>Feature sequence001 157 1959 gene locus_tag LOCUS_00010 gene dnaG 157 1959 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_00010 1965 3134 gene locus_tag LOCUS_00020 gene rpoD 1965 3134 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_00020 3186 4154 gene locus_tag LOCUS_00030 gene prmA 3186 4154 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861555.1 protein_id gnl|my_center|LOCUS_00030 4142 5266 gene locus_tag LOCUS_00040 4142 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5380 6732 gene locus_tag LOCUS_00050 5380 6732 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435635.1 protein_id gnl|my_center|LOCUS_00050 6791 7201 gene locus_tag LOCUS_00060 6791 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_00060 7293 8795 gene locus_tag LOCUS_00070 gene thrC 7293 8795 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986278.1 protein_id gnl|my_center|LOCUS_00070 8840 10129 gene locus_tag LOCUS_00080 gene galK 8840 10129 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 protein_id gnl|my_center|LOCUS_00080 10262 11095 gene locus_tag LOCUS_00090 gene spoIIGA 10262 11095 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261975.1 protein_id gnl|my_center|LOCUS_00090 11117 11830 gene locus_tag LOCUS_00100 gene sigE 11117 11830 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_00100 11901 12671 gene locus_tag LOCUS_00110 gene sigG 11901 12671 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_00110 12872 13957 gene locus_tag LOCUS_00120 12872 13957 CDS product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393831.1 protein_id gnl|my_center|LOCUS_00120 14013 15227 gene locus_tag LOCUS_00130 14013 15227 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963821.1 protein_id gnl|my_center|LOCUS_00130 15232 17187 gene locus_tag LOCUS_00140 15232 17187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 18101 17235 gene locus_tag LOCUS_00150 18101 17235 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582695.1 protein_id gnl|my_center|LOCUS_00150 19017 18154 gene locus_tag LOCUS_00160 gene fba 19017 18154 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_00160 19674 19060 gene locus_tag LOCUS_00170 19674 19060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393882.1 protein_id gnl|my_center|LOCUS_00170 20626 19754 gene locus_tag LOCUS_00180 20626 19754 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965994.1 protein_id gnl|my_center|LOCUS_00180 20827 20744 gene locus_tag LOCUS_t00010 20827 20744 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 20954 25873 gene locus_tag LOCUS_00190 20954 25873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 25937 26908 gene locus_tag LOCUS_00200 gene spoIID 25937 26908 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393851.1 protein_id gnl|my_center|LOCUS_00200 27039 32297 gene locus_tag LOCUS_00210 27039 32297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 33183 32386 gene locus_tag LOCUS_00220 gene lgt 33183 32386 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242661.1 protein_id gnl|my_center|LOCUS_00220 35351 33189 gene locus_tag LOCUS_00230 35351 33189 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947999.1 protein_id gnl|my_center|LOCUS_00230 35399 35408 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35679 36122 gene locus_tag LOCUS_00240 gene mraZ 35679 36122 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700457.1 protein_id gnl|my_center|LOCUS_00240 36173 37105 gene locus_tag LOCUS_00250 gene rsmH 36173 37105 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861627.1 protein_id gnl|my_center|LOCUS_00250 37118 37618 gene locus_tag LOCUS_00260 37118 37618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 37670 39937 gene locus_tag LOCUS_00270 37670 39937 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_00270 39959 41395 gene locus_tag LOCUS_00280 39959 41395 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_00280 41469 42839 gene locus_tag LOCUS_00290 41469 42839 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861626.1 protein_id gnl|my_center|LOCUS_00290 42861 43886 gene locus_tag LOCUS_00300 gene mraY 42861 43886 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965426.1 protein_id gnl|my_center|LOCUS_00300 43905 45086 gene locus_tag LOCUS_00310 gene spoVE 43905 45086 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244810.1 protein_id gnl|my_center|LOCUS_00310 45097 46206 gene locus_tag LOCUS_00320 gene murG 45097 46206 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893705.1 protein_id gnl|my_center|LOCUS_00320 46203 47435 gene locus_tag LOCUS_00330 gene hisS 46203 47435 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_00330 47619 47903 gene locus_tag LOCUS_00340 47619 47903 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890712.1 protein_id gnl|my_center|LOCUS_00340 48007 49086 gene locus_tag LOCUS_00350 48007 49086 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392538.1 protein_id gnl|my_center|LOCUS_00350 49281 51614 gene locus_tag LOCUS_00360 49281 