_tag LOCUS_03180 7456 8865 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433878.1 protein_id gnl|my_center|LOCUS_03180 8919 10871 gene locus_tag LOCUS_03190 8919 10871 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113100.1 protein_id gnl|my_center|LOCUS_03190 10858 11130 gene locus_tag LOCUS_03200 10858 11130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 >Feature sequence024 <1 901 gene locus_tag LOCUS_03210 <1 901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948191.1:helicase-exonuclease AddAB subunit AddB 882 4862 gene locus_tag LOCUS_03220 gene addA 882 4862 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572298.1 protein_id gnl|my_center|LOCUS_03220 4881 5825 gene locus_tag LOCUS_03230 4881 5825 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812829.1 protein_id gnl|my_center|LOCUS_03230 6821 5991 gene locus_tag LOCUS_03240 6821 5991 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_03240 7018 7515 gene locus_tag LOCUS_03250 7018 7515 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288392.1 protein_id gnl|my_center|LOCUS_03250 7512 8003 gene locus_tag LOCUS_03260 gene folA 7512 8003 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_03260 8143 9057 gene locus_tag LOCUS_03270 8143 9057 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296994.1 protein_id gnl|my_center|LOCUS_03270 9093 9983 gene locus_tag LOCUS_03280 9093 9983 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896496.1 protein_id gnl|my_center|LOCUS_03280 9983 11371 gene locus_tag LOCUS_03290 gene gltA 9983 11371 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 protein_id gnl|my_center|LOCUS_03290 >Feature sequence025 870 1574 gene locus_tag LOCUS_03300 870 1574 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929879.1 protein_id gnl|my_center|LOCUS_03300 1564 2700 gene locus_tag LOCUS_03310 1564 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 2733 5309 gene locus_tag LOCUS_03320 2733 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 5309 6271 gene locus_tag LOCUS_03330 5309 6271 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330018.1 protein_id gnl|my_center|LOCUS_03330 6249 7169 gene locus_tag LOCUS_03340 6249 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 7208 8599 gene locus_tag LOCUS_03350 7208 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 8692 9702 gene locus_tag LOCUS_03360 8692 9702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289233.1 protein_id gnl|my_center|LOCUS_03360 9702 10733 gene locus_tag LOCUS_03370 9702 10733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 10984 11265 gene locus_tag LOCUS_03380 10984 11265 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003394408.1 protein_id gnl|my_center|LOCUS_03380 >Feature sequence026 <1 1263 gene locus_tag LOCUS_03390 <1 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810376.1:helix-turn-helix domain-containing protein 1774 1295 gene locus_tag LOCUS_03400 1774 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 2676 1771 gene locus_tag LOCUS_03410 2676 1771 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969293.1 protein_id gnl|my_center|LOCUS_03410 3767 2682 gene locus_tag LOCUS_03420 3767 2682 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969292.1 protein_id gnl|my_center|LOCUS_03420 5283 3757 gene locus_tag LOCUS_03430 5283 3757 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865052.1 protein_id gnl|my_center|LOCUS_03430 6497 5391 gene locus_tag LOCUS_03440 6497 5391 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869312.1 protein_id gnl|my_center|LOCUS_03440 7928 6522 gene locus_tag LOCUS_03450 7928 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 8078 9271 gene locus_tag LOCUS_03460 8078 9271 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964735.1 protein_id gnl|my_center|LOCUS_03460 10042 9284 gene locus_tag LOCUS_03470 10042 9284 CDS product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067911.1 protein_id gnl|my_center|LOCUS_03470 10247 11533 gene locus_tag LOCUS_03480 10247 11533 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067908.1 protein_id gnl|my_center|LOCUS_03480 >Feature sequence027 162 1097 gene locus_tag LOCUS_03490 162 1097 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_03490 1152 2063 gene locus_tag LOCUS_03500 1152 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 2121 3023 gene locus_tag LOCUS_03510 2121 3023 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393753.1 protein_id gnl|my_center|LOCUS_03510 3053 4012 gene locus_tag LOCUS_03520 3053 4012 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271954.1 protein_id gnl|my_center|LOCUS_03520 4168 6078 gene locus_tag LOCUS_03530 4168 6078 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943766.1 protein_id gnl|my_center|LOCUS_03530 6182 7039 gene locus_tag LOCUS_03540 6182 7039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 7083 8012 gene locus_tag LOCUS_03550 7083 8012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 8486 8028 gene locus_tag LOCUS_03560 8486 8028 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016553.1 protein_id gnl|my_center|LOCUS_03560 8657 9679 gene locus_tag LOCUS_03570 8657 9679 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_03570 9710 9880 gene locus_tag LOCUS_03580 9710 9880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 9927 10706 gene locus_tag LOCUS_03590 gene mtnP 9927 10706 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877204.1 protein_id gnl|my_center|LOCUS_03590 10720 11379 gene locus_tag LOCUS_03600 gene ppaX 10720 11379 CDS product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700956.1 protein_id gnl|my_center|LOCUS_03600 >Feature sequence028 252 1196 gene locus_tag LOCUS_03610 252 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 1235 2026 gene locus_tag LOCUS_03620 1235 2026 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160784.1 protein_id gnl|my_center|LOCUS_03620 2023 2805 gene locus_tag LOCUS_03630 gene tauC 2023 2805 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095795.1 protein_id gnl|my_center|LOCUS_03630 2784 3554 gene locus_tag LOCUS_03640 2784 3554 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_03640 3563 4306 gene locus_tag LOCUS_03650 3563 4306 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_03650 5017 4313 gene locus_tag LOCUS_03660 5017 4313 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440228.1 protein_id gnl|my_center|LOCUS_03660 5216 5698 gene locus_tag LOCUS_03670 5216 5698 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948566.1 protein_id gnl|my_center|LOCUS_03670 5765 6598 gene locus_tag LOCUS_03680 5765 6598 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016757.1 protein_id gnl|my_center|LOCUS_03680 6579 7634 gene locus_tag LOCUS_03690 6579 7634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 7650 8483 gene locus_tag LOCUS_03700 7650 8483 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766394.1 protein_id gnl|my_center|LOCUS_03700 8547 8702 gene locus_tag LOCUS_03710 8547 8702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 8665 9570 gene locus_tag LOCUS_03720 8665 9570 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549090.1 protein_id gnl|my_center|LOCUS_03720 9695 9949 gene locus_tag LOCUS_03730 9695 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 10000 11217 gene locus_tag LOCUS_03740 10000 11217 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03740 >Feature sequence029 1113 592 gene locus_tag LOCUS_03750 1113 592 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438867.1 protein_id gnl|my_center|LOCUS_03750 1748 1143 gene locus_tag LOCUS_03760 1748 1143 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905771.1 protein_id gnl|my_center|LOCUS_03760 2200 1889 gene locus_tag LOCUS_03770 2200 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 3919 2288 gene locus_tag LOCUS_03780 3919 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03780 6283 3974 gene locus_tag LOCUS_03790 6283 3974 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111154492.1 protein_id gnl|my_center|LOCUS_03790 7139 6306 gene locus_tag LOCUS_03800 7139 6306 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921761.1 protein_id gnl|my_center|LOCUS_03800 8085 7204 gene locus_tag LOCUS_03810 8085 7204 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939305.1 protein_id gnl|my_center|LOCUS_03810 9444 8143 gene locus_tag LOCUS_03820 9444 8143 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774915.1 protein_id gnl|my_center|LOCUS_03820 9720 10589 gene locus_tag LOCUS_03830 9720 10589 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909131.1 protein_id gnl|my_center|LOCUS_03830 <11487 10728 gene locus_tag LOCUS_03840 <11487 10728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681065.1:ABC transporter ATP-binding protein >Feature sequence030 1402 692 gene locus_tag LOCUS_03850 1402 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03850 2524 1514 gene locus_tag LOCUS_03860 2524 1514 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875811.1 protein_id gnl|my_center|LOCUS_03860 3089 2532 gene locus_tag LOCUS_03870 3089 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03870 4745 3093 gene locus_tag LOCUS_03880 4745 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03880 5749 4742 gene locus_tag LOCUS_03890 5749 4742 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_03890 6745 5756 gene locus_tag LOCUS_03900 6745 5756 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403393.1 protein_id gnl|my_center|LOCUS_03900 8046 6913 gene locus_tag LOCUS_03910 8046 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 9169 8060 gene locus_tag LOCUS_03920 9169 8060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 11324 9261 gene locus_tag LOCUS_03930 11324 9261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 >Feature sequence031 52 1137 gene locus_tag LOCUS_03940 52 1137 CDS product DUF917 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391754.1 protein_id gnl|my_center|LOCUS_03940 1813 1544 gene locus_tag LOCUS_03950 1813 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 2343 1810 gene locus_tag LOCUS_03960 2343 1810 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048408.1 protein_id gnl|my_center|LOCUS_03960 4037 2364 gene locus_tag LOCUS_03970 4037 2364 CDS product OPT/YSL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062285060.1 protein_id gnl|my_center|LOCUS_03970 4254 5195 gene locus_tag LOCUS_03980 4254 5195 CDS product DUF1177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391755.1 protein_id gnl|my_center|LOCUS_03980 5268 5957 gene locus_tag LOCUS_03990 5268 5957 CDS product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391756.1 protein_id gnl|my_center|LOCUS_03990 5327 5336 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5968 6909 gene locus_tag LOCUS_04000 5968 6909 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391757.1 protein_id gnl|my_center|LOCUS_04000 6993 7331 gene locus_tag LOCUS_04010 6993 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04010 7359 7652 gene locus_tag LOCUS_04020 7359 7652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04020 9201 7810 gene locus_tag LOCUS_04030 9201 7810 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891654.1 protein_id gnl|my_center|LOCUS_04030 10755 9406 gene locus_tag LOCUS_04040 10755 9406 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490912.1 protein_id gnl|my_center|LOCUS_04040 >Feature sequence032 2534 240 gene locus_tag LOCUS_04050 2534 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 3517 2672 gene locus_tag LOCUS_04060 3517 2672 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532943.1 protein_id gnl|my_center|LOCUS_04060 4626 3505 gene locus_tag LOCUS_04070 4626 3505 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963681.1 protein_id gnl|my_center|LOCUS_04070 6832 4682 gene locus_tag LOCUS_04080 6832 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 7955 6825 gene locus_tag LOCUS_04090 7955 6825 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583627.1 protein_id gnl|my_center|LOCUS_04090 9477 7948 gene locus_tag LOCUS_04100 9477 7948 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459464.1 protein_id gnl|my_center|LOCUS_04100 9966 9499 gene locus_tag LOCUS_04110 9966 9499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 11145 10063 gene locus_tag LOCUS_04120 11145 10063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 >Feature sequence033 1397 264 gene locus_tag LOCUS_04130 1397 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 2838 1753 gene locus_tag LOCUS_04140 2838 1753 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861827.1 protein_id gnl|my_center|LOCUS_04140 4402 3005 gene locus_tag LOCUS_04150 4402 3005 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298077.1 protein_id gnl|my_center|LOCUS_04150 5524 4439 gene locus_tag LOCUS_04160 5524 4439 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966073.1 protein_id gnl|my_center|LOCUS_04160 7016 5577 gene locus_tag LOCUS_04170 7016 5577 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_04170 8711 7017 gene locus_tag LOCUS_04180 gene gcl 8711 7017 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125316584.1 protein_id gnl|my_center|LOCUS_04180 9790 8825 gene locus_tag LOCUS_04190 9790 8825 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271954.1 protein_id gnl|my_center|LOCUS_04190 10642 9824 gene locus_tag LOCUS_04200 10642 9824 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393753.1 protein_id gnl|my_center|LOCUS_04200 >Feature sequence034 1110 337 gene locus_tag LOCUS_04210 gene phnC 1110 337 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567449.1 protein_id gnl|my_center|LOCUS_04210 1412 1134 gene locus_tag LOCUS_04220 1412 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 2040 1366 gene locus_tag LOCUS_04230 2040 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04230 1383 1392 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2275 2961 gene locus_tag LOCUS_04240 2275 2961 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754845.1 protein_id gnl|my_center|LOCUS_04240 5351 3102 gene locus_tag LOCUS_04250 5351 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 5928 5344 gene locus_tag LOCUS_04260 5928 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453592.1 protein_id gnl|my_center|LOCUS_04260 6802 5975 gene locus_tag LOCUS_04270 6802 5975 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051830.1 protein_id gnl|my_center|LOCUS_04270 7701 6799 gene locus_tag LOCUS_04280 7701 6799 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145161548.1 protein_id gnl|my_center|LOCUS_04280 9084 7714 gene locus_tag LOCUS_04290 9084 7714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 9289 11073 gene locus_tag LOCUS_04300 9289 11073 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_04300 >Feature sequence035 125 916 gene locus_tag LOCUS_04310 125 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 1019 1645 gene locus_tag LOCUS_04320 gene ytaF 1019 1645 CDS product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949142.1 protein_id gnl|my_center|LOCUS_04320 2204 1878 gene locus_tag LOCUS_04330 2204 1878 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944876.1 protein_id gnl|my_center|LOCUS_04330 2388 2209 gene locus_tag LOCUS_04340 2388 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 2666 2388 gene locus_tag LOCUS_04350 2666 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 2890 3405 gene locus_tag LOCUS_04360 2890 3405 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002265011.1 protein_id gnl|my_center|LOCUS_04360 3357 3542 gene locus_tag LOCUS_04370 3357 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 3575 4402 gene locus_tag LOCUS_04380 3575 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 4413 5687 gene locus_tag LOCUS_04390 gene hflX 4413 5687 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224262.1 protein_id gnl|my_center|LOCUS_04390 5915 8326 gene locus_tag LOCUS_04400 5915 8326 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_04400 7438 7447 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8336 8629 gene locus_tag LOCUS_04410 8336 8629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 9154 8717 gene locus_tag LOCUS_04420 9154 8717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 9253 11043 gene locus_tag LOCUS_04430 9253 11043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 >Feature sequence036 1611 208 gene locus_tag LOCUS_04440 gene pepV 1611 208 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048281.1 protein_id gnl|my_center|LOCUS_04440 2713 1637 gene locus_tag LOCUS_04450 2713 1637 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426912.1 protein_id gnl|my_center|LOCUS_04450 3639 2722 gene locus_tag LOCUS_04460 3639 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04460 4115 3666 gene locus_tag LOCUS_04470 4115 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04470 5427 4222 gene locus_tag LOCUS_04480 5427 4222 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016873.1 protein_id gnl|my_center|LOCUS_04480 6774 5437 gene locus_tag LOCUS_04490 6774 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 7859 6777 gene locus_tag LOCUS_04500 7859 6777 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868878.1 protein_id gnl|my_center|LOCUS_04500 9463 7862 gene locus_tag LOCUS_04510 9463 7862 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868877.1 protein_id gnl|my_center|LOCUS_04510 10841 9621 gene locus_tag LOCUS_04520 10841 9621 CDS product DUF3798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627591.1 protein_id gnl|my_center|LOCUS_04520 >Feature sequence037 192 416 gene locus_tag LOCUS_04530 192 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 468 4844 gene locus_tag LOCUS_04540 468 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 5144 5926 gene locus_tag LOCUS_04550 5144 5926 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021347.1 protein_id gnl|my_center|LOCUS_04550 5938 7380 gene locus_tag LOCUS_04560 5938 7380 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059312.1 protein_id gnl|my_center|LOCUS_04560 7397 8830 gene locus_tag LOCUS_04570 7397 8830 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039681.1 protein_id gnl|my_center|LOCUS_04570 8900 9691 gene locus_tag LOCUS_04580 8900 9691 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602471.1 protein_id gnl|my_center|LOCUS_04580 9688 10629 gene locus_tag LOCUS_04590 9688 10629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 >Feature sequence038 51 1520 gene locus_tag LOCUS_04600 gene flgK 51 1520 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228001.1 protein_id gnl|my_center|LOCUS_04600 1531 2514 gene locus_tag LOCUS_04610 1531 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 2536 3135 gene locus_tag LOCUS_04620 2536 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 3157 3603 gene locus_tag LOCUS_04630 3157 3603 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943666.1 protein_id gnl|my_center|LOCUS_04630 3597 3875 gene locus_tag LOCUS_04640 3597 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 3862 4338 gene locus_tag LOCUS_04650 3862 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 4350 7247 gene locus_tag LOCUS_04660 4350 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 7264 7644 gene locus_tag LOCUS_04670 gene fliS 7264 7644 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392287.1 protein_id gnl|my_center|LOCUS_04670 7662 8018 gene locus_tag LOCUS_04680 gene flgB 7662 8018 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 protein_id gnl|my_center|LOCUS_04680 8030 8464 gene locus_tag LOCUS_04690 gene flgC 8030 8464 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_04690 8465 9298 gene locus_tag LOCUS_04700 8465 9298 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986952.1 protein_id gnl|my_center|LOCUS_04700 9291 10181 gene locus_tag LOCUS_04710 gene fliM 9291 10181 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183958.1 protein_id gnl|my_center|LOCUS_04710 >Feature sequence039 <1 1271 gene locus_tag LOCUS_04720 <1 1271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582827.1:alpha-glucosidase/alpha-galactosidase 1268 1774 gene locus_tag LOCUS_04730 gene rpiB 1268 1774 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389089.1 protein_id gnl|my_center|LOCUS_04730 1771 2595 gene locus_tag LOCUS_04740 1771 2595 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943550.1 protein_id gnl|my_center|LOCUS_04740 2607 3536 gene locus_tag LOCUS_04750 2607 3536 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545386.1 protein_id gnl|my_center|LOCUS_04750 3555 4103 gene locus_tag LOCUS_04760 3555 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 4140 4352 gene locus_tag LOCUS_04770 4140 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 4532 4383 gene locus_tag LOCUS_04780 4532 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 5421 4525 gene locus_tag LOCUS_04790 5421 4525 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102012.1 protein_id gnl|my_center|LOCUS_04790 5545 6087 gene locus_tag LOCUS_04800 5545 6087 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_04800 6065 6907 gene locus_tag LOCUS_04810 6065 6907 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 protein_id gnl|my_center|LOCUS_04810 7012 8178 gene locus_tag LOCUS_04820 7012 8178 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107750.1 protein_id gnl|my_center|LOCUS_04820 8247 10292 gene locus_tag LOCUS_04830 8247 10292 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138304587.1 protein_id gnl|my_center|LOCUS_04830 >Feature sequence040 <1 2233 gene locus_tag LOCUS_04840 <1 2233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010773627.1:ATP-binding protein 2223 2549 gene locus_tag LOCUS_04850 2223 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 3201 3608 gene locus_tag LOCUS_04860 3201 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 4367 5521 gene locus_tag LOCUS_04870 4367 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 5644 6096 gene locus_tag LOCUS_04880 5644 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 6124 6840 gene locus_tag LOCUS_04890 6124 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 6825 7019 gene locus_tag LOCUS_04900 6825 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 7042 7509 gene locus_tag LOCUS_04910 7042 7509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04910 7555 7905 gene locus_tag LOCUS_04920 7555 7905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 7917 8540 gene locus_tag LOCUS_04930 7917 8540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 8540 8899 gene locus_tag LOCUS_04940 8540 8899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 8946 9638 gene locus_tag LOCUS_04950 8946 9638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 >Feature sequence041 2479 851 gene locus_tag LOCUS_04960 2479 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 3389 2592 gene locus_tag LOCUS_04970 3389 2592 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_04970 4348 3389 gene locus_tag LOCUS_04980 4348 3389 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811777.1 protein_id gnl|my_center|LOCUS_04980 5654 4587 gene locus_tag LOCUS_04990 5654 4587 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_04990 7209 5809 gene locus_tag LOCUS_05000 7209 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 7948 7235 gene locus_tag LOCUS_05010 7948 7235 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_05010 9028 8033 gene locus_tag LOCUS_05020 9028 8033 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948854.1 protein_id gnl|my_center|LOCUS_05020 <10156 9132 gene locus_tag LOCUS_05030 <10156 9132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_129256806.1:SulP family inorganic anion transporter >Feature sequence042 663 672 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 711 908 gene locus_tag LOCUS_05040 711 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 933 1661 gene locus_tag LOCUS_05050 933 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 1615 2340 gene locus_tag LOCUS_05060 1615 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 2358 3218 gene locus_tag LOCUS_05070 2358 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 3527 3910 gene locus_tag LOCUS_05080 3527 3910 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_05080 4212 4661 gene locus_tag LOCUS_05090 gene nusB 4212 4661 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_05090 4665 5951 gene locus_tag LOCUS_05100 gene xseA 4665 5951 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358983.1 protein_id gnl|my_center|LOCUS_05100 5955 6254 gene locus_tag LOCUS_05110 5955 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 6247 7158 gene locus_tag LOCUS_05120 6247 7158 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_05120 7189 9054 gene locus_tag LOCUS_05130 gene dxs 7189 9054 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_05130 9054 9878 gene locus_tag LOCUS_05140 9054 9878 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_05140 >Feature sequence043 2631 703 gene locus_tag LOCUS_05150 2631 703 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860962.1 protein_id gnl|my_center|LOCUS_05150 5298 2737 gene locus_tag LOCUS_05160 gene gyrA 5298 2737 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_05160 7262 5349 gene locus_tag LOCUS_05170 gene gyrB 7262 5349 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815132.1 protein_id gnl|my_center|LOCUS_05170 8393 7308 gene locus_tag LOCUS_05180 gene recF 8393 7308 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359456.1 protein_id gnl|my_center|LOCUS_05180 8557 8566 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9787 8669 gene locus_tag LOCUS_05190 gene dnaN 9787 8669 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_05190 >Feature sequence044 <1 1439 gene locus_tag LOCUS_05200 <1 1439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082593.1:ABC-ATPase domain-containing protein 1247 1256 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1513 1761 gene locus_tag LOCUS_05210 1513 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 2981 1959 gene locus_tag LOCUS_05220 2981 1959 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_05220 3292 3047 gene locus_tag LOCUS_05230 3292 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 3599 4021 gene locus_tag LOCUS_05240 3599 4021 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289317.1 protein_id gnl|my_center|LOCUS_05240 4095 5129 gene locus_tag LOCUS_05250 4095 5129 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964264.1 protein_id gnl|my_center|LOCUS_05250 5158 5370 gene locus_tag LOCUS_05260 5158 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 5456 6463 gene locus_tag LOCUS_05270 gene asnA 5456 6463 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476128.1 protein_id gnl|my_center|LOCUS_05270 6504 6776 gene locus_tag LOCUS_05280 6504 6776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05280 6819 7169 gene locus_tag LOCUS_05290 6819 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05290 8952 7285 gene locus_tag LOCUS_05300 8952 7285 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_05300 >Feature sequence045 1122 637 gene locus_tag LOCUS_05310 1122 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 1135 1144 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2315 1452 gene locus_tag LOCUS_05320 2315 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 3432 2308 gene locus_tag LOCUS_05330 gene rpoD 3432 2308 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_05330 5378 3462 gene locus_tag LOCUS_05340 5378 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 5831 5412 gene locus_tag LOCUS_05350 5831 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05350 6422 5877 gene locus_tag LOCUS_05360 6422 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05360 8352 6607 gene locus_tag LOCUS_05370 8352 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 9760 8432 gene locus_tag LOCUS_05380 9760 8432 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399312.1 protein_id gnl|my_center|LOCUS_05380 10052 9732 gene locus_tag LOCUS_05390 10052 9732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 >Feature sequence046 1 1125 gene locus_tag LOCUS_05400 1 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 1129 2964 gene locus_tag LOCUS_05410 1129 2964 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_05410 3165 4205 gene locus_tag LOCUS_05420 3165 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05420 4096 4105 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4235 5935 gene locus_tag LOCUS_05430 4235 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 5997 7688 gene locus_tag LOCUS_05440 5997 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 7750 8733 gene locus_tag LOCUS_05450 7750 8733 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764881.1 protein_id gnl|my_center|LOCUS_05450 9009 8743 gene locus_tag LOCUS_05460 9009 8743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 9708 9208 gene locus_tag LOCUS_05470 9708 9208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 >Feature sequence047 1730 714 gene locus_tag LOCUS_05480 1730 714 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704143.1 protein_id gnl|my_center|LOCUS_05480 2172 1774 gene locus_tag LOCUS_05490 2172 1774 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048257.1 protein_id gnl|my_center|LOCUS_05490 4135 2354 gene locus_tag LOCUS_05500 4135 2354 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931645.1 protein_id gnl|my_center|LOCUS_05500 4914 4198 gene locus_tag LOCUS_05510 gene rsmA 4914 4198 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294004.1 protein_id gnl|my_center|LOCUS_05510 5400 6041 gene locus_tag LOCUS_05520 5400 6041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 6907 6140 gene locus_tag LOCUS_05530 6907 6140 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_05530 7738 6950 gene locus_tag LOCUS_05540 7738 6950 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_05540 10007 7977 gene locus_tag LOCUS_05550 gene metG 10007 7977 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_05550 >Feature sequence048 81 2063 gene locus_tag LOCUS_05560 gene tkt 81 2063 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964657.1 protein_id gnl|my_center|LOCUS_05560 2306 6622 gene locus_tag LOCUS_05570 2306 6622 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272590.1 protein_id gnl|my_center|LOCUS_05570 6780 7271 gene locus_tag LOCUS_05580 6780 7271 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461280.1 protein_id gnl|my_center|LOCUS_05580 8394 7279 gene locus_tag LOCUS_05590 8394 7279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 9725 8577 gene locus_tag LOCUS_05600 9725 8577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 >Feature sequence049 132 2018 gene locus_tag LOCUS_05610 132 2018 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05610 1921 2403 gene locus_tag LOCUS_05620 1921 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 2393 4213 gene locus_tag LOCUS_05630 2393 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 4132 4141 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4152 5291 gene locus_tag LOCUS_05640 4152 5291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 5344 5910 gene locus_tag LOCUS_05650 5344 5910 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816608.1 protein_id gnl|my_center|LOCUS_05650 6140 7288 gene locus_tag LOCUS_05660 gene fucO 6140 7288 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013588.1 protein_id gnl|my_center|LOCUS_05660 7524 8318 gene locus_tag LOCUS_05670 7524 8318 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359839.1 protein_id gnl|my_center|LOCUS_05670 9776 8673 gene locus_tag LOCUS_05680 9776 8673 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881057.1 protein_id gnl|my_center|LOCUS_05680 >Feature sequence050 43 510 gene locus_tag LOCUS_05690 43 510 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892531.1 protein_id gnl|my_center|LOCUS_05690 507 791 gene locus_tag LOCUS_05700 gene gatB 507 791 CDS product PTS galactitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824293.1 protein_id gnl|my_center|LOCUS_05700 827 2179 gene locus_tag LOCUS_05710 827 2179 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490608.1 protein_id gnl|my_center|LOCUS_05710 2282 2908 gene locus_tag LOCUS_05720 2282 2908 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215708.1 protein_id gnl|my_center|LOCUS_05720 2984 5077 gene locus_tag LOCUS_05730 2984 5077 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986653.1 protein_id gnl|my_center|LOCUS_05730 5206 6264 gene locus_tag LOCUS_05740 5206 6264 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384594.1 protein_id gnl|my_center|LOCUS_05740 6267 7220 gene locus_tag LOCUS_05750 6267 7220 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966234.1 protein_id gnl|my_center|LOCUS_05750 7244 8098 gene locus_tag LOCUS_05760 7244 8098 CDS product tagatose-bisphosphate aldolase subunit GatY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861804.1 protein_id gnl|my_center|LOCUS_05760 8116 8997 gene locus_tag LOCUS_05770 8116 8997 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234196.1 protein_id gnl|my_center|LOCUS_05770 9409 9418 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence051 942 139 gene locus_tag LOCUS_05780 942 139 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819520.1 protein_id gnl|my_center|LOCUS_05780 1820 945 gene locus_tag LOCUS_05790 1820 945 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_05790 3443 1893 gene locus_tag LOCUS_05800 3443 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 5249 3462 gene locus_tag LOCUS_05810 5249 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 6834 5497 gene locus_tag LOCUS_05820 6834 5497 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455014.1 protein_id gnl|my_center|LOCUS_05820 7354 6893 gene locus_tag LOCUS_05830 7354 6893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437484.1 protein_id gnl|my_center|LOCUS_05830 8190 7369 gene locus_tag LOCUS_05840 8190 7369 CDS product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016874.1 protein_id gnl|my_center|LOCUS_05840 9281 8382 gene locus_tag LOCUS_05850 9281 8382 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025693.1 protein_id gnl|my_center|LOCUS_05850 >Feature sequence052 50 1336 gene locus_tag LOCUS_05860 50 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 1431 2336 gene locus_tag LOCUS_05870 1431 2336 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722208.1 protein_id gnl|my_center|LOCUS_05870 2348 3244 gene locus_tag LOCUS_05880 2348 3244 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776379.1 protein_id gnl|my_center|LOCUS_05880 3280 4206 gene locus_tag LOCUS_05890 3280 4206 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_05890 4210 5310 gene locus_tag LOCUS_05900 4210 5310 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_05900 5620 6846 gene locus_tag LOCUS_05910 5620 6846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 7036 8436 gene locus_tag LOCUS_05920 7036 8436 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930967.1 protein_id gnl|my_center|LOCUS_05920 8470 9531 gene locus_tag LOCUS_05930 8470 9531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 >Feature sequence053 153 365 gene locus_tag LOCUS_05940 153 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 387 2357 gene locus_tag LOCUS_05950 387 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 2645 2439 gene locus_tag LOCUS_05960 2645 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 4046 2661 gene locus_tag LOCUS_05970 4046 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 5524 4043 gene locus_tag LOCUS_05980 5524 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 5967 5521 gene locus_tag LOCUS_05990 5967 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 6455 6003 gene locus_tag LOCUS_06000 gene dtd 6455 6003 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965571.1 protein_id gnl|my_center|LOCUS_06000 8289 6472 gene locus_tag LOCUS_06010 8289 6472 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948830.1 protein_id gnl|my_center|LOCUS_06010 8966 8286 gene locus_tag LOCUS_06020 8966 8286 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723980.1 protein_id gnl|my_center|LOCUS_06020 <9617 8998 gene locus_tag LOCUS_06030 <9617 8998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_160994650.1:30S ribosomal protein S1 >Feature sequence054 1571 1314 gene locus_tag LOCUS_06040 1571 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 3037 1589 gene locus_tag LOCUS_06050 3037 1589 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_06050 6740 3474 gene locus_tag LOCUS_06060 6740 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 7775 6918 gene locus_tag LOCUS_06070 7775 6918 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965896.1 protein_id gnl|my_center|LOCUS_06070 9530 8076 gene locus_tag LOCUS_06080 9530 8076 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963597.1 protein_id gnl|my_center|LOCUS_06080 >Feature sequence055 290 1954 gene locus_tag LOCUS_06090 290 1954 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140832957.1 protein_id gnl|my_center|LOCUS_06090 2067 3788 gene locus_tag LOCUS_06100 2067 3788 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011285511.1 protein_id gnl|my_center|LOCUS_06100 3788 4579 gene locus_tag LOCUS_06110 3788 4579 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286068.1 protein_id gnl|my_center|LOCUS_06110 4758 4591 gene locus_tag LOCUS_06120 4758 4591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 5914 4745 gene locus_tag LOCUS_06130 5914 4745 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439713.1 protein_id gnl|my_center|LOCUS_06130 6889 6065 gene locus_tag LOCUS_06140 gene bltR 6889 6065 CDS product multidrug efflux transcriptional regulator BltR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229881.1 protein_id gnl|my_center|LOCUS_06140 6979 8307 gene locus_tag LOCUS_06150 6979 8307 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861931.1 protein_id gnl|my_center|LOCUS_06150 9086 8310 gene locus_tag LOCUS_06160 9086 8310 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922260.1 protein_id gnl|my_center|LOCUS_06160 >Feature sequence056 188 1261 gene locus_tag LOCUS_06170 188 1261 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731581.1 protein_id gnl|my_center|LOCUS_06170 1355 1846 gene locus_tag LOCUS_06180 1355 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 1843 3147 gene locus_tag LOCUS_06190 1843 3147 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404808.1 protein_id gnl|my_center|LOCUS_06190 3242 3949 gene locus_tag LOCUS_06200 3242 3949 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191776298.1 protein_id gnl|my_center|LOCUS_06200 3976 4314 gene locus_tag LOCUS_06210 3976 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 4307 5551 gene locus_tag LOCUS_06220 4307 5551 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200876.1 protein_id gnl|my_center|LOCUS_06220 5659 6459 gene locus_tag LOCUS_06230 5659 6459 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991075.1 protein_id gnl|my_center|LOCUS_06230 6475 7890 gene locus_tag LOCUS_06240 gene uxaC 6475 7890 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_06240 7893 8816 gene locus_tag LOCUS_06250 7893 8816 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583026.1 protein_id gnl|my_center|LOCUS_06250 <9585 8801 gene locus_tag LOCUS_06260 <9585 8801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000421907.1:LysR family transcriptional regulator >Feature sequence057 113 928 gene locus_tag LOCUS_06270 113 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 2534 1017 gene locus_tag LOCUS_06280 2534 1017 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460243.1 protein_id gnl|my_center|LOCUS_06280 3597 2644 gene locus_tag LOCUS_06290 3597 2644 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208802.1 protein_id gnl|my_center|LOCUS_06290 5144 3639 gene locus_tag LOCUS_06300 5144 3639 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208803.1 protein_id gnl|my_center|LOCUS_06300 6366 5191 gene locus_tag LOCUS_06310 6366 5191 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668256.1 protein_id gnl|my_center|LOCUS_06310 7253 6477 gene locus_tag LOCUS_06320 7253 6477 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409686.1 protein_id gnl|my_center|LOCUS_06320 7781 7284 gene locus_tag LOCUS_06330 7781 7284 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876409.1 protein_id gnl|my_center|LOCUS_06330 8524 7796 gene locus_tag LOCUS_06340 8524 7796 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674983.1 protein_id gnl|my_center|LOCUS_06340 9403 8600 gene locus_tag LOCUS_06350 gene iolO 9403 8600 CDS product 5-keto-L-gluconate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083268.1 protein_id gnl|my_center|LOCUS_06350 >Feature sequence058 261 986 gene locus_tag LOCUS_06360 gene nagB 261 986 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_06360 1952 1077 gene locus_tag LOCUS_06370 1952 1077 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940086.1 protein_id gnl|my_center|LOCUS_06370 2058 2945 gene locus_tag LOCUS_06380 2058 2945 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439497.1 protein_id gnl|my_center|LOCUS_06380 3694 2960 gene locus_tag LOCUS_06390 3694 2960 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818563.1 protein_id gnl|my_center|LOCUS_06390 4641 3691 gene locus_tag LOCUS_06400 gene rihA 4641 3691 CDS product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207526.1 protein_id gnl|my_center|LOCUS_06400 5596 4610 gene locus_tag LOCUS_06410 5596 4610 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537587.1 protein_id gnl|my_center|LOCUS_06410 6604 5600 gene locus_tag LOCUS_06420 6604 5600 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682259.1 protein_id gnl|my_center|LOCUS_06420 6637 6646 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8226 6667 gene locus_tag LOCUS_06430 8226 6667 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383861.1 protein_id gnl|my_center|LOCUS_06430 9462 8314 gene locus_tag LOCUS_06440 9462 8314 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383860.1 protein_id gnl|my_center|LOCUS_06440 >Feature sequence059 <1 527 gene locus_tag LOCUS_06450 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066440.1:homoaconitase large subunit 544 1041 gene locus_tag LOCUS_06460 544 1041 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870109.1 protein_id gnl|my_center|LOCUS_06460 1190 2761 gene locus_tag LOCUS_06470 1190 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 2929 3288 gene locus_tag LOCUS_06480 2929 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 3383 3649 gene locus_tag LOCUS_06490 3383 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 3861 5543 gene locus_tag LOCUS_06500 3861 5543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 5568 7025 gene locus_tag LOCUS_06510 5568 7025 CDS product cyclic nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990029.1 protein_id gnl|my_center|LOCUS_06510 7092 7817 gene locus_tag LOCUS_06520 gene cwlD 7092 7817 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048347.1 protein_id gnl|my_center|LOCUS_06520 >Feature sequence060 159 1373 gene locus_tag LOCUS_06530 gene siaM 159 1373 CDS product sialic acid TRAP transporter large permease SiaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233105.1 protein_id gnl|my_center|LOCUS_06530 1720 1439 gene locus_tag LOCUS_06540 1720 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06540 2579 1614 gene locus_tag LOCUS_06550 2579 1614 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169508.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06550 2871 4109 gene locus_tag LOCUS_06560 2871 4109 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868824.1 protein_id gnl|my_center|LOCUS_06560 4123 5292 gene locus_tag LOCUS_06570 4123 5292 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966253.1 protein_id gnl|my_center|LOCUS_06570 5394 6062 gene locus_tag LOCUS_06580 5394 6062 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_06580 6059 6670 gene locus_tag LOCUS_06590 6059 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 6728 7486 gene locus_tag LOCUS_06600 6728 7486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06600 7492 8718 gene locus_tag LOCUS_06610 7492 8718 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434922.1 protein_id gnl|my_center|LOCUS_06610 >Feature sequence061 911 111 gene locus_tag LOCUS_06620 911 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 1691 933 gene locus_tag LOCUS_06630 1691 933 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991075.1 protein_id gnl|my_center|LOCUS_06630 2829 1903 gene locus_tag LOCUS_06640 2829 1903 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_06640 3710 2826 gene locus_tag LOCUS_06650 3710 2826 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546285.1 protein_id gnl|my_center|LOCUS_06650 4754 3732 gene locus_tag LOCUS_06660 4754 3732 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_06660 6856 4751 gene locus_tag LOCUS_06670 6856 4751 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530523.1 protein_id gnl|my_center|LOCUS_06670 7730 6888 gene locus_tag LOCUS_06680 7730 6888 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459730.1 protein_id gnl|my_center|LOCUS_06680 8628 7732 gene locus_tag LOCUS_06690 8628 7732 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226190.1 protein_id gnl|my_center|LOCUS_06690 <9392 8759 gene locus_tag LOCUS_06700 <9392 8759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011229209.1:sugar ABC transporter substrate-binding protein >Feature sequence062 97 1215 gene locus_tag LOCUS_06710 97 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 2955 1351 gene locus_tag LOCUS_06720 gene pckA 2955 1351 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761973.1 protein_id gnl|my_center|LOCUS_06720 7343 3063 gene locus_tag LOCUS_06730 7343 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 7714 7349 gene locus_tag LOCUS_06740 7714 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 <9345 7717 gene locus_tag LOCUS_06750 <9345 7717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_196793289.1:PAS domain-containing hybrid sensor histidine kinase/response regulator >Feature sequence063 2 160 gene locus_tag LOCUS_06760 2 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 220 1404 gene locus_tag LOCUS_06770 220 1404 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975831.1 protein_id gnl|my_center|LOCUS_06770 1817 2512 gene locus_tag LOCUS_06780 1817 2512 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706813.1 protein_id gnl|my_center|LOCUS_06780 2484 3449 gene locus_tag LOCUS_06790 2484 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06790 3297 3306 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3389 3541 gene locus_tag LOCUS_06800 3389 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 3656 5173 gene locus_tag LOCUS_06810 3656 5173 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430454.1 protein_id gnl|my_center|LOCUS_06810 5267 5716 gene locus_tag LOCUS_06820 5267 5716 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890423.1 protein_id gnl|my_center|LOCUS_06820 5817 6701 gene locus_tag LOCUS_06830 5817 6701 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894437.1 protein_id gnl|my_center|LOCUS_06830 6706 7533 gene locus_tag LOCUS_06840 6706 7533 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972486.1 protein_id gnl|my_center|LOCUS_06840 8563 7643 gene locus_tag LOCUS_06850 8563 7643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 9059 8544 gene locus_tag LOCUS_06860 9059 8544 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576092.1 protein_id gnl|my_center|LOCUS_06860 >Feature sequence064 1512 808 gene locus_tag LOCUS_06870 1512 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06870 2449 1460 gene locus_tag LOCUS_06880 2449 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06880 3456 2692 gene locus_tag LOCUS_06890 3456 2692 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963852.1 protein_id gnl|my_center|LOCUS_06890 3866 3555 gene locus_tag LOCUS_06900 3866 3555 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134124.1 protein_id gnl|my_center|LOCUS_06900 4217 3900 gene locus_tag LOCUS_06910 4217 3900 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023334100.1 protein_id gnl|my_center|LOCUS_06910 5654 4221 gene locus_tag LOCUS_06920 5654 4221 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890696.1 protein_id gnl|my_center|LOCUS_06920 6979 5735 gene locus_tag LOCUS_06930 gene licC 6979 5735 CDS product PTS lichenan transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243273.1 protein_id gnl|my_center|LOCUS_06930 9017 7110 gene locus_tag LOCUS_06940 9017 7110 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897679.1 protein_id gnl|my_center|LOCUS_06940 >Feature sequence065 534 10 gene locus_tag LOCUS_06950 534 10 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357763.1 protein_id gnl|my_center|LOCUS_06950 737 1642 gene locus_tag LOCUS_06960 737 1642 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966200.1 protein_id gnl|my_center|LOCUS_06960 1644 2393 gene locus_tag LOCUS_06970 1644 2393 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096592.1 protein_id gnl|my_center|LOCUS_06970 2612 3265 gene locus_tag LOCUS_06980 gene fsa 2612 3265 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722103.1 protein_id gnl|my_center|LOCUS_06980 4379 3387 gene locus_tag LOCUS_06990 4379 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06990 4990 4376 gene locus_tag LOCUS_07000 4990 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07000 6250 5096 gene locus_tag LOCUS_07010 6250 5096 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161666.1 protein_id gnl|my_center|LOCUS_07010 6826 6347 gene locus_tag LOCUS_07020 6826 6347 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426364.1 protein_id gnl|my_center|LOCUS_07020 7273 6863 gene locus_tag LOCUS_07030 7273 6863 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027178.1 protein_id gnl|my_center|LOCUS_07030 9155 7266 gene locus_tag LOCUS_07040 9155 7266 CDS product transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861840.1 protein_id gnl|my_center|LOCUS_07040 >Feature sequence066 56 703 gene locus_tag LOCUS_07050 56 703 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861699.1 protein_id gnl|my_center|LOCUS_07050 1803 784 gene locus_tag LOCUS_07060 1803 784 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864933.1 protein_id gnl|my_center|LOCUS_07060 2314 1862 gene locus_tag LOCUS_07070 2314 1862 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576052.1 protein_id gnl|my_center|LOCUS_07070 3397 2378 gene locus_tag LOCUS_07080 gene yiaK 3397 2378 CDS product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693365.1 protein_id gnl|my_center|LOCUS_07080 2819 2828 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4420 3461 gene locus_tag LOCUS_07090 4420 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 6535 4427 gene locus_tag LOCUS_07100 6535 4427 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329693.1 protein_id gnl|my_center|LOCUS_07100 8125 6731 gene locus_tag LOCUS_07110 8125 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329694.1 protein_id gnl|my_center|LOCUS_07110 9010 8297 gene locus_tag LOCUS_07120 9010 8297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 >Feature sequence067 62 421 gene locus_tag LOCUS_07130 62 421 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_07130 463 681 gene locus_tag LOCUS_07140 463 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07140 751 2676 gene locus_tag LOCUS_07150 751 2676 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07150 3458 2889 gene locus_tag LOCUS_07160 3458 2889 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938908.1 protein_id gnl|my_center|LOCUS_07160 3882 3496 gene locus_tag LOCUS_07170 3882 3496 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_07170 4100 4267 gene locus_tag LOCUS_07180 4100 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 5672 4560 gene locus_tag LOCUS_07190 5672 4560 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964155.1 protein_id gnl|my_center|LOCUS_07190 6499 5702 gene locus_tag LOCUS_07200 6499 5702 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_07200 7338 6499 gene locus_tag LOCUS_07210 7338 6499 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808911.1 protein_id gnl|my_center|LOCUS_07210 8407 7331 gene locus_tag LOCUS_07220 8407 7331 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_07220 8974 8441 gene locus_tag LOCUS_07230 8974 8441 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_07230 >Feature sequence068 <1 1794 gene locus_tag LOCUS_07240 <1 1794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679271.1:NAD(P)-binding protein 1815 3623 gene locus_tag LOCUS_07250 1815 3623 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_07250 5543 3753 gene locus_tag LOCUS_07260 5543 3753 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_07260 7352 5562 gene locus_tag LOCUS_07270 gene nuoF 7352 5562 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_07270 7747 7370 gene locus_tag LOCUS_07280 7747 7370 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_07280 8373 7885 gene locus_tag LOCUS_07290 8373 7885 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_07290 8872 8378 gene locus_tag LOCUS_07300 gene nuoE 8872 8378 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_07300 >Feature sequence069 47 238 gene locus_tag LOCUS_07310 47 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 955 248 gene locus_tag LOCUS_07320 955 248 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083214.1 protein_id gnl|my_center|LOCUS_07320 1833 1027 gene locus_tag LOCUS_07330 1833 1027 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027182.1 protein_id gnl|my_center|LOCUS_07330 2738 1896 gene locus_tag LOCUS_07340 gene kduI 2738 1896 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383248.1 protein_id gnl|my_center|LOCUS_07340 3029 3742 gene locus_tag LOCUS_07350 3029 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07350 3751 4257 gene locus_tag LOCUS_07360 3751 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07360 5108 4266 gene locus_tag LOCUS_07370 5108 4266 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047578.1 protein_id gnl|my_center|LOCUS_07370 6481 5432 gene locus_tag LOCUS_07380 gene uxuA 6481 5432 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964641.1 protein_id gnl|my_center|LOCUS_07380 6666 7556 gene locus_tag LOCUS_07390 6666 7556 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964642.1 protein_id gnl|my_center|LOCUS_07390 7587 8582 gene locus_tag LOCUS_07400 7587 8582 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_07400 >Feature sequence070 2090 3553 gene locus_tag LOCUS_07410 2090 3553 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965885.1 protein_id gnl|my_center|LOCUS_07410 5410 3626 gene locus_tag LOCUS_07420 5410 3626 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948081.1 protein_id gnl|my_center|LOCUS_07420 6921 5464 gene locus_tag LOCUS_07430 6921 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence071 13 1194 gene locus_tag LOCUS_07440 13 1194 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966253.1 protein_id gnl|my_center|LOCUS_07440 1215 1631 gene locus_tag LOCUS_07450 1215 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 1997 1761 gene locus_tag LOCUS_07460 1997 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 2218 3360 gene locus_tag LOCUS_07470 2218 3360 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733226.1 protein_id gnl|my_center|LOCUS_07470 3357 6371 gene locus_tag LOCUS_07480 3357 6371 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247622.1 protein_id gnl|my_center|LOCUS_07480 6403 7158 gene locus_tag LOCUS_07490 6403 7158 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065023.1 protein_id gnl|my_center|LOCUS_07490 7184 7648 gene locus_tag LOCUS_07500 7184 7648 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903575.1 protein_id gnl|my_center|LOCUS_07500 7659 8261 gene locus_tag LOCUS_07510 7659 8261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 8316 8942 gene locus_tag LOCUS_07520 8316 8942 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948818.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence072 105 1286 gene locus_tag LOCUS_07530 gene rng 105 1286 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461826.1 protein_id gnl|my_center|LOCUS_07530 1326 2681 gene locus_tag LOCUS_07540 gene trkA 1326 2681 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_07540 2695 4134 gene locus_tag LOCUS_07550 2695 4134 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_07550 4267 5037 gene locus_tag LOCUS_07560 4267 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 5197 5505 gene locus_tag LOCUS_07570 gene rplU 5197 5505 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229668.1 protein_id gnl|my_center|LOCUS_07570 5517 5864 gene locus_tag LOCUS_07580 5517 5864 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588481.1 protein_id gnl|my_center|LOCUS_07580 5898 6188 gene locus_tag LOCUS_07590 gene rpmA 5898 6188 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916187.1 protein_id gnl|my_center|LOCUS_07590 6278 7567 gene locus_tag LOCUS_07600 gene obgE 6278 7567 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_07600 7579 7878 gene locus_tag LOCUS_07610 gene yhbY 7579 7878 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955235.1 protein_id gnl|my_center|LOCUS_07610 7894 8532 gene locus_tag LOCUS_07620 gene nadD 7894 8532 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_07620 >Feature sequence073 700 206 gene locus_tag LOCUS_07630 700 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07630 1715 657 gene locus_tag LOCUS_07640 1715 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07640 1992 1765 gene locus_tag LOCUS_07650 gene acpP 1992 1765 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631656.1 protein_id gnl|my_center|LOCUS_07650 3469 2063 gene locus_tag LOCUS_07660 3469 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 4466 3474 gene locus_tag LOCUS_07670 4466 3474 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357629.1 protein_id gnl|my_center|LOCUS_07670 4811 4494 gene locus_tag LOCUS_07680 4811 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 5022 5678 gene locus_tag LOCUS_07690 5022 5678 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836620.1 protein_id gnl|my_center|LOCUS_07690 5895 8714 gene locus_tag LOCUS_07700 5895 8714 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048098.1 protein_id gnl|my_center|LOCUS_07700 >Feature sequence074 1674 985 gene locus_tag LOCUS_07710 1674 985 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811089.1 protein_id gnl|my_center|LOCUS_07710 3119 1791 gene locus_tag LOCUS_07720 3119 1791 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523062.1 protein_id gnl|my_center|LOCUS_07720 4370 3180 gene locus_tag LOCUS_07730 4370 3180 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975831.1 protein_id gnl|my_center|LOCUS_07730 4714 5394 gene locus_tag LOCUS_07740 4714 5394 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097856.1 protein_id gnl|my_center|LOCUS_07740 6513 5671 gene locus_tag LOCUS_07750 6513 5671 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131820.1 protein_id gnl|my_center|LOCUS_07750 6846 6526 gene locus_tag LOCUS_07760 6846 6526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 7896 6898 gene locus_tag LOCUS_07770 7896 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 8627 8007 gene locus_tag LOCUS_07780 gene dhaL 8627 8007 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267780.1 protein_id gnl|my_center|LOCUS_07780 >Feature sequence075 41 1540 gene locus_tag LOCUS_07790 41 1540 CDS product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099547.1 protein_id gnl|my_center|LOCUS_07790 1537 2463 gene locus_tag LOCUS_07800 1537 2463 CDS product YjjW family glycine radical enzyme activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099548.1 protein_id gnl|my_center|LOCUS_07800 3355 2654 gene locus_tag LOCUS_07810 3355 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 4405 3461 gene locus_tag LOCUS_07820 4405 3461 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573417.1 protein_id gnl|my_center|LOCUS_07820 5967 4402 gene locus_tag LOCUS_07830 5967 4402 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584014.1 protein_id gnl|my_center|LOCUS_07830 6970 5954 gene locus_tag LOCUS_07840 6970 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 7974 6991 gene locus_tag LOCUS_07850 7974 6991 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_07850 8389 7979 gene locus_tag LOCUS_07860 gene rbsD 8389 7979 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244175.1 protein_id gnl|my_center|LOCUS_07860 8676 8407 gene locus_tag LOCUS_07870 8676 8407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07870 >Feature sequence076 2109 4091 gene locus_tag LOCUS_07880 2109 4091 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_07880 4186 4195 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5668 4241 gene locus_tag LOCUS_07890 5668 4241 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440025.1 protein_id gnl|my_center|LOCUS_07890 7614 5692 gene locus_tag LOCUS_07900 7614 5692 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861829.1 protein_id gnl|my_center|LOCUS_07900 8465 7614 gene locus_tag LOCUS_07910 8465 7614 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891460.1 protein_id gnl|my_center|LOCUS_07910 >Feature sequence077 412 2 gene locus_tag LOCUS_07920 412 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 1087 560 gene locus_tag LOCUS_07930 1087 560 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946311.1 protein_id gnl|my_center|LOCUS_07930 1821 1156 gene locus_tag LOCUS_07940 1821 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 2606 2136 gene locus_tag LOCUS_07950 2606 2136 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 protein_id gnl|my_center|LOCUS_07950 3525 2593 gene locus_tag LOCUS_07960 3525 2593 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812232.1 protein_id gnl|my_center|LOCUS_07960 5203 3518 gene locus_tag LOCUS_07970 gene lpdA 5203 3518 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948421.1 protein_id gnl|my_center|LOCUS_07970 5737 5291 gene locus_tag LOCUS_07980 5737 5291 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669420.1 protein_id gnl|my_center|LOCUS_07980 6149 5754 gene locus_tag LOCUS_07990 6149 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 7323 6166 gene locus_tag LOCUS_08000 7323 6166 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727328.1 protein_id gnl|my_center|LOCUS_08000 8601 7345 gene locus_tag LOCUS_08010 8601 7345 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047697.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence078 188 2413 gene locus_tag LOCUS_08020 188 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 3099 2458 gene locus_tag LOCUS_08030 3099 2458 CDS product CatA-like O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021707.1 protein_id gnl|my_center|LOCUS_08030 3181 3366 gene locus_tag LOCUS_08040 3181 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 4163 3489 gene locus_tag LOCUS_08050 4163 3489 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287585.1 protein_id gnl|my_center|LOCUS_08050 4394 5509 gene locus_tag LOCUS_08060 4394 5509 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861263.1 protein_id gnl|my_center|LOCUS_08060 5514 6485 gene locus_tag LOCUS_08070 5514 6485 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861264.1 protein_id gnl|my_center|LOCUS_08070 6478 7707 gene locus_tag LOCUS_08080 6478 7707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861265.1 protein_id gnl|my_center|LOCUS_08080 7724 8347 gene locus_tag LOCUS_08090 7724 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08090 >Feature sequence079 772 497 gene locus_tag LOCUS_08100 772 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 1102 1698 gene locus_tag LOCUS_08110 1102 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 1110 1119 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1716 1880 gene locus_tag LOCUS_08120 1716 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 2609 2142 gene locus_tag LOCUS_08130 2609 2142 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948438.1 protein_id gnl|my_center|LOCUS_08130 3601 2690 gene locus_tag LOCUS_08140 3601 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 4480 3671 gene locus_tag LOCUS_08150 4480 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08150 4859 4482 gene locus_tag LOCUS_08160 4859 4482 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459856.1 protein_id gnl|my_center|LOCUS_08160 7431 5167 gene locus_tag LOCUS_08170 7431 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 8482 7442 gene locus_tag LOCUS_08180 8482 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 8647 8501 gene locus_tag LOCUS_08190 8647 8501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 >Feature sequence080 304 1374 gene locus_tag LOCUS_08200 304 1374 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987044.1 protein_id gnl|my_center|LOCUS_08200 1919 1371 gene locus_tag LOCUS_08210 1919 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 2349 1933 gene locus_tag LOCUS_08220 2349 1933 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016840.1 protein_id gnl|my_center|LOCUS_08220 3014 2394 gene locus_tag LOCUS_08230 3014 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 4644 3193 gene locus_tag LOCUS_08240 4644 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 5553 5029 gene locus_tag LOCUS_08250 5553 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 6265 5555 gene locus_tag LOCUS_08260 6265 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 8501 6534 gene locus_tag LOCUS_08270 8501 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence081 1165 209 gene locus_tag LOCUS_08280 1165 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 2628 1234 gene locus_tag LOCUS_08290 2628 1234 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081059.1 protein_id gnl|my_center|LOCUS_08290 3178 2663 gene locus_tag LOCUS_08300 3178 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08300 4046 3144 gene locus_tag LOCUS_08310 4046 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08310 4993 4049 gene locus_tag LOCUS_08320 4993 4049 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_08320 5934 5041 gene locus_tag LOCUS_08330 5934 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 6972 5968 gene locus_tag LOCUS_08340 6972 5968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978822.1 protein_id gnl|my_center|LOCUS_08340 8476 6998 gene locus_tag LOCUS_08350 8476 6998 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582804.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence082 177 944 gene locus_tag LOCUS_08360 177 944 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047750.1 protein_id gnl|my_center|LOCUS_08360 2070 1012 gene locus_tag LOCUS_08370 2070 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08370 2490 2188 gene locus_tag LOCUS_08380 2490 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08380 2837 2697 gene locus_tag LOCUS_08390 2837 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 4150 2819 gene locus_tag LOCUS_08400 4150 2819 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098287.1 protein_id gnl|my_center|LOCUS_08400 5821 4217 gene locus_tag LOCUS_08410 5821 4217 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948069.1 protein_id gnl|my_center|LOCUS_08410 7000 6194 gene locus_tag LOCUS_08420 7000 6194 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948072.1 protein_id gnl|my_center|LOCUS_08420 7825 7043 gene locus_tag LOCUS_08430 7825 7043 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966631.1 protein_id gnl|my_center|LOCUS_08430 8092 8430 gene locus_tag LOCUS_08440 8092 8430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 >Feature sequence083 3155 1356 gene locus_tag LOCUS_08450 3155 1356 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831067.1 protein_id gnl|my_center|LOCUS_08450 4320 3157 gene locus_tag LOCUS_08460 gene ogl 4320 3157 CDS product oligogalacturonate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816209.1 protein_id gnl|my_center|LOCUS_08460 5361 4348 gene locus_tag LOCUS_08470 5361 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 6535 5348 gene locus_tag LOCUS_08480 6535 5348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 8014 6611 gene locus_tag LOCUS_08490 8014 6611 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325939.1 protein_id gnl|my_center|LOCUS_08490 <8647 8026 gene locus_tag LOCUS_08500 <8647 8026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976934.1:carbohydrate ABC transporter permease >Feature sequence084 212 1453 gene locus_tag LOCUS_08510 212 1453 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113995.1 protein_id gnl|my_center|LOCUS_08510 1710 3131 gene locus_tag LOCUS_08520 1710 3131 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939914.1 protein_id gnl|my_center|LOCUS_08520 2866 2875 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3137 3844 gene locus_tag LOCUS_08530 3137 3844 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089550.1 protein_id gnl|my_center|LOCUS_08530 3863 4897 gene locus_tag LOCUS_08540 gene ltaE 3863 4897 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903270.1 protein_id gnl|my_center|LOCUS_08540 6337 5051 gene locus_tag LOCUS_08550 6337 5051 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313207.1 protein_id gnl|my_center|LOCUS_08550 6820 6341 gene locus_tag LOCUS_08560 6820 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 7921 6863 gene locus_tag LOCUS_08570 7921 6863 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_08570 <8580 7979 gene locus_tag LOCUS_08580 <8580 7979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000869037.1:3-dehydro-L-gulonate 2-dehydrogenase >Feature sequence085 <1 690 gene locus_tag LOCUS_08590 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083013.1:fructose-6-phosphate aldolase 707 1561 gene locus_tag LOCUS_08600 707 1561 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966614.1 protein_id gnl|my_center|LOCUS_08600 1589 2266 gene locus_tag LOCUS_08610 1589 2266 CDS product DUF4867 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965899.1 protein_id gnl|my_center|LOCUS_08610 2456 4195 gene locus_tag LOCUS_08620 2456 4195 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077417416.1 protein_id gnl|my_center|LOCUS_08620 4354 5226 gene locus_tag LOCUS_08630 4354 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08630 5242 6375 gene locus_tag LOCUS_08640 5242 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08640 6379 6963 gene locus_tag LOCUS_08650 6379 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 7023 7238 gene locus_tag LOCUS_08660 7023 7238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 >Feature sequence086 142 1473 gene locus_tag LOCUS_08670 142 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 1470 1724 gene locus_tag LOCUS_08680 1470 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08680 1752 2981 gene locus_tag LOCUS_08690 1752 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 3228 3392 gene locus_tag LOCUS_08700 3228 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 3389 4348 gene locus_tag LOCUS_08710 3389 4348 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932714.1 protein_id gnl|my_center|LOCUS_08710 4381 5895 gene locus_tag LOCUS_08720 4381 5895 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964022.1 protein_id gnl|my_center|LOCUS_08720 5892 7010 gene locus_tag LOCUS_08730 5892 7010 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969292.1 protein_id gnl|my_center|LOCUS_08730 7007 7870 gene locus_tag LOCUS_08740 7007 7870 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583516.1 protein_id gnl|my_center|LOCUS_08740 >Feature sequence087 423 1184 gene locus_tag LOCUS_08750 423 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08750 1181 1456 gene locus_tag LOCUS_08760 1181 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 1449 1697 gene locus_tag LOCUS_08770 1449 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 1664 2374 gene locus_tag LOCUS_08780 1664 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 2476 3369 gene locus_tag LOCUS_08790 2476 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 3687 4538 gene locus_tag LOCUS_08800 3687 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 4535 5008 gene locus_tag LOCUS_08810 4535 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 5139 6173 gene locus_tag LOCUS_08820 5139 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 6198 7406 gene locus_tag LOCUS_08830 6198 7406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 7426 8118 gene locus_tag LOCUS_08840 7426 8118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 8450 8139 gene locus_tag LOCUS_08850 8450 8139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 >Feature sequence088 584 96 gene locus_tag LOCUS_08860 584 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 1765 662 gene locus_tag LOCUS_08870 1765 662 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253036.1 protein_id gnl|my_center|LOCUS_08870 4429 2096 gene locus_tag LOCUS_08880 4429 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 5499 4609 gene locus_tag LOCUS_08890 gene dapA 5499 4609 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940835.1 protein_id gnl|my_center|LOCUS_08890 5627 5842 gene locus_tag LOCUS_08900 5627 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 5833 6450 gene locus_tag LOCUS_08910 5833 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08910 6487 7074 gene locus_tag LOCUS_08920 6487 7074 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429956.1 protein_id gnl|my_center|LOCUS_08920 8374 7253 gene locus_tag LOCUS_08930 8374 7253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 >Feature sequence089 1425 145 gene locus_tag LOCUS_08940 1425 145 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_08940 2121 1447 gene locus_tag LOCUS_08950 2121 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08950 2555 2094 gene locus_tag LOCUS_08960 2555 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08960 2158 2167 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3318 2662 gene locus_tag LOCUS_08970 3318 2662 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435225.1 protein_id gnl|my_center|LOCUS_08970 3586 3302 gene locus_tag LOCUS_08980 3586 3302 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006512.1 protein_id gnl|my_center|LOCUS_08980 5754 3826 gene locus_tag LOCUS_08990 5754 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 7300 5888 gene locus_tag LOCUS_09000 7300 5888 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371458.1 protein_id gnl|my_center|LOCUS_09000 8285 7326 gene locus_tag LOCUS_09010 8285 7326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence090 <1 1222 gene locus_tag LOCUS_09020 <1 1222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002359868.1:sugar ABC transporter substrate-binding protein 1361 2434 gene locus_tag LOCUS_09030 1361 2434 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_09030 2450 3286 gene locus_tag LOCUS_09040 2450 3286 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383582.1 protein_id gnl|my_center|LOCUS_09040 3338 4519 gene locus_tag LOCUS_09050 3338 4519 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922040.1 protein_id gnl|my_center|LOCUS_09050 4570 6615 gene locus_tag LOCUS_09060 4570 6615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence091 985 194 gene locus_tag LOCUS_09070 985 194 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418385.1 protein_id gnl|my_center|LOCUS_09070 1997 978 gene locus_tag LOCUS_09080 1997 978 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436936.1 protein_id gnl|my_center|LOCUS_09080 3130 2033 gene locus_tag LOCUS_09090 3130 2033 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583513.1 protein_id gnl|my_center|LOCUS_09090 4074 3187 gene locus_tag LOCUS_09100 4074 3187 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969293.1 protein_id gnl|my_center|LOCUS_09100 5153 4071 gene locus_tag LOCUS_09110 5153 4071 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969292.1 protein_id gnl|my_center|LOCUS_09110 6685 5150 gene locus_tag LOCUS_09120 6685 5150 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964022.1 protein_id gnl|my_center|LOCUS_09120 8055 6682 gene locus_tag LOCUS_09130 gene allB 8055 6682 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006892.1 protein_id gnl|my_center|LOCUS_09130 >Feature sequence092 93 1598 gene locus_tag LOCUS_09140 93 1598 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704305.1 protein_id gnl|my_center|LOCUS_09140 1659 2318 gene locus_tag LOCUS_09150 1659 2318 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381503.1 protein_id gnl|my_center|LOCUS_09150 2318 3928 gene locus_tag LOCUS_09160 2318 3928 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392815.1 protein_id gnl|my_center|LOCUS_09160 3941 4891 gene locus_tag LOCUS_09170 3941 4891 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027390.1 protein_id gnl|my_center|LOCUS_09170 4921 5535 gene locus_tag LOCUS_09180 4921 5535 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082560.1 protein_id gnl|my_center|LOCUS_09180 5661 6722 gene locus_tag LOCUS_09190 5661 6722 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947984.1 protein_id gnl|my_center|LOCUS_09190 6818 7492 gene locus_tag LOCUS_09200 6818 7492 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002938037.1 protein_id gnl|my_center|LOCUS_09200 <8257 7516 gene locus_tag LOCUS_09210 <8257 7516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861491.1:alpha/beta hydrolase family protein >Feature sequence093 3206 897 gene locus_tag LOCUS_09220 3206 897 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593905.1 protein_id gnl|my_center|LOCUS_09220 4474 3428 gene locus_tag LOCUS_09230 4474 3428 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993974.1 protein_id gnl|my_center|LOCUS_09230 4586 5236 gene locus_tag LOCUS_09240 4586 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 7792 5225 gene locus_tag LOCUS_09250 7792 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 8109 7945 gene locus_tag LOCUS_09260 8109 7945 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670545.1 protein_id gnl|my_center|LOCUS_09260 >Feature sequence094 839 1819 gene locus_tag LOCUS_09270 839 1819 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_09270 2036 3979 gene locus_tag LOCUS_09280 2036 3979 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986707.1 protein_id gnl|my_center|LOCUS_09280 4079 4429 gene locus_tag LOCUS_09290 4079 4429 CDS product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889198.1 protein_id gnl|my_center|LOCUS_09290 4582 5880 gene locus_tag LOCUS_09300 4582 5880 CDS product DUF1576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869156.1 protein_id gnl|my_center|LOCUS_09300 6272 5964 gene locus_tag LOCUS_09310 6272 5964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 6981 6262 gene locus_tag LOCUS_09320 6981 6262 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941430.1 protein_id gnl|my_center|LOCUS_09320 7308 7475 gene locus_tag LOCUS_09330 7308 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 7586 8020 gene locus_tag LOCUS_09340 7586 8020 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590444.1 protein_id gnl|my_center|LOCUS_09340 >Feature sequence095 2158 1616 gene locus_tag LOCUS_09350 2158 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09350 2787 2191 gene locus_tag LOCUS_09360 2787 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09360 3489 2809 gene locus_tag LOCUS_09370 3489 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 5400 3556 gene locus_tag LOCUS_09380 5400 3556 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813953.1 protein_id gnl|my_center|LOCUS_09380 6662 5397 gene locus_tag LOCUS_09390 6662 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09390 7128 6667 gene locus_tag LOCUS_09400 7128 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09400 7756 7130 gene locus_tag LOCUS_09410 7756 7130 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_09410 >Feature sequence096 317 1864 gene locus_tag LOCUS_09420 317 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 1861 2826 gene locus_tag LOCUS_09430 1861 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 3234 3569 gene locus_tag LOCUS_09440 3234 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 3597 3983 gene locus_tag LOCUS_09450 3597 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 3988 5424 gene locus_tag LOCUS_09460 3988 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 5421 6032 gene locus_tag LOCUS_09470 5421 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 6007 7206 gene locus_tag LOCUS_09480 6007 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 7089 8036 gene locus_tag LOCUS_09490 7089 8036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 >Feature sequence097 231 255 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 386 1297 gene locus_tag LOCUS_09500 386 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 2115 1387 gene locus_tag LOCUS_09510 2115 1387 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_09510 3665 2262 gene locus_tag LOCUS_09520 3665 2262 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 protein_id gnl|my_center|LOCUS_09520 3044 3053 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5151 3625 gene locus_tag LOCUS_09530 5151 3625 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_09530 5644 5288 gene locus_tag LOCUS_09540 gene ndoA 5644 5288 CDS product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156187.1 protein_id gnl|my_center|LOCUS_09540 6948 5758 gene locus_tag LOCUS_09550 gene alr 6948 5758 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048315.1 protein_id gnl|my_center|LOCUS_09550 7348 6971 gene locus_tag LOCUS_09560 7348 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09560 <8121 7400 gene locus_tag LOCUS_09570 <8121 7400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924808.1:NAD(P)H-hydrate dehydratase note possible pseudo, internal stop codon >Feature sequence098 1700 1017 gene locus_tag LOCUS_09580 gene feuP 1700 1017 CDS product two-component system response regulator FeuP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974832.1 protein_id gnl|my_center|LOCUS_09580 1750 1759 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2137 1781 gene locus_tag LOCUS_09590 2137 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 4225 2345 gene locus_tag LOCUS_09600 4225 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 4902 4222 gene locus_tag LOCUS_09610 4902 4222 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417201.1 protein_id gnl|my_center|LOCUS_09610 5795 5040 gene locus_tag LOCUS_09620 5795 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 6069 5782 gene locus_tag LOCUS_09630 6069 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 7802 6330 gene locus_tag LOCUS_09640 7802 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09640 8028 7738 gene locus_tag LOCUS_09650 8028 7738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09650 >Feature sequence099 <1 962 gene locus_tag LOCUS_09660 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005449968.1:TRAP transporter substrate-binding protein 1158 1697 gene locus_tag LOCUS_09670 1158 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1694 1948 gene locus_tag LOCUS_09680 1694 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1776 1785 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1890 2975 gene locus_tag LOCUS_09690 1890 2975 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975184.1 protein_id gnl|my_center|LOCUS_09690 3029 4420 gene locus_tag LOCUS_09700 3029 4420 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083033.1 protein_id gnl|my_center|LOCUS_09700 4438 5184 gene locus_tag LOCUS_09710 gene fabG 4438 5184 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_09710 5225 5983 gene locus_tag LOCUS_09720 5225 5983 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373316.1 protein_id gnl|my_center|LOCUS_09720 6023 7576 gene locus_tag LOCUS_09730 6023 7576 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086082.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence100 219 1568 gene locus_tag LOCUS_09740 gene mgtE 219 1568 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_09740 1682 3472 gene locus_tag LOCUS_09750 1682 3472 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831067.1 protein_id gnl|my_center|LOCUS_09750 3500 5029 gene locus_tag LOCUS_09760 3500 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 5130 6527 gene locus_tag LOCUS_09770 5130 6527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 6691 7581 gene locus_tag LOCUS_09780 6691 7581 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030753.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence101 487 1326 gene locus_tag LOCUS_09790 gene araQ 487 1326 CDS product arabinose ABC transporter permease AraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229508.1 protein_id gnl|my_center|LOCUS_09790 1366 2916 gene locus_tag LOCUS_09800 gene abfB 1366 2916 CDS product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 protein_id gnl|my_center|LOCUS_09800 2930 3190 gene locus_tag LOCUS_09810 2930 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 5255 3393 gene locus_tag LOCUS_09820 5255 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 6329 5259 gene locus_tag LOCUS_09830 6329 5259 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545188.1 protein_id gnl|my_center|LOCUS_09830 7820 6429 gene locus_tag LOCUS_09840 gene asnS 7820 6429 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462263.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence102 1619 390 gene locus_tag LOCUS_09850 gene rspA 1619 390 CDS product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096791.1 protein_id gnl|my_center|LOCUS_09850 2550 1657 gene locus_tag LOCUS_09860 2550 1657 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810029.1 protein_id gnl|my_center|LOCUS_09860 3098 2547 gene locus_tag LOCUS_09870 3098 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 4624 3101 gene locus_tag LOCUS_09880 4624 3101 CDS product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393517.1 protein_id gnl|my_center|LOCUS_09880 5846 4785 gene locus_tag LOCUS_09890 5846 4785 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067432.1 protein_id gnl|my_center|LOCUS_09890 6910 5945 gene locus_tag LOCUS_09900 6910 5945 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583990.1 protein_id gnl|my_center|LOCUS_09900 7970 6921 gene locus_tag LOCUS_09910 7970 6921 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976169.1 protein_id gnl|my_center|LOCUS_09910 >Feature sequence103 1630 323 gene locus_tag LOCUS_09920 1630 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 3351 1630 gene locus_tag LOCUS_09930 gene ptsP 3351 1630 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431795.1 protein_id gnl|my_center|LOCUS_09930 3701 3438 gene locus_tag LOCUS_09940 3701 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 5329 3995 gene locus_tag LOCUS_09950 5329 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 6179 5310 gene locus_tag LOCUS_09960 gene cdaA 6179 5310 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_09960 7167 6211 gene locus_tag LOCUS_09970 7167 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 7595 7164 gene locus_tag LOCUS_09980 7595 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence104 1207 206 gene locus_tag LOCUS_09990 1207 206 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682008.1 protein_id gnl|my_center|LOCUS_09990 905 914 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2239 1220 gene locus_tag LOCUS_10000 2239 1220 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682009.1 protein_id gnl|my_center|LOCUS_10000 2278 2499 gene locus_tag LOCUS_10010 2278 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 3402 2473 gene locus_tag LOCUS_10020 3402 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 4616 3537 gene locus_tag LOCUS_10030 4616 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 6765 5404 gene locus_tag LOCUS_10040 6765 5404 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_10040 7704 6787 gene locus_tag LOCUS_10050 7704 6787 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023517.1 protein_id gnl|my_center|LOCUS_10050 >Feature sequence105 191 862 gene locus_tag LOCUS_10060 191 862 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_10060 2665 1112 gene locus_tag LOCUS_10070 gene rny 2665 1112 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428216.1 protein_id gnl|my_center|LOCUS_10070 3414 2791 gene locus_tag LOCUS_10080 gene recX 3414 2791 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475719.1 protein_id gnl|my_center|LOCUS_10080 4583 3414 gene locus_tag LOCUS_10090 gene recA 4583 3414 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_10090 4646 4876 gene locus_tag LOCUS_10100 4646 4876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 5953 4901 gene locus_tag LOCUS_10110 5953 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 7336 6167 gene locus_tag LOCUS_10120 7336 6167 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_10120 7912 7457 gene locus_tag LOCUS_10130 7912 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence106 <1 3138 gene locus_tag LOCUS_10140 <1 3138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000753855.1:choline-binding protein PcpA 3196 3726 gene locus_tag LOCUS_10150 3196 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 3753 5438 gene locus_tag LOCUS_10160 3753 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 5435 5593 gene locus_tag LOCUS_10170 5435 5593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence107 <1 926 gene locus_tag LOCUS_10180 <1 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000377334.1:aspartate--tRNA(Asn) ligase 1000 1290 gene locus_tag LOCUS_10190 gene gatC 1000 1290 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_10190 1317 2813 gene locus_tag LOCUS_10200 gene gatA 1317 2813 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_10200 2810 4249 gene locus_tag LOCUS_10210 gene gatB 2810 4249 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_10210 4485 5774 gene locus_tag LOCUS_10220 4485 5774 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083681.1 protein_id gnl|my_center|LOCUS_10220 5970 6545 gene locus_tag LOCUS_10230 5970 6545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 7872 6685 gene locus_tag LOCUS_10240 7872 6685 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence108 <1 809 gene locus_tag LOCUS_10250 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680804.1:tyrosine-type recombinase/integrase 878 1069 gene locus_tag LOCUS_10260 878 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1038 2078 gene locus_tag LOCUS_10270 1038 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10270 3958 2222 gene locus_tag LOCUS_10280 3958 2222 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_10280 5308 4217 gene locus_tag LOCUS_10290 5308 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 5988 5482 gene locus_tag LOCUS_10300 gene trmL 5988 5482 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016664.1 protein_id gnl|my_center|LOCUS_10300 7168 5996 gene locus_tag LOCUS_10310 7168 5996 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_10310 7647 7165 gene locus_tag LOCUS_10320 7647 7165 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence109 935 33 gene locus_tag LOCUS_10330 gene moaA 935 33 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371204.1 protein_id gnl|my_center|LOCUS_10330 1417 938 gene locus_tag LOCUS_10340 gene moaC 1417 938 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256659.1 protein_id gnl|my_center|LOCUS_10340 2489 1431 gene locus_tag LOCUS_10350 2489 1431 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948644.1 protein_id gnl|my_center|LOCUS_10350 3678 2623 gene locus_tag LOCUS_10360 3678 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 4633 3689 gene locus_tag LOCUS_10370 4633 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 6274 4850 gene locus_tag LOCUS_10380 6274 4850 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989392.1 protein_id gnl|my_center|LOCUS_10380 5731 5742 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <7842 6350 gene locus_tag LOCUS_10390 <7842 6350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046694763.1:PTS cellobiose/arbutin/salicin transporter subunit IIBC >Feature sequence110 2274 1792 gene locus_tag LOCUS_10400 gene greA 2274 1792 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_10400 3390 2404 gene locus_tag LOCUS_10410 gene dusB 3390 2404 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_10410 3735 3391 gene locus_tag LOCUS_10420 3735 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 4835 3861 gene locus_tag LOCUS_10430 gene pfkA 4835 3861 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_10430 <7832 4926 gene locus_tag LOCUS_10440 <7832 4926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963838.1:DNA polymerase III subunit alpha >Feature sequence111 48 1286 gene locus_tag LOCUS_10450 gene argJ 48 1286 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082329.1 protein_id gnl|my_center|LOCUS_10450 1331 2221 gene locus_tag LOCUS_10460 gene argB 1331 2221 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864194.1 protein_id gnl|my_center|LOCUS_10460 2214 3461 gene locus_tag LOCUS_10470 2214 3461 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864195.1 protein_id gnl|my_center|LOCUS_10470 4934 3552 gene locus_tag LOCUS_10480 4934 3552 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860625.1 protein_id gnl|my_center|LOCUS_10480 5789 4992 gene locus_tag LOCUS_10490 5789 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 6060 7568 gene locus_tag LOCUS_10500 6060 7568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence112 1009 29 gene locus_tag LOCUS_10510 1009 29 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_10510 2144 1026 gene locus_tag LOCUS_10520 2144 1026 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_10520 3669 2137 gene locus_tag LOCUS_10530 3669 2137 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_10530 5130 3850 gene locus_tag LOCUS_10540 5130 3850 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407996.1 protein_id gnl|my_center|LOCUS_10540 5668 5384 gene locus_tag LOCUS_10550 5668 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 7661 5763 gene locus_tag LOCUS_10560 gene ftsH 7661 5763 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272613.1 protein_id gnl|my_center|LOCUS_10560 6675 6684 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence113 3195 841 gene locus_tag LOCUS_10570 3195 841 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_10570 3703 3173 gene locus_tag LOCUS_10580 3703 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 4743 3796 gene locus_tag LOCUS_10590 gene rsmH 4743 3796 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861627.1 protein_id gnl|my_center|LOCUS_10590 5168 4743 gene locus_tag LOCUS_10600 gene mraZ 5168 4743 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_10600 6344 5442 gene locus_tag LOCUS_10610 gene lgt 6344 5442 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812530.1 protein_id gnl|my_center|LOCUS_10610 <7793 6509 gene locus_tag LOCUS_10620 <7793 6509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002989788.1:FAD-dependent oxidoreductase >Feature sequence114 65 397 gene locus_tag LOCUS_10630 65 397 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461784.1 protein_id gnl|my_center|LOCUS_10630 390 1889 gene locus_tag LOCUS_10640 390 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 2795 2052 gene locus_tag LOCUS_10650 2795 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 4061 2835 gene locus_tag LOCUS_10660 gene tyrS 4061 2835 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_10660 5533 4589 gene locus_tag LOCUS_10670 5533 4589 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808885.1 protein_id gnl|my_center|LOCUS_10670 5737 6768 gene locus_tag LOCUS_10680 5737 6768 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_10680 <7790 6850 gene locus_tag LOCUS_10690 <7790 6850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005903111.1:ROK family protein >Feature sequence115 58 342 gene locus_tag LOCUS_10700 58 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 311 1774 gene locus_tag LOCUS_10710 311 1774 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005946978.1 protein_id gnl|my_center|LOCUS_10710 1786 3408 gene locus_tag LOCUS_10720 1786 3408 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016558.1 protein_id gnl|my_center|LOCUS_10720 3553 4842 gene locus_tag LOCUS_10730 gene serS 3553 4842 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_10730 5005 5373 gene locus_tag LOCUS_10740 5005 5373 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016333.1 protein_id gnl|my_center|LOCUS_10740 5385 5846 gene locus_tag LOCUS_10750 5385 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 5857 6300 gene locus_tag LOCUS_10760 5857 6300 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816014.1 protein_id gnl|my_center|LOCUS_10760 6888 6457 gene locus_tag LOCUS_10770 6888 6457 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_10770 <7758 6882 gene locus_tag LOCUS_10780 <7758 6882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048210.1:aspartate carbamoyltransferase >Feature sequence116 375 37 gene locus_tag LOCUS_10790 375 37 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722125.1 protein_id gnl|my_center|LOCUS_10790 2159 528 gene locus_tag LOCUS_10800 2159 528 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989614.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10800 2451 2152 gene locus_tag LOCUS_10810 2451 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 3171 2476 gene locus_tag LOCUS_10820 3171 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10820 3569 3213 gene locus_tag LOCUS_10830 3569 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10830 3949 3692 gene locus_tag LOCUS_10840 3949 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 4160 4993 gene locus_tag LOCUS_10850 4160 4993 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_10850 4258 4267 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7059 5053 gene locus_tag LOCUS_10860 7059 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 5490 5499 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7679 7101 gene locus_tag LOCUS_10870 7679 7101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence117 1765 488 gene locus_tag LOCUS_10880 1765 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 2974 1766 gene locus_tag LOCUS_10890 2974 1766 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860865.1 protein_id gnl|my_center|LOCUS_10890 4184 3249 gene locus_tag LOCUS_10900 4184 3249 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151128636.1 protein_id gnl|my_center|LOCUS_10900 4475 5893 gene locus_tag LOCUS_10910 4475 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 5890 7260 gene locus_tag LOCUS_10920 5890 7260 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023355052.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence118 743 27 gene locus_tag LOCUS_10930 743 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 1597 770 gene locus_tag LOCUS_10940 1597 770 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454798.1 protein_id gnl|my_center|LOCUS_10940 2904 1594 gene locus_tag LOCUS_10950 2904 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 3077 2862 gene locus_tag LOCUS_10960 3077 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 4272 3049 gene locus_tag LOCUS_10970 4272 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 4957 4361 gene locus_tag LOCUS_10980 gene recR 4957 4361 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359478.1 protein_id gnl|my_center|LOCUS_10980 5313 4957 gene locus_tag LOCUS_10990 5313 4957 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_10990 7000 5351 gene locus_tag LOCUS_11000 7000 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 <7679 7025 gene locus_tag LOCUS_11010 <7679 7025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256167.1:ATP-dependent 6-phosphofructokinase >Feature sequence119 804 1346 gene locus_tag LOCUS_11020 804 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1356 1763 gene locus_tag LOCUS_11030 1356 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1753 2628 gene locus_tag LOCUS_11040 1753 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 2680 2874 gene locus_tag LOCUS_11050 2680 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 2819 3547 gene locus_tag LOCUS_11060 2819 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 3544 4986 gene locus_tag LOCUS_11070 3544 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 4980 6233 gene locus_tag LOCUS_11080 4980 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 6726 6208 gene locus_tag LOCUS_11090 6726 6208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 7200 6940 gene locus_tag LOCUS_11100 7200 6940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 >Feature sequence120 744 169 gene locus_tag LOCUS_11110 744 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11110 1206 790 gene locus_tag LOCUS_11120 1206 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11120 1468 1259 gene locus_tag LOCUS_11130 1468 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 1700 1449 gene locus_tag LOCUS_11140 1700 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1837 2364 gene locus_tag LOCUS_11150 1837 2364 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_11150 2580 3035 gene locus_tag LOCUS_11160 2580 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 4134 3064 gene locus_tag LOCUS_11170 4134 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11170 4996 4049 gene locus_tag LOCUS_11180 4996 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 6039 5155 gene locus_tag LOCUS_11190 6039 5155 CDS product class II fructose-bisphosphate aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989903.1 protein_id gnl|my_center|LOCUS_11190 7123 6068 gene locus_tag LOCUS_11200 7123 6068 CDS product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662199.1 protein_id gnl|my_center|LOCUS_11200 7443 7120 gene locus_tag LOCUS_11210 7443 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11210 >Feature sequence121 849 127 gene locus_tag LOCUS_11220 849 127 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922646.1 protein_id gnl|my_center|LOCUS_11220 3078 1324 gene locus_tag LOCUS_11230 gene thrS 3078 1324 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965659.1 protein_id gnl|my_center|LOCUS_11230 3824 4237 gene locus_tag LOCUS_11240 3824 4237 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810723.1 protein_id gnl|my_center|LOCUS_11240 4234 4476 gene locus_tag LOCUS_11250 4234 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 4524 5546 gene locus_tag LOCUS_11260 4524 5546 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723973.1 protein_id gnl|my_center|LOCUS_11260 7474 5543 gene locus_tag LOCUS_11270 7474 5543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 >Feature sequence122 1474 68 gene locus_tag LOCUS_11280 1474 68 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048386.1 protein_id gnl|my_center|LOCUS_11280 2186 1479 gene locus_tag LOCUS_11290 2186 1479 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_11290 4763 2232 gene locus_tag LOCUS_11300 4763 2232 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860930.1 protein_id gnl|my_center|LOCUS_11300 4954 6297 gene locus_tag LOCUS_11310 4954 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 6389 7348 gene locus_tag LOCUS_11320 6389 7348 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence123 170 952 gene locus_tag LOCUS_11330 170 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 1989 949 gene locus_tag LOCUS_11340 1989 949 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102084.1 protein_id gnl|my_center|LOCUS_11340 2099 2968 gene locus_tag LOCUS_11350 2099 2968 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286319.1 protein_id gnl|my_center|LOCUS_11350 2908 2917 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3744 2986 gene locus_tag LOCUS_11360 gene fabG 3744 2986 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383937.1 protein_id gnl|my_center|LOCUS_11360 5003 3741 gene locus_tag LOCUS_11370 5003 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 6011 5067 gene locus_tag LOCUS_11380 6011 5067 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_11380 6995 6015 gene locus_tag LOCUS_11390 6995 6015 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 protein_id gnl|my_center|LOCUS_11390 <7576 7013 gene locus_tag LOCUS_11400 <7576 7013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704838.1:glutathione ABC transporter permease GsiD >Feature sequence124 528 1190 gene locus_tag LOCUS_11410 528 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1187 1363 gene locus_tag LOCUS_11420 1187 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1365 1961 gene locus_tag LOCUS_11430 1365 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 2263 3849 gene locus_tag LOCUS_11440 2263 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 3874 4389 gene locus_tag LOCUS_11450 3874 4389 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246088.1 protein_id gnl|my_center|LOCUS_11450 4386 4940 gene locus_tag LOCUS_11460 4386 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 4954 5715 gene locus_tag LOCUS_11470 4954 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 5780 5899 gene locus_tag LOCUS_11480 5780 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence125 684 2111 gene locus_tag LOCUS_11490 684 2111 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016772.1 protein_id gnl|my_center|LOCUS_11490 3190 2195 gene locus_tag LOCUS_11500 3190 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 3568 3197 gene locus_tag LOCUS_11510 3568 3197 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_11510 4482 3592 gene locus_tag LOCUS_11520 4482 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 6570 4648 gene locus_tag LOCUS_11530 6570 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence126 1007 189 gene locus_tag LOCUS_11540 1007 189 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016216.1 protein_id gnl|my_center|LOCUS_11540 2535 1018 gene locus_tag LOCUS_11550 2535 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 5636 2757 gene locus_tag LOCUS_11560 gene glgB 5636 2757 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_11560 3054 3149 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6162 5698 gene locus_tag LOCUS_11570 6162 5698 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964912.1 protein_id gnl|my_center|LOCUS_11570 7072 6176 gene locus_tag LOCUS_11580 7072 6176 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891824.1 protein_id gnl|my_center|LOCUS_11580 >Feature sequence127 3034 26 gene locus_tag LOCUS_11590 gene rpoB 3034 26 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966421.1 protein_id gnl|my_center|LOCUS_11590 3431 3655 gene locus_tag LOCUS_11600 3431 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 3659 3880 gene locus_tag LOCUS_11610 3659 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 4388 3948 gene locus_tag LOCUS_11620 4388 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 5467 4406 gene locus_tag LOCUS_11630 5467 4406 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_11630 5612 6247 gene locus_tag LOCUS_11640 gene spoIIR 5612 6247 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966181.1 protein_id gnl|my_center|LOCUS_11640 6508 6305 gene locus_tag LOCUS_11650 6508 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 7209 6508 gene locus_tag LOCUS_11660 7209 6508 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence128 <1 5062 gene locus_tag LOCUS_11670 <1 5062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047816759.1:DUF11 domain-containing protein 5293 5505 gene locus_tag LOCUS_11680 5293 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 5849 6121 gene locus_tag LOCUS_11690 5849 6121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 6155 7213 gene locus_tag LOCUS_11700 6155 7213 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109299.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence129 31 732 gene locus_tag LOCUS_11710 31 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 746 1303 gene locus_tag LOCUS_11720 746 1303 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891255.1 protein_id gnl|my_center|LOCUS_11720 1312 2445 gene locus_tag LOCUS_11730 1312 2445 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861765.1 protein_id gnl|my_center|LOCUS_11730 2614 3930 gene locus_tag LOCUS_11740 2614 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 5037 3931 gene locus_tag LOCUS_11750 5037 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 5481 5107 gene locus_tag LOCUS_11760 5481 5107 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434285.1 protein_id gnl|my_center|LOCUS_11760 6451 5579 gene locus_tag LOCUS_11770 6451 5579 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_11770 7003 6464 gene locus_tag LOCUS_11780 7003 6464 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020471.