51614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 <52784 51650 gene locus_tag LOCUS_00370 <52784 51650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966140.1:methionine adenosyltransferase >Feature sequence002 2418 1672 gene locus_tag LOCUS_00380 2418 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 2779 4155 gene locus_tag LOCUS_00390 gene ygjG 2779 4155 CDS product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098827.1 protein_id gnl|my_center|LOCUS_00390 4186 5667 gene locus_tag LOCUS_00400 gene betB 4186 5667 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243430.1 protein_id gnl|my_center|LOCUS_00400 5682 6794 gene locus_tag LOCUS_00410 5682 6794 CDS product 4-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861531.1 protein_id gnl|my_center|LOCUS_00410 6807 8180 gene locus_tag LOCUS_00420 gene gabT 6807 8180 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093009.1 protein_id gnl|my_center|LOCUS_00420 8317 10437 gene locus_tag LOCUS_00430 8317 10437 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00430 10789 11082 gene locus_tag LOCUS_00440 10789 11082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 11126 11605 gene locus_tag LOCUS_00450 11126 11605 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_00450 11625 14354 gene locus_tag LOCUS_00460 11625 14354 CDS product beta-galactosidase GalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036450.1 protein_id gnl|my_center|LOCUS_00460 14880 14413 gene locus_tag LOCUS_00470 14880 14413 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053897.1 protein_id gnl|my_center|LOCUS_00470 16295 14937 gene locus_tag LOCUS_00480 gene mgtE 16295 14937 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_00480 17525 16365 gene locus_tag LOCUS_00490 gene wecB 17525 16365 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947987.1 protein_id gnl|my_center|LOCUS_00490 18674 17544 gene locus_tag LOCUS_00500 18674 17544 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966159.1 protein_id gnl|my_center|LOCUS_00500 19688 18687 gene locus_tag LOCUS_00510 gene trpS 19688 18687 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048270.1 protein_id gnl|my_center|LOCUS_00510 20905 19712 gene locus_tag LOCUS_00520 20905 19712 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429271.1 protein_id gnl|my_center|LOCUS_00520 22603 20936 gene locus_tag LOCUS_00530 22603 20936 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_00530 24266 22608 gene locus_tag LOCUS_00540 24266 22608 CDS product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225984.1 protein_id gnl|my_center|LOCUS_00540 25145 24426 gene locus_tag LOCUS_00550 25145 24426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 25906 25142 gene locus_tag LOCUS_00560 25906 25142 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_00560 28641 26038 gene locus_tag LOCUS_00570 28641 26038 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949094.1 protein_id gnl|my_center|LOCUS_00570 30627 28894 gene locus_tag LOCUS_00580 gene recQ 30627 28894 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965975.1 protein_id gnl|my_center|LOCUS_00580 33214 30830 gene locus_tag LOCUS_00590 gene pheT 33214 30830 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357703.1 protein_id gnl|my_center|LOCUS_00590 33581 33240 gene locus_tag LOCUS_00600 33581 33240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 33861 33571 gene locus_tag LOCUS_00610 33861 33571 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870896.1 protein_id gnl|my_center|LOCUS_00610 >Feature sequence003 46 1437 gene locus_tag LOCUS_00620 gene murC 46 1437 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_00620 2529 1501 gene locus_tag LOCUS_00630 gene ilvC 2529 1501 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081338.1 protein_id gnl|my_center|LOCUS_00630 3079 2579 gene locus_tag LOCUS_00640 gene ilvN 3079 2579 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496411.1 protein_id gnl|my_center|LOCUS_00640 4757 3081 gene locus_tag LOCUS_00650 4757 3081 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_00650 5800 5096 gene locus_tag LOCUS_00660 5800 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 6694 5855 gene locus_tag LOCUS_00670 6694 5855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 7253 6705 gene locus_tag LOCUS_00680 7253 6705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 8151 7444 gene locus_tag LOCUS_00690 8151 7444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 9227 8220 gene locus_tag LOCUS_00700 9227 8220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 9944 9282 gene locus_tag LOCUS_00710 gene pyrE 9944 9282 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_00710 10693 9956 gene locus_tag LOCUS_00720 10693 9956 CDS product SigB/SigF/SigG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420464.1 protein_id gnl|my_center|LOCUS_00720 11371 10712 gene locus_tag LOCUS_00730 11371 10712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 11950 11570 gene locus_tag LOCUS_00740 11950 11570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 