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence130 2910 925 gene locus_tag LOCUS_11790 2910 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 3070 4314 gene locus_tag LOCUS_11800 3070 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 5469 4429 gene locus_tag LOCUS_11810 gene asrC 5469 4429 CDS product sulfite reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706397.1 protein_id gnl|my_center|LOCUS_11810 6278 5487 gene locus_tag LOCUS_11820 gene asrB 6278 5487 CDS product anaerobic sulfite reductase subunit AsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706396.1 protein_id gnl|my_center|LOCUS_11820 7328 6282 gene locus_tag LOCUS_11830 gene asrA 7328 6282 CDS product anaerobic sulfite reductase subunit AsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948641.1 protein_id gnl|my_center|LOCUS_11830 >Feature sequence131 1019 249 gene locus_tag LOCUS_11840 gene trpA 1019 249 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_11840 2196 1012 gene locus_tag LOCUS_11850 gene trpB 2196 1012 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562635.1 protein_id gnl|my_center|LOCUS_11850 2857 2201 gene locus_tag LOCUS_11860 2857 2201 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 protein_id gnl|my_center|LOCUS_11860 3816 2995 gene locus_tag LOCUS_11870 gene trpC 3816 2995 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_11870 4871 3813 gene locus_tag LOCUS_11880 gene trpD 4871 3813 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869732.1 protein_id gnl|my_center|LOCUS_11880 5533 4952 gene locus_tag LOCUS_11890 5533 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11890 7095 5530 gene locus_tag LOCUS_11900 gene trpE 7095 5530 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence132 2135 888 gene locus_tag LOCUS_11910 2135 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 3540 2764 gene locus_tag LOCUS_11920 3540 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11920 3838 3644 gene locus_tag LOCUS_11930 3838 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 4612 3998 gene locus_tag LOCUS_11940 4612 3998 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681311.1 protein_id gnl|my_center|LOCUS_11940 5469 4939 gene locus_tag LOCUS_11950 5469 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 5030 5039 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6930 5506 gene locus_tag LOCUS_11960 6930 5506 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036258.1 protein_id gnl|my_center|LOCUS_11960 7234 7064 gene locus_tag LOCUS_11970 7234 7064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 >Feature sequence133 106 4080 gene locus_tag LOCUS_11980 106 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 4136 4219 gene locus_tag LOCUS_t00010 4136 4219 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4275 4475 gene locus_tag LOCUS_11990 4275 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 4484 5221 gene locus_tag LOCUS_12000 4484 5221 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_12000 5234 6157 gene locus_tag LOCUS_12010 5234 6157 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence134 1208 285 gene locus_tag LOCUS_12020 1208 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1436 1816 gene locus_tag LOCUS_12030 1436 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1813 2529 gene locus_tag LOCUS_12040 1813 2529 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963931.1 protein_id gnl|my_center|LOCUS_12040 2617 4401 gene locus_tag LOCUS_12050 gene pepF 2617 4401 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944353.1 protein_id gnl|my_center|LOCUS_12050 4398 5789 gene locus_tag LOCUS_12060 4398 5789 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_12060 5791 6294 gene locus_tag LOCUS_12070 5791 6294 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 protein_id gnl|my_center|LOCUS_12070 <7328 6322 gene locus_tag LOCUS_12080 <7328 6322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338251.1:phospholipase D family protein >Feature sequence135 731 1720 gene locus_tag LOCUS_12090 gene argF 731 1720 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_12090 1726 2028 gene locus_tag LOCUS_12100 1726 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 2067 3047 gene locus_tag LOCUS_12110 2067 3047 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_12110 3034 4227 gene locus_tag LOCUS_12120 3034 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 3694 3703 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4268 5158 gene locus_tag LOCUS_12130 4268 5158 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977671.1 protein_id gnl|my_center|LOCUS_12130 5164 5346 gene locus_tag LOCUS_12140 5164 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 5258 6403 gene locus_tag LOCUS_12150 gene rpoD 5258 6403 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_12150 6534 7199 gene locus_tag LOCUS_12160 6534 7199 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence136 1 1461 gene locus_tag LOCUS_12170 gene ilvD 1 1461 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_12170 1500 3182 gene locus_tag LOCUS_12180 gene ilvB 1500 3182 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_12180 3434 4519 gene locus_tag LOCUS_12190 gene serC 3434 4519 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_12190 4582 5745 gene locus_tag LOCUS_12200 4582 5745 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_12200 5858 7102 gene locus_tag LOCUS_12210 5858 7102 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462038.1 protein_id gnl|my_center|LOCUS_12210 6192 6201 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence137 291 1013 gene locus_tag LOCUS_12220 gene cps4B 291 1013 CDS product capsular polysaccharide biosynthesis protein Cps4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837624.1 protein_id gnl|my_center|LOCUS_12220 1023 1805 gene locus_tag LOCUS_12230 1023 1805 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033073.1 protein_id gnl|my_center|LOCUS_12230 1802 2551 gene locus_tag LOCUS_12240 1802 2551 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704149.1 protein_id gnl|my_center|LOCUS_12240 2548 3363 gene locus_tag LOCUS_12250 2548 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 3332 3601 gene locus_tag LOCUS_12260 3332 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 3680 4375 gene locus_tag LOCUS_12270 3680 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 4520 5923 gene locus_tag LOCUS_12280 4520 5923 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936357.1 protein_id gnl|my_center|LOCUS_12280 5997 6476 gene locus_tag LOCUS_12290 5997 6476 CDS product UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686635.1 protein_id gnl|my_center|LOCUS_12290 6494 6994 gene locus_tag LOCUS_12300 6494 6994 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578443.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence138 1088 153 gene locus_tag LOCUS_12310 1088 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1814 1155 gene locus_tag LOCUS_12320 1814 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 2079 1870 gene locus_tag LOCUS_12330 2079 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 3648 2239 gene locus_tag LOCUS_12340 3648 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 5273 3648 gene locus_tag LOCUS_12350 5273 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 5503 5237 gene locus_tag LOCUS_12360 5503 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 6381 5614 gene locus_tag LOCUS_12370 gene flgG 6381 5614 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081929.1 protein_id gnl|my_center|LOCUS_12370 7133 6393 gene locus_tag LOCUS_12380 gene flgF 7133 6393 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869895.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence139 20 679 gene locus_tag LOCUS_12390 20 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12390 542 551 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 622 1011 gene locus_tag LOCUS_12400 622 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12400 1385 2644 gene locus_tag LOCUS_12410 gene hydF 1385 2644 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964958.1 protein_id gnl|my_center|LOCUS_12410 2870 4009 gene locus_tag LOCUS_12420 gene nagA 2870 4009 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386286.1 protein_id gnl|my_center|LOCUS_12420 4183 4650 gene locus_tag LOCUS_12430 4183 4650 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_12430 4702 5889 gene locus_tag LOCUS_12440 gene nusA 4702 5889 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_12440 5957 6229 gene locus_tag LOCUS_12450 5957 6229 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419469.1 protein_id gnl|my_center|LOCUS_12450 6219 6554 gene locus_tag LOCUS_12460 6219 6554 CDS product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286523.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence140 88 1053 gene locus_tag LOCUS_12470 gene prpB 88 1053 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846659.1 protein_id gnl|my_center|LOCUS_12470 1071 2708 gene locus_tag LOCUS_12480 1071 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 2794 3747 gene locus_tag LOCUS_12490 2794 3747 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085651.1 protein_id gnl|my_center|LOCUS_12490 3744 4640 gene locus_tag LOCUS_12500 3744 4640 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_12500 4641 5456 gene locus_tag LOCUS_12510 4641 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12510 5334 5343 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5347 6681 gene locus_tag LOCUS_12520 5347 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 >Feature sequence141 71 1081 gene locus_tag LOCUS_12530 gene gpr 71 1081 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964587.1 protein_id gnl|my_center|LOCUS_12530 1566 2918 gene locus_tag LOCUS_12540 1566 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 3086 4900 gene locus_tag LOCUS_12550 gene lepA 3086 4900 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416556.1 protein_id gnl|my_center|LOCUS_12550 4991 6232 gene locus_tag LOCUS_12560 gene hemW 4991 6232 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099423.1 protein_id gnl|my_center|LOCUS_12560 6307 7050 gene locus_tag LOCUS_12570 6307 7050 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814285.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence142 1007 495 gene locus_tag LOCUS_12580 1007 495 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861480.1 protein_id gnl|my_center|LOCUS_12580 3150 1012 gene locus_tag LOCUS_12590 3150 1012 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861481.1 protein_id gnl|my_center|LOCUS_12590 4427 3147 gene locus_tag LOCUS_12600 4427 3147 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083225.1 protein_id gnl|my_center|LOCUS_12600 6071 4701 gene locus_tag LOCUS_12610 6071 4701 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679363.1 protein_id gnl|my_center|LOCUS_12610 6325 6119 gene locus_tag LOCUS_12620 6325 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12620 <7251 6310 gene locus_tag LOCUS_12630 <7251 6310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966253.1:pyridoxal phosphate-dependent aminotransferase note possible pseudo, frameshifted 6326 6335 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence143 74 2215 gene locus_tag LOCUS_12640 74 2215 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861481.1 protein_id gnl|my_center|LOCUS_12640 2235 3521 gene locus_tag LOCUS_12650 2235 3521 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812847.1 protein_id gnl|my_center|LOCUS_12650 3505 4008 gene locus_tag LOCUS_12660 3505 4008 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861480.1 protein_id gnl|my_center|LOCUS_12660 4040 5023 gene locus_tag LOCUS_12670 4040 5023 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967986.1 protein_id gnl|my_center|LOCUS_12670 5414 6610 gene locus_tag LOCUS_12680 5414 6610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence144 120 1280 gene locus_tag LOCUS_12690 120 1280 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869387.1 protein_id gnl|my_center|LOCUS_12690 1433 2314 gene locus_tag LOCUS_12700 1433 2314 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_12700 2325 3440 gene locus_tag LOCUS_12710 2325 3440 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080270.1 protein_id gnl|my_center|LOCUS_12710 3440 4294 gene locus_tag LOCUS_12720 3440 4294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262678.1 protein_id gnl|my_center|LOCUS_12720 4281 4988 gene locus_tag LOCUS_12730 4281 4988 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869391.1 protein_id gnl|my_center|LOCUS_12730 5295 6155 gene locus_tag LOCUS_12740 5295 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 6863 6225 gene locus_tag LOCUS_12750 6863 6225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 >Feature sequence145 1011 376 gene locus_tag LOCUS_12760 1011 376 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943184.1 protein_id gnl|my_center|LOCUS_12760 1677 1036 gene locus_tag LOCUS_12770 1677 1036 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888032.1 protein_id gnl|my_center|LOCUS_12770 3100 1736 gene locus_tag LOCUS_12780 3100 1736 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_12780 3405 3133 gene locus_tag LOCUS_12790 3405 3133 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_12790 4409 3612 gene locus_tag LOCUS_12800 4409 3612 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_12800 5052 4441 gene locus_tag LOCUS_12810 gene coaE 5052 4441 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310474.1 protein_id gnl|my_center|LOCUS_12810 <7220 5090 gene locus_tag LOCUS_12820 <7220 5090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009896068.1:DNA polymerase I >Feature sequence146 <1 940 gene locus_tag LOCUS_12830 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000762189.1:Gfo/Idh/MocA family oxidoreductase 996 2885 gene locus_tag LOCUS_12840 996 2885 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359609.1 protein_id gnl|my_center|LOCUS_12840 2910 3623 gene locus_tag LOCUS_12850 2910 3623 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902346.1 protein_id gnl|my_center|LOCUS_12850 3646 5079 gene locus_tag LOCUS_12860 gene bglA 3646 5079 CDS product 6-phospho-beta-glucosidase BglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226994.1 protein_id gnl|my_center|LOCUS_12860 5112 5678 gene locus_tag LOCUS_12870 5112 5678 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642721.1 protein_id gnl|my_center|LOCUS_12870 6364 5702 gene locus_tag LOCUS_12880 6364 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12880 6646 6371 gene locus_tag LOCUS_12890 6646 6371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 6831 6840 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence147 1118 600 gene locus_tag LOCUS_12900 1118 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 1444 1178 gene locus_tag LOCUS_12910 1444 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 1485 1494 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1836 1534 gene locus_tag LOCUS_12920 1836 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 2364 1843 gene locus_tag LOCUS_12930 2364 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 3828 2386 gene locus_tag LOCUS_12940 3828 2386 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031772.1 protein_id gnl|my_center|LOCUS_12940 5295 3853 gene locus_tag LOCUS_12950 5295 3853 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618874.1 protein_id gnl|my_center|LOCUS_12950 6357 5314 gene locus_tag LOCUS_12960 6357 5314 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_12960 <7131 6361 gene locus_tag LOCUS_12970 <7131 6361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016362.1:ABC transporter ATP-binding protein >Feature sequence148 2595 1075 gene locus_tag LOCUS_12980 2595 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 4771 2813 gene locus_tag LOCUS_12990 4771 2813 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094944.1 protein_id gnl|my_center|LOCUS_12990 5644 4811 gene locus_tag LOCUS_13000 5644 4811 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977772.1 protein_id gnl|my_center|LOCUS_13000 6554 5646 gene locus_tag LOCUS_13010 6554 5646 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226190.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence149 702 67 gene locus_tag LOCUS_13020 gene deoC 702 67 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356166.1 protein_id gnl|my_center|LOCUS_13020 984 1502 gene locus_tag LOCUS_13030 984 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13030 1650 2036 gene locus_tag LOCUS_13040 1650 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13040 2029 2949 gene locus_tag LOCUS_13050 gene rbsK 2029 2949 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761960.1 protein_id gnl|my_center|LOCUS_13050 2997 3440 gene locus_tag LOCUS_13060 2997 3440 CDS product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993892.1 protein_id gnl|my_center|LOCUS_13060 3496 4632 gene locus_tag LOCUS_13070 3496 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 4706 6214 gene locus_tag LOCUS_13080 gene gguA 4706 6214 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence150 748 566 gene locus_tag LOCUS_13090 748 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 1158 769 gene locus_tag LOCUS_13100 1158 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1984 1142 gene locus_tag LOCUS_13110 1984 1142 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 protein_id gnl|my_center|LOCUS_13110 3530 2046 gene locus_tag LOCUS_13120 3530 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 5253 3565 gene locus_tag LOCUS_13130 5253 3565 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425090.1 protein_id gnl|my_center|LOCUS_13130 6345 5524 gene locus_tag LOCUS_13140 6345 5524 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583055.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13140 6603 6451 gene locus_tag LOCUS_13150 6603 6451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 7003 6620 gene locus_tag LOCUS_13160 7003 6620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13160 >Feature sequence151 54 284 gene locus_tag LOCUS_13170 54 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 424 2841 gene locus_tag LOCUS_13180 424 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 2918 5128 gene locus_tag LOCUS_13190 2918 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 6861 5401 gene locus_tag LOCUS_13200 6861 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence152 942 502 gene locus_tag LOCUS_13210 942 502 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642743.1 protein_id gnl|my_center|LOCUS_13210 2189 969 gene locus_tag LOCUS_13220 2189 969 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_13220 3275 2445 gene locus_tag LOCUS_13230 gene dapF 3275 2445 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_13230 3833 3285 gene locus_tag LOCUS_13240 3833 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 5224 3887 gene locus_tag LOCUS_13250 gene glnA 5224 3887 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392811.1 protein_id gnl|my_center|LOCUS_13250 6282 5389 gene locus_tag LOCUS_13260 gene dapF 6282 5389 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence153 5 1057 gene locus_tag LOCUS_13270 5 1057 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566022.1 protein_id gnl|my_center|LOCUS_13270 1143 1637 gene locus_tag LOCUS_13280 1143 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1634 2938 gene locus_tag LOCUS_13290 1634 2938 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720648.1 protein_id gnl|my_center|LOCUS_13290 2938 3588 gene locus_tag LOCUS_13300 2938 3588 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531484.1 protein_id gnl|my_center|LOCUS_13300 3969 4442 gene locus_tag LOCUS_13310 3969 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 4564 5601 gene locus_tag LOCUS_13320 4564 5601 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566022.1 protein_id gnl|my_center|LOCUS_13320 6467 5649 gene locus_tag LOCUS_13330 6467 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence154 137 2545 gene locus_tag LOCUS_13340 137 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 2535 2978 gene locus_tag LOCUS_13350 2535 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13350 2945 3430 gene locus_tag LOCUS_13360 2945 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13360 3459 4142 gene locus_tag LOCUS_13370 3459 4142 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048325.1 protein_id gnl|my_center|LOCUS_13370 4255 4710 gene locus_tag LOCUS_13380 4255 4710 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836305.1 protein_id gnl|my_center|LOCUS_13380 4736 5230 gene locus_tag LOCUS_13390 4736 5230 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425168.1 protein_id gnl|my_center|LOCUS_13390 5261 6886 gene locus_tag LOCUS_13400 5261 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence155 940 53 gene locus_tag LOCUS_13410 gene prmC 940 53 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_13410 1952 894 gene locus_tag LOCUS_13420 1952 894 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947980.1 protein_id gnl|my_center|LOCUS_13420 2264 2058 gene locus_tag LOCUS_13430 gene rpmE 2264 2058 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_13430 4317 2620 gene locus_tag LOCUS_13440 4317 2620 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681029.1 protein_id gnl|my_center|LOCUS_13440 5753 4374 gene locus_tag LOCUS_13450 5753 4374 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684693.1 protein_id gnl|my_center|LOCUS_13450 6947 5754 gene locus_tag LOCUS_13460 6947 5754 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016536.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence156 1336 245 gene locus_tag LOCUS_13470 1336 245 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928176.1 protein_id gnl|my_center|LOCUS_13470 2007 1333 gene locus_tag LOCUS_13480 2007 1333 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044826408.1 protein_id gnl|my_center|LOCUS_13480 2187 3458 gene locus_tag LOCUS_13490 2187 3458 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214669.1 protein_id gnl|my_center|LOCUS_13490 3471 6476 gene locus_tag LOCUS_13500 3471 6476 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861545.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence157 935 9 gene locus_tag LOCUS_13510 935 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1279 932 gene locus_tag LOCUS_13520 1279 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 2664 1315 gene locus_tag LOCUS_13530 2664 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 3917 2667 gene locus_tag LOCUS_13540 3917 2667 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966849.1 protein_id gnl|my_center|LOCUS_13540 4461 3919 gene locus_tag LOCUS_13550 gene pgsA 4461 3919 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052965.1 protein_id gnl|my_center|LOCUS_13550 5800 4445 gene locus_tag LOCUS_13560 gene rimO 5800 4445 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_13560 6172 5903 gene locus_tag LOCUS_13570 6172 5903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 6833 6201 gene locus_tag LOCUS_13580 gene gmk 6833 6201 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257738.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence158 369 2165 gene locus_tag LOCUS_13590 369 2165 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963781.1 protein_id gnl|my_center|LOCUS_13590 3606 2335 gene locus_tag LOCUS_13600 3606 2335 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728380.1 protein_id gnl|my_center|LOCUS_13600 4742 3699 gene locus_tag LOCUS_13610 4742 3699 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681302.1 protein_id gnl|my_center|LOCUS_13610 <6978 4803 gene locus_tag LOCUS_13620 <6978 4803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788368.1:ribonucleoside-diphosphate reductase subunit alpha >Feature sequence159 1263 646 gene locus_tag LOCUS_13630 1263 646 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966152.1 protein_id gnl|my_center|LOCUS_13630 1597 3072 gene locus_tag LOCUS_13640 1597 3072 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459057.1 protein_id gnl|my_center|LOCUS_13640 3109 4563 gene locus_tag LOCUS_13650 3109 4563 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306203.1 protein_id gnl|my_center|LOCUS_13650 5389 4679 gene locus_tag LOCUS_13660 5389 4679 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868218.1 protein_id gnl|my_center|LOCUS_13660 5549 6481 gene locus_tag LOCUS_13670 5549 6481 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459056.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence160 386 1057 gene locus_tag LOCUS_13680 386 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13680 1032 1751 gene locus_tag LOCUS_13690 1032 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13690 3064 1826 gene locus_tag LOCUS_13700 3064 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 3255 4121 gene locus_tag LOCUS_13710 3255 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 4169 5065 gene locus_tag LOCUS_13720 4169 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 5368 6309 gene locus_tag LOCUS_13730 5368 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13730 >Feature sequence161 1008 148 gene locus_tag LOCUS_13740 1008 148 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226187.1 protein_id gnl|my_center|LOCUS_13740 2549 1221 gene locus_tag LOCUS_13750 gene gudD 2549 1221 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234816.1 protein_id gnl|my_center|LOCUS_13750 4061 2580 gene locus_tag LOCUS_13760 4061 2580 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000463030.1 protein_id gnl|my_center|LOCUS_13760 4475 4077 gene locus_tag LOCUS_13770 4475 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 5548 4541 gene locus_tag LOCUS_13780 5548 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 6918 5590 gene locus_tag LOCUS_13790 gene gudD 6918 5590 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098237.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence162 2512 53 gene locus_tag LOCUS_13800 2512 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 3904 2669 gene locus_tag LOCUS_13810 3904 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 5314 4172 gene locus_tag LOCUS_13820 5314 4172 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533028.1 protein_id gnl|my_center|LOCUS_13820 <6949 5332 gene locus_tag LOCUS_13830 <6949 5332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268260.1:LysR family transcriptional regulator >Feature sequence163 2798 168 gene locus_tag LOCUS_13840 gene ppdK 2798 168 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_13840 4762 3239 gene locus_tag LOCUS_13850 4762 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 6563 4782 gene locus_tag LOCUS_13860 6563 4782 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_13860 >Feature sequence164 553 275 gene locus_tag LOCUS_13870 553 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 1350 631 gene locus_tag LOCUS_13880 gene sigF 1350 631 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 protein_id gnl|my_center|LOCUS_13880 1841 1356 gene locus_tag LOCUS_13890 gene spoIIAB 1841 1356 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_13890 2199 1858 gene locus_tag LOCUS_13900 gene spoIIAA 2199 1858 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418414.1 protein_id gnl|my_center|LOCUS_13900 3622 2312 gene locus_tag LOCUS_13910 3622 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 3766 3626 gene locus_tag LOCUS_13920 3766 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 5139 3763 gene locus_tag LOCUS_13930 5139 3763 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_13930 6225 5314 gene locus_tag LOCUS_13940 6225 5314 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_13940 6856 6251 gene locus_tag LOCUS_13950 6856 6251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 >Feature sequence165 <1 2045 gene locus_tag LOCUS_13960 <1 2045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948260.1:ATP-dependent DNA helicase 2950 2075 gene locus_tag LOCUS_13970 2950 2075 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435316.1 protein_id gnl|my_center|LOCUS_13970 3088 3681 gene locus_tag LOCUS_13980 3088 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 3695 4315 gene locus_tag LOCUS_13990 3695 4315 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869658.1 protein_id gnl|my_center|LOCUS_13990 4418 5665 gene locus_tag LOCUS_14000 4418 5665 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_14000 <6917 5784 gene locus_tag LOCUS_14010 <6917 5784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015555.1:DUF1846 domain-containing protein >Feature sequence166 53 517 gene locus_tag LOCUS_14020 53 517 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390656.1 protein_id gnl|my_center|LOCUS_14020 545 1399 gene locus_tag LOCUS_14030 545 1399 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964110.1 protein_id gnl|my_center|LOCUS_14030 1602 2492 gene locus_tag LOCUS_14040 1602 2492 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897671.1 protein_id gnl|my_center|LOCUS_14040 2639 3067 gene locus_tag LOCUS_14050 2639 3067 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861681.1 protein_id gnl|my_center|LOCUS_14050 3074 4471 gene locus_tag LOCUS_14060 3074 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14060 4419 6182 gene locus_tag LOCUS_14070 4419 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14070 >Feature sequence167 1451 786 gene locus_tag LOCUS_14080 1451 786 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393497.1 protein_id gnl|my_center|LOCUS_14080 2302 1448 gene locus_tag LOCUS_14090 2302 1448 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461127.1 protein_id gnl|my_center|LOCUS_14090 2713 2513 gene locus_tag LOCUS_14100 2713 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 3709 2723 gene locus_tag LOCUS_14110 3709 2723 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813864.1 protein_id gnl|my_center|LOCUS_14110 5254 3746 gene locus_tag LOCUS_14120 5254 3746 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459464.1 protein_id gnl|my_center|LOCUS_14120 5721 5272 gene locus_tag LOCUS_14130 5721 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 6823 5744 gene locus_tag LOCUS_14140 6823 5744 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461129.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence168 <1 863 gene locus_tag LOCUS_14150 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529473.1:ABC transporter permease 952 2853 gene locus_tag LOCUS_14160 952 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 2877 4043 gene locus_tag LOCUS_14170 2877 4043 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082682.1 protein_id gnl|my_center|LOCUS_14170 4056 4475 gene locus_tag LOCUS_14180 gene rbsD 4056 4475 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244175.1 protein_id gnl|my_center|LOCUS_14180 4492 5517 gene locus_tag LOCUS_14190 4492 5517 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582778.1 protein_id gnl|my_center|LOCUS_14190 5646 6089 gene locus_tag LOCUS_14200 5646 6089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14200 6011 6685 gene locus_tag LOCUS_14210 6011 6685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14210 >Feature sequence169 3052 2402 gene locus_tag LOCUS_14220 gene pth 3052 2402 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_14220 4317 3250 gene locus_tag LOCUS_14230 4317 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 5261 4362 gene locus_tag LOCUS_14240 5261 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 4368 4377 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6568 5288 gene locus_tag LOCUS_14250 gene larA 6568 5288 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438088.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence170 40 2922 gene locus_tag LOCUS_14260 40 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 3163 4014 gene locus_tag LOCUS_14270 3163 4014 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942747.1 protein_id gnl|my_center|LOCUS_14270 4026 6137 gene locus_tag LOCUS_14280 4026 6137 CDS product pyruvate formate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797468.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence171 <1 516 gene locus_tag LOCUS_14290 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948495.1:HAMP domain-containing sensor histidine kinase 590 1273 gene locus_tag LOCUS_14300 590 1273 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399472.1 protein_id gnl|my_center|LOCUS_14300 1270 3084 gene locus_tag LOCUS_14310 1270 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 5015 3165 gene locus_tag LOCUS_14320 5015 3165 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031049.1 protein_id gnl|my_center|LOCUS_14320 <6775 5063 gene locus_tag LOCUS_14330 <6775 5063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011183195.1:DUF2075 domain-containing protein >Feature sequence172 301 741 gene locus_tag LOCUS_14340 301 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14340 820 1269 gene locus_tag LOCUS_14350 820 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14350 1398 2465 gene locus_tag LOCUS_14360 1398 2465 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003836797.1 protein_id gnl|my_center|LOCUS_14360 2469 3455 gene locus_tag LOCUS_14370 2469 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 3504 4946 gene locus_tag LOCUS_14380 3504 4946 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202937.1 protein_id gnl|my_center|LOCUS_14380 6736 5156 gene locus_tag LOCUS_14390 6736 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence173 <1 1276 gene locus_tag LOCUS_14400 <1 1276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232344.1:ATP-binding cassette domain-containing protein 1366 3489 gene locus_tag LOCUS_14410 1366 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 3537 4025 gene locus_tag LOCUS_14420 3537 4025 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_14420 4038 4793 gene locus_tag LOCUS_14430 4038 4793 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_14430 4845 6719 gene locus_tag LOCUS_14440 4845 6719 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460031.1 protein_id gnl|my_center|LOCUS_14440 >Feature sequence174 398 1216 gene locus_tag LOCUS_14450 398 1216 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948063.1 protein_id gnl|my_center|LOCUS_14450 1200 1958 gene locus_tag LOCUS_14460 1200 1958 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098513.1 protein_id gnl|my_center|LOCUS_14460 3532 2009 gene locus_tag LOCUS_14470 3532 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 5051 3708 gene locus_tag LOCUS_14480 5051 3708 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948061.1 protein_id gnl|my_center|LOCUS_14480 4432 4441 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5063 5072 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6607 5282 gene locus_tag LOCUS_14490 6607 5282 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948060.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence175 282 291 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 393 1598 gene locus_tag LOCUS_14500 393 1598 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389936.1 protein_id gnl|my_center|LOCUS_14500 1757 2647 gene locus_tag LOCUS_14510 1757 2647 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034565176.1 protein_id gnl|my_center|LOCUS_14510 2637 3461 gene locus_tag LOCUS_14520 2637 3461 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002299926.1 protein_id gnl|my_center|LOCUS_14520 3475 4656 gene locus_tag LOCUS_14530 3475 4656 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002299925.1 protein_id gnl|my_center|LOCUS_14530 4625 5407 gene locus_tag LOCUS_14540 4625 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 5492 6706 gene locus_tag LOCUS_14550 5492 6706 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence176 729 49 gene locus_tag LOCUS_14560 729 49 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_14560 2162 762 gene locus_tag LOCUS_14570 2162 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 2750 2331 gene locus_tag LOCUS_14580 2750 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_14580 3832 2840 gene locus_tag LOCUS_14590 3832 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 4227 3832 gene locus_tag LOCUS_14600 gene mgsA 4227 3832 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_14600 5369 4248 gene locus_tag LOCUS_14610 gene rodA 5369 4248 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_14610 5741 5370 gene locus_tag LOCUS_14620 5741 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 6459 5668 gene locus_tag LOCUS_14630 gene minD 6459 5668 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392079.1 protein_id gnl|my_center|LOCUS_14630 >Feature sequence177 19 1401 gene locus_tag LOCUS_14640 19 1401 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659213.1 protein_id gnl|my_center|LOCUS_14640 1081 1090 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1428 2888 gene locus_tag LOCUS_14650 1428 2888 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903396.1 protein_id gnl|my_center|LOCUS_14650 2893 4437 gene locus_tag LOCUS_14660 2893 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 4547 4981 gene locus_tag LOCUS_14670 4547 4981 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052318.1 protein_id gnl|my_center|LOCUS_14670 5232 5993 gene locus_tag LOCUS_14680 5232 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14680 5942 5951 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence178 <1 902 gene locus_tag LOCUS_14690 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545844.1:selenium metabolism-associated LysR family transcriptional regulator 999 2756 gene locus_tag LOCUS_14700 999 2756 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_14700 2783 3652 gene locus_tag LOCUS_14710 2783 3652 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228320.1 protein_id gnl|my_center|LOCUS_14710 3653 5122 gene locus_tag LOCUS_14720 3653 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 5119 6066 gene locus_tag LOCUS_14730 5119 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 >Feature sequence179 1328 594 gene locus_tag LOCUS_14740 1328 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14740 1996 1325 gene locus_tag LOCUS_14750 1996 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14750 3468 2020 gene locus_tag LOCUS_14760 3468 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 4753 3626 gene locus_tag LOCUS_14770 4753 3626 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_14770 6121 4868 gene locus_tag LOCUS_14780 6121 4868 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868879.1 protein_id gnl|my_center|LOCUS_14780 6558 6118 gene locus_tag LOCUS_14790 6558 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14790 >Feature sequence180 479 1747 gene locus_tag LOCUS_14800 479 1747 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481288.1 protein_id gnl|my_center|LOCUS_14800 1785 2582 gene locus_tag LOCUS_14810 1785 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 2589 3845 gene locus_tag LOCUS_14820 2589 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 3863 3994 gene locus_tag LOCUS_14830 3863 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 4066 4341 gene locus_tag LOCUS_14840 4066 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 4338 5261 gene locus_tag LOCUS_14850 4338 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 5277 5690 gene locus_tag LOCUS_14860 5277 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 6044 6502 gene locus_tag LOCUS_14870 6044 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 >Feature sequence181 1095 268 gene locus_tag LOCUS_14880 1095 268 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860968.1 protein_id gnl|my_center|LOCUS_14880 2119 1262 gene locus_tag LOCUS_14890 2119 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 2229 3548 gene locus_tag LOCUS_14900 2229 3548 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567789.1 protein_id gnl|my_center|LOCUS_14900 3927 3670 gene locus_tag LOCUS_14910 3927 3670 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385299.1 protein_id gnl|my_center|LOCUS_14910 5285 4008 gene locus_tag LOCUS_14920 5285 4008 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047697.1 protein_id gnl|my_center|LOCUS_14920 6481 5312 gene locus_tag LOCUS_14930 6481 5312 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986500.1 protein_id gnl|my_center|LOCUS_14930 >Feature sequence182 1034 1951 gene locus_tag LOCUS_14940 gene pyrF 1034 1951 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_14940 2012 2944 gene locus_tag LOCUS_14950 2012 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 2941 3864 gene locus_tag LOCUS_14960 2941 3864 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_14960 4297 4034 gene locus_tag LOCUS_14970 4297 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 5089 4364 gene locus_tag LOCUS_14980 5089 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 5497 6174 gene locus_tag LOCUS_14990 gene pyrE 5497 6174 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_14990 6206 6355 gene locus_tag LOCUS_15000 6206 6355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence183 198 995 gene locus_tag LOCUS_15010 198 995 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429371.1 protein_id gnl|my_center|LOCUS_15010 1622 918 gene locus_tag LOCUS_15020 1622 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 1963 1700 gene locus_tag LOCUS_15030 1963 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 2458 2054 gene locus_tag LOCUS_15040 2458 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 3200 2577 gene locus_tag LOCUS_15050 3200 2577 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224137664.1 protein_id gnl|my_center|LOCUS_15050 3832 3260 gene locus_tag LOCUS_15060 3832 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 4408 3854 gene locus_tag LOCUS_15070 4408 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 4683 4504 gene locus_tag LOCUS_15080 4683 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 5086 4685 gene locus_tag LOCUS_15090 5086 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15090 5244 6092 gene locus_tag LOCUS_15100 5244 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 6213 6398 gene locus_tag LOCUS_15110 6213 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence184 1703 399 gene locus_tag LOCUS_15120 gene ssnA 1703 399 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393455.1 protein_id gnl|my_center|LOCUS_15120 2196 1717 gene locus_tag LOCUS_15130 2196 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 3137 2199 gene locus_tag LOCUS_15140 gene arcC 3137 2199 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037992.1 protein_id gnl|my_center|LOCUS_15140 3924 3148 gene locus_tag LOCUS_15150 3924 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15150 4356 3976 gene locus_tag LOCUS_15160 4356 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15160 5462 4374 gene locus_tag LOCUS_15170 5462 4374 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891591.1 protein_id gnl|my_center|LOCUS_15170 6507 5476 gene locus_tag LOCUS_15180 6507 5476 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869178.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence185 326 57 gene locus_tag LOCUS_15190 326 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 816 310 gene locus_tag LOCUS_15200 816 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1949 1104 gene locus_tag LOCUS_15210 1949 1104 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764673.1 protein_id gnl|my_center|LOCUS_15210 3091 2249 gene locus_tag LOCUS_15220 3091 2249 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 protein_id gnl|my_center|LOCUS_15220 3973 3104 gene locus_tag LOCUS_15230 3973 3104 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775954.1 protein_id gnl|my_center|LOCUS_15230 5552 4128 gene locus_tag LOCUS_15240 5552 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 6588 5638 gene locus_tag LOCUS_15250 6588 5638 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263651.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence186 891 202 gene locus_tag LOCUS_15260 891 202 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642100.1 protein_id gnl|my_center|LOCUS_15260 1731 1057 gene locus_tag LOCUS_15270 1731 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1938 1768 gene locus_tag LOCUS_15280 1938 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 2231 3658 gene locus_tag LOCUS_15290 2231 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 3806 4501 gene locus_tag LOCUS_15300 3806 4501 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420189.1 protein_id gnl|my_center|LOCUS_15300 5448 4612 gene locus_tag LOCUS_15310 5448 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence187 1683 400 gene locus_tag LOCUS_15320 1683 400 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_15320 450 459 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1937 2245 gene locus_tag LOCUS_15330 1937 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 2267 2632 gene locus_tag LOCUS_15340 2267 2632 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321527.1 protein_id gnl|my_center|LOCUS_15340 2910 2629 gene locus_tag LOCUS_15350 2910 2629 CDS product DUF503 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964058.1 protein_id gnl|my_center|LOCUS_15350 3587 2907 gene locus_tag LOCUS_15360 3587 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 4252 3683 gene locus_tag LOCUS_15370 4252 3683 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263635.1 protein_id gnl|my_center|LOCUS_15370 5028 4588 gene locus_tag LOCUS_15380 5028 4588 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003828945.1 protein_id gnl|my_center|LOCUS_15380 5244 5172 gene locus_tag LOCUS_t00020 5244 5172 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5382 5311 gene locus_tag LOCUS_t00030 5382 5311 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5467 5392 gene locus_tag LOCUS_t00040 5467 5392 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6564 5581 gene locus_tag LOCUS_15390 6564 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence188 38 358 gene locus_tag LOCUS_15400 38 358 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425440.1 protein_id gnl|my_center|LOCUS_15400 415 1746 gene locus_tag LOCUS_15410 gene celB 415 1746 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 protein_id gnl|my_center|LOCUS_15410 1861 2376 gene locus_tag LOCUS_15420 1861 2376 CDS product GrdB-related putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860643.1 protein_id gnl|my_center|LOCUS_15420 2411 3367 gene locus_tag LOCUS_15430 2411 3367 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895213.1 protein_id gnl|my_center|LOCUS_15430 3371 4540 gene locus_tag LOCUS_15440 3371 4540 CDS product Sapep family Mn(2+)-dependent dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860644.1 protein_id gnl|my_center|LOCUS_15440 4600 5355 gene locus_tag LOCUS_15450 4600 5355 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674428.1 protein_id gnl|my_center|LOCUS_15450 5352 6224 gene locus_tag LOCUS_15460 5352 6224 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723662.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence189 <1 867 gene locus_tag LOCUS_15470 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002379465.1:glycoside hydrolase family 1 protein 940 1116 gene locus_tag LOCUS_15480 940 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 1049 1468 gene locus_tag LOCUS_15490 1049 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107995.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence190 3733 191 gene locus_tag LOCUS_15500 3733 191 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392027.1 protein_id gnl|my_center|LOCUS_15500 4436 3615 gene locus_tag LOCUS_15510 4436 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 5815 4436 gene locus_tag LOCUS_15520 5815 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 <6522 5899 gene locus_tag LOCUS_15530 <6522 5899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765761.1:DUF4846 domain-containing protein >Feature sequence191 2305 1292 gene locus_tag LOCUS_15540 gene ruvB 2305 1292 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_15540 3061 2459 gene locus_tag LOCUS_15550 gene ruvA 3061 2459 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707372.1 protein_id gnl|my_center|LOCUS_15550 3357 4439 gene locus_tag LOCUS_15560 3357 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 6084 4498 gene locus_tag LOCUS_15570 6084 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 6452 6081 gene locus_tag LOCUS_15580 6452 6081 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888340.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence192 71 1744 gene locus_tag LOCUS_15590 71 1744 CDS product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268782.1 protein_id gnl|my_center|LOCUS_15590 1744 3660 gene locus_tag LOCUS_15600 1744 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 5027 3684 gene locus_tag LOCUS_15610 5027 3684 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386645.1 protein_id gnl|my_center|LOCUS_15610 5720 5043 gene locus_tag LOCUS_15620 5720 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15620 <6507 5730 gene locus_tag LOCUS_15630 <6507 5730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002384673.1:adenine deaminase C-terminal domain-containing protein note possible pseudo, internal stop codon >Feature sequence193 235 1092 gene locus_tag LOCUS_15640 235 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1104 1979 gene locus_tag LOCUS_15650 1104 1979 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383328.1 protein_id gnl|my_center|LOCUS_15650 1993 2820 gene locus_tag LOCUS_15660 1993 2820 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383329.1 protein_id gnl|my_center|LOCUS_15660 2850 4952 gene locus_tag LOCUS_15670 2850 4952 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537441.1 protein_id gnl|my_center|LOCUS_15670 4973 5944 gene locus_tag LOCUS_15680 4973 5944 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223693862.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence194 347 793 gene locus_tag LOCUS_15690 347 793 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937348.1 protein_id gnl|my_center|LOCUS_15690 797 2698 gene locus_tag LOCUS_15700 797 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 2856 3401 gene locus_tag LOCUS_15710 2856 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 3533 5026 gene locus_tag LOCUS_15720 3533 5026 CDS product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160248.1 protein_id gnl|my_center|LOCUS_15720 5922 5029 gene locus_tag LOCUS_15730 5922 5029 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079106.1 protein_id gnl|my_center|LOCUS_15730 <6464 5965 gene locus_tag LOCUS_15740 <6464 5965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_035249689.1:DNA polymerase IV >Feature sequence195 469 478 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1200 484 gene locus_tag LOCUS_15750 gene cobI 1200 484 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914028.1 protein_id gnl|my_center|LOCUS_15750 3711 1279 gene locus_tag LOCUS_15760 3711 1279 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196793289.1 protein_id gnl|my_center|LOCUS_15760 3932 5404 gene locus_tag LOCUS_15770 3932 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 <6445 5485 gene locus_tag LOCUS_15780 <6445 5485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682004.1:ABC transporter ATP-binding protein >Feature sequence196 13 453 gene locus_tag LOCUS_15790 13 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15790 460 1221 gene locus_tag LOCUS_15800 460 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15800 1215 2360 gene locus_tag LOCUS_15810 gene glgD 1215 2360 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 protein_id gnl|my_center|LOCUS_15810 3017 2499 gene locus_tag LOCUS_15820 3017 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 4698 3316 gene locus_tag LOCUS_15830 4698 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 >Feature sequence197 19 1062 gene locus_tag LOCUS_15840 19 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 1059 2585 gene locus_tag LOCUS_15850 1059 2585 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243027.1 protein_id gnl|my_center|LOCUS_15850 3687 2599 gene locus_tag LOCUS_15860 3687 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15860 4113 3688 gene locus_tag LOCUS_15870 4113 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15870 5582 4131 gene locus_tag LOCUS_15880 5582 4131 CDS product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393517.1 protein_id gnl|my_center|LOCUS_15880 <6385 5601 gene locus_tag LOCUS_15890 <6385 5601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004396514.1:DeoR/GlpR family transcriptional regulator >Feature sequence198 738 349 gene locus_tag LOCUS_15900 738 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1175 768 gene locus_tag LOCUS_15910 1175 768 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289210.1 protein_id gnl|my_center|LOCUS_15910 2026 1199 gene locus_tag LOCUS_15920 2026 1199 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775658.1 protein_id gnl|my_center|LOCUS_15920 2931 2038 gene locus_tag LOCUS_15930 2931 2038 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530241.1 protein_id gnl|my_center|LOCUS_15930 4407 3025 gene locus_tag LOCUS_15940 4407 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 4795 5736 gene locus_tag LOCUS_15950 4795 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 6289 5741 gene locus_tag LOCUS_15960 6289 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence199 3 1367 gene locus_tag LOCUS_15970 3 1367 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015962.1 protein_id gnl|my_center|LOCUS_15970 1703 2380 gene locus_tag LOCUS_15980 1703 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 3803 2469 gene locus_tag LOCUS_15990 3803 2469 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280110.1 protein_id gnl|my_center|LOCUS_15990 4015 5454 gene locus_tag LOCUS_16000 gene nhaC 4015 5454 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261868.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence200 1480 113 gene locus_tag LOCUS_16010 1480 113 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642213.1 protein_id gnl|my_center|LOCUS_16010 2644 1559 gene locus_tag LOCUS_16020 2644 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 3465 2728 gene locus_tag LOCUS_16030 3465 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673400.1 protein_id gnl|my_center|LOCUS_16030 4194 3484 gene locus_tag LOCUS_16040 4194 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 5504 4221 gene locus_tag LOCUS_16050 5504 4221 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798122.1 protein_id gnl|my_center|LOCUS_16050 6283 5603 gene locus_tag LOCUS_16060 6283 5603 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287585.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence201 560 1240 gene locus_tag LOCUS_16070 560 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 1234 2166 gene locus_tag LOCUS_16080 gene murQ 1234 2166 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726731.1 protein_id gnl|my_center|LOCUS_16080 2181 2669 gene locus_tag LOCUS_16090 2181 2669 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426364.1 protein_id gnl|my_center|LOCUS_16090 2688 3473 gene locus_tag LOCUS_16100 2688 3473 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964768.1 protein_id gnl|my_center|LOCUS_16100 3470 4339 gene locus_tag LOCUS_16110 3470 4339 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368464.1 protein_id gnl|my_center|LOCUS_16110 4422 4832 gene locus_tag LOCUS_16120 4422 4832 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706826.1 protein_id gnl|my_center|LOCUS_16120 4987 5062 gene locus_tag LOCUS_t00050 4987 5062 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5100 5174 gene locus_tag LOCUS_t00060 5100 5174 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 5210 5282 gene locus_tag LOCUS_t00070 5210 5282 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5383 5392 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5513 6109 gene locus_tag LOCUS_16130 5513 6109 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_16130 >Feature sequence202 2391 2011 gene locus_tag LOCUS_16140 2391 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 2924 2445 gene locus_tag LOCUS_16150 2924 2445 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965786.1 protein_id gnl|my_center|LOCUS_16150 3170 3718 gene locus_tag LOCUS_16160 3170 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 3769 4653 gene locus_tag LOCUS_16170 3769 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 5341 4616 gene locus_tag LOCUS_16180 5341 4616 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895939.1 protein_id gnl|my_center|LOCUS_16180 6246 5380 gene locus_tag LOCUS_16190 6246 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence203 <1 1072 gene locus_tag LOCUS_16200 <1 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582710.1:TRAP transporter substrate-binding protein 1150 1692 gene locus_tag LOCUS_16210 1150 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1689 2981 gene locus_tag LOCUS_16220 1689 2981 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969469.1 protein_id gnl|my_center|LOCUS_16220 2997 4196 gene locus_tag LOCUS_16230 2997 4196 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398426.1 protein_id gnl|my_center|LOCUS_16230 4269 4952 gene locus_tag LOCUS_16240 4269 4952 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258130.1 protein_id gnl|my_center|LOCUS_16240 6145 5117 gene locus_tag LOCUS_16250 6145 5117 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_16250 >Feature sequence204 4717 1484 gene locus_tag LOCUS_16260 4717 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 6258 4729 gene locus_tag LOCUS_16270 6258 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence205 170 595 gene locus_tag LOCUS_16280 170 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 680 2770 gene locus_tag LOCUS_16290 680 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 3691 2771 gene locus_tag LOCUS_16300 3691 2771 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027102.1 protein_id gnl|my_center|LOCUS_16300 4424 3825 gene locus_tag LOCUS_16310 4424 3825 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852949.1 protein_id gnl|my_center|LOCUS_16310 5622 4417 gene locus_tag LOCUS_16320 gene thiH 5622 4417 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015813.1 protein_id gnl|my_center|LOCUS_16320 5024 5033 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <6300 5643 gene locus_tag LOCUS_16330 <6300 5643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015814.1:thiazole synthase >Feature sequence206 1082 318 gene locus_tag LOCUS_16340 1082 318 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528708.1 protein_id gnl|my_center|LOCUS_16340 1900 1079 gene locus_tag LOCUS_16350 1900 1079 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160784.1 protein_id gnl|my_center|LOCUS_16350 3119 1974 gene locus_tag LOCUS_16360 3119 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 4121 3159 gene locus_tag LOCUS_16370 4121 3159 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098117.1 protein_id gnl|my_center|LOCUS_16370 5031 4138 gene locus_tag LOCUS_16380 5031 4138 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_16380 6106 5084 gene locus_tag LOCUS_16390 6106 5084 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence207 <1 1012 gene locus_tag LOCUS_16400 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458890.1:metal ABC transporter substrate-binding protein 1045 1833 gene locus_tag LOCUS_16410 1045 1833 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904122.1 protein_id gnl|my_center|LOCUS_16410 1830 2651 gene locus_tag LOCUS_16420 1830 2651 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_16420 2807 4210 gene locus_tag LOCUS_16430 2807 4210 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_16430 4246 4902 gene locus_tag LOCUS_16440 4246 4902 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_16440 5286 5717 gene locus_tag LOCUS_16450 5286 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 5679 5688 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5689 6126 gene locus_tag LOCUS_16460 5689 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16460 >Feature sequence208 299 676 gene locus_tag LOCUS_16470 299 676 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867829.1 protein_id gnl|my_center|LOCUS_16470 673 2157 gene locus_tag LOCUS_16480 673 2157 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_16480 2171 3664 gene locus_tag LOCUS_16490 2171 3664 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242829.1 protein_id gnl|my_center|LOCUS_16490 3678 5207 gene locus_tag LOCUS_16500 3678 5207 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969265.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence209 <1 545 gene locus_tag LOCUS_16510 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005970668.1:amino acid carrier protein 582 770 gene locus_tag LOCUS_16520 582 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 739 2172 gene locus_tag LOCUS_16530 739 2172 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459057.1 protein_id gnl|my_center|LOCUS_16530 3135 2221 gene locus_tag LOCUS_16540 3135 2221 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462055.1 protein_id gnl|my_center|LOCUS_16540 3174 3980 gene locus_tag LOCUS_16550 3174 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 3990 4559 gene locus_tag LOCUS_16560 3990 4559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 4615 5682 gene locus_tag LOCUS_16570 4615 5682 CDS product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966697.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence210 374 1330 gene locus_tag LOCUS_16580 374 1330 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_16580 422 431 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1358 2296 gene locus_tag LOCUS_16590 gene pstC 1358 2296 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262177.1 protein_id gnl|my_center|LOCUS_16590 2286 3227 gene locus_tag LOCUS_16600 gene pstA 2286 3227 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432350.1 protein_id gnl|my_center|LOCUS_16600 3289 4050 gene locus_tag LOCUS_16610 gene pstB 3289 4050 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986851.1 protein_id gnl|my_center|LOCUS_16610 4125 4787 gene locus_tag LOCUS_16620 gene phoU 4125 4787 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965016.1 protein_id gnl|my_center|LOCUS_16620 5783 4872 gene locus_tag LOCUS_16630 gene alsK 5783 4872 CDS product allose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171683.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence211 882 124 gene locus_tag LOCUS_16640 gene dapB 882 124 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965675.1 protein_id gnl|my_center|LOCUS_16640 1794 910 gene locus_tag LOCUS_16650 gene dapA 1794 910 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422063.1 protein_id gnl|my_center|LOCUS_16650 2039 1866 gene locus_tag LOCUS_16660 2039 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 2628 2131 gene locus_tag LOCUS_16670 gene cobO 2628 2131 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812021.1 protein_id gnl|my_center|LOCUS_16670 3396 2821 gene locus_tag LOCUS_16680 3396 2821 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422086.1 protein_id gnl|my_center|LOCUS_16680 5416 3587 gene locus_tag LOCUS_16690 gene typA 5416 3587 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_16690 6229 5534 gene locus_tag LOCUS_16700 6229 5534 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227979.1 protein_id gnl|my_center|LOCUS_16700 >Feature sequence212 687 58 gene locus_tag LOCUS_16710 gene sigK 687 58 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 protein_id gnl|my_center|LOCUS_16710 2633 771 gene locus_tag LOCUS_16720 2633 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 2844 2710 gene locus_tag LOCUS_16730 2844 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 4334 2997 gene locus_tag LOCUS_16740 4334 2997 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_16740 5675 4497 gene locus_tag LOCUS_16750 5675 4497 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788311.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence213 <1 1165 gene locus_tag LOCUS_16760 <1 1165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861669.1:sensor domain-containing diguanylate cyclase 1173 3899 gene locus_tag LOCUS_16770 1173 3899 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861668.1 protein_id gnl|my_center|LOCUS_16770 4073 5335 gene locus_tag LOCUS_16780 gene ugpC 4073 5335 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_16780 5346 5966 gene locus_tag LOCUS_16790 5346 5966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16790 5945 5954 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5990 6229 gene locus_tag LOCUS_16800 5990 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16800 >Feature sequence214 63 950 gene locus_tag LOCUS_16810 63 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 1027 1941 gene locus_tag LOCUS_16820 1027 1941 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592816.1 protein_id gnl|my_center|LOCUS_16820 2014 3147 gene locus_tag LOCUS_16830 2014 3147 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202936.1 protein_id gnl|my_center|LOCUS_16830 3189 4202 gene locus_tag LOCUS_16840 3189 4202 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_16840 4269 4955 gene locus_tag LOCUS_16850 4269 4955 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985169.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence215 865 155 gene locus_tag LOCUS_16860 865 155 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894681.1 protein_id gnl|my_center|LOCUS_16860 1638 880 gene locus_tag LOCUS_16870 1638 880 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017145.1 protein_id gnl|my_center|LOCUS_16870 2713 1640 gene locus_tag LOCUS_16880 2713 1640 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815200.1 protein_id gnl|my_center|LOCUS_16880 3603 2722 gene locus_tag LOCUS_16890 3603 2722 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_16890 5000 3777 gene locus_tag LOCUS_16900 5000 3777 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815196.1 protein_id gnl|my_center|LOCUS_16900 6200 5256 gene locus_tag LOCUS_16910 6200 5256 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence216 858 1481 gene locus_tag LOCUS_16920 858 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16920 1494 2294 gene locus_tag LOCUS_16930 1494 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16930 2422 3690 gene locus_tag LOCUS_16940 2422 3690 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856534.1 protein_id gnl|my_center|LOCUS_16940 3844 4641 gene locus_tag LOCUS_16950 gene proC 3844 4641 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048171.1 protein_id gnl|my_center|LOCUS_16950 4908 5504 gene locus_tag LOCUS_16960 4908 5504 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460247.1 protein_id gnl|my_center|LOCUS_16960 5504 6112 gene locus_tag LOCUS_16970 5504 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence217 <1 1185 gene locus_tag LOCUS_16980 <1 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980451.1:mandelate racemase/muconate lactonizing enzyme family protein 1204 1995 gene locus_tag LOCUS_16990 1204 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 2004 2780 gene locus_tag LOCUS_17000 gene fabG 2004 2780 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911773.1 protein_id gnl|my_center|LOCUS_17000 2793 3209 gene locus_tag LOCUS_17010 2793 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17010 3221 3895 gene locus_tag LOCUS_17020 3221 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17020 3910 5004 gene locus_tag LOCUS_17030 3910 5004 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782251.1 protein_id gnl|my_center|LOCUS_17030 5136 5543 gene locus_tag LOCUS_17040 5136 5543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 5494 5503 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5618 6196 gene locus_tag LOCUS_17050 5618 6196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 >Feature sequence218 292 765 gene locus_tag LOCUS_17060 292 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 1110 784 gene locus_tag LOCUS_17070 1110 784 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263275.1 protein_id gnl|my_center|LOCUS_17070 1917 1246 gene locus_tag LOCUS_17080 1917 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17080 2472 1972 gene locus_tag LOCUS_17090 2472 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17090 6117 2581 gene locus_tag LOCUS_17100 gene nifJ 6117 2581 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence219 <1 1626 gene locus_tag LOCUS_17110 <1 1626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877874.1:OFA family MFS transporter 1642 3012 gene locus_tag LOCUS_17120 1642 3012 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_17120 4031 3177 gene locus_tag LOCUS_17130 4031 3177 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287072.1 protein_id gnl|my_center|LOCUS_17130 4820 4059 gene locus_tag LOCUS_17140 4820 4059 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_17140 <6192 4826 gene locus_tag LOCUS_17150 <6192 4826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963751.1:ABC transporter substrate-binding protein >Feature sequence220 1522 2415 gene locus_tag LOCUS_17160 1522 2415 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832366.1 protein_id gnl|my_center|LOCUS_17160 2887 4332 gene locus_tag LOCUS_17170 2887 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 3189 3198 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4369 5097 gene locus_tag LOCUS_17180 gene nagB 4369 5097 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence221 981 22 gene locus_tag LOCUS_17190 gene rbsK 981 22 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212251.1 protein_id gnl|my_center|LOCUS_17190 1979 996 gene locus_tag LOCUS_17200 gene rbsC 1979 996 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612396.1 protein_id gnl|my_center|LOCUS_17200 2951 1992 gene locus_tag LOCUS_17210 2951 1992 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223210.1 protein_id gnl|my_center|LOCUS_17210 4434 2944 gene locus_tag LOCUS_17220 4434 2944 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525260.1 protein_id gnl|my_center|LOCUS_17220 5630 4599 gene locus_tag LOCUS_17230 5630 4599 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975769.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence222 251 260 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 558 2177 gene locus_tag LOCUS_17240 558 2177 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 protein_id gnl|my_center|LOCUS_17240 2301 2501 gene locus_tag LOCUS_17250 2301 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 2622 3842 gene locus_tag LOCUS_17260 2622 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 3896 4135 gene locus_tag LOCUS_17270 3896 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 4141 5154 gene locus_tag LOCUS_17280 4141 5154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17280 5170 6081 gene locus_tag LOCUS_17290 5170 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17290 >Feature sequence223 1756 1208 gene locus_tag LOCUS_17300 1756 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 3154 1838 gene locus_tag LOCUS_17310 3154 1838 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815933.1 protein_id gnl|my_center|LOCUS_17310 3924 3115 gene locus_tag LOCUS_17320 gene fabG 3924 3115 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_17320 4259 3969 gene locus_tag LOCUS_17330 4259 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 4711 4259 gene locus_tag LOCUS_17340 4711 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 5398 4730 gene locus_tag LOCUS_17350 gene deoC 5398 4730 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836882.1 protein_id gnl|my_center|LOCUS_17350 6104 5439 gene locus_tag LOCUS_17360 gene deoC 6104 5439 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence224 76 699 gene locus_tag LOCUS_17370 76 699 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864755.1 protein_id gnl|my_center|LOCUS_17370 849 1493 gene locus_tag LOCUS_17380 849 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 2321 1602 gene locus_tag LOCUS_17390 2321 1602 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068399.1 protein_id gnl|my_center|LOCUS_17390 2613 2446 gene locus_tag LOCUS_17400 2613 2446 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809805.1 protein_id gnl|my_center|LOCUS_17400 3497 2736 gene locus_tag LOCUS_17410 gene pflA 3497 2736 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921923.1 protein_id gnl|my_center|LOCUS_17410 3805 3560 gene locus_tag LOCUS_17420 3805 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 5966 3858 gene locus_tag LOCUS_17430 gene pflB 5966 3858 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195485.1 protein_id gnl|my_center|LOCUS_17430 >Feature sequence225 <1 1346 gene locus_tag LOCUS_17440 <1 1346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989914.1:acyl CoA:acetate/3-ketoacid CoA transferase 1383 2519 gene locus_tag LOCUS_17450 gene acdB 1383 2519 CDS product putative isocaproyl-CoA dehydrogenase AcdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986694.1 protein_id gnl|my_center|LOCUS_17450 2546 3331 gene locus_tag LOCUS_17460 gene etfB 2546 3331 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986693.1 protein_id gnl|my_center|LOCUS_17460 3346 4353 gene locus_tag LOCUS_17470 3346 4353 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417347.1 protein_id gnl|my_center|LOCUS_17470 4337 5866 gene locus_tag LOCUS_17480 4337 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 >Feature sequence226 29 493 gene locus_tag LOCUS_17490 29 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 584 724 gene locus_tag LOCUS_17500 584 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 728 1534 gene locus_tag LOCUS_17510 728 1534 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17510 1660 3054 gene locus_tag LOCUS_17520 1660 3054 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_17520 3095 3277 gene locus_tag LOCUS_17530 3095 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 3582 4418 gene locus_tag LOCUS_17540 gene nudC 3582 4418 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102051.1 protein_id gnl|my_center|LOCUS_17540 4485 5162 gene locus_tag LOCUS_17550 4485 5162 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435799.1 protein_id gnl|my_center|LOCUS_17550 5283 5825 gene locus_tag LOCUS_17560 gene ilvN 5283 5825 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061054.1 protein_id gnl|my_center|LOCUS_17560 >Feature sequence227 157 2856 gene locus_tag LOCUS_17570 157 2856 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880372.1 protein_id gnl|my_center|LOCUS_17570 3438 3085 gene locus_tag LOCUS_17580 gene spoVAE 3438 3085 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811048.1 protein_id gnl|my_center|LOCUS_17580 4476 3454 gene locus_tag LOCUS_17590 gene spoVAD 4476 3454 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_17590 4911 6116 gene locus_tag LOCUS_17600 4911 6116 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139310338.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence228 1332 586 gene locus_tag LOCUS_17610 1332 586 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896965.1 protein_id gnl|my_center|LOCUS_17610 2399 1335 gene locus_tag LOCUS_17620 gene rlmN 2399 1335 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986842.1 protein_id gnl|my_center|LOCUS_17620 3818 2478 gene locus_tag LOCUS_17630 gene rsmB 3818 2478 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_17630 4513 3818 gene locus_tag LOCUS_17640 4513 3818 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642482.1 protein_id gnl|my_center|LOCUS_17640 5499 4546 gene locus_tag LOCUS_17650 gene fmt 5499 4546 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_17650 6040 5552 gene locus_tag LOCUS_17660 gene def 6040 5552 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence229 1137 58 gene locus_tag LOCUS_17670 1137 58 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528957.1 protein_id gnl|my_center|LOCUS_17670 2683 1127 gene locus_tag LOCUS_17680 2683 1127 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865052.1 protein_id gnl|my_center|LOCUS_17680 3997 2813 gene locus_tag LOCUS_17690 3997 2813 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902635.1 protein_id gnl|my_center|LOCUS_17690 4815 4078 gene locus_tag LOCUS_17700 4815 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 5580 4816 gene locus_tag LOCUS_17710 gene udp 5580 4816 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_17710 >Feature sequence230 242 406 gene locus_tag LOCUS_17720 242 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 956 866 gene locus_tag LOCUS_t00080 956 866 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1854 1048 gene locus_tag LOCUS_17730 1854 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 3335 1989 gene locus_tag LOCUS_17740 3335 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 4408 3332 gene locus_tag LOCUS_17750 gene mnmA 4408 3332 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_17750 4842 4405 gene locus_tag LOCUS_17760 gene nifU 4842 4405 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438275.1 protein_id gnl|my_center|LOCUS_17760 6066 4870 gene locus_tag LOCUS_17770 gene nifS 6066 4870 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence231 <1 2083 gene locus_tag LOCUS_17780 <1 2083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460393.1:translation initiation factor IF-2 2284 2685 gene locus_tag LOCUS_17790 gene rbfA 2284 2685 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_17790 2685 3635 gene locus_tag LOCUS_17800 2685 3635 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_17800 3671 4606 gene locus_tag LOCUS_17810 gene truB 3671 4606 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986789.1 protein_id gnl|my_center|LOCUS_17810 4654 5607 gene locus_tag LOCUS_17820 4654 5607 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012163110.1 protein_id gnl|my_center|LOCUS_17820 5820 6086 gene locus_tag LOCUS_17830 gene rpsO 5820 6086 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419491.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence232 2118 718 gene locus_tag LOCUS_17840 2118 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 2330 2115 gene locus_tag LOCUS_17850 2330 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 3533 2436 gene locus_tag LOCUS_17860 3533 2436 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133415011.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17860 3855 3466 gene locus_tag LOCUS_17870 3855 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 4725 3889 gene locus_tag LOCUS_17880 4725 3889 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066677.1 protein_id gnl|my_center|LOCUS_17880 5613 4729 gene locus_tag LOCUS_17890 5613 4729 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972367.1 protein_id gnl|my_center|LOCUS_17890 >Feature sequence233 98 2203 gene locus_tag LOCUS_17900 98 2203 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966830.1 protein_id gnl|my_center|LOCUS_17900 2207 2947 gene locus_tag LOCUS_17910 2207 2947 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_17910 3219 5177 gene locus_tag LOCUS_17920 3219 5177 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146623251.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence234 3721 713 gene locus_tag LOCUS_17930 3721 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 4193 3759 gene locus_tag LOCUS_17940 4193 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 4294 5811 gene locus_tag LOCUS_17950 4294 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 5808 6077 gene locus_tag LOCUS_17960 5808 6077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence235 350 123 gene locus_tag LOCUS_17970 350 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 1544 492 gene locus_tag LOCUS_17980 gene rhaS 1544 492 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582803.1 protein_id gnl|my_center|LOCUS_17980 1676 3229 gene locus_tag LOCUS_17990 1676 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 3229 5115 gene locus_tag LOCUS_18000 3229 5115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence236 <1 1082 gene locus_tag LOCUS_18010 <1 1082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005449968.1:TRAP transporter substrate-binding protein 1155 1679 gene locus_tag LOCUS_18020 1155 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 1679 2983 gene locus_tag LOCUS_18030 1679 2983 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898268.1 protein_id gnl|my_center|LOCUS_18030 3882 3109 gene locus_tag LOCUS_18040 3882 3109 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762537.1 protein_id gnl|my_center|LOCUS_18040 4667 3927 gene locus_tag LOCUS_18050 4667 3927 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335855.1 protein_id gnl|my_center|LOCUS_18050 5887 4703 gene locus_tag LOCUS_18060 gene nagA 5887 4703 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108898.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence237 1309 989 gene locus_tag LOCUS_18070 1309 989 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422665.1 protein_id gnl|my_center|LOCUS_18070 2282 1302 gene locus_tag LOCUS_18080 2282 1302 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439726.1 protein_id gnl|my_center|LOCUS_18080 2893 2300 gene locus_tag LOCUS_18090 2893 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 3421 2939 gene locus_tag LOCUS_18100 3421 2939 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422657.1 protein_id gnl|my_center|LOCUS_18100 5439 3424 gene locus_tag LOCUS_18110 5439 3424 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898067.1 protein_id gnl|my_center|LOCUS_18110 5875 5567 gene locus_tag LOCUS_18120 5875 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence238 272 1126 gene locus_tag LOCUS_18130 272 1126 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219862.1 protein_id gnl|my_center|LOCUS_18130 1133 3013 gene locus_tag LOCUS_18140 gene bglP 1133 3013 CDS product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242943.1 protein_id gnl|my_center|LOCUS_18140 3025 4497 gene locus_tag LOCUS_18150 3025 4497 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431416.1 protein_id gnl|my_center|LOCUS_18150 4904 5101 gene locus_tag LOCUS_18160 gene thiS 4904 5101 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051161.1 protein_id gnl|my_center|LOCUS_18160 5104 5745 gene locus_tag LOCUS_18170 gene thiF 5104 5745 CDS product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858442.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence239 669 580 gene locus_tag LOCUS_t00090 669 580 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 848 762 gene locus_tag LOCUS_t00100 848 762 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1748 1005 gene locus_tag LOCUS_18180 gene ispD 1748 1005 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860629.1 protein_id gnl|my_center|LOCUS_18180 2797 1763 gene locus_tag LOCUS_18190 gene tsaD 2797 1763 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_18190 3722 2811 gene locus_tag LOCUS_18200 3722 2811 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_18200 4211 3969 gene locus_tag LOCUS_18210 4211 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 4805 4356 gene locus_tag LOCUS_18220 gene rimI 4805 4356 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434429.1 protein_id gnl|my_center|LOCUS_18220 5669 4833 gene locus_tag LOCUS_18230 5669 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence240 2 556 gene locus_tag LOCUS_18240 2 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 570 1481 gene locus_tag LOCUS_18250 gene era 570 1481 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_18250 1574 2224 gene locus_tag LOCUS_18260 1574 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 2352 3005 gene locus_tag LOCUS_18270 2352 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 3042 4430 gene locus_tag LOCUS_18280 3042 4430 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence241 2245 1250 gene locus_tag LOCUS_18290 gene rbsC 2245 1250 CDS product ribose ABC transporter permease RbsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968282.1 protein_id gnl|my_center|LOCUS_18290 3213 2257 gene locus_tag LOCUS_18300 3213 2257 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061668.1 protein_id gnl|my_center|LOCUS_18300 4724 3216 gene locus_tag LOCUS_18310 4724 3216 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223211.1 protein_id gnl|my_center|LOCUS_18310 5895 4828 gene locus_tag LOCUS_18320 5895 4828 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314797.1 protein_id gnl|my_center|LOCUS_18320 >Feature sequence242 4409 822 gene locus_tag LOCUS_18330 4409 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 5298 4681 gene locus_tag LOCUS_18340 5298 4681 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964647.1 protein_id gnl|my_center|LOCUS_18340 5559 5299 gene locus_tag LOCUS_18350 5559 5299 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454698.1 protein_id gnl|my_center|LOCUS_18350 5373 5382 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5819 5556 gene locus_tag LOCUS_18360 5819 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 >Feature sequence243 <1 886 gene locus_tag LOCUS_18370 <1 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023852887.1:tripartite tricarboxylate transporter substrate binding protein 912 1379 gene locus_tag LOCUS_18380 912 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 1391 2728 gene locus_tag LOCUS_18390 1391 2728 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724194.1 protein_id gnl|my_center|LOCUS_18390 2898 3812 gene locus_tag LOCUS_18400 2898 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 5758 3911 gene locus_tag LOCUS_18410 5758 3911 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193735789.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence244 58 1002 gene locus_tag LOCUS_18420 58 1002 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061696.1 protein_id gnl|my_center|LOCUS_18420 1013 1876 gene locus_tag LOCUS_18430 1013 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 1864 2274 gene locus_tag LOCUS_18440 1864 2274 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211334279.1 protein_id gnl|my_center|LOCUS_18440 2313 3851 gene locus_tag LOCUS_18450 gene gguA 2313 3851 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061407.1 protein_id gnl|my_center|LOCUS_18450 3855 5021 gene locus_tag LOCUS_18460 gene gguB 3855 5021 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727841.1 protein_id gnl|my_center|LOCUS_18460 >Feature sequence245 536 721 gene locus_tag LOCUS_18470 536 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 733 873 gene locus_tag LOCUS_18480 733 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 1264 1992 gene locus_tag LOCUS_18490 1264 1992 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107878.1 protein_id gnl|my_center|LOCUS_18490 1268 1277 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2385 3224 gene locus_tag LOCUS_18500 2385 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 3154 4110 gene locus_tag LOCUS_18510 gene prmA 3154 4110 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964596.1 protein_id gnl|my_center|LOCUS_18510 4190 4939 gene locus_tag LOCUS_18520 4190 4939 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence246 11 271 gene locus_tag LOCUS_18530 11 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1695 418 gene locus_tag LOCUS_18540 gene aroA 1695 418 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664618.1 protein_id gnl|my_center|LOCUS_18540 2854 1721 gene locus_tag LOCUS_18550 gene tyrA 2854 1721 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228123.1 protein_id gnl|my_center|LOCUS_18550 3950 2928 gene locus_tag LOCUS_18560 gene aroF 3950 2928 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_18560 4406 5755 gene locus_tag LOCUS_18570 4406 5755 CDS product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893189.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence247 91 708 gene locus_tag LOCUS_18580 91 708 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 protein_id gnl|my_center|LOCUS_18580 705 1277 gene locus_tag LOCUS_18590 705 1277 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 protein_id gnl|my_center|LOCUS_18590 1394 1185 gene locus_tag LOCUS_18600 1394 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 1448 2779 gene locus_tag LOCUS_18610 1448 2779 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016800.1 protein_id gnl|my_center|LOCUS_18610 3291 2911 gene locus_tag LOCUS_18620 3291 2911 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287076.1 protein_id gnl|my_center|LOCUS_18620 4476 3517 gene locus_tag LOCUS_18630 4476 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 4686 4504 gene locus_tag LOCUS_18640 4686 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 5679 4696 gene locus_tag LOCUS_18650 5679 4696 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence248 40 1140 gene locus_tag LOCUS_18660 40 1140 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050532079.1 protein_id gnl|my_center|LOCUS_18660 2301 1228 gene locus_tag LOCUS_18670 2301 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 2420 3169 gene locus_tag LOCUS_18680 2420 3169 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530480.1 protein_id gnl|my_center|LOCUS_18680 4190 3195 gene locus_tag LOCUS_18690 4190 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 4666 4187 gene locus_tag LOCUS_18700 4666 4187 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 protein_id gnl|my_center|LOCUS_18700 5876 4848 gene locus_tag LOCUS_18710 gene prfA 5876 4848 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_18710 >Feature sequence249 <1 758 gene locus_tag LOCUS_18720 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986493.1:ABC transporter ATP-binding protein 755 2509 gene locus_tag LOCUS_18730 755 2509 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986492.1 protein_id gnl|my_center|LOCUS_18730 4132 2756 gene locus_tag LOCUS_18740 4132 2756 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356594.1 protein_id gnl|my_center|LOCUS_18740 5562 4204 gene locus_tag LOCUS_18750 5562 4204 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence250 60 1712 gene locus_tag LOCUS_18760 60 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948590.1 protein_id gnl|my_center|LOCUS_18760 2355 1807 gene locus_tag LOCUS_18770 2355 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18770 3474 2362 gene locus_tag LOCUS_18780 3474 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18780 5054 3771 gene locus_tag LOCUS_18790 5054 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 <5842 5212 gene locus_tag LOCUS_18800 <5842 5212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010990035.1:BglG family transcription antiterminator >Feature sequence251 <1 1126 gene locus_tag LOCUS_18810 <1 1126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000753855.1:choline-binding protein PcpA 1166 1669 gene locus_tag LOCUS_18820 gene greA 1166 1669 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965725.1 protein_id gnl|my_center|LOCUS_18820 1719 3044 gene locus_tag LOCUS_18830 1719 3044 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966626.1 protein_id gnl|my_center|LOCUS_18830 3147 4364 gene locus_tag LOCUS_18840 3147 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 5562 4378 gene locus_tag LOCUS_18850 5562 4378 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence252 1342 929 gene locus_tag LOCUS_18860 1342 929 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358536.1 protein_id gnl|my_center|LOCUS_18860 2003 1308 gene locus_tag LOCUS_18870 gene deoC 2003 1308 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453154.1 protein_id gnl|my_center|LOCUS_18870 2507 2109 gene locus_tag LOCUS_18880 gene ybaK 2507 2109 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002404288.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18880 2778 3872 gene locus_tag LOCUS_18890 2778 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 <5841 4755 gene locus_tag LOCUS_18900 <5841 4755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437464.1:DEAD/DEAH box helicase >Feature sequence253 199 1278 gene locus_tag LOCUS_18910 199 1278 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042143812.1 protein_id gnl|my_center|LOCUS_18910 1348 1863 gene locus_tag LOCUS_18920 1348 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 1925 3139 gene locus_tag LOCUS_18930 1925 3139 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384579.1 protein_id gnl|my_center|LOCUS_18930 3152 4231 gene locus_tag LOCUS_18940 3152 4231 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 protein_id gnl|my_center|LOCUS_18940 4237 5409 gene locus_tag LOCUS_18950 4237 5409 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095329.1 protein_id gnl|my_center|LOCUS_18950 5409 5594 gene locus_tag LOCUS_18960 5409 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 5754 5500 gene locus_tag LOCUS_18970 5754 5500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence254 160 522 gene locus_tag LOCUS_18980 160 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 1764 640 gene locus_tag LOCUS_18990 1764 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 3626 1776 gene locus_tag LOCUS_19000 gene gyrB 3626 1776 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_19000 4036 3905 gene locus_tag LOCUS_19010 4036 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 3908 3917 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4835 4128 gene locus_tag LOCUS_19020 4835 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 >Feature sequence255 1125 10 gene locus_tag LOCUS_19030 1125 10 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485679.1 protein_id gnl|my_center|LOCUS_19030 2470 1139 gene locus_tag LOCUS_19040 2470 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 2655 2506 gene locus_tag LOCUS_19050 gene rpmG 2655 2506 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831295.1 protein_id gnl|my_center|LOCUS_19050 3605 2724 gene locus_tag LOCUS_19060 3605 2724 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942544.1 protein_id gnl|my_center|LOCUS_19060 5117 3702 gene locus_tag LOCUS_19070 5117 3702 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815046.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19070 3867 3876 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <5791 5114 gene locus_tag LOCUS_19080 <5791 5114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815048.1:GTP-binding protein >Feature sequence256 309 318 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 349 1107 gene locus_tag LOCUS_19090 349 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 1252 1722 gene locus_tag LOCUS_19100 1252 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19100 1921 3726 gene locus_tag LOCUS_19110 1921 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19110 3751 4446 gene locus_tag LOCUS_19120 3751 4446 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897077.1 protein_id gnl|my_center|LOCUS_19120 5505 4453 gene locus_tag LOCUS_19130 5505 4453 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435347.1 protein_id gnl|my_center|LOCUS_19130 >Feature sequence257 384 19 gene locus_tag LOCUS_19140 384 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 995 399 gene locus_tag LOCUS_19150 995 399 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817527.1 protein_id gnl|my_center|LOCUS_19150 1224 1592 gene locus_tag LOCUS_19160 1224 1592 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385301.1 protein_id gnl|my_center|LOCUS_19160 2968 1733 gene locus_tag LOCUS_19170 gene hydA 2968 1733 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891590.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19170 2907 2916 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3915 3178 gene locus_tag LOCUS_19180 3915 3178 CDS product N-carbamoylsarcosine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258125.1 protein_id gnl|my_center|LOCUS_19180 4202 5785 gene locus_tag LOCUS_19190 4202 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 >Feature sequence258 1255 416 gene locus_tag LOCUS_19200 1255 416 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803810.1 protein_id gnl|my_center|LOCUS_19200 2223 1252 gene locus_tag LOCUS_19210 2223 1252 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969646.1 protein_id gnl|my_center|LOCUS_19210 3626 2259 gene locus_tag LOCUS_19220 3626 2259 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969647.1 protein_id gnl|my_center|LOCUS_19220 3855 3664 gene locus_tag LOCUS_19230 3855 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 4032 4199 gene locus_tag LOCUS_19240 4032 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 5498 4383 gene locus_tag LOCUS_19250 5498 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 >Feature sequence259 1719 745 gene locus_tag LOCUS_19260 1719 745 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932731.1 protein_id gnl|my_center|LOCUS_19260 2948 1749 gene locus_tag LOCUS_19270 2948 1749 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_19270 4551 3055 gene locus_tag LOCUS_19280 gene xylB 4551 3055 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_19280 4946 4557 gene locus_tag LOCUS_19290 4946 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 5757 4960 gene locus_tag LOCUS_19300 5757 4960 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence260 1231 233 gene locus_tag LOCUS_19310 1231 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 2288 1239 gene locus_tag LOCUS_19320 gene queA 2288 1239 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_19320 3378 2308 gene locus_tag LOCUS_19330 3378 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 3994 3632 gene locus_tag LOCUS_19340 3994 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 4914 3997 gene locus_tag LOCUS_19350 4914 3997 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209628184.1 protein_id gnl|my_center|LOCUS_19350 <5762 4911 gene locus_tag LOCUS_19360 <5762 4911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583990.1:ABC transporter permease >Feature sequence261 1404 421 gene locus_tag LOCUS_19370 1404 421 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021910.1 protein_id gnl|my_center|LOCUS_19370 3120 1420 gene locus_tag LOCUS_19380 3120 1420 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461189.1 protein_id gnl|my_center|LOCUS_19380 4720 3473 gene locus_tag LOCUS_19390 4720 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 5468 4797 gene locus_tag LOCUS_19400 5468 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 >Feature sequence262 873 661 gene locus_tag LOCUS_19410 873 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 1989 907 gene locus_tag LOCUS_19420 1989 907 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964021.1 protein_id gnl|my_center|LOCUS_19420 2959 2018 gene locus_tag LOCUS_19430 2959 2018 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536791.1 protein_id gnl|my_center|LOCUS_19430 3723 2956 gene locus_tag LOCUS_19440 3723 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19440 4043 3729 gene locus_tag LOCUS_19450 4043 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19450 3732 3755 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5562 4030 gene locus_tag LOCUS_19460 5562 4030 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583514.1 protein_id gnl|my_center|LOCUS_19460 >Feature sequence263 674 1186 gene locus_tag LOCUS_19470 674 1186 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966038.1 protein_id gnl|my_center|LOCUS_19470 5085 1312 gene locus_tag LOCUS_19480 5085 1312 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence264 63 1262 gene locus_tag LOCUS_19490 gene dpaL 63 1262 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819571.1 protein_id gnl|my_center|LOCUS_19490 4405 1358 gene locus_tag LOCUS_19500 4405 1358 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861545.1 protein_id gnl|my_center|LOCUS_19500 5547 4420 gene locus_tag LOCUS_19510 5547 4420 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214676.1 protein_id gnl|my_center|LOCUS_19510 >Feature sequence265 1518 106 gene locus_tag LOCUS_19520 1518 106 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_19520 2702 1557 gene locus_tag LOCUS_19530 2702 1557 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_19530 2944 2753 gene locus_tag LOCUS_19540 2944 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 2944 3114 gene locus_tag LOCUS_19550 2944 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 3988 3182 gene locus_tag LOCUS_19560 3988 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 5469 4018 gene locus_tag LOCUS_19570 5469 4018 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 protein_id gnl|my_center|LOCUS_19570 >Feature sequence266 77 1240 gene locus_tag LOCUS_19580 77 1240 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612363.1 protein_id gnl|my_center|LOCUS_19580 1349 2374 gene locus_tag LOCUS_19590 1349 2374 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613875.1 protein_id gnl|my_center|LOCUS_19590 2387 3907 gene locus_tag LOCUS_19600 2387 3907 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967750.1 protein_id gnl|my_center|LOCUS_19600 3921 4883 gene locus_tag LOCUS_19610 3921 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978822.1 protein_id gnl|my_center|LOCUS_19610 <5740 4887 gene locus_tag LOCUS_19620 <5740 4887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002901419.1:AraC family transcriptional regulator >Feature sequence267 1274 489 gene locus_tag LOCUS_19630 1274 489 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109278.1 protein_id gnl|my_center|LOCUS_19630 2904 1294 gene locus_tag LOCUS_19640 2904 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 4090 3074 gene locus_tag LOCUS_19650 gene galE 4090 3074 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_19650 4611 4222 gene locus_tag LOCUS_19660 4611 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19660 5625 4612 gene locus_tag LOCUS_19670 5625 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19670 >Feature sequence268 72 569 gene locus_tag LOCUS_19680 72 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 599 1777 gene locus_tag LOCUS_19690 599 1777 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089637.1 protein_id gnl|my_center|LOCUS_19690 1890 2777 gene locus_tag LOCUS_19700 1890 2777 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_19700 2774 3784 gene locus_tag LOCUS_19710 2774 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 3781 4602 gene locus_tag LOCUS_19720 3781 4602 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680286.1 protein_id gnl|my_center|LOCUS_19720 4595 5305 gene locus_tag LOCUS_19730 4595 5305 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680283.1 protein_id gnl|my_center|LOCUS_19730 >Feature sequence269 <1 833 gene locus_tag LOCUS_19740 <1 833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003233927.1:DUF3048 domain-containing protein 853 2547 gene locus_tag LOCUS_19750 853 2547 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964334.1 protein_id gnl|my_center|LOCUS_19750 2742 3140 gene locus_tag LOCUS_19760 2742 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 3349 4698 gene locus_tag LOCUS_19770 3349 4698 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_19770 3821 3830 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence270 <1 934 gene locus_tag LOCUS_19780 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000421907.1:LysR family transcriptional regulator 1077 2444 gene locus_tag LOCUS_19790 gene brnQ 1077 2444 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964918.1 protein_id gnl|my_center|LOCUS_19790 2487 4277 gene locus_tag LOCUS_19800 gene recJ 2487 4277 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943623.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence271 28 738 gene locus_tag LOCUS_19810 28 738 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815292.1 protein_id gnl|my_center|LOCUS_19810 754 2154 gene locus_tag LOCUS_19820 754 2154 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861243.1 protein_id gnl|my_center|LOCUS_19820 2129 2878 gene locus_tag LOCUS_19830 2129 2878 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760203.1 protein_id gnl|my_center|LOCUS_19830 3018 3917 gene locus_tag LOCUS_19840 3018 3917 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272547.1 protein_id gnl|my_center|LOCUS_19840 4087 4746 gene locus_tag LOCUS_19850 4087 4746 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272546.1 protein_id gnl|my_center|LOCUS_19850 4766 5533 gene locus_tag LOCUS_19860 4766 5533 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815786.1 protein_id gnl|my_center|LOCUS_19860 >Feature sequence272 320 940 gene locus_tag LOCUS_19870 320 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 930 1700 gene locus_tag LOCUS_19880 930 1700 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896415.1 protein_id gnl|my_center|LOCUS_19880 1687 2403 gene locus_tag LOCUS_19890 1687 2403 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893083.1 protein_id gnl|my_center|LOCUS_19890 2418 3500 gene locus_tag LOCUS_19900 2418 3500 CDS product NrtA/SsuA/CpmA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429089.1 protein_id gnl|my_center|LOCUS_19900 3770 5062 gene locus_tag LOCUS_19910 3770 5062 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966804.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence273 513 31 gene locus_tag LOCUS_19920 513 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2114 609 gene locus_tag LOCUS_19930 2114 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 3921 2134 gene locus_tag LOCUS_19940 3921 2134 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_19940 5361 4168 gene locus_tag LOCUS_19950 gene metK 5361 4168 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163123.1 protein_id gnl|my_center|LOCUS_19950 >Feature sequence274 1177 143 gene locus_tag LOCUS_19960 1177 143 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_19960 1499 2944 gene locus_tag LOCUS_19970 1499 2944 CDS product beta-fructofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296814.1 protein_id gnl|my_center|LOCUS_19970 2972 4291 gene locus_tag LOCUS_19980 2972 4291 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243455.1 protein_id gnl|my_center|LOCUS_19980 4360 5262 gene locus_tag LOCUS_19990 4360 5262 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256269.1 protein_id gnl|my_center|LOCUS_19990 >Feature sequence275 83 394 gene locus_tag LOCUS_20000 83 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 604 2043 gene locus_tag LOCUS_20010 604 2043 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666927.1 protein_id gnl|my_center|LOCUS_20010 4075 2222 gene locus_tag LOCUS_20020 4075 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 4756 4292 gene locus_tag LOCUS_20030 4756 4292 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964154.1 protein_id gnl|my_center|LOCUS_20030 <5641 4853 gene locus_tag LOCUS_20040 <5641 4853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_170291217.1:cell wall hydrolase >Feature sequence276 271 630 gene locus_tag LOCUS_20050 271 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 1289 801 gene locus_tag LOCUS_20060 1289 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 1409 3172 gene locus_tag LOCUS_20070 1409 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 4630 3212 gene locus_tag LOCUS_20080 gene clpX 4630 3212 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082752.1 protein_id gnl|my_center|LOCUS_20080 <5635 4779 gene locus_tag LOCUS_20090 <5635 4779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015943178.1:trypsin-like peptidase domain-containing protein >Feature sequence277 997 134 gene locus_tag LOCUS_20100 997 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 1575 1093 gene locus_tag LOCUS_20110 gene rnhA 1575 1093 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705464.1 protein_id gnl|my_center|LOCUS_20110 3205 1604 gene locus_tag LOCUS_20120 3205 1604 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_20120 3494 3372 gene locus_tag LOCUS_20130 3494 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20130 4847 3597 gene locus_tag LOCUS_20140 gene spoIVA 4847 3597 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454943.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20140 5513 5052 gene locus_tag LOCUS_20150 5513 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 >Feature sequence278 1075 266 gene locus_tag LOCUS_20160 1075 266 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965542.1 protein_id gnl|my_center|LOCUS_20160 1637 1053 gene locus_tag LOCUS_20170 1637 1053 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389803.1 protein_id gnl|my_center|LOCUS_20170 1759 1768 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2996 1794 gene locus_tag LOCUS_20180 2996 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 4598 3204 gene locus_tag LOCUS_20190 4598 3204 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861085.1 protein_id gnl|my_center|LOCUS_20190 5558 4617 gene locus_tag LOCUS_20200 5558 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 >Feature sequence279 966 247 gene locus_tag LOCUS_20210 gene hisA 966 247 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256251.1 protein_id gnl|my_center|LOCUS_20210 1987 986 gene locus_tag LOCUS_20220 1987 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2592 2002 gene locus_tag LOCUS_20230 gene hisB 2592 2002 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263176.1 protein_id gnl|my_center|LOCUS_20230 4046 2754 gene locus_tag LOCUS_20240 gene hisD 4046 2754 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949111.1 protein_id gnl|my_center|LOCUS_20240 4694 4047 gene locus_tag LOCUS_20250 gene hisG 4694 4047 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358779.1 protein_id gnl|my_center|LOCUS_20250 <5605 4725 gene locus_tag LOCUS_20260 <5605 4725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964253.1:ATP phosphoribosyltransferase regulatory subunit >Feature sequence280 199 429 gene locus_tag LOCUS_20270 199 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 746 1180 gene locus_tag LOCUS_20280 746 1180 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779558.1 protein_id gnl|my_center|LOCUS_20280 1916 1476 gene locus_tag LOCUS_20290 1916 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20290 2757 2029 gene locus_tag LOCUS_20300 2757 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20300 3005 2757 gene locus_tag LOCUS_20310 3005 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 3269 3006 gene locus_tag LOCUS_20320 3269 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 4396 3308 gene locus_tag LOCUS_20330 4396 3308 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_20330 5077 4424 gene locus_tag LOCUS_20340 5077 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20340 5405 5058 gene locus_tag LOCUS_20350 5405 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20350 >Feature sequence281 5582 606 gene locus_tag LOCUS_20360 5582 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 >Feature sequence282 840 571 gene locus_tag LOCUS_20370 840 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 1600 947 gene locus_tag LOCUS_20380 1600 947 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_20380 1720 2433 gene locus_tag LOCUS_20390 1720 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20390 2369 2378 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2478 3332 gene locus_tag LOCUS_20400 2478 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20400 4189 3404 gene locus_tag LOCUS_20410 gene yaaA 4189 3404 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458998.1 protein_id gnl|my_center|LOCUS_20410 4794 4198 gene locus_tag LOCUS_20420 gene lepB 4794 4198 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583882.1 protein_id gnl|my_center|LOCUS_20420 <5563 4818 gene locus_tag LOCUS_20430 <5563 4818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002385467.1:glutamate-5-semialdehyde dehydrogenase >Feature sequence283 230 955 gene locus_tag LOCUS_20440 230 955 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219152.1 protein_id gnl|my_center|LOCUS_20440 970 2244 gene locus_tag LOCUS_20450 970 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 2394 3155 gene locus_tag LOCUS_20460 2394 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 3160 4644 gene locus_tag LOCUS_20470 3160 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 4656 5327 gene locus_tag LOCUS_20480 4656 5327 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460105.1 protein_id gnl|my_center|LOCUS_20480 >Feature sequence284 54 1634 gene locus_tag LOCUS_20490 54 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 1631 2152 gene locus_tag LOCUS_20500 1631 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 2163 3443 gene locus_tag LOCUS_20510 2163 3443 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083225.1 protein_id gnl|my_center|LOCUS_20510 4835 3555 gene locus_tag LOCUS_20520 4835 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 5353 4838 gene locus_tag LOCUS_20530 5353 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 >Feature sequence285 <1 1507 gene locus_tag LOCUS_20540 <1 1507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243833.1:two-component system sensor histidine kinase YesM 1508 3136 gene locus_tag LOCUS_20550 1508 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 5330 3090 gene locus_tag LOCUS_20560 5330 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 >Feature sequence286 1747 1322 gene locus_tag LOCUS_20570 1747 1322 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002301684.1 protein_id gnl|my_center|LOCUS_20570 2170 1781 gene locus_tag LOCUS_20580 2170 1781 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002301685.1 protein_id gnl|my_center|LOCUS_20580 3292 2186 gene locus_tag LOCUS_20590 3292 2186 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989865.1 protein_id gnl|my_center|LOCUS_20590 4154 3306 gene locus_tag LOCUS_20600 4154 3306 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723163.1 protein_id gnl|my_center|LOCUS_20600 4903 4154 gene locus_tag LOCUS_20610 4903 4154 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453987.1 protein_id gnl|my_center|LOCUS_20610 5415 4939 gene locus_tag LOCUS_20620 5415 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 >Feature sequence287 45 851 gene locus_tag LOCUS_20630 45 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 1295 939 gene locus_tag LOCUS_20640 gene rplT 1295 939 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429730.1 protein_id gnl|my_center|LOCUS_20640 1520 1323 gene locus_tag LOCUS_20650 gene rpmI 1520 1323 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_20650 1713 1549 gene locus_tag LOCUS_20660 1713 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20660 2043 1729 gene locus_tag LOCUS_20670 2043 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20670 3813 2359 gene locus_tag LOCUS_20680 3813 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 <5541 3827 gene locus_tag LOCUS_20690 <5541 3827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_196793289.1:PAS domain-containing hybrid sensor histidine kinase/response regulator >Feature sequence288 <1 617 gene locus_tag LOCUS_20700 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_214357293.1:MerR family transcriptional regulator 1652 672 gene locus_tag LOCUS_20710 1652 672 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263651.1 protein_id gnl|my_center|LOCUS_20710 2804 1863 gene locus_tag LOCUS_20720 2804 1863 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732677.1 protein_id gnl|my_center|LOCUS_20720 3637 2801 gene locus_tag LOCUS_20730 3637 2801 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_20730 5205 3670 gene locus_tag LOCUS_20740 5205 3670 CDS product DUF5605 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080612.1 protein_id gnl|my_center|LOCUS_20740 >Feature sequence289 1740 163 gene locus_tag LOCUS_20750 1740 163 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_20750 1982 1755 gene locus_tag LOCUS_20760 1982 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 3319 1982 gene locus_tag LOCUS_20770 3319 1982 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225484.1 protein_id gnl|my_center|LOCUS_20770 4829 3312 gene locus_tag LOCUS_20780 4829 3312 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_20780 5493 5065 gene locus_tag LOCUS_20790 5493 5065 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_20790 >Feature sequence290 <1 692 gene locus_tag LOCUS_20800 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640554.1:Xaa-Pro dipeptidase 1282 737 gene locus_tag LOCUS_20810 1282 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 1438 1316 gene locus_tag LOCUS_20820 1438 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 1647 2468 gene locus_tag LOCUS_20830 1647 2468 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_20830 2468 3403 gene locus_tag LOCUS_20840 2468 3403 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_20840 3458 4321 gene locus_tag LOCUS_20850 3458 4321 CDS product phosphogluconate dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027214.1 protein_id gnl|my_center|LOCUS_20850 4344 5312 gene locus_tag LOCUS_20860 4344 5312 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271954.1 protein_id gnl|my_center|LOCUS_20860 >Feature sequence291 98 754 gene locus_tag LOCUS_20870 98 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 1718 906 gene locus_tag LOCUS_20880 1718 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 1840 1610 gene locus_tag LOCUS_20890 1840 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 3368 1968 gene locus_tag LOCUS_20900 3368 1968 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366303.1 protein_id gnl|my_center|LOCUS_20900 5372 3678 gene locus_tag LOCUS_20910 5372 3678 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945515.1 protein_id gnl|my_center|LOCUS_20910 >Feature sequence292 <1 1239 gene locus_tag LOCUS_20920 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393761.1:phenylacetate--CoA ligase 1296 3044 gene locus_tag LOCUS_20930 gene iorA 1296 3044 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_20930 3046 3621 gene locus_tag LOCUS_20940 3046 3621 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_20940 3677 4975 gene locus_tag LOCUS_20950 3677 4975 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_20950 4987 5415 gene locus_tag LOCUS_20960 4987 5415 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879168.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence293 1159 578 gene locus_tag LOCUS_20970 1159 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 1522 1214 gene locus_tag LOCUS_20980 1522 1214 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_20980 1961 1527 gene locus_tag LOCUS_20990 1961 1527 CDS product ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869272.1 protein_id gnl|my_center|LOCUS_20990 3970 2030 gene locus_tag LOCUS_21000 3970 2030 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_21000 5007 3988 gene locus_tag LOCUS_21010 5007 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 5323 5012 gene locus_tag LOCUS_21020 5323 5012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence294 1972 434 gene locus_tag LOCUS_21030 gene cobA 1972 434 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_21030 2879 1974 gene locus_tag LOCUS_21040 gene hemC 2879 1974 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930577.1 protein_id gnl|my_center|LOCUS_21040 3522 2872 gene locus_tag LOCUS_21050 3522 2872 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125118834.1 protein_id gnl|my_center|LOCUS_21050 5026 3701 gene locus_tag LOCUS_21060 5026 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence295 1070 108 gene locus_tag LOCUS_21070 1070 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 2830 1466 gene locus_tag LOCUS_21080 2830 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 3547 2843 gene locus_tag LOCUS_21090 3547 2843 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102804.1 protein_id gnl|my_center|LOCUS_21090 4499 3528 gene locus_tag LOCUS_21100 4499 3528 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_21100 5397 4492 gene locus_tag LOCUS_21110 gene chbR 5397 4492 CDS product transcriptional regulator ChbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097020.1 protein_id gnl|my_center|LOCUS_21110 >Feature sequence296 1008 223 gene locus_tag LOCUS_21120 1008 223 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027227.1 protein_id gnl|my_center|LOCUS_21120 1648 998 gene locus_tag LOCUS_21130 1648 998 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383606.1 protein_id gnl|my_center|LOCUS_21130 2223 1645 gene locus_tag LOCUS_21140 gene gmhB 2223 1645 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_21140 3310 2240 gene locus_tag LOCUS_21150 3310 2240 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966336.1 protein_id gnl|my_center|LOCUS_21150 4081 3374 gene locus_tag LOCUS_21160 4081 3374 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966337.1 protein_id gnl|my_center|LOCUS_21160 <5451 4170 gene locus_tag LOCUS_21170 <5451 4170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_136798312.1:glycosyltransferase >Feature sequence297 1763 858 gene locus_tag LOCUS_21180 1763 858 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583516.1 protein_id gnl|my_center|LOCUS_21180 2798 1767 gene locus_tag LOCUS_21190 2798 1767 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969292.1 protein_id gnl|my_center|LOCUS_21190 3165 2782 gene locus_tag LOCUS_21200 3165 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21200 4297 3200 gene locus_tag LOCUS_21210 4297 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21210 5420 4314 gene locus_tag LOCUS_21220 5420 4314 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902635.1 protein_id gnl|my_center|LOCUS_21220 >Feature sequence298 1634 132 gene locus_tag LOCUS_21230 gene gcvPB 1634 132 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679310.1 protein_id gnl|my_center|LOCUS_21230 2998 1631 gene locus_tag LOCUS_21240 gene gcvPA 2998 1631 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678346.1 protein_id gnl|my_center|LOCUS_21240 3413 3033 gene locus_tag LOCUS_21250 gene gcvH 3413 3033 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249105.1 protein_id gnl|my_center|LOCUS_21250 4638 3532 gene locus_tag LOCUS_21260 gene gcvT 4638 3532 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631769.1 protein_id gnl|my_center|LOCUS_21260 5407 5210 gene locus_tag LOCUS_21270 5407 5210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 >Feature sequence299 1806 613 gene locus_tag LOCUS_21280 gene tuf 1806 613 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887863.1 protein_id gnl|my_center|LOCUS_21280 4033 1916 gene locus_tag LOCUS_21290 gene fusA 4033 1916 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436178.1 protein_id gnl|my_center|LOCUS_21290 4552 4082 gene locus_tag LOCUS_21300 gene rpsG 4552 4082 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357613.1 protein_id gnl|my_center|LOCUS_21300 5326 4907 gene locus_tag LOCUS_21310 gene rpsL 5326 4907 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_21310 >Feature sequence300 83 580 gene locus_tag LOCUS_21320 83 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 762 1985 gene locus_tag LOCUS_21330 gene pepT 762 1985 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963798.1 protein_id gnl|my_center|LOCUS_21330 3134 2169 gene locus_tag LOCUS_21340 3134 2169 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837553.1 protein_id gnl|my_center|LOCUS_21340 4332 3445 gene locus_tag LOCUS_21350 4332 3445 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108784.1 protein_id gnl|my_center|LOCUS_21350 5374 4361 gene locus_tag LOCUS_21360 5374 4361 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535705.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence301 502 29 gene locus_tag LOCUS_21370 502 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 1751 522 gene locus_tag LOCUS_21380 1751 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 2744 1791 gene locus_tag LOCUS_21390 2744 1791 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_21390 3724 2747 gene locus_tag LOCUS_21400 3724 2747 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 protein_id gnl|my_center|LOCUS_21400 4623 3736 gene locus_tag LOCUS_21410 4623 3736 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453817.1 protein_id gnl|my_center|LOCUS_21410 5413 4613 gene locus_tag LOCUS_21420 5413 4613 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_21420 >Feature sequence302 <1 607 gene locus_tag LOCUS_21430 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193576902.1:peptide chain release factor 2 1204 671 gene locus_tag LOCUS_21440 1204 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 1748 1185 gene locus_tag LOCUS_21450 1748 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 3831 1789 gene locus_tag LOCUS_21460 3831 1789 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460617.1 protein_id gnl|my_center|LOCUS_21460 4530 3853 gene locus_tag LOCUS_21470 4530 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813876.1 protein_id gnl|my_center|LOCUS_21470 5306 4587 gene locus_tag LOCUS_21480 5306 4587 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461125.1 protein_id gnl|my_center|LOCUS_21480 >Feature sequence303 <1 731 gene locus_tag LOCUS_21490 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383270.1:LacI family DNA-binding transcriptional regulator 803 1810 gene locus_tag LOCUS_21500 803 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 1822 2601 gene locus_tag LOCUS_21510 1822 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 2645 3553 gene locus_tag LOCUS_21520 gene dapA 2645 3553 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880718.1 protein_id gnl|my_center|LOCUS_21520 4061 3696 gene locus_tag LOCUS_21530 4061 3696 CDS product Zn-finger containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964917.1 protein_id gnl|my_center|LOCUS_21530 <5401 4282 gene locus_tag LOCUS_21540 <5401 4282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948237.1:PhoH family protein >Feature sequence304 2325 1321 gene locus_tag LOCUS_21550 2325 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 3544 2564 gene locus_tag LOCUS_21560 3544 2564 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439589.1 protein_id gnl|my_center|LOCUS_21560 5129 3654 gene locus_tag LOCUS_21570 gene dacF 5129 3654 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_21570 4385 4394 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence305 3779 1539 gene locus_tag LOCUS_21580 3779 1539 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400844.1 protein_id gnl|my_center|LOCUS_21580 4639 3806 gene locus_tag LOCUS_21590 4639 3806 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 protein_id gnl|my_center|LOCUS_21590 <5350 4641 gene locus_tag LOCUS_21600 <5350 4641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775954.1:sugar ABC transporter permease >Feature sequence306 2212 2502 gene locus_tag LOCUS_21610 2212 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 2610 3062 gene locus_tag LOCUS_21620 2610 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 2948 3664 gene locus_tag LOCUS_21630 2948 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 4394 3699 gene locus_tag LOCUS_21640 4394 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21640 4807 4343 gene locus_tag LOCUS_21650 4807 4343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21650 4398 4407 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5216 4773 gene locus_tag LOCUS_21660 5216 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21660 4831 4840 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence307 2681 1776 gene locus_tag LOCUS_21670 2681 1776 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_21670 3060 2668 gene locus_tag LOCUS_21680 3060 2668 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723373.1 protein_id gnl|my_center|LOCUS_21680 3256 4953 gene locus_tag LOCUS_21690 3256 4953 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393463.1 protein_id gnl|my_center|LOCUS_21690 >Feature sequence308 369 1199 gene locus_tag LOCUS_21700 369 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 1167 1176 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1375 2757 gene locus_tag LOCUS_21710 1375 2757 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876596.1 protein_id gnl|my_center|LOCUS_21710 2774 3250 gene locus_tag LOCUS_21720 2774 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21720 3196 4002 gene locus_tag LOCUS_21730 3196 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21730 3999 4508 gene locus_tag LOCUS_21740 3999 4508 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879257.1 protein_id gnl|my_center|LOCUS_21740 4489 5217 gene locus_tag LOCUS_21750 4489 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21750 >Feature sequence309 259 1242 gene locus_tag LOCUS_21760 259 1242 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812232.1 protein_id gnl|my_center|LOCUS_21760 1287 2675 gene locus_tag LOCUS_21770 gene lpdA 1287 2675 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949165.1 protein_id gnl|my_center|LOCUS_21770 3508 2861 gene locus_tag LOCUS_21780 3508 2861 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627160.1 protein_id gnl|my_center|LOCUS_21780 3763 5304 gene locus_tag LOCUS_21790 3763 5304 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109272.1 protein_id gnl|my_center|LOCUS_21790 >Feature sequence310 <1 586 gene locus_tag LOCUS_21800 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009891775.1:ribosome biogenesis GTP-binding protein YihA/YsxC 2204 786 gene locus_tag LOCUS_21810 gene putP 2204 786 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107217.1 protein_id gnl|my_center|LOCUS_21810 2705 3682 gene locus_tag LOCUS_21820 2705 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 4099 3581 gene locus_tag LOCUS_21830 4099 3581 CDS product DUF4364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357273.1 protein_id gnl|my_center|LOCUS_21830 5206 4133 gene locus_tag LOCUS_21840 5206 4133 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence311 <1 645 gene locus_tag LOCUS_21850 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438166.1:O-methyltransferase 670 1905 gene locus_tag LOCUS_21860 670 1905 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_21860 1949 2776 gene locus_tag LOCUS_21870 1949 2776 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963763.1 protein_id gnl|my_center|LOCUS_21870 2848 5295 gene locus_tag LOCUS_21880 2848 5295 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 protein_id gnl|my_center|LOCUS_21880 >Feature sequence312 51 731 gene locus_tag LOCUS_21890 51 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 820 1683 gene locus_tag LOCUS_21900 gene metF 820 1683 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_21900 2605 1706 gene locus_tag LOCUS_21910 2605 1706 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984924.1 protein_id gnl|my_center|LOCUS_21910 2891 4111 gene locus_tag LOCUS_21920 gene arcA 2891 4111 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681549.1 protein_id gnl|my_center|LOCUS_21920 4175 5167 gene locus_tag LOCUS_21930 gene argF 4175 5167 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence313 1520 1401 gene locus_tag LOCUS_21940 1520 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 2624 1536 gene locus_tag LOCUS_21950 2624 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 3979 3026 gene locus_tag LOCUS_21960 3979 3026 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864933.1 protein_id gnl|my_center|LOCUS_21960 3085 3094 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4814 4104 gene locus_tag LOCUS_21970 4814 4104 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887677.1 protein_id gnl|my_center|LOCUS_21970 >Feature sequence314 329 1327 gene locus_tag LOCUS_21980 gene msrAB 329 1327 CDS product bifunctional peptide-methionine (S)-S-oxide reductase MsrA/peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995985.1 protein_id gnl|my_center|LOCUS_21980 1454 2152 gene locus_tag LOCUS_21990 1454 2152 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815859.1 protein_id gnl|my_center|LOCUS_21990 2379 2149 gene locus_tag LOCUS_22000 2379 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 2194 2203 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2353 3981 gene locus_tag LOCUS_22010 2353 3981 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence315 1605 1300 gene locus_tag LOCUS_22020 1605 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 1775 2734 gene locus_tag LOCUS_22030 1775 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22030 2705 2714 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2763 3434 gene locus_tag LOCUS_22040 2763 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22040 3525 5090 gene locus_tag LOCUS_22050 3525 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 >Feature sequence316 <1 588 gene locus_tag LOCUS_22060 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011475972.1:nucleoside hydrolase 677 1522 gene locus_tag LOCUS_22070 677 1522 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964642.1 protein_id gnl|my_center|LOCUS_22070 1995 1543 gene locus_tag LOCUS_22080 1995 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 3047 1992 gene locus_tag LOCUS_22090 3047 1992 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615678.1 protein_id gnl|my_center|LOCUS_22090 4416 3115 gene locus_tag LOCUS_22100 4416 3115 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378953.1 protein_id gnl|my_center|LOCUS_22100 4919 4419 gene locus_tag LOCUS_22110 4919 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 >Feature sequence317 1002 244 gene locus_tag LOCUS_22120 1002 244 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129430.1 protein_id gnl|my_center|LOCUS_22120 1600 992 gene locus_tag LOCUS_22130 1600 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 3802 1670 gene locus_tag LOCUS_22140 3802 1670 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329693.1 protein_id gnl|my_center|LOCUS_22140 5096 3819 gene locus_tag LOCUS_22150 5096 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329694.1 protein_id gnl|my_center|LOCUS_22150 >Feature sequence318 458 1063 gene locus_tag LOCUS_22160 458 1063 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391707.1 protein_id gnl|my_center|LOCUS_22160 1068 2108 gene locus_tag LOCUS_22170 1068 2108 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235007.1 protein_id gnl|my_center|LOCUS_22170 2134 3102 gene locus_tag LOCUS_22180 2134 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22180 3032 4765 gene locus_tag LOCUS_22190 3032 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22190 3042 3051 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence319 1439 552 gene locus_tag LOCUS_22200 1439 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 1708 2223 gene locus_tag LOCUS_22210 gene cutC 1708 2223 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846651.1 protein_id gnl|my_center|LOCUS_22210 2225 4501 gene locus_tag LOCUS_22220 gene xdhA 2225 4501 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393458.1 protein_id gnl|my_center|LOCUS_22220 >Feature sequence320 129 482 gene locus_tag LOCUS_22230 129 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 553 807 gene locus_tag LOCUS_22240 553 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 883 2232 gene locus_tag LOCUS_22250 883 2232 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_22250 2234 4213 gene locus_tag LOCUS_22260 gene glgB 2234 4213 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141306.1 protein_id gnl|my_center|LOCUS_22260 4372 5121 gene locus_tag LOCUS_22270 4372 5121 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242836.1 protein_id gnl|my_center|LOCUS_22270 >Feature sequence321 314 1426 gene locus_tag LOCUS_22280 gene ugpC 314 1426 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_22280 1568 2656 gene locus_tag LOCUS_22290 1568 2656 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966511.1 protein_id gnl|my_center|LOCUS_22290 2670 3338 gene locus_tag LOCUS_22300 gene ftsE 2670 3338 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_22300 3408 4253 gene locus_tag LOCUS_22310 3408 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 4287 4856 gene locus_tag LOCUS_22320 4287 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 >Feature sequence322 <1 651 gene locus_tag LOCUS_22330 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009895184.1:cysteine--tRNA ligase 636 1181 gene locus_tag LOCUS_22340 636 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 1178 1921 gene locus_tag LOCUS_22350 gene rlmB 1178 1921 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357423.1 protein_id gnl|my_center|LOCUS_22350 1953 2924 gene locus_tag LOCUS_22360 1953 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 2940 3641 gene locus_tag LOCUS_22370 2940 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 3497 3506 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3539 3883 gene locus_tag LOCUS_22380 3539 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 3896 4240 gene locus_tag LOCUS_22390 3896 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 4237 4731 gene locus_tag LOCUS_22400 4237 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence323 30 1304 gene locus_tag LOCUS_22410 30 1304 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896806.1 protein_id gnl|my_center|LOCUS_22410 1410 2804 gene locus_tag LOCUS_22420 1410 2804 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_22420 >Feature sequence324 1216 2 gene locus_tag LOCUS_22430 1216 2 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456640.1 protein_id gnl|my_center|LOCUS_22430 1924 1262 gene locus_tag LOCUS_22440 gene ribE 1924 1262 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493840.1 protein_id gnl|my_center|LOCUS_22440 3018 1906 gene locus_tag LOCUS_22450 gene ribD 3018 1906 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284101.1 protein_id gnl|my_center|LOCUS_22450 3569 3378 gene locus_tag LOCUS_22460 3569 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 3670 4920 gene locus_tag LOCUS_22470 gene sleC 3670 4920 CDS product spore cortex-lytic germination protein SleC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425119.1 protein_id gnl|my_center|LOCUS_22470 >Feature sequence325 46 945 gene locus_tag LOCUS_22480 46 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22480 967 1230 gene locus_tag LOCUS_22490 967 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22490 1365 2507 gene locus_tag LOCUS_22500 1365 2507 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903799.1 protein_id gnl|my_center|LOCUS_22500 2520 3308 gene locus_tag LOCUS_22510 gene etfB 2520 3308 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986693.1 protein_id gnl|my_center|LOCUS_22510 3324 4325 gene locus_tag LOCUS_22520 3324 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 >Feature sequence326 300 2621 gene locus_tag LOCUS_22530 300 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 3784 2618 gene locus_tag LOCUS_22540 3784 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 4431 3817 gene locus_tag LOCUS_22550 4431 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 3871 3880 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <5128 4428 gene locus_tag LOCUS_22560 <5128 4428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016216.1:response regulator >Feature sequence327 1006 98 gene locus_tag LOCUS_22570 1006 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 1209 2762 gene locus_tag LOCUS_22580 1209 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 2752 4533 gene locus_tag LOCUS_22590 2752 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 4648 5081 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatccacacagccctcgcaggctgtgac >Feature sequence328 1153 53 gene locus_tag LOCUS_22600 1153 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22600 1809 1252 gene locus_tag LOCUS_22610 gene efp 1809 1252 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_22610 3334 1946 gene locus_tag LOCUS_22620 3334 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 3908 3402 gene locus_tag LOCUS_22630 3908 3402 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393068.1 protein_id gnl|my_center|LOCUS_22630 4384 3932 gene locus_tag LOCUS_22640 gene nrdR 4384 3932 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence329 <1 560 gene locus_tag LOCUS_22650 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001207527.1:pyrimidine-specific ribonucleoside hydrolase RihA 541 1308 gene locus_tag LOCUS_22660 gene deoD 541 1308 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 protein_id gnl|my_center|LOCUS_22660 1315 2229 gene locus_tag LOCUS_22670 1315 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 2238 3194 gene locus_tag LOCUS_22680 2238 3194 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_22680 3728 3540 gene locus_tag LOCUS_22690 3728 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 >Feature sequence330 389 180 gene locus_tag LOCUS_22700 389 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22700 1746 451 gene locus_tag LOCUS_22710 1746 451 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_22710 3973 1730 gene locus_tag LOCUS_22720 3973 1730 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156899988.1 protein_id gnl|my_center|LOCUS_22720 <5120 3995 gene locus_tag LOCUS_22730 <5120 3995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868784.1:AbgT family transporter >Feature sequence331 428 225 gene locus_tag LOCUS_22740 428 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 520 2688 gene locus_tag LOCUS_22750 520 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 2920 2735 gene locus_tag LOCUS_22760 2920 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 2896 3666 gene locus_tag LOCUS_22770 2896 3666 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949141.1 protein_id gnl|my_center|LOCUS_22770 >Feature sequence332 <1 1293 gene locus_tag LOCUS_22780 <1 1293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000658539.1:D-serine ammonia-lyase 1363 2709 gene locus_tag LOCUS_22790 1363 2709 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_22790 2871 3239 gene locus_tag LOCUS_22800 2871 3239 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385301.1 protein_id gnl|my_center|LOCUS_22800 3364 4083 gene locus_tag LOCUS_22810 3364 4083 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948375.1 protein_id gnl|my_center|LOCUS_22810 4773 4303 gene locus_tag LOCUS_22820 4773 4303 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870309.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence333 <1 1112 gene locus_tag LOCUS_22830 <1 1112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438096.1:acetate kinase 1208 1735 gene locus_tag LOCUS_22840 1208 1735 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_22840 1739 1921 gene locus_tag LOCUS_22850 gene rpmF 1739 1921 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_22850 2157 3452 gene locus_tag LOCUS_22860 2157 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 3365 3374 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3472 3765 gene locus_tag LOCUS_22870 3472 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 >Feature sequence334 1456 671 gene locus_tag LOCUS_22880 1456 671 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861671.1 protein_id gnl|my_center|LOCUS_22880 2063 1449 gene locus_tag LOCUS_22890 2063 1449 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_22890 2701 2150 gene locus_tag LOCUS_22900 2701 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 3213 2749 gene locus_tag LOCUS_22910 3213 2749 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810945.1 protein_id gnl|my_center|LOCUS_22910 3525 3238 gene locus_tag LOCUS_22920 3525 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 4902 3808 gene locus_tag LOCUS_22930 4902 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 >Feature sequence335 2030 1149 gene locus_tag LOCUS_22940 2030 1149 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22940 2126 2135 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2547 3512 gene locus_tag LOCUS_22950 2547 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 3721 4806 gene locus_tag LOCUS_22960 gene eno 3721 4806 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898301.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22960 >Feature sequence336 14 1651 gene locus_tag LOCUS_22970 14 1651 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425090.1 protein_id gnl|my_center|LOCUS_22970 1675 2286 gene locus_tag LOCUS_22980 1675 2286 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006874833.1 protein_id gnl|my_center|LOCUS_22980 2291 2767 gene locus_tag LOCUS_22990 2291 2767 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425085.1 protein_id gnl|my_center|LOCUS_22990 2785 3729 gene locus_tag LOCUS_23000 2785 3729 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895564.1 protein_id gnl|my_center|LOCUS_23000 >Feature sequence337 1246 218 gene locus_tag LOCUS_23010 1246 218 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461831.1 protein_id gnl|my_center|LOCUS_23010 1369 1378 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2244 1471 gene locus_tag LOCUS_23020 2244 1471 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461832.1 protein_id gnl|my_center|LOCUS_23020 2509 2213 gene locus_tag LOCUS_23030 2509 2213 CDS product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461833.1 protein_id gnl|my_center|LOCUS_23030 3085 2741 gene locus_tag LOCUS_23040 3085 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 3423 3085 gene locus_tag LOCUS_23050 3423 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 3750 3472 gene locus_tag LOCUS_23060 3750 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 4912 4091 gene locus_tag LOCUS_23070 gene amrS 4912 4091 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459758.1 protein_id gnl|my_center|LOCUS_23070 >Feature sequence338 25 348 gene locus_tag LOCUS_23080 25 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 541 804 gene locus_tag LOCUS_23090 gene rpsT 541 804 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902954.1 protein_id gnl|my_center|LOCUS_23090 2286 886 gene locus_tag LOCUS_23100 2286 886 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476670.1 protein_id gnl|my_center|LOCUS_23100 4009 2300 gene locus_tag LOCUS_23110 4009 2300 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775582.1 protein_id gnl|my_center|LOCUS_23110 4924 4070 gene locus_tag LOCUS_23120 4924 4070 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027122.1 protein_id gnl|my_center|LOCUS_23120 >Feature sequence339 348 3332 gene locus_tag LOCUS_23130 gene ygfK 348 3332 CDS product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387142.1 protein_id gnl|my_center|LOCUS_23130 3890 4129 gene locus_tag LOCUS_23140 3890 4129 CDS product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392915.1 protein_id gnl|my_center|LOCUS_23140 >Feature sequence340 181 855 gene locus_tag LOCUS_23150 181 855 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732773.1 protein_id gnl|my_center|LOCUS_23150 967 1809 gene locus_tag LOCUS_23160 967 1809 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645539.1 protein_id gnl|my_center|LOCUS_23160 2477 4798 gene locus_tag LOCUS_23170 2477 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 >Feature sequence341 804 88 gene locus_tag LOCUS_23180 804 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 930 1796 gene locus_tag LOCUS_23190 930 1796 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059810.1 protein_id gnl|my_center|LOCUS_23190 3317 1800 gene locus_tag LOCUS_23200 3317 1800 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_23200 3993 3334 gene locus_tag LOCUS_23210 3993 3334 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_23210 <4989 4089 gene locus_tag LOCUS_23220 <4989 4089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048080.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase >Feature sequence342 <1 1115 gene locus_tag LOCUS_23230 <1 1115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529214.1:substrate-binding domain-containing protein 1197 2708 gene locus_tag LOCUS_23240 gene gguA 1197 2708 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_23240 2692 3693 gene locus_tag LOCUS_23250 2692 3693 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529212.1 protein_id gnl|my_center|LOCUS_23250 3711 4634 gene locus_tag LOCUS_23260 gene rbsK 3711 4634 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350272.1 protein_id gnl|my_center|LOCUS_23260 >Feature sequence343 3456 1498 gene locus_tag LOCUS_23270 3456 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 4947 3496 gene locus_tag LOCUS_23280 4947 3496 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860945.1 protein_id gnl|my_center|LOCUS_23280 >Feature sequence344 965 1882 gene locus_tag LOCUS_23290 965 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 1960 2211 gene locus_tag LOCUS_23300 1960 2211 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963809.1 protein_id gnl|my_center|LOCUS_23300 2248 2568 gene locus_tag LOCUS_23310 2248 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 3865 2630 gene locus_tag LOCUS_23320 3865 2630 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459673.1 protein_id gnl|my_center|LOCUS_23320 <4982 3970 gene locus_tag LOCUS_23330 <4982 3970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966492.1:transcription-repair coupling factor >Feature sequence345 720 1169 gene locus_tag LOCUS_23340 720 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 1159 2478 gene locus_tag LOCUS_23350 1159 2478 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_23350 2690 3868 gene locus_tag LOCUS_23360 2690 3868 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614866.1 protein_id gnl|my_center|LOCUS_23360 3984 4763 gene locus_tag LOCUS_23370 3984 4763 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583263.1 protein_id gnl|my_center|LOCUS_23370 >Feature sequence346 153 1007 gene locus_tag LOCUS_23380 153 1007 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 protein_id gnl|my_center|LOCUS_23380 987 996 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2612 1272 gene locus_tag LOCUS_23390 2612 1272 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948572.1 protein_id gnl|my_center|LOCUS_23390 4681 2726 gene locus_tag LOCUS_23400 4681 2726 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861834.1 protein_id gnl|my_center|LOCUS_23400 >Feature sequence347 831 682 gene locus_tag LOCUS_23410 831 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 1715 873 gene locus_tag LOCUS_23420 1715 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 2736 2053 gene locus_tag LOCUS_23430 2736 2053 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891221.1 protein_id gnl|my_center|LOCUS_23430 4139 2766 gene locus_tag LOCUS_23440 4139 2766 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422669.1 protein_id gnl|my_center|LOCUS_23440 <4962 4139 gene locus_tag LOCUS_23450 <4962 4139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003426762.1:V-type ATP synthase subunit A >Feature sequence348 <1 1273 gene locus_tag LOCUS_23460 <1 1273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462118.1:Na+/H+ antiporter NhaC family protein 1329 2501 gene locus_tag LOCUS_23470 1329 2501 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461849.1 protein_id gnl|my_center|LOCUS_23470 2534 2543 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2613 4319 gene locus_tag LOCUS_23480 2613 4319 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810317.1 protein_id gnl|my_center|LOCUS_23480 >Feature sequence349 135 1067 gene locus_tag LOCUS_23490 135 1067 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460082.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23490 2357 1182 gene locus_tag LOCUS_23500 2357 1182 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436463.1 protein_id gnl|my_center|LOCUS_23500 3466 2399 gene locus_tag LOCUS_23510 3466 2399 CDS product 2-keto-3-deoxygluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439631.1 protein_id gnl|my_center|LOCUS_23510 3617 3736 gene locus_tag LOCUS_23520 3617 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 >Feature sequence350 <1 2063 gene locus_tag LOCUS_23530 <1 2063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584086.1:alpha-L-arabinofuranosidase C-terminal domain-containing protein 3216 2272 gene locus_tag LOCUS_23540 3216 2272 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707531.1 protein_id gnl|my_center|LOCUS_23540 4262 3216 gene locus_tag LOCUS_23550 4262 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23550 <4951 4241 gene locus_tag LOCUS_23560 <4951 4241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203125.1:right-handed parallel beta-helix repeat-containing protein note possible pseudo, frameshifted 4315 4324 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence351 600 1589 gene locus_tag LOCUS_23570 600 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 1746 2678 gene locus_tag LOCUS_23580 gene cysK 1746 2678 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_23580 2694 4784 gene locus_tag LOCUS_23590 2694 4784 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986498.1 protein_id gnl|my_center|LOCUS_23590 >Feature sequence352 <1 677 gene locus_tag LOCUS_23600 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459550.1:BMP family ABC transporter substrate-binding protein 811 2487 gene locus_tag LOCUS_23610 811 2487 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_23610 2484 3584 gene locus_tag LOCUS_23620 2484 3584 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_23620 3581 4534 gene locus_tag LOCUS_23630 3581 4534 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_23630 >Feature sequence353 <1 1164 gene locus_tag LOCUS_23640 <1 1164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703620.1:SLC13 family permease 1280 1777 gene locus_tag LOCUS_23650 1280 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 1900 2898 gene locus_tag LOCUS_23660 1900 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 3021 4322 gene locus_tag LOCUS_23670 3021 4322 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_23670 >Feature sequence354 <1 1003 gene locus_tag LOCUS_23680 <1 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002359868.1:sugar ABC transporter substrate-binding protein 1159 2052 gene locus_tag LOCUS_23690 1159 2052 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_23690 2064 2891 gene locus_tag LOCUS_23700 2064 2891 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383582.1 protein_id gnl|my_center|LOCUS_23700 4516 4525 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence355 <1 896 gene locus_tag LOCUS_23710 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459687.1:RNA-splicing ligase RtcB 907 1392 gene locus_tag LOCUS_23720 907 1392 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_23720 1431 1985 gene locus_tag LOCUS_23730 1431 1985 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016900.1 protein_id gnl|my_center|LOCUS_23730 1994 3067 gene locus_tag LOCUS_23740 1994 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 3402 3130 gene locus_tag LOCUS_23750 3402 3130 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595964.1 protein_id gnl|my_center|LOCUS_23750 >Feature sequence356 644 2671 gene locus_tag LOCUS_23760 644 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 2925 4073 gene locus_tag LOCUS_23770 gene dgoD 2925 4073 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617237.1 protein_id gnl|my_center|LOCUS_23770 >Feature sequence357 737 2029 gene locus_tag LOCUS_23780 737 2029 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401829.1 protein_id gnl|my_center|LOCUS_23780 2572 2240 gene locus_tag LOCUS_23790 2572 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 4547 2604 gene locus_tag LOCUS_23800 4547 2604 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966001.1 protein_id gnl|my_center|LOCUS_23800 >Feature sequence358 633 244 gene locus_tag LOCUS_23810 633 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 913 662 gene locus_tag LOCUS_23820 913 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 2461 1103 gene locus_tag LOCUS_23830 2461 1103 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966975.1 protein_id gnl|my_center|LOCUS_23830 2993 2547 gene locus_tag LOCUS_23840 gene rplI 2993 2547 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_23840 <4870 3037 gene locus_tag LOCUS_23850 <4870 3037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003429268.1:DHH family phosphoesterase >Feature sequence359 1651 953 gene locus_tag LOCUS_23860 1651 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 2162 1653 gene locus_tag LOCUS_23870 2162 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 2835 2209 gene locus_tag LOCUS_23880 2835 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 <4848 2962 gene locus_tag LOCUS_23890 <4848 2962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860821.1:FtsX-like permease family protein >Feature sequence360 2275 776 gene locus_tag LOCUS_23900 2275 776 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582707.1 protein_id gnl|my_center|LOCUS_23900 2762 2286 gene locus_tag LOCUS_23910 2762 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 3884 2781 gene locus_tag LOCUS_23920 3884 2781 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582705.1 protein_id gnl|my_center|LOCUS_23920 4722 3928 gene locus_tag LOCUS_23930 gene hpaI 4722 3928 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205448.1 protein_id gnl|my_center|LOCUS_23930 >Feature sequence361 <1 2127 gene locus_tag LOCUS_23940 <1 2127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454973.1:EAL domain-containing protein 2244 2840 gene locus_tag LOCUS_23950 2244 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 2956 4251 gene locus_tag LOCUS_23960 2956 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 >Feature sequence362 3 188 gene locus_tag LOCUS_23970 3 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 205 1230 gene locus_tag LOCUS_23980 205 1230 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462165.1 protein_id gnl|my_center|LOCUS_23980 1761 2327 gene locus_tag LOCUS_23990 1761 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 2632 3849 gene locus_tag LOCUS_24000 2632 3849 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964082.1 protein_id gnl|my_center|LOCUS_24000 <4830 4004 gene locus_tag LOCUS_24010 <4830 4004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437109.1:MATE family efflux transporter >Feature sequence363 584 1831 gene locus_tag LOCUS_24020 584 1831 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495003.1 protein_id gnl|my_center|LOCUS_24020 1853 2872 gene locus_tag LOCUS_24030 1853 2872 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392937.1 protein_id gnl|my_center|LOCUS_24030 2869 3678 gene locus_tag LOCUS_24040 2869 3678 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367330.1 protein_id gnl|my_center|LOCUS_24040 3678 4805 gene locus_tag LOCUS_24050 gene hydE 3678 4805 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_24050 >Feature sequence364 137 4087 gene locus_tag LOCUS_24060 137 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 4069 4248 gene locus_tag LOCUS_24070 4069 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 >Feature sequence365 1786 797 gene locus_tag LOCUS_24080 1786 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 3115 1811 gene locus_tag LOCUS_24090 3115 1811 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210884.1 protein_id gnl|my_center|LOCUS_24090 3558 4337 gene locus_tag LOCUS_24100 3558 4337 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582797.1 protein_id gnl|my_center|LOCUS_24100 >Feature sequence366 1417 293 gene locus_tag LOCUS_24110 1417 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 3346 1421 gene locus_tag LOCUS_24120 3346 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 4718 3327 gene locus_tag LOCUS_24130 4718 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 >Feature sequence367 1110 472 gene locus_tag LOCUS_24140 1110 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 1943 1128 gene locus_tag LOCUS_24150 1943 1128 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289081.1 protein_id gnl|my_center|LOCUS_24150 2784 2227 gene locus_tag LOCUS_24160 gene rfbC 2784 2227 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_24160 4763 2976 gene locus_tag LOCUS_24170 4763 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 >Feature sequence368 1907 1206 gene locus_tag LOCUS_24180 1907 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 2967 1951 gene locus_tag LOCUS_24190 2967 1951 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582705.1 protein_id gnl|my_center|LOCUS_24190 2643 2652 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3890 3018 gene locus_tag LOCUS_24200 3890 3018 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228638.1 protein_id gnl|my_center|LOCUS_24200 <4778 3957 gene locus_tag LOCUS_24210 <4778 3957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003723485.1:sugar-phosphatase >Feature sequence369 <1 1019 gene locus_tag LOCUS_24220 <1 1019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860719.1:LacI family DNA-binding transcriptional regulator 1265 1441 gene locus_tag LOCUS_24230 1265 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 1766 3487 gene locus_tag LOCUS_24240 1766 3487 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_24240 4189 3749 gene locus_tag LOCUS_24250 4189 3749 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082236.1 protein_id gnl|my_center|LOCUS_24250 4540 4226 gene locus_tag LOCUS_24260 4540 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 >Feature sequence370 779 654 gene locus_tag LOCUS_24270 779 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 1209 2000 gene locus_tag LOCUS_24280 1209 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 2402 3166 gene locus_tag LOCUS_24290 2402 3166 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921670.1 protein_id gnl|my_center|LOCUS_24290 4735 3230 gene locus_tag LOCUS_24300 gene xylB 4735 3230 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_24300 >Feature sequence371 1027 773 gene locus_tag LOCUS_24310 1027 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 1647 1048 gene locus_tag LOCUS_24320 1647 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 2602 1739 gene locus_tag LOCUS_24330 gene ylqF 2602 1739 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_24330 3169 2618 gene locus_tag LOCUS_24340 gene lepB 3169 2618 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425127.1 protein_id gnl|my_center|LOCUS_24340 3618 3271 gene locus_tag LOCUS_24350 gene rplS 3618 3271 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362586.1 protein_id gnl|my_center|LOCUS_24350 <4762 3837 gene locus_tag LOCUS_24360 <4762 3837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009888861.1:hemolysin family protein >Feature sequence372 65 1063 gene locus_tag LOCUS_24370 gene rbsR 65 1063 CDS product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104055.1 protein_id gnl|my_center|LOCUS_24370 1148 2668 gene locus_tag LOCUS_24380 gene alsA 1148 2668 CDS product D-allose ABC transporter ATP-binding protein AlsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235240.1 protein_id gnl|my_center|LOCUS_24380 2686 3654 gene locus_tag LOCUS_24390 gene alsC 2686 3654 CDS product D-allose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000507106.1 protein_id gnl|my_center|LOCUS_24390 3671 4348 gene locus_tag LOCUS_24400 gene alsE 3671 4348 CDS product D-allulose-6-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314355.1 protein_id gnl|my_center|LOCUS_24400 >Feature sequence373 86 1375 gene locus_tag LOCUS_24410 86 1375 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24410 1328 1337 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1368 1493 gene locus_tag LOCUS_24420 1368 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 1804 1813 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1977 2639 gene locus_tag LOCUS_24430 1977 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 2694 3671 gene locus_tag LOCUS_24440 gene holA 2694 3671 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700067.1 protein_id gnl|my_center|LOCUS_24440 3689 4261 gene locus_tag LOCUS_24450 3689 4261 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678780.1 protein_id gnl|my_center|LOCUS_24450 >Feature sequence374 569 195 gene locus_tag LOCUS_24460 569 195 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947952.1 protein_id gnl|my_center|LOCUS_24460 2594 780 gene locus_tag LOCUS_24470 gene ftsH 2594 780 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966478.1 protein_id gnl|my_center|LOCUS_24470 3177 2620 gene locus_tag LOCUS_24480 gene hpt 3177 2620 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016283.1 protein_id gnl|my_center|LOCUS_24480 <4745 3174 gene locus_tag LOCUS_24490 <4745 3174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434952.1:tRNA lysidine(34) synthetase TilS >Feature sequence375 <1 572 gene locus_tag LOCUS_24500 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941116.1:M20 family metallopeptidase 584 1753 gene locus_tag LOCUS_24510 gene iadA 584 1753 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048339.1 protein_id gnl|my_center|LOCUS_24510 1740 2051 gene locus_tag LOCUS_24520 1740 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 1874 1883 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2029 2946 gene locus_tag LOCUS_24530 2029 2946 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387189.1 protein_id gnl|my_center|LOCUS_24530 4556 3000 gene locus_tag LOCUS_24540 4556 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 >Feature sequence376 829 161 gene locus_tag LOCUS_24550 829 161 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904095.1 protein_id gnl|my_center|LOCUS_24550 1260 841 gene locus_tag LOCUS_24560 1260 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 1688 1491 gene locus_tag LOCUS_24570 1688 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 3765 1783 gene locus_tag LOCUS_24580 3765 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 4502 3897 gene locus_tag LOCUS_24590 gene kdpC 4502 3897 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186443.1 protein_id gnl|my_center|LOCUS_24590 >Feature sequence377 78 1073 gene locus_tag LOCUS_24600 78 1073 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567704.1 protein_id gnl|my_center|LOCUS_24600 1154 1651 gene locus_tag LOCUS_24610 1154 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 1651 2019 gene locus_tag LOCUS_24620 1651 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24620 1965 1974 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2006 2929 gene locus_tag LOCUS_24630 2006 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24630 3006 3425 gene locus_tag LOCUS_24640 3006 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 <4735 3526 gene locus_tag LOCUS_24650 <4735 3526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808619.1:argininosuccinate synthase >Feature sequence378 1779 1006 gene locus_tag LOCUS_24660 1779 1006 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_24660 2546 1758 gene locus_tag LOCUS_24670 2546 1758 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814796.1 protein_id gnl|my_center|LOCUS_24670 3346 2543 gene locus_tag LOCUS_24680 gene tauC 3346 2543 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704532.1 protein_id gnl|my_center|LOCUS_24680 4527 3415 gene locus_tag LOCUS_24690 4527 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 >Feature sequence379 2794 2099 gene locus_tag LOCUS_24700 2794 2099 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_24700 3902 2910 gene locus_tag LOCUS_24710 3902 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 3928 3937 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4560 3997 gene locus_tag LOCUS_24720 4560 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 >Feature sequence380 1530 925 gene locus_tag LOCUS_24730 1530 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24730 1925 1527 gene locus_tag LOCUS_24740 1925 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24740 1555 1564 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3457 1952 gene locus_tag LOCUS_24750 3457 1952 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392224.1 protein_id gnl|my_center|LOCUS_24750 4562 3528 gene locus_tag LOCUS_24760 4562 3528 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066698.1 protein_id gnl|my_center|LOCUS_24760 >Feature sequence381 32 988 gene locus_tag LOCUS_24770 32 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 882 1109 gene locus_tag LOCUS_24780 882 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 1093 1959 gene locus_tag LOCUS_24790 1093 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 1989 2408 gene locus_tag LOCUS_24800 1989 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 2408 3379 gene locus_tag LOCUS_24810 2408 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 3393 4409 gene locus_tag LOCUS_24820 3393 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 >Feature sequence382 325 1263 gene locus_tag LOCUS_24830 325 1263 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732677.1 protein_id gnl|my_center|LOCUS_24830 1273 2898 gene locus_tag LOCUS_24840 gene glpK 1273 2898 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080610.1 protein_id gnl|my_center|LOCUS_24840 2967 4049 gene locus_tag LOCUS_24850 2967 4049 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975228.1 protein_id gnl|my_center|LOCUS_24850 >Feature sequence383 214 708 gene locus_tag LOCUS_24860 214 708 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393456.1 protein_id gnl|my_center|LOCUS_24860 762 2102 gene locus_tag LOCUS_24870 762 2102 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052123.1 protein_id gnl|my_center|LOCUS_24870 3469 2189 gene locus_tag LOCUS_24880 3469 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 4425 3580 gene locus_tag LOCUS_24890 4425 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 >Feature sequence384 2 781 gene locus_tag LOCUS_24900 2 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 957 2027 gene locus_tag LOCUS_24910 957 2027 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039520.1 protein_id gnl|my_center|LOCUS_24910 2056 2844 gene locus_tag LOCUS_24920 2056 2844 CDS product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016874.1 protein_id gnl|my_center|LOCUS_24920 2856 3329 gene locus_tag LOCUS_24930 2856 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492212.1 protein_id gnl|my_center|LOCUS_24930 3416 4501 gene locus_tag LOCUS_24940 3416 4501 CDS product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582756.1 protein_id gnl|my_center|LOCUS_24940 >Feature sequence385 856 1746 gene locus_tag LOCUS_24950 856 1746 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964760.1 protein_id gnl|my_center|LOCUS_24950 1910 3418 gene locus_tag LOCUS_24960 gene malQ 1910 3418 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_24960 4054 3485 gene locus_tag LOCUS_24970 4054 3485 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_24970 >Feature sequence386 1471 65 gene locus_tag LOCUS_24980 1471 65 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459130.1 protein_id gnl|my_center|LOCUS_24980 3296 1458 gene locus_tag LOCUS_24990 3296 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 4122 3274 gene locus_tag LOCUS_25000 4122 3274 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051244.1 protein_id gnl|my_center|LOCUS_25000 >Feature sequence387 1558 374 gene locus_tag LOCUS_25010 1558 374 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_25010 2304 1555 gene locus_tag LOCUS_25020 gene truA 2304 1555 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294728.1 protein_id gnl|my_center|LOCUS_25020 2855 2301 gene locus_tag LOCUS_25030 2855 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 3009 2887 gene locus_tag LOCUS_25040 3009 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 4201 3035 gene locus_tag LOCUS_25050 4201 3035 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222697.1 protein_id gnl|my_center|LOCUS_25050 >Feature sequence388 <1 747 gene locus_tag LOCUS_25060 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021995.1:glycogen debranching protein GlgX 737 1894 gene locus_tag LOCUS_25070 737 1894 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257313.1 protein_id gnl|my_center|LOCUS_25070 >Feature sequence389 146 355 gene locus_tag LOCUS_25080 146 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 833 456 gene locus_tag LOCUS_25090 833 456 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851392.1 protein_id gnl|my_center|LOCUS_25090 1024 1422 gene locus_tag LOCUS_25100 1024 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 1571 1966 gene locus_tag LOCUS_25110 1571 1966 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393392.1 protein_id gnl|my_center|LOCUS_25110 2013 3728 gene locus_tag LOCUS_25120 gene lpdA 2013 3728 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809814.1 protein_id gnl|my_center|LOCUS_25120 >Feature sequence390 675 196 gene locus_tag LOCUS_25130 675 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25130 1215 811 gene locus_tag LOCUS_25140 1215 811 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092635.1 protein_id gnl|my_center|LOCUS_25140 2163 1246 gene locus_tag LOCUS_25150 2163 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 3632 2301 gene locus_tag LOCUS_25160 3632 2301 CDS product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002308483.1 protein_id gnl|my_center|LOCUS_25160 <4627 3704 gene locus_tag LOCUS_25170 <4627 3704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048334.1:butyrate kinase >Feature sequence391 20 850 gene locus_tag LOCUS_25180 gene licT 20 850 CDS product transcriptional antiterminator LicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242598.1 protein_id gnl|my_center|LOCUS_25180 910 1404 gene locus_tag LOCUS_25190 910 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 1422 1673 gene locus_tag LOCUS_25200 1422 1673 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437472.1 protein_id gnl|my_center|LOCUS_25200 1808 3268 gene locus_tag LOCUS_25210 gene nagE 1808 3268 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705424.1 protein_id gnl|my_center|LOCUS_25210 2284 2293 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence392 2053 1391 gene locus_tag LOCUS_25220 2053 1391 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_25220 2843 2079 gene locus_tag LOCUS_25230 2843 2079 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234947.1 protein_id gnl|my_center|LOCUS_25230 4299 2902 gene locus_tag LOCUS_25240 4299 2902 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_25240 >Feature sequence393 99 425 gene locus_tag LOCUS_25250 99 425 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079948.1 protein_id gnl|my_center|LOCUS_25250 641 1630 gene locus_tag LOCUS_25260 641 1630 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_25260 1740 2669 gene locus_tag LOCUS_25270 1740 2669 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963624.1 protein_id gnl|my_center|LOCUS_25270 2685 3434 gene locus_tag LOCUS_25280 2685 3434 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_25280 3386 3395 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3469 4314 gene locus_tag LOCUS_25290 gene rsmI 3469 4314 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435873.1 protein_id gnl|my_center|LOCUS_25290 >Feature sequence394 253 1827 gene locus_tag LOCUS_25300 253 1827 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_25300 2702 1914 gene locus_tag LOCUS_25310 2702 1914 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355995.1 protein_id gnl|my_center|LOCUS_25310 3294 2719 gene locus_tag LOCUS_25320 gene rsxA 3294 2719 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_25320 4098 3307 gene locus_tag LOCUS_25330 4098 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 >Feature sequence395 654 3221 gene locus_tag LOCUS_25340 654 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 3334 4530 gene locus_tag LOCUS_25350 3334 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 >Feature sequence396 1746 805 gene locus_tag LOCUS_25360 1746 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 2925 1762 gene locus_tag LOCUS_25370 2925 1762 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888694.1 protein_id gnl|my_center|LOCUS_25370 3600 2929 gene locus_tag LOCUS_25380 gene modB 3600 2929 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360415.1 protein_id gnl|my_center|LOCUS_25380 4549 3623 gene locus_tag LOCUS_25390 gene modA 4549 3623 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382290.1 protein_id gnl|my_center|LOCUS_25390 >Feature sequence397 262 1527 gene locus_tag LOCUS_25400 gene hisS 262 1527 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_25400 1543 3351 gene locus_tag LOCUS_25410 gene aspS 1543 3351 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965567.1 protein_id gnl|my_center|LOCUS_25410 3348 3755 gene locus_tag LOCUS_25420 3348 3755 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272371.1 protein_id gnl|my_center|LOCUS_25420 4522 3938 gene locus_tag LOCUS_25430 4522 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 >Feature sequence398 3556 638 gene locus_tag LOCUS_25440 3556 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 4082 3549 gene locus_tag LOCUS_25450 4082 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 >Feature sequence399 206 379 gene locus_tag LOCUS_25460 206 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 355 364 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 376 2502 gene locus_tag LOCUS_25470 376 2502 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256716.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25470 2364 2373 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2858 3733 gene locus_tag LOCUS_25480 2858 3733 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530857.1 protein_id gnl|my_center|LOCUS_25480 3941 4483 gene locus_tag LOCUS_25490 3941 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 >Feature sequence400 720 2675 gene locus_tag LOCUS_25500 gene iorA 720 2675 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021731.1 protein_id gnl|my_center|LOCUS_25500 2691 3278 gene locus_tag LOCUS_25510 2691 3278 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393759.1 protein_id gnl|my_center|LOCUS_25510 3298 4530 gene locus_tag LOCUS_25520 3298 4530 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021729.1 protein_id gnl|my_center|LOCUS_25520 >Feature sequence401 1365 100 gene locus_tag LOCUS_25530 gene uraA 1365 100 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667891.1 protein_id gnl|my_center|LOCUS_25530 3268 1445 gene locus_tag LOCUS_25540 3268 1445 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948968.1 protein_id gnl|my_center|LOCUS_25540 3907 3512 gene locus_tag LOCUS_25550 3907 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 >Feature sequence402 299 1702 gene locus_tag LOCUS_25560 299 1702 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355588.1 protein_id gnl|my_center|LOCUS_25560 560 569 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1758 2849 gene locus_tag LOCUS_25570 gene aguA 1758 2849 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989327.1 protein_id gnl|my_center|LOCUS_25570 3000 3941 gene locus_tag LOCUS_25580 3000 3941 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167019.1 protein_id gnl|my_center|LOCUS_25580 >Feature sequence403 1413 235 gene locus_tag LOCUS_25590 1413 235 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860822.1 protein_id gnl|my_center|LOCUS_25590 1201 1210 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2081 1410 gene locus_tag LOCUS_25600 2081 1410 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434705.1 protein_id gnl|my_center|LOCUS_25600 3653 2259 gene locus_tag LOCUS_25610 gene glnA 3653 2259 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_25610 4304 3732 gene locus_tag LOCUS_25620 4304 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 >Feature sequence404 1540 209 gene locus_tag LOCUS_25630 1540 209 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022819390.1 protein_id gnl|my_center|LOCUS_25630 3774 1792 gene locus_tag LOCUS_25640 3774 1792 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461059.1 protein_id gnl|my_center|LOCUS_25640 <4534 3850 gene locus_tag LOCUS_25650 <4534 3850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462069.1:glucose 1-dehydrogenase >Feature sequence405 1899 1408 gene locus_tag LOCUS_25660 1899 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25660 2811 2578 gene locus_tag LOCUS_25670 2811 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25670 3227 2844 gene locus_tag LOCUS_25680 3227 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25680 >Feature sequence406 <1 1024 gene locus_tag LOCUS_25690 <1 1024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002379712.1:knotted carbamoyltransferase YgeW 1164 2111 gene locus_tag LOCUS_25700 gene arcC 1164 2111 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037999.1 protein_id gnl|my_center|LOCUS_25700 2132 3502 gene locus_tag LOCUS_25710 2132 3502 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893433.1 protein_id gnl|my_center|LOCUS_25710 3727 4068 gene locus_tag LOCUS_25720 3727 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 4096 4515 gene locus_tag LOCUS_25730 4096 4515 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816021.1 protein_id gnl|my_center|LOCUS_25730 >Feature sequence407 868 176 gene locus_tag LOCUS_25740 868 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25740 <4483 922 gene locus_tag LOCUS_25750 <4483 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966712.1:DNA polymerase III subunit alpha note possible pseudo, frameshifted 975 984 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence408 1006 425 gene locus_tag LOCUS_25760 1006 425 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_25760 1154 1273 gene locus_tag LOCUS_25770 1154 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 1291 2178 gene locus_tag LOCUS_25780 1291 2178 CDS product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890749.1 protein_id gnl|my_center|LOCUS_25780 3212 2397 gene locus_tag LOCUS_25790 3212 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 3370 4428 gene locus_tag LOCUS_25800 3370 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 >Feature sequence409 912 160 gene locus_tag LOCUS_25810 912 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 1949 933 gene locus_tag LOCUS_25820 1949 933 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966818.1 protein_id gnl|my_center|LOCUS_25820 >Feature sequence410 1585 1010 gene locus_tag LOCUS_25830 1585 1010 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434060.1 protein_id gnl|my_center|LOCUS_25830 2376 1582 gene locus_tag LOCUS_25840 2376 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 2824 2690 gene locus_tag LOCUS_25850 2824 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 4280 2826 gene locus_tag LOCUS_25860 4280 2826 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048310.1 protein_id gnl|my_center|LOCUS_25860 >Feature sequence411 1 528 gene locus_tag LOCUS_25870 1 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25870 494 503 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 548 1081 gene locus_tag LOCUS_25880 548 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25880 1097 1447 gene locus_tag LOCUS_25890 1097 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 1785 1456 gene locus_tag LOCUS_25900 1785 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 2089 4233 gene locus_tag LOCUS_25910 2089 4233 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947999.1 protein_id gnl|my_center|LOCUS_25910 >Feature sequence412 188 1195 gene locus_tag LOCUS_25920 188 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25920 3842 1302 gene locus_tag LOCUS_25930 3842 1302 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861604.1 protein_id gnl|my_center|LOCUS_25930 4440 3814 gene locus_tag LOCUS_25940 4440 3814 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861605.1 protein_id gnl|my_center|LOCUS_25940 >Feature sequence413 3397 2309 gene locus_tag LOCUS_25950 3397 2309 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898522.1 protein_id gnl|my_center|LOCUS_25950 3575 4192 gene locus_tag LOCUS_25960 3575 4192 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964199.1 protein_id gnl|my_center|LOCUS_25960 >Feature sequence414 52 1995 gene locus_tag LOCUS_25970 52 1995 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_25970 2154 3284 gene locus_tag LOCUS_25980 2154 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 3281 3940 gene locus_tag LOCUS_25990 3281 3940 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_25990 >Feature sequence415 576 52 gene locus_tag LOCUS_26000 gene nrdG 576 52 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_26000 1645 578 gene locus_tag LOCUS_26010 1645 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26010 2737 1730 gene locus_tag LOCUS_26020 2737 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26020 3212 2973 gene locus_tag LOCUS_26030 3212 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 <4400 3480 gene locus_tag LOCUS_26040 <4400 3480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000219053.1:maltose operon transcriptional repressor MalR >Feature sequence416 167 1747 gene locus_tag LOCUS_26050 167 1747 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075232.1 protein_id gnl|my_center|LOCUS_26050 1803 3284 gene locus_tag LOCUS_26060 1803 3284 CDS product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098405.1 protein_id gnl|my_center|LOCUS_26060 2590 2599 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3303 3863 gene locus_tag LOCUS_26070 3303 3863 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021975.1 protein_id gnl|my_center|LOCUS_26070 3897 4277 gene locus_tag LOCUS_26080 3897 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 >Feature sequence417 1687 770 gene locus_tag LOCUS_26090 1687 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 2181 1705 gene locus_tag LOCUS_26100 2181 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 3134 2391 gene locus_tag LOCUS_26110 gene larB 3134 2391 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435015.1 protein_id gnl|my_center|LOCUS_26110 3748 3137 gene locus_tag LOCUS_26120 3748 3137 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461185.1 protein_id gnl|my_center|LOCUS_26120 <4398 3745 gene locus_tag LOCUS_26130 <4398 3745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005809174.1:ABC transporter ATP-binding protein >Feature sequence418 2593 173 gene locus_tag LOCUS_26140 2593 173 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_26140 1379 1388 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3654 2614 gene locus_tag LOCUS_26150 3654 2614 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966690.1 protein_id gnl|my_center|LOCUS_26150 <4387 3693 gene locus_tag LOCUS_26160 <4387 3693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986274.1:methionine synthase >Feature sequence419 348 160 gene locus_tag LOCUS_26170 348 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 832 1884 gene locus_tag LOCUS_26180 gene tdh 832 1884 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707888.1 protein_id gnl|my_center|LOCUS_26180 1909 3108 gene locus_tag LOCUS_26190 1909 3108 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539575.1 protein_id gnl|my_center|LOCUS_26190 4184 3270 gene locus_tag LOCUS_26200 4184 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 >Feature sequence420 1182 349 gene locus_tag LOCUS_26210 1182 349 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142277.1 protein_id gnl|my_center|LOCUS_26210 2149 1163 gene locus_tag LOCUS_26220 2149 1163 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253118.1 protein_id gnl|my_center|LOCUS_26220 3085 2219 gene locus_tag LOCUS_26230 3085 2219 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_26230 <4385 3155 gene locus_tag LOCUS_26240 <4385 3155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902269.1:ABC transporter substrate-binding protein >Feature sequence421 294 875 gene locus_tag LOCUS_26250 gene clpP 294 875 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965928.1 protein_id gnl|my_center|LOCUS_26250 1020 2270 gene locus_tag LOCUS_26260 gene clpX 1020 2270 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_26260 >Feature sequence422 1260 379 gene locus_tag LOCUS_26270 1260 379 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964117.1 protein_id gnl|my_center|LOCUS_26270 1895 1281 gene locus_tag LOCUS_26280 1895 1281 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964116.1 protein_id gnl|my_center|LOCUS_26280 2124 3644 gene locus_tag LOCUS_26290 2124 3644 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963640.1 protein_id gnl|my_center|LOCUS_26290 3616 4305 gene locus_tag LOCUS_26300 3616 4305 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_26300 >Feature sequence423 2130 1012 gene locus_tag LOCUS_26310 2130 1012 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016300.1 protein_id gnl|my_center|LOCUS_26310 >Feature sequence424 841 80 gene locus_tag LOCUS_26320 gene fabG 841 80 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566240.1 protein_id gnl|my_center|LOCUS_26320 1286 858 gene locus_tag LOCUS_26330 gene agaF 1286 858 CDS product PTS galactosamine/N-acetylgalactosamine transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948809.1 protein_id gnl|my_center|LOCUS_26330 2129 1299 gene locus_tag LOCUS_26340 2129 1299 CDS product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289226.1 protein_id gnl|my_center|LOCUS_26340 3751 2147 gene locus_tag LOCUS_26350 3751 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 4288 3794 gene locus_tag LOCUS_26360 4288 3794 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425168.1 protein_id gnl|my_center|LOCUS_26360 >Feature sequence425 985 8 gene locus_tag LOCUS_26370 985 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 1422 991 gene locus_tag LOCUS_26380 1422 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 1798 1409 gene locus_tag LOCUS_26390 1798 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 1460 1469 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2962 1847 gene locus_tag LOCUS_26400 2962 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 3869 2985 gene locus_tag LOCUS_26410 3869 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 >Feature sequence426 <1 708 gene locus_tag LOCUS_26420 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461579.1:aspartate/glutamate racemase family protein 2884 1688 gene locus_tag LOCUS_26430 2884 1688 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_26430 3899 2973 gene locus_tag LOCUS_26440 3899 2973 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048393.1 protein_id gnl|my_center|LOCUS_26440 >Feature sequence427 <1 1536 gene locus_tag LOCUS_26450 <1 1536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458899.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase 1552 2661 gene locus_tag LOCUS_26460 gene leuB 1552 2661 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_26460 2684 3835 gene locus_tag LOCUS_26470 2684 3835 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870340.1 protein_id gnl|my_center|LOCUS_26470 >Feature sequence428 1737 472 gene locus_tag LOCUS_26480 1737 472 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391959.1 protein_id gnl|my_center|LOCUS_26480 2057 3550 gene locus_tag LOCUS_26490 2057 3550 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104585.1 protein_id gnl|my_center|LOCUS_26490 >Feature sequence429 627 1040 gene locus_tag LOCUS_26500 627 1040 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_26500 1165 1314 gene locus_tag LOCUS_26510 1165 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 1715 1491 gene locus_tag LOCUS_26520 1715 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 2361 1888 gene locus_tag LOCUS_26530 gene bcp 2361 1888 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 protein_id gnl|my_center|LOCUS_26530 <4343 2662 gene locus_tag LOCUS_26540 <4343 2662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897443.1:PTS fructose transporter subunit IIABC >Feature sequence430 190 1098 gene locus_tag LOCUS_26550 190 1098 CDS product multidrug resistance efflux transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643657.1 protein_id gnl|my_center|LOCUS_26550 1214 1888 gene locus_tag LOCUS_26560 1214 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 2013 3914 gene locus_tag LOCUS_26570 2013 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 >Feature sequence431 459 34 gene locus_tag LOCUS_26580 459 34 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243290.1 protein_id gnl|my_center|LOCUS_26580 1712 447 gene locus_tag LOCUS_26590 1712 447 CDS product aconitase X catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243289.1 protein_id gnl|my_center|LOCUS_26590 3274 1709 gene locus_tag LOCUS_26600 3274 1709 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868946.1 protein_id gnl|my_center|LOCUS_26600 3904 3296 gene locus_tag LOCUS_26610 3904 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 4292 3909 gene locus_tag LOCUS_26620 4292 3909 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691774.1 protein_id gnl|my_center|LOCUS_26620 >Feature sequence432 699 19 gene locus_tag LOCUS_26630 699 19 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044683.1 protein_id gnl|my_center|LOCUS_26630 1190 861 gene locus_tag LOCUS_26640 1190 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 1821 1285 gene locus_tag LOCUS_26650 1821 1285 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582462.1 protein_id gnl|my_center|LOCUS_26650 3644 1818 gene locus_tag LOCUS_26660 3644 1818 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860946.1 protein_id gnl|my_center|LOCUS_26660 <4341 3634 gene locus_tag LOCUS_26670 <4341 3634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964308.1:glutamate--tRNA ligase >Feature sequence433 144 869 gene locus_tag LOCUS_26680 144 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 1889 912 gene locus_tag LOCUS_26690 1889 912 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_26690 3345 1936 gene locus_tag LOCUS_26700 3345 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 <4341 3387 gene locus_tag LOCUS_26710 <4341 3387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963747.1:sucrose-6-phosphate hydrolase >Feature sequence434 646 1587 gene locus_tag LOCUS_26720 gene ylbJ 646 1587 CDS product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986835.1 protein_id gnl|my_center|LOCUS_26720 2240 1614 gene locus_tag LOCUS_26730 2240 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 2801 2316 gene locus_tag LOCUS_26740 gene coaD 2801 2316 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728846.1 protein_id gnl|my_center|LOCUS_26740 3359 2802 gene locus_tag LOCUS_26750 gene rsmD 3359 2802 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_26750 4175 3498 gene locus_tag LOCUS_26760 4175 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 >Feature sequence435 3 539 gene locus_tag LOCUS_26770 3 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 561 1319 gene locus_tag LOCUS_26780 561 1319 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878463.1 protein_id gnl|my_center|LOCUS_26780 1339 2403 gene locus_tag LOCUS_26790 1339 2403 CDS product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491570.1 protein_id gnl|my_center|LOCUS_26790 2437 2925 gene locus_tag LOCUS_26800 2437 2925 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191776283.1 protein_id gnl|my_center|LOCUS_26800 2927 4210 gene locus_tag LOCUS_26810 2927 4210 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902212.1 protein_id gnl|my_center|LOCUS_26810 >Feature sequence436 112 1173 gene locus_tag LOCUS_26820 112 1173 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170324993.1 protein_id gnl|my_center|LOCUS_26820 1094 2794 gene locus_tag LOCUS_26830 1094 2794 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860825.1 protein_id gnl|my_center|LOCUS_26830 >Feature sequence437 65 940 gene locus_tag LOCUS_26840 65 940 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439497.1 protein_id gnl|my_center|LOCUS_26840 1617 1063 gene locus_tag LOCUS_26850 1617 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26850 1119 1128 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2417 1734 gene locus_tag LOCUS_26860 2417 1734 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860883.1 protein_id gnl|my_center|LOCUS_26860 2485 2667 gene locus_tag LOCUS_26870 2485 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 2946 2955 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3082 4215 gene locus_tag LOCUS_26880 3082 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 3598 3607 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence438 3 1196 gene locus_tag LOCUS_26890 gene hacA 3 1196 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876998.1 protein_id gnl|my_center|LOCUS_26890 1335 1826 gene locus_tag LOCUS_26900 1335 1826 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878133.1 protein_id gnl|my_center|LOCUS_26900 1846 3102 gene locus_tag LOCUS_26910 1846 3102 CDS product isopropylmalate/citramalate isomerase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870000.1 protein_id gnl|my_center|LOCUS_26910 3102 3677 gene locus_tag LOCUS_26920 3102 3677 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701817.1 protein_id gnl|my_center|LOCUS_26920 4175 3714 gene locus_tag LOCUS_26930 gene bltD 4175 3714 CDS product spermine/spermidine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229879.1 protein_id gnl|my_center|LOCUS_26930 >Feature sequence439 21 305 gene locus_tag LOCUS_26940 21 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 278 287 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 363 1475 gene locus_tag LOCUS_26950 363 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26950 1581 2483 gene locus_tag LOCUS_26960 1581 2483 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229507.1 protein_id gnl|my_center|LOCUS_26960 2487 3323 gene locus_tag LOCUS_26970 gene araQ 2487 3323 CDS product arabinose ABC transporter permease AraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229508.1 protein_id gnl|my_center|LOCUS_26970 >Feature sequence440 2245 956 gene locus_tag LOCUS_26980 2245 956 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391962.1 protein_id gnl|my_center|LOCUS_26980 2745 2245 gene locus_tag LOCUS_26990 2745 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 3931 2855 gene locus_tag LOCUS_27000 3931 2855 CDS product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584121.1 protein_id gnl|my_center|LOCUS_27000 4316 3984 gene locus_tag LOCUS_27010 4316 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 >Feature sequence441 334 155 gene locus_tag LOCUS_27020 334 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 3158 567 gene locus_tag LOCUS_27030 gene clpB 3158 567 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_27030 <4314 3422 gene locus_tag LOCUS_27040 <4314 3422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383771.1:substrate-binding domain-containing protein >Feature sequence442 1140 769 gene locus_tag LOCUS_27050 1140 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 1553 1275 gene locus_tag LOCUS_27060 1553 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 2353 1553 gene locus_tag LOCUS_27070 gene recT 2353 1553 CDS product recombination protein RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166313.1 protein_id gnl|my_center|LOCUS_27070 3380 2451 gene locus_tag LOCUS_27080 3380 2451 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398673.1 protein_id gnl|my_center|LOCUS_27080 3967 3446 gene locus_tag LOCUS_27090 3967 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 4255 4055 gene locus_tag LOCUS_27100 4255 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 >Feature sequence443 <1 590 gene locus_tag LOCUS_27110 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531484.1:SGNH/GDSL hydrolase family protein 1764 823 gene locus_tag LOCUS_27120 1764 823 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812829.1 protein_id gnl|my_center|LOCUS_27120 2367 1828 gene locus_tag LOCUS_27130 2367 1828 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940892.1 protein_id gnl|my_center|LOCUS_27130 3126 2419 gene locus_tag LOCUS_27140 3126 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 4146 3304 gene locus_tag LOCUS_27150 4146 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 >Feature sequence444 1446 646 gene locus_tag LOCUS_27160 1446 646 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860631.1 protein_id gnl|my_center|LOCUS_27160 2014 1574 gene locus_tag LOCUS_27170 2014 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27170 3553 2087 gene locus_tag LOCUS_27180 3553 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27180 3663 4274 gene locus_tag LOCUS_27190 3663 4274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence445 <1 1005 gene locus_tag LOCUS_27200 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582710.1:TRAP transporter substrate-binding protein 1056 1547 gene locus_tag LOCUS_27210 1056 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 1544 2599 gene locus_tag LOCUS_27220 1544 2599 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969469.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27220 2627 2830 gene locus_tag LOCUS_27230 2627 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27230 3165 3551 gene locus_tag LOCUS_27240 3165 3551 CDS product GrdX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948883.1 protein_id gnl|my_center|LOCUS_27240 3586 4263 gene locus_tag LOCUS_27250 3586 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence446 100 1317 gene locus_tag LOCUS_27260 100 1317 CDS product pyridoxal phosphate-dependent class II aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812326.1 protein_id gnl|my_center|LOCUS_27260 1363 2949 gene locus_tag LOCUS_27270 1363 2949 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964683.1 protein_id gnl|my_center|LOCUS_27270 3107 3757 gene locus_tag LOCUS_27280 3107 3757 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437747.1 protein_id gnl|my_center|LOCUS_27280 <4284 3771 gene locus_tag LOCUS_27290 <4284 3771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764741.1:amidophosphoribosyltransferase >Feature sequence447 1084 326 gene locus_tag LOCUS_27300 1084 326 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249330.1 protein_id gnl|my_center|LOCUS_27300 1182 2096 gene locus_tag LOCUS_27310 1182 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 3556 2093 gene locus_tag LOCUS_27320 3556 2093 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272312.1 protein_id gnl|my_center|LOCUS_27320 >Feature sequence448 2959 599 gene locus_tag LOCUS_27330 2959 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 3255 2977 gene locus_tag LOCUS_27340 3255 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 3691 3245 gene locus_tag LOCUS_27350 gene ruvX 3691 3245 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730148.1 protein_id gnl|my_center|LOCUS_27350 >Feature sequence449 <1 1639 gene locus_tag LOCUS_27360 <1 1639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582720.1:response regulator >Feature sequence450 537 1553 gene locus_tag LOCUS_27370 537 1553 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817222.1 protein_id gnl|my_center|LOCUS_27370 1555 2220 gene locus_tag LOCUS_27380 1555 2220 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817223.1 protein_id gnl|my_center|LOCUS_27380 2367 3296 gene locus_tag LOCUS_27390 2367 3296 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_27390 >Feature sequence451 1725 157 gene locus_tag LOCUS_27400 1725 157 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_27400 2708 1743 gene locus_tag LOCUS_27410 2708 1743 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_27410 3856 2705 gene locus_tag LOCUS_27420 3856 2705 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 protein_id gnl|my_center|LOCUS_27420 >Feature sequence452 219 1319 gene locus_tag LOCUS_27430 gene araR 219 1319 CDS product arabinose utilization transcriptional regulator AraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243070.1 protein_id gnl|my_center|LOCUS_27430 1333 1731 gene locus_tag LOCUS_27440 1333 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 1718 3214 gene locus_tag LOCUS_27450 gene araA 1718 3214 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229499.1 protein_id gnl|my_center|LOCUS_27450 >Feature sequence453 1355 33 gene locus_tag LOCUS_27460 1355 33 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682237.1 protein_id gnl|my_center|LOCUS_27460 3215 1524 gene locus_tag LOCUS_27470 3215 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 <4237 3229 gene locus_tag LOCUS_27480 <4237 3229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011192741.1:M24 family metallopeptidase >Feature sequence454 2816 1290 gene locus_tag LOCUS_27490 2816 1290 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986625.1 protein_id gnl|my_center|LOCUS_27490 3143 2835 gene locus_tag LOCUS_27500 3143 2835 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986626.1 protein_id gnl|my_center|LOCUS_27500 3697 3401 gene locus_tag LOCUS_27510 3697 3401 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358244.1 protein_id gnl|my_center|LOCUS_27510 4000 3713 gene locus_tag LOCUS_27520 4000 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 >Feature sequence455 1453 356 gene locus_tag LOCUS_27530 1453 356 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_27530 3170 1629 gene locus_tag LOCUS_27540 3170 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 <4229 3167 gene locus_tag LOCUS_27550 <4229 3167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388674.1:response regulator >Feature sequence456 2 2308 gene locus_tag LOCUS_27560 2 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 2335 3801 gene locus_tag LOCUS_27570 2335 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 >Feature sequence457 708 1727 gene locus_tag LOCUS_27580 gene pheS 708 1727 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965654.1 protein_id gnl|my_center|LOCUS_27580 1769 4024 gene locus_tag LOCUS_27590 gene pheT 1769 4024 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_27590 4082 4201 gene locus_tag LOCUS_27600 4082 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 >Feature sequence458 222 1457 gene locus_tag LOCUS_27610 222 1457 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913616.1 protein_id gnl|my_center|LOCUS_27610 1993 3111 gene locus_tag LOCUS_27620 1993 3111 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966652.1 protein_id gnl|my_center|LOCUS_27620 3210 3509 gene locus_tag LOCUS_27630 3210 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27630 >Feature sequence459 1927 17 gene locus_tag LOCUS_27640 1927 17 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802963.1 protein_id gnl|my_center|LOCUS_27640 3669 1924 gene locus_tag LOCUS_27650 3669 1924 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798723.1 protein_id gnl|my_center|LOCUS_27650 4164 3670 gene locus_tag LOCUS_27660 4164 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 >Feature sequence460 310 546 gene locus_tag LOCUS_27670 310 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 536 796 gene locus_tag LOCUS_27680 536 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 808 1050 gene locus_tag LOCUS_27690 808 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 1142 1720 gene locus_tag LOCUS_27700 1142 1720 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117417247.1 protein_id gnl|my_center|LOCUS_27700 3282 1825 gene locus_tag LOCUS_27710 3282 1825 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104497.1 protein_id gnl|my_center|LOCUS_27710 3486 4187 gene locus_tag LOCUS_27720 3486 4187 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812913.1 protein_id gnl|my_center|LOCUS_27720 >Feature sequence461 140 1324 gene locus_tag LOCUS_27730 140 1324 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460816.1 protein_id gnl|my_center|LOCUS_27730 1421 2755 gene locus_tag LOCUS_27740 1421 2755 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626527.1 protein_id gnl|my_center|LOCUS_27740 2769 3995 gene locus_tag LOCUS_27750 2769 3995 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459641.1 protein_id gnl|my_center|LOCUS_27750 3366 3375 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence462 657 319 gene locus_tag LOCUS_27760 657 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27760 1839 691 gene locus_tag LOCUS_27770 1839 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27770 2947 1874 gene locus_tag LOCUS_27780 2947 1874 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583513.1 protein_id gnl|my_center|LOCUS_27780 3383 3081 gene locus_tag LOCUS_27790 3383 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 4117 3380 gene locus_tag LOCUS_27800 4117 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 >Feature sequence463 <1 929 gene locus_tag LOCUS_27810 <1 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011862014.1:diguanylate cyclase 2758 905 gene locus_tag LOCUS_27820 gene asnB 2758 905 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333979.1 protein_id gnl|my_center|LOCUS_27820 4168 2795 gene locus_tag LOCUS_27830 4168 2795 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861659.1 protein_id gnl|my_center|LOCUS_27830 >Feature sequence464 721 2604 gene locus_tag LOCUS_27840 721 2604 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338380.1 protein_id gnl|my_center|LOCUS_27840 >Feature sequence465 1848 1135 gene locus_tag LOCUS_27850 1848 1135 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775050.1 protein_id gnl|my_center|LOCUS_27850 3396 1900 gene locus_tag LOCUS_27860 gene glpK 3396 1900 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987067.1 protein_id gnl|my_center|LOCUS_27860 4145 3576 gene locus_tag LOCUS_27870 4145 3576 CDS product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116197.1 protein_id gnl|my_center|LOCUS_27870 >Feature sequence466 55 180 gene locus_tag LOCUS_27880 55 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 180 734 gene locus_tag LOCUS_27890 180 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 739 2373 gene locus_tag LOCUS_27900 739 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 >Feature sequence467 1220 3232 gene locus_tag LOCUS_27910 gene htpG 1220 3232 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_27910 <4173 3366 gene locus_tag LOCUS_27920 <4173 3366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393389.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence468 1727 999 gene locus_tag LOCUS_27930 gene phnF 1727 999 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194085.1 protein_id gnl|my_center|LOCUS_27930 3326 1896 gene locus_tag LOCUS_27940 gene abc-f 3326 1896 CDS product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070104985.1 protein_id gnl|my_center|LOCUS_27940 >Feature sequence469 1580 261 gene locus_tag LOCUS_27950 1580 261 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_27950 1865 1704 gene locus_tag LOCUS_27960 1865 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 2102 1878 gene locus_tag LOCUS_27970 2102 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 3499 2102 gene locus_tag LOCUS_27980 3499 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27980 >Feature sequence470 155 2989 gene locus_tag LOCUS_27990 155 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 >Feature sequence471 601 1437 gene locus_tag LOCUS_28000 601 1437 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_28000 1425 2363 gene locus_tag LOCUS_28010 1425 2363 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_28010 2441 3235 gene locus_tag LOCUS_28020 2441 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 3984 3391 gene locus_tag LOCUS_28030 3984 3391 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170138703.1 protein_id gnl|my_center|LOCUS_28030 >Feature sequence472 732 163 gene locus_tag LOCUS_28040 732 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 2338 758 gene locus_tag LOCUS_28050 2338 758 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033562369.1 protein_id gnl|my_center|LOCUS_28050 3590 2358 gene locus_tag LOCUS_28060 gene ilvA 3590 2358 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 protein_id gnl|my_center|LOCUS_28060 >Feature sequence473 <1 561 gene locus_tag LOCUS_28070 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986486.1:MATE family efflux transporter 1896 634 gene locus_tag LOCUS_28080 gene dcm 1896 634 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068549.1 protein_id gnl|my_center|LOCUS_28080 2022 2468 gene locus_tag LOCUS_28090 2022 2468 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138156903.1 protein_id gnl|my_center|LOCUS_28090 3144 2440 gene locus_tag LOCUS_28100 gene rpiA 3144 2440 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364539.1 protein_id gnl|my_center|LOCUS_28100 <4115 3274 gene locus_tag LOCUS_28110 <4115 3274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393785.1:glucose-6-phosphate dehydrogenase >Feature sequence474 889 92 gene locus_tag LOCUS_28120 889 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 2186 1077 gene locus_tag LOCUS_28130 2186 1077 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016302.1 protein_id gnl|my_center|LOCUS_28130 3924 2191 gene locus_tag LOCUS_28140 3924 2191 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016301.1 protein_id gnl|my_center|LOCUS_28140 >Feature sequence475 576 226 gene locus_tag LOCUS_28150 576 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28150 1775 621 gene locus_tag LOCUS_28160 1775 621 CDS product 2-methylaconitate cis-trans isomerase PrpF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967865.1 protein_id gnl|my_center|LOCUS_28160 4063 1775 gene locus_tag LOCUS_28170 4063 1775 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593936.1 protein_id gnl|my_center|LOCUS_28170 >Feature sequence476 >Feature sequence477 53 1579 gene locus_tag LOCUS_28180 53 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 2277 1582 gene locus_tag LOCUS_28190 2277 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 3802 2267 gene locus_tag LOCUS_28200 3802 2267 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_28200 >Feature sequence478 <1 615 gene locus_tag LOCUS_28210 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776905.1:sugar ABC transporter permease 630 1463 gene locus_tag LOCUS_28220 630 1463 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776904.1 protein_id gnl|my_center|LOCUS_28220 1543 3051 gene locus_tag LOCUS_28230 gene abfA 1543 3051 CDS product alpha-L-arabinofuranosidase AbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398747.1 protein_id gnl|my_center|LOCUS_28230 >Feature sequence479 48 755 gene locus_tag LOCUS_28240 48 755 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047943.1 protein_id gnl|my_center|LOCUS_28240 875 2323 gene locus_tag LOCUS_28250 gene purF 875 2323 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047942.1 protein_id gnl|my_center|LOCUS_28250 2426 3862 gene locus_tag LOCUS_28260 gene purB 2426 3862 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_28260 >Feature sequence480 55 375 gene locus_tag LOCUS_28270 55 375 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_28270 372 893 gene locus_tag LOCUS_28280 372 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 795 804 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 823 1356 gene locus_tag LOCUS_28290 823 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 1353 2183 gene locus_tag LOCUS_28300 1353 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 2200 2385 gene locus_tag LOCUS_28310 2200 2385 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965947.1 protein_id gnl|my_center|LOCUS_28310 3505 2363 gene locus_tag LOCUS_28320 3505 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 >Feature sequence481 72 320 gene locus_tag LOCUS_28330 72 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 486 1304 gene locus_tag LOCUS_28340 gene glcT 486 1304 CDS product ptsGHI operon transcription antiterminator GlcT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073864.1 protein_id gnl|my_center|LOCUS_28340 2293 1379 gene locus_tag LOCUS_28350 2293 1379 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 protein_id gnl|my_center|LOCUS_28350 3149 2283 gene locus_tag LOCUS_28360 3149 2283 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811658.1 protein_id gnl|my_center|LOCUS_28360 >Feature sequence482 61 507 gene locus_tag LOCUS_28370 61 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 1510 494 gene locus_tag LOCUS_28380 1510 494 CDS product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771532.1 protein_id gnl|my_center|LOCUS_28380 1710 2345 gene locus_tag LOCUS_28390 gene nth 1710 2345 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895383.1 protein_id gnl|my_center|LOCUS_28390 >Feature sequence483 2099 18 gene locus_tag LOCUS_28400 2099 18 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861490.1 protein_id gnl|my_center|LOCUS_28400 2676 2137 gene locus_tag LOCUS_28410 2676 2137 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430880.1 protein_id gnl|my_center|LOCUS_28410 3427 2669 gene locus_tag LOCUS_28420 3427 2669 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454726.1 protein_id gnl|my_center|LOCUS_28420 <4068 3429 gene locus_tag LOCUS_28430 <4068 3429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009890635.1:3-methyl-2-oxobutanoate dehydrogenase subunit VorB >Feature sequence484 456 91 gene locus_tag LOCUS_28440 456 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 1989 1015 gene locus_tag LOCUS_28450 gene add 1989 1015 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548323.1 protein_id gnl|my_center|LOCUS_28450 3497 2010 gene locus_tag LOCUS_28460 3497 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 3720 3481 gene locus_tag LOCUS_28470 3720 3481 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791339.1 protein_id gnl|my_center|LOCUS_28470 >Feature sequence485 <1 713 gene locus_tag LOCUS_28480 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964594.1:molecular chaperone DnaK 802 1950 gene locus_tag LOCUS_28490 gene dnaJ 802 1950 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048002.1 protein_id gnl|my_center|LOCUS_28490 2163 3050 gene locus_tag LOCUS_28500 gene rfbD 2163 3050 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786018.1 protein_id gnl|my_center|LOCUS_28500 3076 3663 gene locus_tag LOCUS_28510 3076 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 >Feature sequence486 <1 943 gene locus_tag LOCUS_28520 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963418.1:ketol-acid reductoisomerase 1251 2168 gene locus_tag LOCUS_28530 1251 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 3184 2303 gene locus_tag LOCUS_28540 3184 2303 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948557.1 protein_id gnl|my_center|LOCUS_28540 3196 3205 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <4062 3444 gene locus_tag LOCUS_28550 <4062 3444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963352.1:LysR family transcriptional regulator >Feature sequence487 3908 3729 gene locus_tag LOCUS_28560 3908 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 3734 3743 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence488 739 1929 gene locus_tag LOCUS_28570 739 1929 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459580.1 protein_id gnl|my_center|LOCUS_28570 2011 3075 gene locus_tag LOCUS_28580 gene hisC 2011 3075 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766530.1 protein_id gnl|my_center|LOCUS_28580 >Feature sequence489 941 594 gene locus_tag LOCUS_28590 941 594 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957066.1 protein_id gnl|my_center|LOCUS_28590 2944 1094 gene locus_tag LOCUS_28600 2944 1094 CDS product GGDEF domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454514.1 protein_id gnl|my_center|LOCUS_28600 <4038 3388 gene locus_tag LOCUS_28610 <4038 3388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005463044.1:AraC family transcriptional regulator >Feature sequence490 52 1557 gene locus_tag LOCUS_28620 gene pap 52 1557 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869086.1 protein_id gnl|my_center|LOCUS_28620 1554 2801 gene locus_tag LOCUS_28630 1554 2801 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_28630 2864 3547 gene locus_tag LOCUS_28640 gene cmk 2864 3547 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700259.1 protein_id gnl|my_center|LOCUS_28640 >Feature sequence491 1538 726 gene locus_tag LOCUS_28650 1538 726 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113099.1 protein_id gnl|my_center|LOCUS_28650 2736 1819 gene locus_tag LOCUS_28660 2736 1819 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583516.1 protein_id gnl|my_center|LOCUS_28660 3803 2736 gene locus_tag LOCUS_28670 3803 2736 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969292.1 protein_id gnl|my_center|LOCUS_28670 >Feature sequence492 130 384 gene locus_tag LOCUS_28680 130 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 468 2822 gene locus_tag LOCUS_28690 gene rnr 468 2822 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948032.1 protein_id gnl|my_center|LOCUS_28690 2827 3294 gene locus_tag LOCUS_28700 gene smpB 2827 3294 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545050.1 protein_id gnl|my_center|LOCUS_28700 3312 3866 gene locus_tag LOCUS_28710 3312 3866 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198788.1 protein_id gnl|my_center|LOCUS_28710 >Feature sequence493 1966 155 gene locus_tag LOCUS_28720 1966 155 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941543.1 protein_id gnl|my_center|LOCUS_28720 3073 2093 gene locus_tag LOCUS_28730 3073 2093 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 protein_id gnl|my_center|LOCUS_28730 <3992 3369 gene locus_tag LOCUS_28740 <3992 3369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808153.1:diaminopimelate dehydrogenase >Feature sequence494 80 1615 gene locus_tag LOCUS_28750 80 1615 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 protein_id gnl|my_center|LOCUS_28750 1989 1714 gene locus_tag LOCUS_28760 gene spoIIID 1989 1714 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_28760 2591 2130 gene locus_tag LOCUS_28770 2591 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 3819 2635 gene locus_tag LOCUS_28780 3819 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287480.1 protein_id gnl|my_center|LOCUS_28780 >Feature sequence495 502 1506 gene locus_tag LOCUS_28790 502 1506 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092876.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28790 1646 2593 gene locus_tag LOCUS_28800 1646 2593 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948810.1 protein_id gnl|my_center|LOCUS_28800 2586 3359 gene locus_tag LOCUS_28810 2586 3359 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948811.1 protein_id gnl|my_center|LOCUS_28810 >Feature sequence496 1 960 gene locus_tag LOCUS_28820 1 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 >Feature sequence497 1601 882 gene locus_tag LOCUS_28830 1601 882 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867222.1 protein_id gnl|my_center|LOCUS_28830 2333 1602 gene locus_tag LOCUS_28840 2333 1602 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867222.1 protein_id gnl|my_center|LOCUS_28840 3366 2350 gene locus_tag LOCUS_28850 3366 2350 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762549.1 protein_id gnl|my_center|LOCUS_28850 3701 3363 gene locus_tag LOCUS_28860 3701 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 >Feature sequence498 <1 815 gene locus_tag LOCUS_28870 <1 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207243.1:AraC family transcriptional regulator 3823 824 gene locus_tag LOCUS_28880 3823 824 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 protein_id gnl|my_center|LOCUS_28880 >Feature sequence499 <1 707 gene locus_tag LOCUS_28890 <1 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002382189.1:ABC transporter permease 700 1482 gene locus_tag LOCUS_28900 700 1482 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357916.1 protein_id gnl|my_center|LOCUS_28900 1496 2536 gene locus_tag LOCUS_28910 1496 2536 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002413403.1 protein_id gnl|my_center|LOCUS_28910 2580 3638 gene locus_tag LOCUS_28920 2580 3638 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379352.1 protein_id gnl|my_center|LOCUS_28920 >Feature sequence500 338 2008 gene locus_tag LOCUS_28930 338 2008 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_28930 2019 2663 gene locus_tag LOCUS_28940 2019 2663 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840898.1 protein_id gnl|my_center|LOCUS_28940 2761 3420 gene locus_tag LOCUS_28950 2761 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 >Feature sequence501 1589 6 gene locus_tag LOCUS_28960 1589 6 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584014.1 protein_id gnl|my_center|LOCUS_28960 2185 1586 gene locus_tag LOCUS_28970 2185 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28970 2581 2273 gene locus_tag LOCUS_28980 2581 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28980 3812 2751 gene locus_tag LOCUS_28990 3812 2751 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003661512.1 protein_id gnl|my_center|LOCUS_28990 >Feature sequence502 3668 696 gene locus_tag LOCUS_29000 3668 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 >Feature sequence503 <1 1072 gene locus_tag LOCUS_29010 <1 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003105529.1:C4-dicarboxylate TRAP transporter large permease protein DctM 1091 1939 gene locus_tag LOCUS_29020 gene blaBJP 1091 1939 CDS product subclass B3 metallo-beta-lactamase BJP-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088970.1 protein_id gnl|my_center|LOCUS_29020 1960 2751 gene locus_tag LOCUS_29030 1960 2751 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861491.1 protein_id gnl|my_center|LOCUS_29030 >Feature sequence504 80 1876 gene locus_tag LOCUS_29040 80 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 1876 3024 gene locus_tag LOCUS_29050 1876 3024 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430617.1 protein_id gnl|my_center|LOCUS_29050 >Feature sequence505 1473 2231 gene locus_tag LOCUS_29060 1473 2231 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393059.1 protein_id gnl|my_center|LOCUS_29060 2993 2262 gene locus_tag LOCUS_29070 2993 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 3523 2999 gene locus_tag LOCUS_29080 3523 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 3844 3539 gene locus_tag LOCUS_29090 3844 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 >Feature sequence506 1728 670 gene locus_tag LOCUS_29100 1728 670 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976288.1 protein_id gnl|my_center|LOCUS_29100 2017 1748 gene locus_tag LOCUS_29110 2017 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29110 3462 2002 gene locus_tag LOCUS_29120 gene ptsI 3462 2002 CDS product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706834.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29120 3741 3481 gene locus_tag LOCUS_29130 3741 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 >Feature sequence507 <1 545 gene locus_tag LOCUS_29140 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000517460.1:SDR family oxidoreductase UcpA 550 1632 gene locus_tag LOCUS_29150 gene eutH 550 1632 CDS product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016133.1 protein_id gnl|my_center|LOCUS_29150 1671 1790 gene locus_tag LOCUS_29160 1671 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 2888 3628 gene locus_tag LOCUS_29170 2888 3628 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_29170 >Feature sequence508 775 32 gene locus_tag LOCUS_29180 775 32 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061295975.1 protein_id gnl|my_center|LOCUS_29180 1547 750 gene locus_tag LOCUS_29190 1547 750 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948430.1 protein_id gnl|my_center|LOCUS_29190 2380 1604 gene locus_tag LOCUS_29200 2380 1604 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891631.1 protein_id gnl|my_center|LOCUS_29200 2524 3015 gene locus_tag LOCUS_29210 2524 3015 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775452.1 protein_id gnl|my_center|LOCUS_29210 2955 2964 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3106 3702 gene locus_tag LOCUS_29220 3106 3702 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434301.1 protein_id gnl|my_center|LOCUS_29220 >Feature sequence509 57 371 gene locus_tag LOCUS_29230 57 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 349 2982 gene locus_tag LOCUS_29240 349 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 3494 3318 gene locus_tag LOCUS_29250 3494 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 >Feature sequence510 51 470 gene locus_tag LOCUS_29260 51 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 350 359 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 833 2242 gene locus_tag LOCUS_29270 833 2242 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392886.1 protein_id gnl|my_center|LOCUS_29270 2365 3633 gene locus_tag LOCUS_29280 2365 3633 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392338.1 protein_id gnl|my_center|LOCUS_29280 3922 3692 gene locus_tag LOCUS_29290 3922 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 >Feature sequence511 103 1611 gene locus_tag LOCUS_29300 103 1611 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680067.1 protein_id gnl|my_center|LOCUS_29300 1621 3282 gene locus_tag LOCUS_29310 1621 3282 CDS product galactoside ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680065.1 protein_id gnl|my_center|LOCUS_29310 3902 3444 gene locus_tag LOCUS_29320 3902 3444 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_29320 >Feature sequence512 752 597 gene locus_tag LOCUS_29330 752 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 2505 1198 gene locus_tag LOCUS_29340 2505 1198 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454913.1 protein_id gnl|my_center|LOCUS_29340 3235 2540 gene locus_tag LOCUS_29350 3235 2540 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066872391.1 protein_id gnl|my_center|LOCUS_29350 <3899 3253 gene locus_tag LOCUS_29360 <3899 3253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870531.1:phosphoglycerate dehydrogenase >Feature sequence513 3510 3361 gene locus_tag LOCUS_29370 3510 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 >Feature sequence514 593 1144 gene locus_tag LOCUS_29380 593 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 1183 2550 gene locus_tag LOCUS_29390 1183 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 3626 2691 gene locus_tag LOCUS_29400 gene sdaAA 3626 2691 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671221.1 protein_id gnl|my_center|LOCUS_29400 >Feature sequence515 <1 573 gene locus_tag LOCUS_29410 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003532039.1:xanthine dehydrogenase family protein subunit M 586 1077 gene locus_tag LOCUS_29420 586 1077 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_29420 1070 3433 gene locus_tag LOCUS_29430 1070 3433 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969633.1 protein_id gnl|my_center|LOCUS_29430 >Feature sequence516 1465 422 gene locus_tag LOCUS_29440 1465 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 1783 1559 gene locus_tag LOCUS_29450 1783 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 2455 1847 gene locus_tag LOCUS_29460 2455 1847 CDS product dihydroxyacetone kinase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680280.1 protein_id gnl|my_center|LOCUS_29460 3492 2485 gene locus_tag LOCUS_29470 3492 2485 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674237.1 protein_id gnl|my_center|LOCUS_29470 >Feature sequence517 291 160 gene locus_tag LOCUS_29480 291 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 849 439 gene locus_tag LOCUS_29490 849 439 CDS product DUF3788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438911.1 protein_id gnl|my_center|LOCUS_29490 1366 983 gene locus_tag LOCUS_29500 1366 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 1726 1574 gene locus_tag LOCUS_29510 1726 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29510 1917 1732 gene locus_tag LOCUS_29520 1917 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29520 2594 1956 gene locus_tag LOCUS_29530 2594 1956 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986618.1 protein_id gnl|my_center|LOCUS_29530 <3874 2609 gene locus_tag LOCUS_29540 <3874 2609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986619.1:acetaldehyde dehydrogenase (acetylating) >Feature sequence518 2 694 gene locus_tag LOCUS_29550 2 694 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966116.1 protein_id gnl|my_center|LOCUS_29550 999 1877 gene locus_tag LOCUS_29560 999 1877 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726366.1 protein_id gnl|my_center|LOCUS_29560 >Feature sequence519 2751 1093 gene locus_tag LOCUS_29570 gene recN 2751 1093 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699855.1 protein_id gnl|my_center|LOCUS_29570 3227 2775 gene locus_tag LOCUS_29580 3227 2775 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_29580 <3869 3229 gene locus_tag LOCUS_29590 <3869 3229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393018.1:NAD(+)/NADH kinase >Feature sequence520 973 2910 gene locus_tag LOCUS_29600 973 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 >Feature sequence521 90 611 gene locus_tag LOCUS_29610 90 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 616 1908 gene locus_tag LOCUS_29620 616 1908 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404808.1 protein_id gnl|my_center|LOCUS_29620 2041 3858 gene locus_tag LOCUS_29630 2041 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 >Feature sequence522 683 66 gene locus_tag LOCUS_29640 683 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 2427 1069 gene locus_tag LOCUS_29650 2427 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 3159 2503 gene locus_tag LOCUS_29660 3159 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 3767 3255 gene locus_tag LOCUS_29670 gene rimM 3767 3255 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170278.1 protein_id gnl|my_center|LOCUS_29670 >Feature sequence523 94 1437 gene locus_tag LOCUS_29680 94 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329694.1 protein_id gnl|my_center|LOCUS_29680 1478 2569 gene locus_tag LOCUS_29690 1478 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 3303 2671 gene locus_tag LOCUS_29700 3303 2671 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944116.1 protein_id gnl|my_center|LOCUS_29700 <3848 3336 gene locus_tag LOCUS_29710 <3848 3336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812246.1:ABC transporter permease subunit >Feature sequence524 <1 767 gene locus_tag LOCUS_29720 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048015.1:L-seryl-tRNA(Sec) selenium transferase 767 2677 gene locus_tag LOCUS_29730 gene selB 767 2677 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454786.1 protein_id gnl|my_center|LOCUS_29730 >Feature sequence525 <1 672 gene locus_tag LOCUS_29740 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005895383.1:endonuclease III 689 1411 gene locus_tag LOCUS_29750 689 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 1653 3239 gene locus_tag LOCUS_29760 1653 3239 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986179.1 protein_id gnl|my_center|LOCUS_29760 >Feature sequence526 2 1048 gene locus_tag LOCUS_29770 2 1048 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_29770 263 272 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1127 1981 gene locus_tag LOCUS_29780 gene fba 1127 1981 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392146.1 protein_id gnl|my_center|LOCUS_29780 2011 2742 gene locus_tag LOCUS_29790 2011 2742 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002301131.1 protein_id gnl|my_center|LOCUS_29790 <3839 2881 gene locus_tag LOCUS_29800 <3839 2881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870531.1:phosphoglycerate dehydrogenase >Feature sequence527 2804 861 gene locus_tag LOCUS_29810 2804 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 3328 3014 gene locus_tag LOCUS_29820 3328 3014 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422812.1 protein_id gnl|my_center|LOCUS_29820 >Feature sequence528 103 831 gene locus_tag LOCUS_29830 gene rgaR 103 831 CDS product two-component system response regulator RgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432343.1 protein_id gnl|my_center|LOCUS_29830 831 2168 gene locus_tag LOCUS_29840 831 2168 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964890.1 protein_id gnl|my_center|LOCUS_29840 3475 2354 gene locus_tag LOCUS_29850 3475 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 >Feature sequence529 167 547 gene locus_tag LOCUS_29860 167 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 648 923 gene locus_tag LOCUS_29870 648 923 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814866.1 protein_id gnl|my_center|LOCUS_29870 927 1166 gene locus_tag LOCUS_29880 927 1166 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_29880 1238 1525 gene locus_tag LOCUS_29890 1238 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 1537 1917 gene locus_tag LOCUS_29900 1537 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 1922 2239 gene locus_tag LOCUS_29910 1922 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 2344 3606 gene locus_tag LOCUS_29920 2344 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29920 3466 3475 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3497 3763 gene locus_tag LOCUS_29930 3497 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 >Feature sequence530 1531 569 gene locus_tag LOCUS_29940 1531 569 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317694.1 protein_id gnl|my_center|LOCUS_29940 3018 1534 gene locus_tag LOCUS_29950 3018 1534 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584014.1 protein_id gnl|my_center|LOCUS_29950 3815 3075 gene locus_tag LOCUS_29960 3815 3075 CDS product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966764.1 protein_id gnl|my_center|LOCUS_29960 >Feature sequence531 8 820 gene locus_tag LOCUS_29970 8 820 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311867.1 protein_id gnl|my_center|LOCUS_29970 820 1650 gene locus_tag LOCUS_29980 820 1650 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098571.1 protein_id gnl|my_center|LOCUS_29980 1679 2242 gene locus_tag LOCUS_29990 1679 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 >Feature sequence532 696 1367 gene locus_tag LOCUS_30000 696 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 2398 1442 gene locus_tag LOCUS_30010 2398 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 3602 2409 gene locus_tag LOCUS_30020 3602 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 >Feature sequence533 <1 2460 gene locus_tag LOCUS_30030 <1 2460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986028.1:isoleucine--tRNA ligase >Feature sequence534 247 256 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 293 664 gene locus_tag LOCUS_30040 293 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 811 1554 gene locus_tag LOCUS_30050 811 1554 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964283.1 protein_id gnl|my_center|LOCUS_30050 1609 2745 gene locus_tag LOCUS_30060 gene pheA 1609 2745 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_30060 >Feature sequence535 <1 837 gene locus_tag LOCUS_30070 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000725079.1:N-acetylmuramoyl-L-alanine amidase family protein 1111 2400 gene locus_tag LOCUS_30080 1111 2400 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938271.1 protein_id gnl|my_center|LOCUS_30080 2561 3646 gene locus_tag LOCUS_30090 gene leuB 2561 3646 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_30090 >Feature sequence536 1343 951 gene locus_tag LOCUS_30100 1343 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 2521 1355 gene locus_tag LOCUS_30110 2521 1355 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861193.1 protein_id gnl|my_center|LOCUS_30110 3642 2572 gene locus_tag LOCUS_30120 3642 2572 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438474.1 protein_id gnl|my_center|LOCUS_30120 >Feature sequence537 9 1115 gene locus_tag LOCUS_30130 gene xylF 9 1115 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005052270.1 protein_id gnl|my_center|LOCUS_30130 1314 2846 gene locus_tag LOCUS_30140 1314 2846 CDS product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393517.1 protein_id gnl|my_center|LOCUS_30140 >Feature sequence538 165 1109 gene locus_tag LOCUS_30150 165 1109 CDS product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057563589.1 protein_id gnl|my_center|LOCUS_30150 1106 1816 gene locus_tag LOCUS_30160 gene rpe 1106 1816 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965037.1 protein_id gnl|my_center|LOCUS_30160 1821 2393 gene locus_tag LOCUS_30170 gene hxlB 1821 2393 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246343.1 protein_id gnl|my_center|LOCUS_30170 2503 3540 gene locus_tag LOCUS_30180 2503 3540 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094661859.1 protein_id gnl|my_center|LOCUS_30180 >Feature sequence539 142 741 gene locus_tag LOCUS_30190 142 741 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_30190 1005 932 gene locus_tag LOCUS_t00110 1005 932 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1598 1050 gene locus_tag LOCUS_30200 1598 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 2419 1592 gene locus_tag LOCUS_30210 2419 1592 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459298.1 protein_id gnl|my_center|LOCUS_30210 2730 3143 gene locus_tag LOCUS_30220 2730 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 3159 3689 gene locus_tag LOCUS_30230 3159 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 >Feature sequence540 876 595 gene locus_tag LOCUS_30240 876 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 2070 925 gene locus_tag LOCUS_30250 gene tgt 2070 925 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_30250 3475 2075 gene locus_tag LOCUS_30260 gene scfB 3475 2075 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_30260 >Feature sequence541 381 2126 gene locus_tag LOCUS_30270 381 2126 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_30270 2483 2307 gene locus_tag LOCUS_30280 gene rpsU 2483 2307 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964600.1 protein_id gnl|my_center|LOCUS_30280 <3748 2638 gene locus_tag LOCUS_30290 <3748 2638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964985.1:alanine--tRNA ligase >Feature sequence542 1543 1007 gene locus_tag LOCUS_30300 1543 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30300 1087 1096 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2833 1646 gene locus_tag LOCUS_30310 gene chvE 2833 1646 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727839.1 protein_id gnl|my_center|LOCUS_30310 <3741 3106 gene locus_tag LOCUS_30320 <3741 3106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530723.1:sugar ABC transporter substrate-binding protein >Feature sequence543 78 512 gene locus_tag LOCUS_30330 78 512 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460328.1 protein_id gnl|my_center|LOCUS_30330 588 1487 gene locus_tag LOCUS_30340 588 1487 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857771.1 protein_id gnl|my_center|LOCUS_30340 2025 1546 gene locus_tag LOCUS_30350 2025 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 2053 2062 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2385 2092 gene locus_tag LOCUS_30360 2385 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 >Feature sequence544 <1 562 gene locus_tag LOCUS_30370 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117877.1:nitrate reductase note possible pseudo, frameshifted 531 1985 gene locus_tag LOCUS_30380 531 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30380 1966 2388 gene locus_tag LOCUS_30390 1966 2388 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948939.1 protein_id gnl|my_center|LOCUS_30390 2385 3632 gene locus_tag LOCUS_30400 2385 3632 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948940.1 protein_id gnl|my_center|LOCUS_30400 >Feature sequence545 <1 524 gene locus_tag LOCUS_30410 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002381503.1:helix-turn-helix transcriptional regulator 749 1510 gene locus_tag LOCUS_30420 749 1510 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764784.1 protein_id gnl|my_center|LOCUS_30420 1532 3028 gene locus_tag LOCUS_30430 gene gguA 1532 3028 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_30430 3145 3154 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence546 662 1843 gene locus_tag LOCUS_30440 662 1843 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986500.1 protein_id gnl|my_center|LOCUS_30440 1875 3419 gene locus_tag LOCUS_30450 1875 3419 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903217.1 protein_id gnl|my_center|LOCUS_30450 >Feature sequence547 1354 326 gene locus_tag LOCUS_30460 gene ptcA 1354 326 CDS product putrescine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355587.1 protein_id gnl|my_center|LOCUS_30460 2921 1413 gene locus_tag LOCUS_30470 2921 1413 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583434.1 protein_id gnl|my_center|LOCUS_30470 <3711 2944 gene locus_tag LOCUS_30480 <3711 2944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022654.1:MATE family efflux transporter >Feature sequence548 1272 769 gene locus_tag LOCUS_30490 gene sigV 1272 769 CDS product RNA polymerase sigma factor SigV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398891.1 protein_id gnl|my_center|LOCUS_30490 1443 2756 gene locus_tag LOCUS_30500 1443 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 3665 2856 gene locus_tag LOCUS_30510 3665 2856 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896027.1 protein_id gnl|my_center|LOCUS_30510 >Feature sequence549 86 1291 gene locus_tag LOCUS_30520 86 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 1319 1846 gene locus_tag LOCUS_30530 1319 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30530 1855 3573 gene locus_tag LOCUS_30540 1855 3573 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836501.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30540 >Feature sequence550 36 557 gene locus_tag LOCUS_30550 36 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 >Feature sequence551 61 1299 gene locus_tag LOCUS_30560 61 1299 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941893.1 protein_id gnl|my_center|LOCUS_30560 1319 1795 gene locus_tag LOCUS_30570 1319 1795 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392242.1 protein_id gnl|my_center|LOCUS_30570 >Feature sequence552 1095 859 gene locus_tag LOCUS_30580 1095 859 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814054.1 protein_id gnl|my_center|LOCUS_30580 2811 1111 gene locus_tag LOCUS_30590 2811 1111 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113100.1 protein_id gnl|my_center|LOCUS_30590 1599 1608 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <3693 2867 gene locus_tag LOCUS_30600 <3693 2867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930057.1:MmgE/PrpD family protein >Feature sequence553 72 446 gene locus_tag LOCUS_30610 72 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30610 473 766 gene locus_tag LOCUS_30620 473 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30620 800 2239 gene locus_tag LOCUS_30630 800 2239 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459733.1 protein_id gnl|my_center|LOCUS_30630 2441 3076 gene locus_tag LOCUS_30640 2441 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 >Feature sequence554 306 1529 gene locus_tag LOCUS_30650 gene spoVE 306 1529 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244810.1 protein_id gnl|my_center|LOCUS_30650 1612 2880 gene locus_tag LOCUS_30660 gene murA 1612 2880 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_30660 2905 3636 gene locus_tag LOCUS_30670 2905 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 >Feature sequence555 49 1800 gene locus_tag LOCUS_30680 49 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 2028 2177 gene locus_tag LOCUS_30690 gene rpmG 2028 2177 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_30690 2204 2464 gene locus_tag LOCUS_30700 2204 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 2514 3032 gene locus_tag LOCUS_30710 gene nusG 2514 3032 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_30710 3130 3555 gene locus_tag LOCUS_30720 gene rplK 3130 3555 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_30720 >Feature sequence556 898 401 gene locus_tag LOCUS_30730 898 401 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379064.1 protein_id gnl|my_center|LOCUS_30730 1925 900 gene locus_tag LOCUS_30740 1925 900 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288260.1 protein_id gnl|my_center|LOCUS_30740 3196 2201 gene locus_tag LOCUS_30750 3196 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 3116 3125 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence557 <1 1094 gene locus_tag LOCUS_30760 <1 1094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061104.1:homoaconitase large subunit 1107 1622 gene locus_tag LOCUS_30770 1107 1622 CDS product Isopropylmalate/citramalate isomerase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870790.1 protein_id gnl|my_center|LOCUS_30770 1654 2988 gene locus_tag LOCUS_30780 1654 2988 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047747.1 protein_id gnl|my_center|LOCUS_30780 >Feature sequence558 2208 4 gene locus_tag LOCUS_30790 2208 4 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986498.1 protein_id gnl|my_center|LOCUS_30790 >Feature sequence559 18 530 gene locus_tag LOCUS_30800 18 530 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393699.1 protein_id gnl|my_center|LOCUS_30800 710 1555 gene locus_tag LOCUS_30810 710 1555 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860817.1 protein_id gnl|my_center|LOCUS_30810 2876 1557 gene locus_tag LOCUS_30820 2876 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 3555 2869 gene locus_tag LOCUS_30830 3555 2869 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_30830 >Feature sequence560 1254 76 gene locus_tag LOCUS_30840 1254 76 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_30840 3377 1254 gene locus_tag LOCUS_30850 3377 1254 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396717.1 protein_id gnl|my_center|LOCUS_30850 3619 3380 gene locus_tag LOCUS_30860 3619 3380 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_30860 >Feature sequence561 768 2762 gene locus_tag LOCUS_30870 768 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30870 2829 3047 gene locus_tag LOCUS_30880 2829 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 >Feature sequence562 42 467 gene locus_tag LOCUS_30890 42 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 743 1624 gene locus_tag LOCUS_30900 743 1624 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676321.1 protein_id gnl|my_center|LOCUS_30900 1784 2275 gene locus_tag LOCUS_30910 1784 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 2312 2632 gene locus_tag LOCUS_30920 2312 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 2563 3540 gene locus_tag LOCUS_30930 gene rpoD 2563 3540 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_30930 >Feature sequence563 1503 580 gene locus_tag LOCUS_30940 1503 580 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_30940 3374 1680 gene locus_tag LOCUS_30950 3374 1680 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868765.1 protein_id gnl|my_center|LOCUS_30950 >Feature sequence564 1420 536 gene locus_tag LOCUS_30960 1420 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30960 2040 1420 gene locus_tag LOCUS_30970 2040 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30970 2705 2145 gene locus_tag LOCUS_30980 2705 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30980 3193 2690 gene locus_tag LOCUS_30990 3193 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 >Feature sequence565 <1 1024 gene locus_tag LOCUS_31000 <1 1024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902588.1:ABC transporter ATP-binding protein 1018 2670 gene locus_tag LOCUS_31010 1018 2670 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896074.1 protein_id gnl|my_center|LOCUS_31010 >Feature sequence566 2650 1247 gene locus_tag LOCUS_31020 2650 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 >Feature sequence567 <1 551 gene locus_tag LOCUS_31030 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000049572.1:M20 family metallopeptidase 623 3481 gene locus_tag LOCUS_31040 gene uvrA 623 3481 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401468.1 protein_id gnl|my_center|LOCUS_31040 >Feature sequence568 26 1030 gene locus_tag LOCUS_31050 gene mgrA 26 1030 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878153.1 protein_id gnl|my_center|LOCUS_31050 1059 1253 gene locus_tag LOCUS_31060 1059 1253 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728659.1 protein_id gnl|my_center|LOCUS_31060 1451 1738 gene locus_tag LOCUS_31070 gene rpsF 1451 1738 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_31070 1787 2248 gene locus_tag LOCUS_31080 1787 2248 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902513.1 protein_id gnl|my_center|LOCUS_31080 2287 2556 gene locus_tag LOCUS_31090 gene rpsR 2287 2556 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966982.1 protein_id gnl|my_center|LOCUS_31090 3397 2654 gene locus_tag LOCUS_31100 3397 2654 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966768.1 protein_id gnl|my_center|LOCUS_31100 >Feature sequence569 1129 2535 gene locus_tag LOCUS_31110 1129 2535 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071148.1 protein_id gnl|my_center|LOCUS_31110 2698 3276 gene locus_tag LOCUS_31120 2698 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 >Feature sequence570 1592 837 gene locus_tag LOCUS_31130 1592 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31130 2326 1589 gene locus_tag LOCUS_31140 2326 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31140 3376 2342 gene locus_tag LOCUS_31150 3376 2342 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_31150 >Feature sequence571 <1 661 gene locus_tag LOCUS_31160 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963818.1:YitT family protein note possible pseudo, internal stop codon 701 988 gene locus_tag LOCUS_31170 701 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31170 2318 1152 gene locus_tag LOCUS_31180 2318 1152 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080165.1 protein_id gnl|my_center|LOCUS_31180 3486 2344 gene locus_tag LOCUS_31190 3486 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938446.1 protein_id gnl|my_center|LOCUS_31190 >Feature sequence572 1866 1006 gene locus_tag LOCUS_31200 1866 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31200 3068 1893 gene locus_tag LOCUS_31210 3068 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 >Feature sequence573 94 378 gene locus_tag LOCUS_31220 94 378 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272449.1 protein_id gnl|my_center|LOCUS_31220 1505 627 gene locus_tag LOCUS_31230 1505 627 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_31230 1653 2852 gene locus_tag LOCUS_31240 1653 2852 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399531.1 protein_id gnl|my_center|LOCUS_31240 >Feature sequence574 1435 506 gene locus_tag LOCUS_31250 1435 506 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_31250 2434 1490 gene locus_tag LOCUS_31260 2434 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 3414 2449 gene locus_tag LOCUS_31270 3414 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 >Feature sequence575 <1 1792 gene locus_tag LOCUS_31280 <1 1792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003435700.1:EAL domain-containing protein 2043 2432 gene locus_tag LOCUS_31290 2043 2432 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460033.1 protein_id gnl|my_center|LOCUS_31290 >Feature sequence576 1125 475 gene locus_tag LOCUS_31300 1125 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 2138 1272 gene locus_tag LOCUS_31310 2138 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31310 2767 2138 gene locus_tag LOCUS_31320 2767 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31320 2205 2214 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3120 2788 gene locus_tag LOCUS_31330 3120 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 3516 3187 gene locus_tag LOCUS_31340 3516 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 >Feature sequence577 2842 185 gene locus_tag LOCUS_31350 2842 185 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391798.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31350 3121 2849 gene locus_tag LOCUS_31360 3121 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31360 >Feature sequence578 435 1745 gene locus_tag LOCUS_31370 435 1745 CDS product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003394.1 protein_id gnl|my_center|LOCUS_31370 1766 2944 gene locus_tag LOCUS_31380 1766 2944 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229000.1 protein_id gnl|my_center|LOCUS_31380 3376 3041 gene locus_tag LOCUS_31390 3376 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 >Feature sequence579 564 331 gene locus_tag LOCUS_31400 564 331 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460459.1 protein_id gnl|my_center|LOCUS_31400 639 1106 gene locus_tag LOCUS_31410 639 1106 CDS product iron dependent repressor, metal binding and dimerization domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815079.1 protein_id gnl|my_center|LOCUS_31410 1242 1709 gene locus_tag LOCUS_31420 1242 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 2586 1945 gene locus_tag LOCUS_31430 2586 1945 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459560.1 protein_id gnl|my_center|LOCUS_31430 3461 2583 gene locus_tag LOCUS_31440 3461 2583 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897173.1 protein_id gnl|my_center|LOCUS_31440 >Feature sequence580 245 1552 gene locus_tag LOCUS_31450 245 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 1555 2259 gene locus_tag LOCUS_31460 gene rgbR 1555 2259 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_31460 2472 3221 gene locus_tag LOCUS_31470 2472 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 >Feature sequence581 2007 748 gene locus_tag LOCUS_31480 2007 748 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243455.1 protein_id gnl|my_center|LOCUS_31480 2482 2246 gene locus_tag LOCUS_31490 2482 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 >Feature sequence582 626 967 gene locus_tag LOCUS_31500 626 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 1002 1844 gene locus_tag LOCUS_31510 1002 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 1860 2258 gene locus_tag LOCUS_31520 1860 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 2270 2527 gene locus_tag LOCUS_31530 2270 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 2699 3211 gene locus_tag LOCUS_31540 2699 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 >Feature sequence583 3257 2103 gene locus_tag LOCUS_31550 gene dprA 3257 2103 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_31550 >Feature sequence584 100 1011 gene locus_tag LOCUS_31560 100 1011 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_31560 2370 1096 gene locus_tag LOCUS_31570 2370 1096 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853233.1 protein_id gnl|my_center|LOCUS_31570 3333 2404 gene locus_tag LOCUS_31580 gene pfkB 3333 2404 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963555.1 protein_id gnl|my_center|LOCUS_31580 >Feature sequence585 1950 1294 gene locus_tag LOCUS_31590 1950 1294 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170138703.1 protein_id gnl|my_center|LOCUS_31590 3106 2033 gene locus_tag LOCUS_31600 3106 2033 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969469.1 protein_id gnl|my_center|LOCUS_31600 3291 3103 gene locus_tag LOCUS_31610 3291 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 3134 3143 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3530 3303 gene locus_tag LOCUS_31620 3530 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 >Feature sequence586 85 1356 gene locus_tag LOCUS_31630 85 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 1472 2263 gene locus_tag LOCUS_31640 1472 2263 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727665.1 protein_id gnl|my_center|LOCUS_31640 2370 2903 gene locus_tag LOCUS_31650 gene recU 2370 2903 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460152.1 protein_id gnl|my_center|LOCUS_31650 3482 2940 gene locus_tag LOCUS_31660 3482 2940 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966038.1 protein_id gnl|my_center|LOCUS_31660 >Feature sequence587 1020 253 gene locus_tag LOCUS_31670 1020 253 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870346.1 protein_id gnl|my_center|LOCUS_31670 1736 1017 gene locus_tag LOCUS_31680 1736 1017 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459529.1 protein_id gnl|my_center|LOCUS_31680 2564 1737 gene locus_tag LOCUS_31690 2564 1737 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814372.1 protein_id gnl|my_center|LOCUS_31690 3060 2548 gene locus_tag LOCUS_31700 3060 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31700 >Feature sequence588 1956 1156 gene locus_tag LOCUS_31710 1956 1156 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245153.1 protein_id gnl|my_center|LOCUS_31710 2041 2115 gene locus_tag LOCUS_t00120 2041 2115 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3303 2488 gene locus_tag LOCUS_31720 3303 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 >Feature sequence589 204 884 gene locus_tag LOCUS_31730 204 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 947 1819 gene locus_tag LOCUS_31740 947 1819 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048407.1 protein_id gnl|my_center|LOCUS_31740 1992 3011 gene locus_tag LOCUS_31750 1992 3011 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_31750 3317 3084 gene locus_tag LOCUS_31760 3317 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 >Feature sequence590 2516 1242 gene locus_tag LOCUS_31770 2516 1242 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975877.1 protein_id gnl|my_center|LOCUS_31770 <3481 2532 gene locus_tag LOCUS_31780 <3481 2532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289135.1:AraC family transcriptional regulator >Feature sequence591 <1 881 gene locus_tag LOCUS_31790 <1 881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436174.1:DNA-directed RNA polymerase subunit beta >Feature sequence592 105 1406 gene locus_tag LOCUS_31800 105 1406 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861089.1 protein_id gnl|my_center|LOCUS_31800 1436 2227 gene locus_tag LOCUS_31810 1436 2227 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860631.1 protein_id gnl|my_center|LOCUS_31810 2298 2810 gene locus_tag LOCUS_31820 2298 2810 CDS product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435938.1 protein_id gnl|my_center|LOCUS_31820 >Feature sequence593 1 996 gene locus_tag LOCUS_31830 1 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 1445 1218 gene locus_tag LOCUS_31840 1445 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 1866 2777 gene locus_tag LOCUS_31850 1866 2777 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903458.1 protein_id gnl|my_center|LOCUS_31850 3438 2890 gene locus_tag LOCUS_31860 3438 2890 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294657.1 protein_id gnl|my_center|LOCUS_31860 >Feature sequence594 1445 333 gene locus_tag LOCUS_31870 gene asd 1445 333 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699652.1 protein_id gnl|my_center|LOCUS_31870 <3456 1643 gene locus_tag LOCUS_31880 <3456 1643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963336.1:DNA gyrase subunit A >Feature sequence595 151 1314 gene locus_tag LOCUS_31890 151 1314 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383860.1 protein_id gnl|my_center|LOCUS_31890 1357 2889 gene locus_tag LOCUS_31900 1357 2889 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732280.1 protein_id gnl|my_center|LOCUS_31900 >Feature sequence596 1830 2579 gene locus_tag LOCUS_31910 1830 2579 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002683251.1 protein_id gnl|my_center|LOCUS_31910 >Feature sequence597 106 711 gene locus_tag LOCUS_31920 106 711 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966058.1 protein_id gnl|my_center|LOCUS_31920 739 1401 gene locus_tag LOCUS_31930 739 1401 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813444.1 protein_id gnl|my_center|LOCUS_31930 >Feature sequence598 125 913 gene locus_tag LOCUS_31940 125 913 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219921.1 protein_id gnl|my_center|LOCUS_31940 929 2284 gene locus_tag LOCUS_31950 929 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 >Feature sequence599 188 1336 gene locus_tag LOCUS_31960 188 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31960 1358 2689 gene locus_tag LOCUS_31970 1358 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31970 >Feature sequence600 2 313 gene locus_tag LOCUS_31980 2 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 1808 261 gene locus_tag LOCUS_31990 1808 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 <3434 1801 gene locus_tag LOCUS_32000 <3434 1801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836931.1:sensor histidine kinase >Feature sequence601 829 320 gene locus_tag LOCUS_32010 829 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 1141 1779 gene locus_tag LOCUS_32020 1141 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 2039 2569 gene locus_tag LOCUS_32030 2039 2569 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814119.1 protein_id gnl|my_center|LOCUS_32030 >Feature sequence602 1500 559 gene locus_tag LOCUS_32040 1500 559 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285679.1 protein_id gnl|my_center|LOCUS_32040 2468 1497 gene locus_tag LOCUS_32050 2468 1497 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969592.1 protein_id gnl|my_center|LOCUS_32050 <3421 2542 gene locus_tag LOCUS_32060 <3421 2542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678777.1:ABC transporter permease >Feature sequence603 1043 189 gene locus_tag LOCUS_32070 1043 189 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990759.1 protein_id gnl|my_center|LOCUS_32070 1983 1054 gene locus_tag LOCUS_32080 1983 1054 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031749.1 protein_id gnl|my_center|LOCUS_32080 3381 2014 gene locus_tag LOCUS_32090 gene gsiB 3381 2014 CDS product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813717.1 protein_id gnl|my_center|LOCUS_32090 >Feature sequence604 17 1033 gene locus_tag LOCUS_32100 17 1033 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097688.1 protein_id gnl|my_center|LOCUS_32100 1059 1985 gene locus_tag LOCUS_32110 1059 1985 CDS product FMN-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254509.1 protein_id gnl|my_center|LOCUS_32110 3379 1982 gene locus_tag LOCUS_32120 3379 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 >Feature sequence605 <1 1084 gene locus_tag LOCUS_32130 <1 1084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002225706.1:putative hydroxymethylpyrimidine transporter CytX 1261 2010 gene locus_tag LOCUS_32140 1261 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 >Feature sequence606 <1 1481 gene locus_tag LOCUS_32150 <1 1481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000193235.1:ABC transporter ATP-binding protein 1462 2526 gene locus_tag LOCUS_32160 1462 2526 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969639.1 protein_id gnl|my_center|LOCUS_32160 >Feature sequence607 <3389 2581 gene locus_tag LOCUS_32170 <3389 2581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005901990.1:acetyl-CoA hydrolase/transferase family protein >Feature sequence608 61 1041 gene locus_tag LOCUS_32180 61 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 1731 1153 gene locus_tag LOCUS_32190 1731 1153 CDS product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116197.1 protein_id gnl|my_center|LOCUS_32190 2766 1798 gene locus_tag LOCUS_32200 2766 1798 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948689.1 protein_id gnl|my_center|LOCUS_32200 <3374 2759 gene locus_tag LOCUS_32210 <3374 2759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965836.1:electron transfer flavoprotein subunit beta/FixA family protein >Feature sequence609 360 2084 gene locus_tag LOCUS_32220 360 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 2225 3007 gene locus_tag LOCUS_32230 2225 3007 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287979.1 protein_id gnl|my_center|LOCUS_32230 >Feature sequence610 <1 663 gene locus_tag LOCUS_32240 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975365.1:Crp/Fnr family transcriptional regulator 2009 882 gene locus_tag LOCUS_32250 2009 882 CDS product metallo-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977198.1 protein_id gnl|my_center|LOCUS_32250 3368 2055 gene locus_tag LOCUS_32260 3368 2055 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022819390.1 protein_id gnl|my_center|LOCUS_32260 >Feature sequence611 1072 47 gene locus_tag LOCUS_32270 1072 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 1148 1187 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1651 2511 gene locus_tag LOCUS_32280 1651 2511 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_32280 <3368 2582 gene locus_tag LOCUS_32290 <3368 2582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250640.1:S8 family serine peptidase >Feature sequence612 69 584 gene locus_tag LOCUS_32300 69 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 1626 697 gene locus_tag LOCUS_32310 gene arcC 1626 697 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367131.1 protein_id gnl|my_center|LOCUS_32310 1785 2237 gene locus_tag LOCUS_32320 1785 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 2291 3310 gene locus_tag LOCUS_32330 2291 3310 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_32330 >Feature sequence613 1218 1931 gene locus_tag LOCUS_32340 1218 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 2090 3217 gene locus_tag LOCUS_32350 2090 3217 CDS product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898638.1 protein_id gnl|my_center|LOCUS_32350 >Feature sequence614 >Feature sequence615 <1 1021 gene locus_tag LOCUS_32360 <1 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528957.1:ABC transporter permease 1018 1974 gene locus_tag LOCUS_32370 1018 1974 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536145.1 protein_id gnl|my_center|LOCUS_32370 1999 2586 gene locus_tag LOCUS_32380 1999 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453592.1 protein_id gnl|my_center|LOCUS_32380 2589 2783 gene locus_tag LOCUS_32390 2589 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 >Feature sequence616 1915 296 gene locus_tag LOCUS_32400 1915 296 CDS product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462074.1 protein_id gnl|my_center|LOCUS_32400 <3348 1943 gene locus_tag LOCUS_32410 <3348 1943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462074.1:4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein >Feature sequence617 92 928 gene locus_tag LOCUS_32420 92 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 2152 1205 gene locus_tag LOCUS_32430 2152 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 3218 2169 gene locus_tag LOCUS_32440 3218 2169 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546223.1 protein_id gnl|my_center|LOCUS_32440 >Feature sequence618 <1 1801 gene locus_tag LOCUS_32450 <1 1801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011475494.1:sucrose-specific PTS transporter subunit IIBC 1785 3236 gene locus_tag LOCUS_32460 1785 3236 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141432.1 protein_id gnl|my_center|LOCUS_32460 >Feature sequence619 <1 571 gene locus_tag LOCUS_32470 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437044.1:GntR family transcriptional regulator 672 1391 gene locus_tag LOCUS_32480 672 1391 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966768.1 protein_id gnl|my_center|LOCUS_32480 1576 1995 gene locus_tag LOCUS_32490 1576 1995 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002312636.1 protein_id gnl|my_center|LOCUS_32490 2007 2480 gene locus_tag LOCUS_32500 2007 2480 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287114.1 protein_id gnl|my_center|LOCUS_32500 2491 3261 gene locus_tag LOCUS_32510 2491 3261 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287115.1 protein_id gnl|my_center|LOCUS_32510 >Feature sequence620 2534 1251 gene locus_tag LOCUS_32520 2534 1251 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947929.1 protein_id gnl|my_center|LOCUS_32520 <3304 2773 gene locus_tag LOCUS_32530 <3304 2773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458938.1:stage V sporulation protein T >Feature sequence621 801 592 gene locus_tag LOCUS_32540 801 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 1279 767 gene locus_tag LOCUS_32550 1279 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 2043 1342 gene locus_tag LOCUS_32560 2043 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 2633 2067 gene locus_tag LOCUS_32570 2633 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 >Feature sequence622 204 722 gene locus_tag LOCUS_32580 204 722 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966054.1 protein_id gnl|my_center|LOCUS_32580 754 1605 gene locus_tag LOCUS_32590 754 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 2191 1520 gene locus_tag LOCUS_32600 2191 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 2364 3092 gene locus_tag LOCUS_32610 2364 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 >Feature sequence623 1164 220 gene locus_tag LOCUS_32620 1164 220 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963416.1 protein_id gnl|my_center|LOCUS_32620 2694 1363 gene locus_tag LOCUS_32630 2694 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 >Feature sequence624 1083 73 gene locus_tag LOCUS_32640 1083 73 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_32640 1803 1111 gene locus_tag LOCUS_32650 1803 1111 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_32650 3201 1921 gene locus_tag LOCUS_32660 3201 1921 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861729.1 protein_id gnl|my_center|LOCUS_32660 >Feature sequence625 <1 1037 gene locus_tag LOCUS_32670 <1 1037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095329.1:Gfo/Idh/MocA family oxidoreductase 1040 2131 gene locus_tag LOCUS_32680 1040 2131 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 protein_id gnl|my_center|LOCUS_32680 2288 3220 gene locus_tag LOCUS_32690 2288 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 >Feature sequence626 56 586 gene locus_tag LOCUS_32700 gene raiA 56 586 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_32700 2350 857 gene locus_tag LOCUS_32710 2350 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 <3280 2366 gene locus_tag LOCUS_32720 <3280 2366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001288072.1:thioredoxin-disulfide reductase >Feature sequence627 1090 491 gene locus_tag LOCUS_32730 1090 491 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948614.1 protein_id gnl|my_center|LOCUS_32730 1789 1352 gene locus_tag LOCUS_32740 1789 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32740 2485 1835 gene locus_tag LOCUS_32750 2485 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32750 2919 2482 gene locus_tag LOCUS_32760 2919 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 2981 2990 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence628 <1 682 gene locus_tag LOCUS_32770 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064243013.1:haloacid dehalogenase type II 814 1731 gene locus_tag LOCUS_32780 814 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 1603 1612 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1685 2296 gene locus_tag LOCUS_32790 1685 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 2372 3214 gene locus_tag LOCUS_32800 2372 3214 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289273.1 protein_id gnl|my_center|LOCUS_32800 >Feature sequence629 2140 44 gene locus_tag LOCUS_32810 2140 44 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439994.1 protein_id gnl|my_center|LOCUS_32810 >Feature sequence630 372 1415 gene locus_tag LOCUS_32820 372 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 1453 2442 gene locus_tag LOCUS_32830 1453 2442 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906070.1 protein_id gnl|my_center|LOCUS_32830 >Feature sequence631 1525 278 gene locus_tag LOCUS_32840 1525 278 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732668.1 protein_id gnl|my_center|LOCUS_32840 2456 1518 gene locus_tag LOCUS_32850 gene rihC 2456 1518 CDS product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052500.1 protein_id gnl|my_center|LOCUS_32850 3057 2431 gene locus_tag LOCUS_32860 3057 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 >Feature sequence632 1361 414 gene locus_tag LOCUS_32870 1361 414 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715345.1 protein_id gnl|my_center|LOCUS_32870 2596 1535 gene locus_tag LOCUS_32880 2596 1535 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386380.1 protein_id gnl|my_center|LOCUS_32880 3168 2689 gene locus_tag LOCUS_32890 3168 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 >Feature sequence633 331 588 gene locus_tag LOCUS_32900 331 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 <3264 685 gene locus_tag LOCUS_32910 <3264 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861762.1:bifunctional acetaldehyde-CoA/alcohol dehydrogenase >Feature sequence634 2464 1367 gene locus_tag LOCUS_32920 2464 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 2874 2449 gene locus_tag LOCUS_32930 2874 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 >Feature sequence635 <1 1609 gene locus_tag LOCUS_32940 <1 1609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000950158.1:glycogen/starch/alpha-glucan family phosphorylase 1768 3198 gene locus_tag LOCUS_32950 1768 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 >Feature sequence636 1681 431 gene locus_tag LOCUS_32960 1681 431 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888596.1 protein_id gnl|my_center|LOCUS_32960 2739 1693 gene locus_tag LOCUS_32970 2739 1693 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194770.1 protein_id gnl|my_center|LOCUS_32970 >Feature sequence637 79 864 gene locus_tag LOCUS_32980 gene fabG 79 864 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_32980 966 2018 gene locus_tag LOCUS_32990 966 2018 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454628.1 protein_id gnl|my_center|LOCUS_32990 >Feature sequence638 2131 62 gene locus_tag LOCUS_33000 2131 62 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860818.1 protein_id gnl|my_center|LOCUS_33000 2288 2473 gene locus_tag LOCUS_33010 2288 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 2682 2533 gene locus_tag LOCUS_33020 2682 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 >Feature sequence639 971 411 gene locus_tag LOCUS_33030 971 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 2191 1019 gene locus_tag LOCUS_33040 2191 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 <3238 2216 gene locus_tag LOCUS_33050 <3238 2216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000975831.1:mandelate racemase/muconate lactonizing enzyme family protein >Feature sequence640 1025 324 gene locus_tag LOCUS_33060 1025 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 3186 1066 gene locus_tag LOCUS_33070 gene pnp 3186 1066 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_33070 >Feature sequence641 1555 2865 gene locus_tag LOCUS_33080 1555 2865 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986630.1 protein_id gnl|my_center|LOCUS_33080 >Feature sequence642 715 1017 gene locus_tag LOCUS_33090 715 1017 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_33090 >Feature sequence643 <1 810 gene locus_tag LOCUS_33100 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815889.1:alpha/beta hydrolase 1599 892 gene locus_tag LOCUS_33110 1599 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 1723 2445 gene locus_tag LOCUS_33120 gene deoD 1723 2445 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020631.1 protein_id gnl|my_center|LOCUS_33120 >Feature sequence644 1455 70 gene locus_tag LOCUS_33130 gene rpoN 1455 70 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462176.1 protein_id gnl|my_center|LOCUS_33130 1739 2035 gene locus_tag LOCUS_33140 1739 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33140 2084 3157 gene locus_tag LOCUS_33150 2084 3157 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33150 >Feature sequence645 1363 815 gene locus_tag LOCUS_33160 1363 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 2594 1344 gene locus_tag LOCUS_33170 2594 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 3114 2776 gene locus_tag LOCUS_33180 3114 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 >Feature sequence646 <1 573 gene locus_tag LOCUS_33190 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226614.1:acetamidase/formamidase family protein note possible pseudo, frameshifted 561 570 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 620 760 gene locus_tag LOCUS_33200 620 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 806 1582 gene locus_tag LOCUS_33210 806 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 2026 1601 gene locus_tag LOCUS_33220 2026 1601 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816830.1 protein_id gnl|my_center|LOCUS_33220 3155 2019 gene locus_tag LOCUS_33230 3155 2019 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732668.1 protein_id gnl|my_center|LOCUS_33230 >Feature sequence647 <1 1239 gene locus_tag LOCUS_33240 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531926.1:sugar ABC transporter substrate-binding protein 1314 2261 gene locus_tag LOCUS_33250 1314 2261 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531925.1 protein_id gnl|my_center|LOCUS_33250 2276 3130 gene locus_tag LOCUS_33260 2276 3130 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531924.1 protein_id gnl|my_center|LOCUS_33260 >Feature sequence648 363 818 gene locus_tag LOCUS_33270 363 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 895 1764 gene locus_tag LOCUS_33280 gene pdaA 895 1764 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438596.1 protein_id gnl|my_center|LOCUS_33280 2157 1801 gene locus_tag LOCUS_33290 2157 1801 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459556.1 protein_id gnl|my_center|LOCUS_33290 3115 2195 gene locus_tag LOCUS_33300 3115 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 >Feature sequence649 112 807 gene locus_tag LOCUS_33310 112 807 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973341.1 protein_id gnl|my_center|LOCUS_33310 1531 1007 gene locus_tag LOCUS_33320 1531 1007 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949081.1 protein_id gnl|my_center|LOCUS_33320 1871 1737 gene locus_tag LOCUS_33330 1871 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 2657 2091 gene locus_tag LOCUS_33340 2657 2091 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458874.1 protein_id gnl|my_center|LOCUS_33340 <3192 2679 gene locus_tag LOCUS_33350 <3192 2679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963959.1:metallophosphoesterase >Feature sequence650 27 1529 gene locus_tag LOCUS_33360 27 1529 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895854.1 protein_id gnl|my_center|LOCUS_33360 2042 1530 gene locus_tag LOCUS_33370 2042 1530 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809539.1 protein_id gnl|my_center|LOCUS_33370 2739 3164 gene locus_tag LOCUS_33380 2739 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 >Feature sequence651 >Feature sequence652 100 1698 gene locus_tag LOCUS_33390 100 1698 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_33390 1893 2081 gene locus_tag LOCUS_33400 1893 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 3016 2273 gene locus_tag LOCUS_33410 3016 2273 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459577.1 protein_id gnl|my_center|LOCUS_33410 >Feature sequence653 998 81 gene locus_tag LOCUS_33420 998 81 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583516.1 protein_id gnl|my_center|LOCUS_33420 1441 995 gene locus_tag LOCUS_33430 1441 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33430 2042 1398 gene locus_tag LOCUS_33440 2042 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33440 1413 1422 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <3173 2039 gene locus_tag LOCUS_33450 <3173 2039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383861.1:ABC transporter ATP-binding protein >Feature sequence654 1993 221 gene locus_tag LOCUS_33460 1993 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 >Feature sequence655 263 757 gene locus_tag LOCUS_33470 263 757 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_33470 763 3015 gene locus_tag LOCUS_33480 763 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 >Feature sequence656 992 267 gene locus_tag LOCUS_33490 992 267 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583764.1 protein_id gnl|my_center|LOCUS_33490 2327 1506 gene locus_tag LOCUS_33500 2327 1506 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_33500 3063 2344 gene locus_tag LOCUS_33510 3063 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33510 >Feature sequence657 513 1718 gene locus_tag LOCUS_33520 gene coaBC 513 1718 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_33520 >Feature sequence658 331 1752 gene locus_tag LOCUS_33530 331 1752 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392657.1 protein_id gnl|my_center|LOCUS_33530 2659 1868 gene locus_tag LOCUS_33540 2659 1868 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764352.1 protein_id gnl|my_center|LOCUS_33540 >Feature sequence659 198 1211 gene locus_tag LOCUS_33550 gene ansA 198 1211 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 protein_id gnl|my_center|LOCUS_33550 2126 1257 gene locus_tag LOCUS_33560 2126 1257 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948436.1 protein_id gnl|my_center|LOCUS_33560 3087 2143 gene locus_tag LOCUS_33570 3087 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 >Feature sequence660 1175 69 gene locus_tag LOCUS_33580 1175 69 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966934.1 protein_id gnl|my_center|LOCUS_33580 2313 2954 gene locus_tag LOCUS_33590 2313 2954 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548076.1 protein_id gnl|my_center|LOCUS_33590 >Feature sequence661 <1 1037 gene locus_tag LOCUS_33600 <1 1037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392001.1:adenine deaminase 1058 1711 gene locus_tag LOCUS_33610 1058 1711 CDS product DUF6198 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640660.1 protein_id gnl|my_center|LOCUS_33610 2210 2551 gene locus_tag LOCUS_33620 2210 2551 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812158.1 protein_id gnl|my_center|LOCUS_33620 >Feature sequence662 1376 168 gene locus_tag LOCUS_33630 1376 168 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272213.1 protein_id gnl|my_center|LOCUS_33630 2065 1391 gene locus_tag LOCUS_33640 2065 1391 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272034.1 protein_id gnl|my_center|LOCUS_33640 2689 2180 gene locus_tag LOCUS_33650 2689 2180 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889129.1 protein_id gnl|my_center|LOCUS_33650 3118 2846 gene locus_tag LOCUS_33660 3118 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 >Feature sequence663 80 1783 gene locus_tag LOCUS_33670 gene ilvD 80 1783 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023301.1 protein_id gnl|my_center|LOCUS_33670 >Feature sequence664 1027 374 gene locus_tag LOCUS_33680 1027 374 CDS product DUF3298 and DUF4163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810326.1 protein_id gnl|my_center|LOCUS_33680 1463 2239 gene locus_tag LOCUS_33690 gene sigG 1463 2239 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_33690 >Feature sequence665 2442 1831 gene locus_tag LOCUS_33700 2442 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 >Feature sequence666 <1 560 gene locus_tag LOCUS_33710 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067686.1:aldo/keto reductase 634 1182 gene locus_tag LOCUS_33720 634 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 1183 1479 gene locus_tag LOCUS_33730 1183 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 1492 2175 gene locus_tag LOCUS_33740 1492 2175 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787603.1 protein_id gnl|my_center|LOCUS_33740 <3104 2216 gene locus_tag LOCUS_33750 <3104 2216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480207.1:patatin-like phospholipase family protein >Feature sequence667 77 1171 gene locus_tag LOCUS_33760 77 1171 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262368.1 protein_id gnl|my_center|LOCUS_33760 1049 1058 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2180 1266 gene locus_tag LOCUS_33770 2180 1266 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966220.1 protein_id gnl|my_center|LOCUS_33770 2894 2205 gene locus_tag LOCUS_33780 2894 2205 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862963.1 protein_id gnl|my_center|LOCUS_33780 >Feature sequence668 2933 507 gene locus_tag LOCUS_33790 gene xdhA 2933 507 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393458.1 protein_id gnl|my_center|LOCUS_33790 >Feature sequence669 1262 324 gene locus_tag LOCUS_33800 1262 324 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161951947.1 protein_id gnl|my_center|LOCUS_33800 2784 1369 gene locus_tag LOCUS_33810 gene nhaC 2784 1369 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017141.1 protein_id gnl|my_center|LOCUS_33810 >Feature sequence670 210 1169 gene locus_tag LOCUS_33820 210 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 1159 2121 gene locus_tag LOCUS_33830 1159 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 <3093 2081 gene locus_tag LOCUS_33840 <3093 2081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272578.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence671 832 2145 gene locus_tag LOCUS_33850 832 2145 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679363.1 protein_id gnl|my_center|LOCUS_33850 >Feature sequence672 69 2054 gene locus_tag LOCUS_33860 gene treP 69 2054 CDS product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297133.1 protein_id gnl|my_center|LOCUS_33860 >Feature sequence673 <1 919 gene locus_tag LOCUS_33870 <1 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986890.1:AEC family transporter 2993 888 gene locus_tag LOCUS_33880 2993 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 >Feature sequence674 569 171 gene locus_tag LOCUS_33890 569 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 1307 723 gene locus_tag LOCUS_33900 1307 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 2321 1602 gene locus_tag LOCUS_33910 2321 1602 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_33910 2725 2318 gene locus_tag LOCUS_33920 2725 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 >Feature sequence675 2849 2872 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence676 1678 68 gene locus_tag LOCUS_33930 1678 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 2682 1810 gene locus_tag LOCUS_33940 2682 1810 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362794.1 protein_id gnl|my_center|LOCUS_33940 >Feature sequence677 <1 1531 gene locus_tag LOCUS_33950 <1 1531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015848.1:ATP-binding cassette domain-containing protein 249 258 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence678 274 966 gene locus_tag LOCUS_33960 274 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 1016 2695 gene locus_tag LOCUS_33970 1016 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 >Feature sequence679 32 625 gene locus_tag LOCUS_33980 32 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 732 2111 gene locus_tag LOCUS_33990 gene mnmE 732 2111 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898860.1 protein_id gnl|my_center|LOCUS_33990 >Feature sequence680 208 1041 gene locus_tag LOCUS_34000 208 1041 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461127.1 protein_id gnl|my_center|LOCUS_34000 1019 1028 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1094 1681 gene locus_tag LOCUS_34010 1094 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 1678 2928 gene locus_tag LOCUS_34020 1678 2928 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266421.1 protein_id gnl|my_center|LOCUS_34020 >Feature sequence681 1 471 gene locus_tag LOCUS_34030 1 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34030 541 891 gene locus_tag LOCUS_34040 541 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 925 2046 gene locus_tag LOCUS_34050 gene phnW 925 2046 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002326249.1 protein_id gnl|my_center|LOCUS_34050 2048 2815 gene locus_tag LOCUS_34060 gene phnX 2048 2815 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687375.1 protein_id gnl|my_center|LOCUS_34060 >Feature sequence682 882 109 gene locus_tag LOCUS_34070 882 109 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896899.1 protein_id gnl|my_center|LOCUS_34070 2350 1247 gene locus_tag LOCUS_34080 2350 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 >Feature sequence683 2980 1343 gene locus_tag LOCUS_34090 2980 1343 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_34090 >Feature sequence684 <1 935 gene locus_tag LOCUS_34100 <1 935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948739.1:NAD(P)/FAD-dependent oxidoreductase 935 1936 gene locus_tag LOCUS_34110 935 1936 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948740.1 protein_id gnl|my_center|LOCUS_34110 2071 2361 gene locus_tag LOCUS_34120 2071 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 <3038 2495 gene locus_tag LOCUS_34130 <3038 2495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005463707.1:substrate-binding domain-containing protein >Feature sequence685 1950 520 gene locus_tag LOCUS_34140 gene gndA 1950 520 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 protein_id gnl|my_center|LOCUS_34140 2974 1985 gene locus_tag LOCUS_34150 2974 1985 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357153.1 protein_id gnl|my_center|LOCUS_34150 >Feature sequence686 1021 1030 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1142 3019 gene locus_tag LOCUS_34160 1142 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 >Feature sequence687 <1 1048 gene locus_tag LOCUS_34170 <1 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902589.1:ABC transporter substrate-binding protein 1050 2777 gene locus_tag LOCUS_34180 1050 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 >Feature sequence688 1734 523 gene locus_tag LOCUS_34190 1734 523 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970568.1 protein_id gnl|my_center|LOCUS_34190 2849 1800 gene locus_tag LOCUS_34200 2849 1800 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498680.1 protein_id gnl|my_center|LOCUS_34200 >Feature sequence689 1981 1328 gene locus_tag LOCUS_34210 gene grpE 1981 1328 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964593.1 protein_id gnl|my_center|LOCUS_34210 <3025 1988 gene locus_tag LOCUS_34220 <3025 1988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357960.1:heat-inducible transcriptional repressor HrcA >Feature sequence690 1507 524 gene locus_tag LOCUS_34230 1507 524 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582922.1 protein_id gnl|my_center|LOCUS_34230 2445 1783 gene locus_tag LOCUS_34240 2445 1783 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191776298.1 protein_id gnl|my_center|LOCUS_34240 2998 2474 gene locus_tag LOCUS_34250 2998 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 >Feature sequence691 777 1100 gene locus_tag LOCUS_34260 777 1100 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_34260 1541 1146 gene locus_tag LOCUS_34270 1541 1146 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891857.1 protein_id gnl|my_center|LOCUS_34270 <3020 1589 gene locus_tag LOCUS_34280 <3020 1589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454514.1:GGDEF domain-containing phosphodiesterase >Feature sequence692 1651 911 gene locus_tag LOCUS_34290 gene sigE 1651 911 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774280.1 protein_id gnl|my_center|LOCUS_34290 2534 1689 gene locus_tag LOCUS_34300 2534 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 >Feature sequence693 <1 670 gene locus_tag LOCUS_34310 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000026610.1:PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC 654 1469 gene locus_tag LOCUS_34320 654 1469 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148019.1 protein_id gnl|my_center|LOCUS_34320 >Feature sequence694 231 746 gene locus_tag LOCUS_34330 231 746 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681932.1 protein_id gnl|my_center|LOCUS_34330 1070 867 gene locus_tag LOCUS_34340 1070 867 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_34340 1334 1621 gene locus_tag LOCUS_34350 1334 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 1639 1788 gene locus_tag LOCUS_34360 1639 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 >Feature sequence695 269 940 gene locus_tag LOCUS_34370 269 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 952 1275 gene locus_tag LOCUS_34380 952 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 1295 2701 gene locus_tag LOCUS_34390 1295 2701 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869440.1 protein_id gnl|my_center|LOCUS_34390 >Feature sequence696 259 268 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 271 807 gene locus_tag LOCUS_34400 271 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 824 2041 gene locus_tag LOCUS_34410 824 2041 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459641.1 protein_id gnl|my_center|LOCUS_34410 2185 2928 gene locus_tag LOCUS_34420 2185 2928 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461356.1 protein_id gnl|my_center|LOCUS_34420 >Feature sequence697 237 809 gene locus_tag LOCUS_34430 237 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34430 764 964 gene locus_tag LOCUS_34440 764 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 961 2295 gene locus_tag LOCUS_34450 961 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 <3005 2281 gene locus_tag LOCUS_34460 <3005 2281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009892161.1:RluA family pseudouridine synthase >Feature sequence698 255 1808 gene locus_tag LOCUS_34470 255 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34470 1805 2413 gene locus_tag LOCUS_34480 1805 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 2410 2940 gene locus_tag LOCUS_34490 gene dmsB 2410 2940 CDS product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421848.1 protein_id gnl|my_center|LOCUS_34490 >Feature sequence699 <1 831 gene locus_tag LOCUS_34500 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582804.1:sugar ABC transporter ATP-binding protein 832 1797 gene locus_tag LOCUS_34510 832 1797 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573417.1 protein_id gnl|my_center|LOCUS_34510 1831 2883 gene locus_tag LOCUS_34520 1831 2883 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392191.1 protein_id gnl|my_center|LOCUS_34520 >Feature sequence700 1448 1290 gene locus_tag LOCUS_34530 1448 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 >Feature sequence701 <1 1088 gene locus_tag LOCUS_34540 <1 1088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003723080.1:carbamoyl phosphate synthase small subunit >Feature sequence702 <1 726 gene locus_tag LOCUS_34550 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964930.1:pyridoxamine kinase 895 1983 gene locus_tag LOCUS_34560 895 1983 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390206.1 protein_id gnl|my_center|LOCUS_34560 2032 2517 gene locus_tag LOCUS_34570 2032 2517 CDS product DUF4624 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439554.1 protein_id gnl|my_center|LOCUS_34570 2840 2607 gene locus_tag LOCUS_34580 2840 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 >Feature sequence703 505 236 gene locus_tag LOCUS_34590 505 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 <2983 809 gene locus_tag LOCUS_34600 <2983 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246684.1:DNA topoisomerase III >Feature sequence704 <1 1362 gene locus_tag LOCUS_34610 <1 1362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080375.1:TrkH family potassium uptake protein 1394 2815 gene locus_tag LOCUS_34620 1394 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 >Feature sequence705 390 1172 gene locus_tag LOCUS_34630 390 1172 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_34630 >Feature sequence706 818 2188 gene locus_tag LOCUS_34640 818 2188 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681959.1 protein_id gnl|my_center|LOCUS_34640 2288 2668 gene locus_tag LOCUS_34650 2288 2668 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723032.1 protein_id gnl|my_center|LOCUS_34650 2665 2889 gene locus_tag LOCUS_34660 2665 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 >Feature sequence707 65 385 gene locus_tag LOCUS_34670 65 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 2176 416 gene locus_tag LOCUS_34680 gene ade 2176 416 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948084.1 protein_id gnl|my_center|LOCUS_34680 <2974 2217 gene locus_tag LOCUS_34690 <2974 2217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392746.1:NCS2 family permease >Feature sequence708 668 2764 gene locus_tag LOCUS_34700 gene fusA 668 2764 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_34700 >Feature sequence709 497 1678 gene locus_tag LOCUS_34710 497 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 >Feature sequence710 749 24 gene locus_tag LOCUS_34720 749 24 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964914.1 protein_id gnl|my_center|LOCUS_34720 2169 766 gene locus_tag LOCUS_34730 2169 766 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891654.1 protein_id gnl|my_center|LOCUS_34730 2613 2176 gene locus_tag LOCUS_34740 2613 2176 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815091.1 protein_id gnl|my_center|LOCUS_34740 >Feature sequence711 65 1132 gene locus_tag LOCUS_34750 gene uxuA 65 1132 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391968.1 protein_id gnl|my_center|LOCUS_34750 1167 1844 gene locus_tag LOCUS_34760 1167 1844 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673955.1 protein_id gnl|my_center|LOCUS_34760 2824 2075 gene locus_tag LOCUS_34770 2824 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 >Feature sequence712 1260 679 gene locus_tag LOCUS_34780 1260 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 <2966 1379 gene locus_tag LOCUS_34790 <2966 1379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_117776984.1:FAD binding domain-containing protein >Feature sequence713 78 1100 gene locus_tag LOCUS_34800 gene purR 78 1100 CDS product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201014.1 protein_id gnl|my_center|LOCUS_34800 2194 1121 gene locus_tag LOCUS_34810 2194 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 <2961 2303 gene locus_tag LOCUS_34820 <2961 2303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002938037.1:FadR/GntR family transcriptional regulator >Feature sequence714 <1 959 gene locus_tag LOCUS_34830 <1 959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964815.1:HAMP domain-containing sensor histidine kinase 961 1788 gene locus_tag LOCUS_34840 961 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 >Feature sequence715 <1 686 gene locus_tag LOCUS_34850 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727392.1:polysaccharide deacetylase 687 1529 gene locus_tag LOCUS_34860 687 1529 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061891.1 protein_id gnl|my_center|LOCUS_34860 >Feature sequence716 34 1365 gene locus_tag LOCUS_34870 34 1365 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243860.1 protein_id gnl|my_center|LOCUS_34870 1435 2304 gene locus_tag LOCUS_34880 1435 2304 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311867.1 protein_id gnl|my_center|LOCUS_34880 >Feature sequence717 51 218 gene locus_tag LOCUS_34890 51 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 273 998 gene locus_tag LOCUS_34900 273 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 2131 2469 gene locus_tag LOCUS_34910 2131 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 >Feature sequence718 163 717 gene locus_tag LOCUS_34920 163 717 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_34920 1684 1175 gene locus_tag LOCUS_34930 1684 1175 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584342.1 protein_id gnl|my_center|LOCUS_34930 >Feature sequence719 1167 52 gene locus_tag LOCUS_34940 1167 52 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_34940 2646 1234 gene locus_tag LOCUS_34950 2646 1234 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898767.1 protein_id gnl|my_center|LOCUS_34950 >Feature sequence720 2147 159 gene locus_tag LOCUS_34960 2147 159 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459160.1 protein_id gnl|my_center|LOCUS_34960 2905 2144 gene locus_tag LOCUS_34970 2905 2144 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173372.1 protein_id gnl|my_center|LOCUS_34970 >Feature sequence721 <1 1151 gene locus_tag LOCUS_34980 <1 1151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243833.1:two-component system sensor histidine kinase YesM 1126 2658 gene locus_tag LOCUS_34990 1126 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 >Feature sequence722 1499 468 gene locus_tag LOCUS_35000 1499 468 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 protein_id gnl|my_center|LOCUS_35000 2872 1697 gene locus_tag LOCUS_35010 gene gguB 2872 1697 CDS product sugar ABC transporter permease GguB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311699.1 protein_id gnl|my_center|LOCUS_35010 >Feature sequence723 76 1254 gene locus_tag LOCUS_35020 76 1254 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208500.1 protein_id gnl|my_center|LOCUS_35020 1285 2463 gene locus_tag LOCUS_35030 1285 2463 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966253.1 protein_id gnl|my_center|LOCUS_35030 >Feature sequence724 374 2479 gene locus_tag LOCUS_35040 374 2479 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861529.1 protein_id gnl|my_center|LOCUS_35040 >Feature sequence725 1563 544 gene locus_tag LOCUS_35050 1563 544 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682144.1 protein_id gnl|my_center|LOCUS_35050 1774 1580 gene locus_tag LOCUS_35060 1774 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35060 <2915 1794 gene locus_tag LOCUS_35070 <2915 1794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000432606.1:sugar ABC transporter ATP-binding protein note possible pseudo, frameshifted 1802 1811 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence726 994 140 gene locus_tag LOCUS_35080 994 140 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086169.1 protein_id gnl|my_center|LOCUS_35080 2503 1073 gene locus_tag LOCUS_35090 2503 1073 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086171.1 protein_id gnl|my_center|LOCUS_35090 2808 2563 gene locus_tag LOCUS_35100 2808 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 >Feature sequence727 711 1385 gene locus_tag LOCUS_35110 711 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 1451 2056 gene locus_tag LOCUS_35120 gene hisH 1451 2056 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_35120 2066 2827 gene locus_tag LOCUS_35130 gene hisF 2066 2827 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949116.1 protein_id gnl|my_center|LOCUS_35130 >Feature sequence728 1050 10 gene locus_tag LOCUS_35140 1050 10 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890975.1 protein_id gnl|my_center|LOCUS_35140 <2909 1856 gene locus_tag LOCUS_35150 <2909 1856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080960.1:nucleoside kinase >Feature sequence729 729 277 gene locus_tag LOCUS_35160 729 277 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948939.1 protein_id gnl|my_center|LOCUS_35160 2624 741 gene locus_tag LOCUS_35170 gene cooS 2624 741 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948938.1 protein_id gnl|my_center|LOCUS_35170 >Feature sequence730 333 1235 gene locus_tag LOCUS_35180 333 1235 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039165.1 protein_id gnl|my_center|LOCUS_35180 1250 2290 gene locus_tag LOCUS_35190 1250 2290 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_35190 >Feature sequence731 1293 253 gene locus_tag LOCUS_35200 1293 253 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902589.1 protein_id gnl|my_center|LOCUS_35200 2437 1352 gene locus_tag LOCUS_35210 2437 1352 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_35210 >Feature sequence732 470 988 gene locus_tag LOCUS_35220 470 988 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099527.1 protein_id gnl|my_center|LOCUS_35220 2178 1174 gene locus_tag LOCUS_35230 2178 1174 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412453.1 protein_id gnl|my_center|LOCUS_35230 >Feature sequence733 40 1902 gene locus_tag LOCUS_35240 40 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 2874 1990 gene locus_tag LOCUS_35250 2874 1990 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966633.1 protein_id gnl|my_center|LOCUS_35250 >Feature sequence734 1980 817 gene locus_tag LOCUS_35260 1980 817 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423769.1 protein_id gnl|my_center|LOCUS_35260 2558 2001 gene locus_tag LOCUS_35270 gene yfcE 2558 2001 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_35270 >Feature sequence735 1135 146 gene locus_tag LOCUS_35280 1135 146 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_35280 1981 1517 gene locus_tag LOCUS_35290 1981 1517 CDS product DUF3788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888119.1 protein_id gnl|my_center|LOCUS_35290 2874 2014 gene locus_tag LOCUS_35300 2874 2014 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398871.1 protein_id gnl|my_center|LOCUS_35300 >Feature sequence736 304 678 gene locus_tag LOCUS_35310 304 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 694 1083 gene locus_tag LOCUS_35320 694 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35320 1165 1605 gene locus_tag LOCUS_35330 1165 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 >Feature sequence737 122 604 gene locus_tag LOCUS_35340 122 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 737 1192 gene locus_tag LOCUS_35350 gene mscL 737 1192 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147388001.1 protein_id gnl|my_center|LOCUS_35350 <2866 1373 gene locus_tag LOCUS_35360 <2866 1373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009898714.1:transcription termination factor Rho >Feature sequence738 167 2347 gene locus_tag LOCUS_35370 167 2347 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861481.1 protein_id gnl|my_center|LOCUS_35370 2325 2852 gene locus_tag LOCUS_35380 2325 2852 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861480.1 protein_id gnl|my_center|LOCUS_35380 >Feature sequence739 <1 1017 gene locus_tag LOCUS_35390 <1 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003432442.1:3-methyl-2-oxobutanoate dehydrogenase subunit VorB 1022 1771 gene locus_tag LOCUS_35400 1022 1771 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546413.1 protein_id gnl|my_center|LOCUS_35400 1768 2331 gene locus_tag LOCUS_35410 1768 2331 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869337.1 protein_id gnl|my_center|LOCUS_35410 >Feature sequence740 <1 966 gene locus_tag LOCUS_35420 <1 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004550718.1:potassium-transporting ATPase subunit KdpA >Feature sequence741 2304 826 gene locus_tag LOCUS_35430 2304 826 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813871.1 protein_id gnl|my_center|LOCUS_35430 2767 2318 gene locus_tag LOCUS_35440 2767 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 >Feature sequence742 >Feature sequence743 852 861 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2509 992 gene locus_tag LOCUS_35450 2509 992 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533079.1 protein_id gnl|my_center|LOCUS_35450 2798 2511 gene locus_tag LOCUS_35460 2798 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 >Feature sequence744 >Feature sequence745 146 505 gene locus_tag LOCUS_35470 146 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 1023 781 gene locus_tag LOCUS_35480 1023 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 1215 1562 gene locus_tag LOCUS_35490 1215 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 2791 1763 gene locus_tag LOCUS_35500 2791 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 >Feature sequence746 206 1492 gene locus_tag LOCUS_35510 206 1492 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814180.1 protein_id gnl|my_center|LOCUS_35510 1489 2415 gene locus_tag LOCUS_35520 1489 2415 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965842.1 protein_id gnl|my_center|LOCUS_35520 >Feature sequence747 2027 1578 gene locus_tag LOCUS_35530 2027 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 2470 2099 gene locus_tag LOCUS_35540 2470 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 >Feature sequence748 2363 978 gene locus_tag LOCUS_35550 2363 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 >Feature sequence749 <1 643 gene locus_tag LOCUS_35560 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963949.1:peptide chain release factor 3 727 1173 gene locus_tag LOCUS_35570 727 1173 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640683.1 protein_id gnl|my_center|LOCUS_35570 1246 2652 gene locus_tag LOCUS_35580 gene pepV 1246 2652 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371462.1 protein_id gnl|my_center|LOCUS_35580 >Feature sequence750 73 276 gene locus_tag LOCUS_35590 73 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 469 705 gene locus_tag LOCUS_35600 469 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 >Feature sequence751 47 664 gene locus_tag LOCUS_35610 47 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 682 1629 gene locus_tag LOCUS_35620 682 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 1619 2677 gene locus_tag LOCUS_35630 gene cobT 1619 2677 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_35630 >Feature sequence752 1695 937 gene locus_tag LOCUS_35640 1695 937 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121332.1 protein_id gnl|my_center|LOCUS_35640 2561 1692 gene locus_tag LOCUS_35650 2561 1692 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228493.1 protein_id gnl|my_center|LOCUS_35650 >Feature sequence753 1492 236 gene locus_tag LOCUS_35660 1492 236 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435718.1 protein_id gnl|my_center|LOCUS_35660 1075 1084 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence754 126 641 gene locus_tag LOCUS_35670 126 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 747 1484 gene locus_tag LOCUS_35680 747 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35680 1444 2049 gene locus_tag LOCUS_35690 1444 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35690 2039 2368 gene locus_tag LOCUS_35700 2039 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 2526 2371 gene locus_tag LOCUS_35710 2526 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 >Feature sequence755 27 1874 gene locus_tag LOCUS_35720 27 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 >Feature sequence756 56 127 gene locus_tag LOCUS_t00130 56 127 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 141 212 gene locus_tag LOCUS_t00140 141 212 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 431 829 gene locus_tag LOCUS_35730 431 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 947 1069 gene locus_tag LOCUS_35740 947 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 1808 1062 gene locus_tag LOCUS_35750 gene fabG 1808 1062 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_35750 <2797 1847 gene locus_tag LOCUS_35760 <2797 1847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002901592.1:sugar-binding transcriptional regulator >Feature sequence757 313 819 gene locus_tag LOCUS_35770 313 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 840 1166 gene locus_tag LOCUS_35780 840 1166 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416526.1 protein_id gnl|my_center|LOCUS_35780 1591 1211 gene locus_tag LOCUS_35790 1591 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 2293 1661 gene locus_tag LOCUS_35800 gene dhaL 2293 1661 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938279.1 protein_id gnl|my_center|LOCUS_35800 >Feature sequence758 581 1600 gene locus_tag LOCUS_35810 581 1600 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075125.1 protein_id gnl|my_center|LOCUS_35810 1625 2578 gene locus_tag LOCUS_35820 1625 2578 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_35820 >Feature sequence759 185 1909 gene locus_tag LOCUS_35830 185 1909 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_35830 >Feature sequence760 979 8 gene locus_tag LOCUS_35840 gene spoIID 979 8 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393851.1 protein_id gnl|my_center|LOCUS_35840 2672 1158 gene locus_tag LOCUS_35850 2672 1158 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016113.1 protein_id gnl|my_center|LOCUS_35850 >Feature sequence761 157 1353 gene locus_tag LOCUS_35860 157 1353 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969388.1 protein_id gnl|my_center|LOCUS_35860 >Feature sequence762 265 1773 gene locus_tag LOCUS_35870 265 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 >Feature sequence763 <1 809 gene locus_tag LOCUS_35880 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941867.1:MBL fold metallo-hydrolase 2570 876 gene locus_tag LOCUS_35890 2570 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 >Feature sequence764 1687 494 gene locus_tag LOCUS_35900 1687 494 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383860.1 protein_id gnl|my_center|LOCUS_35900 2670 1762 gene locus_tag LOCUS_35910 2670 1762 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502284.1 protein_id gnl|my_center|LOCUS_35910 >Feature sequence765 253 438 gene locus_tag LOCUS_35920 253 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 431 1348 gene locus_tag LOCUS_35930 431 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 >Feature sequence766 59 478 gene locus_tag LOCUS_35940 59 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 694 855 gene locus_tag LOCUS_35950 694 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 >Feature sequence767 2550 910 gene locus_tag LOCUS_35960 2550 910 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085661.1 protein_id gnl|my_center|LOCUS_35960 >Feature sequence768 2336 636 gene locus_tag LOCUS_35970 2336 636 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454872.1 protein_id gnl|my_center|LOCUS_35970 2706 2350 gene locus_tag LOCUS_35980 2706 2350 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813375.1 protein_id gnl|my_center|LOCUS_35980 >Feature sequence769 868 20 gene locus_tag LOCUS_35990 868 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 1024 1033 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2231 1104 gene locus_tag LOCUS_36000 2231 1104 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902589.1 protein_id gnl|my_center|LOCUS_36000 >Feature sequence770 1695 1225 gene locus_tag LOCUS_36010 gene grdA 1695 1225 CDS product glycine/sarcosine/betaine reductase complex selenoprotein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011345262.1 transl_except (pos:complement(1564..1566),aa:Sec) note codon on position 44 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_36010 2067 1744 gene locus_tag LOCUS_36020 2067 1744 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416870.1 protein_id gnl|my_center|LOCUS_36020 <2729 2157 gene locus_tag LOCUS_36030 <2729 2157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948886.1:thioredoxin-disulfide reductase 2228 2237 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence771 <1 521 gene locus_tag LOCUS_36040 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001171683.1:allose kinase 631 1701 gene locus_tag LOCUS_36050 gene alsB 631 1701 CDS product D-allose transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046187.1 protein_id gnl|my_center|LOCUS_36050 1787 2251 gene locus_tag LOCUS_36060 1787 2251 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681334.1 protein_id gnl|my_center|LOCUS_36060 >Feature sequence772 906 616 gene locus_tag LOCUS_36070 gene eutM 906 616 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358305.1 protein_id gnl|my_center|LOCUS_36070 2206 1370 gene locus_tag LOCUS_36080 2206 1370 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402124.1 protein_id gnl|my_center|LOCUS_36080 >Feature sequence773 <1 658 gene locus_tag LOCUS_36090 <1 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048306.1:RNase adapter RapZ 666 1625 gene locus_tag LOCUS_36100 gene whiA 666 1625 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436252.1 protein_id gnl|my_center|LOCUS_36100 1737 1994 gene locus_tag LOCUS_36110 1737 1994 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_36110 >Feature sequence774 266 1414 gene locus_tag LOCUS_36120 266 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 2064 1411 gene locus_tag LOCUS_36130 2064 1411 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811882.1 protein_id gnl|my_center|LOCUS_36130 2169 2654 gene locus_tag LOCUS_36140 2169 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986832.1 protein_id gnl|my_center|LOCUS_36140 >Feature sequence775 831 106 gene locus_tag LOCUS_36150 831 106 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966768.1 protein_id gnl|my_center|LOCUS_36150 1051 2064 gene locus_tag LOCUS_36160 1051 2064 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048604250.1 protein_id gnl|my_center|LOCUS_36160 >Feature sequence776 <1 1041 gene locus_tag LOCUS_36170 <1 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964898.1:anion permease 1128 1835 gene locus_tag LOCUS_36180 1128 1835 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869303.1 protein_id gnl|my_center|LOCUS_36180 2624 1920 gene locus_tag LOCUS_36190 2624 1920 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902966.1 protein_id gnl|my_center|LOCUS_36190 >Feature sequence777 <1 1473 gene locus_tag LOCUS_36200 <1 1473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003233752.1:ABC-F family ATP-binding cassette domain-containing protein >Feature sequence778 371 144 gene locus_tag LOCUS_36210 371 144 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362589.1 protein_id gnl|my_center|LOCUS_36210 634 392 gene locus_tag LOCUS_36220 gene rpsP 634 392 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_36220 2087 711 gene locus_tag LOCUS_36230 gene ffh 2087 711 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_36230 2464 2120 gene locus_tag LOCUS_36240 2464 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 >Feature sequence779 <1 516 gene locus_tag LOCUS_36250 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000649370.1:dicarboxylate/amino acid:cation symporter >Feature sequence780 1663 314 gene locus_tag LOCUS_36260 gene murD 1663 314 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966471.1 protein_id gnl|my_center|LOCUS_36260 <2694 1707 gene locus_tag LOCUS_36270 <2694 1707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037869.1:UDP-N-acetyl-alpha-D-muramoyl-L-alanyl-L-glutamate epimerase >Feature sequence781 1000 128 gene locus_tag LOCUS_36280 1000 128 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953624.1 protein_id gnl|my_center|LOCUS_36280 <2693 1032 gene locus_tag LOCUS_36290 <2693 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_130435197.1:ATP-binding protein >Feature sequence782 <1 563 gene locus_tag LOCUS_36300 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002287024.1:PTS sugar transporter subunit IIC 556 1383 gene locus_tag LOCUS_36310 556 1383 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287022.1 protein_id gnl|my_center|LOCUS_36310 >Feature sequence783 1459 221 gene locus_tag LOCUS_36320 1459 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 2380 1544 gene locus_tag LOCUS_36330 2380 1544 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704383.1 protein_id gnl|my_center|LOCUS_36330 >Feature sequence784 1121 1351 gene locus_tag LOCUS_36340 1121 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 <2682 1605 gene locus_tag LOCUS_36350 <2682 1605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966254.1:tRNA 4-thiouridine(8) synthase ThiI >Feature sequence785 415 1014 gene locus_tag LOCUS_36360 415 1014 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426696.1 protein_id gnl|my_center|LOCUS_36360 1218 1916 gene locus_tag LOCUS_36370 1218 1916 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_36370 >Feature sequence786 2 934 gene locus_tag LOCUS_36380 2 934 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948940.1 protein_id gnl|my_center|LOCUS_36380 1789 929 gene locus_tag LOCUS_36390 1789 929 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860910.1 protein_id gnl|my_center|LOCUS_36390 >Feature sequence787 400 1431 gene locus_tag LOCUS_36400 400 1431 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_36400 1524 2558 gene locus_tag LOCUS_36410 gene kdgK1 1524 2558 CDS product bifunctional 2-dehydro-3-deoxygluconokinase/2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902071.1 protein_id gnl|my_center|LOCUS_36410 >Feature sequence788 114 1895 gene locus_tag LOCUS_36420 114 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 1468 1477 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence789 <1 827 gene locus_tag LOCUS_36430 <1 827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011017141.1:Na+/H+ antiporter NhaC 1320 880 gene locus_tag LOCUS_36440 gene rpiB 1320 880 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721856.1 protein_id gnl|my_center|LOCUS_36440 2537 1407 gene locus_tag LOCUS_36450 gene aroC 2537 1407 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258378.1 protein_id gnl|my_center|LOCUS_36450 >Feature sequence790 462 124 gene locus_tag LOCUS_36460 gene cutA 462 124 CDS product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949143.1 protein_id gnl|my_center|LOCUS_36460 716 1489 gene locus_tag LOCUS_36470 716 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 1660 2538 gene locus_tag LOCUS_36480 1660 2538 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814724.1 protein_id gnl|my_center|LOCUS_36480 >Feature sequence791 1766 1275 gene locus_tag LOCUS_36490 1766 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 <2645 1857 gene locus_tag LOCUS_36500 <2645 1857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090292.1:tripartite tricarboxylate transporter substrate binding protein >Feature sequence792 2392 272 gene locus_tag LOCUS_36510 gene malZ 2392 272 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818979.1 protein_id gnl|my_center|LOCUS_36510 >Feature sequence793 100 633 gene locus_tag LOCUS_36520 100 633 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181746.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36520 858 2090 gene locus_tag LOCUS_36530 858 2090 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_36530 2262 2435 gene locus_tag LOCUS_36540 2262 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 >Feature sequence794 >Feature sequence795 347 1318 gene locus_tag LOCUS_36550 347 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 1333 2403 gene locus_tag LOCUS_36560 gene mglB 1333 2403 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365711.1 protein_id gnl|my_center|LOCUS_36560 >Feature sequence796 1710 514 gene locus_tag LOCUS_36570 1710 514 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948689.1 protein_id gnl|my_center|LOCUS_36570 2521 1733 gene locus_tag LOCUS_36580 2521 1733 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948688.1 protein_id gnl|my_center|LOCUS_36580 >Feature sequence797 6 962 gene locus_tag LOCUS_36590 6 962 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379732.1 protein_id gnl|my_center|LOCUS_36590 1089 1631 gene locus_tag LOCUS_36600 gene ispF 1089 1631 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_36600 >Feature sequence798 984 286 gene locus_tag LOCUS_36610 984 286 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868122.1 protein_id gnl|my_center|LOCUS_36610 2586 1153 gene locus_tag LOCUS_36620 2586 1153 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307517.1 protein_id gnl|my_center|LOCUS_36620 >Feature sequence799 <2630 322 gene locus_tag LOCUS_36630 <2630 322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814149.1:RNA degradosome polyphosphate kinase >Feature sequence800 230 844 gene locus_tag LOCUS_36640 230 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 890 1978 gene locus_tag LOCUS_36650 gene rsmH 890 1978 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_36650 2058 2468 gene locus_tag LOCUS_36660 2058 2468 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892190.1 protein_id gnl|my_center|LOCUS_36660 >Feature sequence801 <1 915 gene locus_tag LOCUS_36670 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009893708.1:stage V sporulation protein D 986 1954 gene locus_tag LOCUS_36680 gene mraY 986 1954 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358738.1 protein_id gnl|my_center|LOCUS_36680 >Feature sequence802 1313 1074 gene locus_tag LOCUS_36690 1313 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 2316 1387 gene locus_tag LOCUS_36700 2316 1387 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431317.1 protein_id gnl|my_center|LOCUS_36700 >Feature sequence803 154 849 gene locus_tag LOCUS_36710 154 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 928 2502 gene locus_tag LOCUS_36720 928 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 >Feature sequence804 317 1081 gene locus_tag LOCUS_36730 317 1081 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815859.1 protein_id gnl|my_center|LOCUS_36730 1298 2404 gene locus_tag LOCUS_36740 1298 2404 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529637.1 protein_id gnl|my_center|LOCUS_36740 >Feature sequence805 175 1446 gene locus_tag LOCUS_36750 175 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 >Feature sequence806 144 869 gene locus_tag LOCUS_36760 144 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 1632 958 gene locus_tag LOCUS_36770 1632 958 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673955.1 protein_id gnl|my_center|LOCUS_36770 <2609 1666 gene locus_tag LOCUS_36780 <2609 1666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245542.1:zinc-binding alcohol dehydrogenase family protein >Feature sequence807 <1 1374 gene locus_tag LOCUS_36790 <1 1374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987111.1:MATE family efflux transporter 1566 2057 gene locus_tag LOCUS_36800 gene sigV 1566 2057 CDS product RNA polymerase sigma factor SigV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398891.1 protein_id gnl|my_center|LOCUS_36800 >Feature sequence808 65 883 gene locus_tag LOCUS_36810 65 883 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537587.1 protein_id gnl|my_center|LOCUS_36810 883 1665 gene locus_tag LOCUS_36820 gene udp 883 1665 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250430.1 protein_id gnl|my_center|LOCUS_36820 1763 2536 gene locus_tag LOCUS_36830 gene udp 1763 2536 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_36830 >Feature sequence809 18 191 gene locus_tag LOCUS_36840 18 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 508 254 gene locus_tag LOCUS_36850 508 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 585 740 gene locus_tag LOCUS_36860 585 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 826 1323 gene locus_tag LOCUS_36870 826 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 >Feature sequence810 358 1431 gene locus_tag LOCUS_36880 358 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 1527 2519 gene locus_tag LOCUS_36890 1527 2519 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086118.1 protein_id gnl|my_center|LOCUS_36890 >Feature sequence811 278 661 gene locus_tag LOCUS_36900 278 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36900 690 1145 gene locus_tag LOCUS_36910 690 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 1157 2125 gene locus_tag LOCUS_36920 1157 2125 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674209.1 protein_id gnl|my_center|LOCUS_36920 >Feature sequence812 128 934 gene locus_tag LOCUS_36930 128 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 1308 1027 gene locus_tag LOCUS_36940 1308 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 1861 1340 gene locus_tag LOCUS_36950 1861 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 1893 2045 gene locus_tag LOCUS_36960 1893 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 2249 2258 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence813 <1 743 gene locus_tag LOCUS_36970 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003427022.1:redox-regulated ATPase YchF 1237 917 gene locus_tag LOCUS_36980 1237 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 2104 1661 gene locus_tag LOCUS_36990 2104 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 2439 2137 gene locus_tag LOCUS_37000 2439 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 >Feature sequence814 <1 844 gene locus_tag LOCUS_37010 <1 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679363.1:APC family permease 1023 1835 gene locus_tag LOCUS_37020 1023 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 2566 1844 gene locus_tag LOCUS_37030 2566 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 >Feature sequence815 <1 531 gene locus_tag LOCUS_37040 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001264517.1:response regulator transcription factor 528 1925 gene locus_tag LOCUS_37050 528 1925 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110230.1 protein_id gnl|my_center|LOCUS_37050 1941 2138 gene locus_tag LOCUS_37060 1941 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 >Feature sequence816 145 1470 gene locus_tag LOCUS_37070 gene rsxC 145 1470 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_37070 1486 1809 gene locus_tag LOCUS_37080 1486 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37080 1738 1747 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1802 2416 gene locus_tag LOCUS_37090 1802 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37090 >Feature sequence817 1015 854 gene locus_tag LOCUS_37100 1015 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 1210 1016 gene locus_tag LOCUS_37110 1210 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 2555 1503 gene locus_tag LOCUS_37120 2555 1503 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976088.1 protein_id gnl|my_center|LOCUS_37120 >Feature sequence818 444 899 gene locus_tag LOCUS_37130 444 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 899 1099 gene locus_tag LOCUS_37140 899 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37140 1066 1257 gene locus_tag LOCUS_37150 1066 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37150 1402 2385 gene locus_tag LOCUS_37160 1402 2385 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896952.1 protein_id gnl|my_center|LOCUS_37160 >Feature sequence819 298 672 gene locus_tag LOCUS_37170 298 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 544 553 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 572 1267 gene locus_tag LOCUS_37180 572 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 1269 2060 gene locus_tag LOCUS_37190 1269 2060 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251129.1 protein_id gnl|my_center|LOCUS_37190 2474 2145 gene locus_tag LOCUS_37200 2474 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 >Feature sequence820 68 952 gene locus_tag LOCUS_37210 68 952 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252895.1 protein_id gnl|my_center|LOCUS_37210 1019 2260 gene locus_tag LOCUS_37220 1019 2260 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_37220 >Feature sequence821 116 565 gene locus_tag LOCUS_37230 116 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 619 1059 gene locus_tag LOCUS_37240 619 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 1124 1912 gene locus_tag LOCUS_37250 1124 1912 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453987.1 protein_id gnl|my_center|LOCUS_37250 >Feature sequence822 >Feature sequence823 1457 270 gene locus_tag LOCUS_37260 1457 270 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002411310.1 protein_id gnl|my_center|LOCUS_37260 <2530 1499 gene locus_tag LOCUS_37270 <2530 1499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000154656.1:Na+/H+ antiporter NhaC >Feature sequence824 147 659 gene locus_tag LOCUS_37280 147 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 1135 2430 gene locus_tag LOCUS_37290 gene eno 1135 2430 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964032.1 protein_id gnl|my_center|LOCUS_37290 >Feature sequence825 915 787 gene locus_tag LOCUS_37300 915 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 1920 919 gene locus_tag LOCUS_37310 1920 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 >Feature sequence826 >Feature sequence827 82 453 gene locus_tag LOCUS_37320 82 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 556 768 gene locus_tag LOCUS_37330 556 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 1851 967 gene locus_tag LOCUS_37340 1851 967 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385464.1 protein_id gnl|my_center|LOCUS_37340 >Feature sequence828 1676 750 gene locus_tag LOCUS_37350 1676 750 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583516.1 protein_id gnl|my_center|LOCUS_37350 <2514 1673 gene locus_tag LOCUS_37360 <2514 1673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969292.1:ABC transporter permease >Feature sequence829 122 997 gene locus_tag LOCUS_37370 122 997 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831939.1 protein_id gnl|my_center|LOCUS_37370 >Feature sequence830 1384 635 gene locus_tag LOCUS_37380 1384 635 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_37380 <2511 1510 gene locus_tag LOCUS_37390 <2511 1510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674227.1:galactokinase >Feature sequence831 509 165 gene locus_tag LOCUS_37400 509 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400