12097 13353 gene locus_tag LOCUS_00750 12097 13353 CDS product glycoside hydrolase family 27 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776921.1 protein_id gnl|my_center|LOCUS_00750 14358 13720 gene locus_tag LOCUS_00760 14358 13720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 14498 15097 gene locus_tag LOCUS_00770 14498 15097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 15111 15974 gene locus_tag LOCUS_00780 15111 15974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 16003 18906 gene locus_tag LOCUS_00790 16003 18906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 19740 18988 gene locus_tag LOCUS_00800 19740 18988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 20356 19751 gene locus_tag LOCUS_00810 20356 19751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 21318 20356 gene locus_tag LOCUS_00820 gene hemB 21318 20356 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963427.1 protein_id gnl|my_center|LOCUS_00820 22801 21368 gene locus_tag LOCUS_00830 gene cobA 22801 21368 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898657.1 protein_id gnl|my_center|LOCUS_00830 23670 22801 gene locus_tag LOCUS_00840 gene hemC 23670 22801 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886587.1 protein_id gnl|my_center|LOCUS_00840 24799 23660 gene locus_tag LOCUS_00850 gene hemA 24799 23660 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546522.1 protein_id gnl|my_center|LOCUS_00850 25492 24800 gene locus_tag LOCUS_00860 gene cobI 25492 24800 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914028.1 protein_id gnl|my_center|LOCUS_00860 26337 25495 gene locus_tag LOCUS_00870 26337 25495 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345602.1 protein_id gnl|my_center|LOCUS_00870 27117 26338 gene locus_tag LOCUS_00880 gene cbiQ 27117 26338 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812266.1 protein_id gnl|my_center|LOCUS_00880 27407 27114 gene locus_tag LOCUS_00890 27407 27114 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003492574.1 protein_id gnl|my_center|LOCUS_00890 28155 27412 gene locus_tag LOCUS_00900 28155 27412 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812271.1 protein_id gnl|my_center|LOCUS_00900 28346 28510 gene locus_tag LOCUS_00910 28346 28510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 28576 29862 gene locus_tag LOCUS_00920 gene hemL 28576 29862 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398699.1 protein_id gnl|my_center|LOCUS_00920 29862 30776 gene locus_tag LOCUS_00930 29862 30776 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_00930 30825 31190 gene locus_tag LOCUS_00940 30825 31190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 31222 32418 gene locus_tag LOCUS_00950 31222 32418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 33649 33062 gene locus_tag LOCUS_00960 33649 33062 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889235.1 protein_id gnl|my_center|LOCUS_00960 >Feature sequence004 1091 414 gene locus_tag LOCUS_00970 1091 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 2599 1130 gene locus_tag LOCUS_00980 2599 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 4345 2609 gene locus_tag LOCUS_00990 4345 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 5150 4458 gene locus_tag LOCUS_01000 5150 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 6640 5162 gene locus_tag LOCUS_01010 gene spoIVA 6640 5162 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986845.1 protein_id gnl|my_center|LOCUS_01010 6753 6762 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6828 8039 gene locus_tag LOCUS_01020 6828 8039 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_01020 8091 8861 gene locus_tag LOCUS_01030 gene tam 8091 8861 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530924.1 protein_id gnl|my_center|LOCUS_01030 9637 9293 gene locus_tag LOCUS_01040 gene rplQ 9637 9293 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357477.1 protein_id gnl|my_center|LOCUS_01040 10603 9653 gene locus_tag LOCUS_01050 10603 9653 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_01050 11299 10706 gene locus_tag LOCUS_01060 gene rpsD 11299 10706 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903916.1 protein_id gnl|my_center|LOCUS_01060 11731 11333 gene locus_tag LOCUS_01070 gene rpsK 11731 11333 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_01070 12117 11749 gene locus_tag LOCUS_01080 gene rpsM 12117 11749 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 protein_id gnl|my_center|LOCUS_01080 12551 12381 gene locus_tag LOCUS_01090 12551 12381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 12729 12511 gene locus_tag LOCUS_01100 gene infA 12729 12511 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_01100 13027 12770 gene locus_tag LOCUS_01110 13027 12770 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966390.1 protein_id gnl|my_center|LOCUS_01110 13783 13037 gene locus_tag LOCUS_01120 gene map 13783 13037 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357322.1 protein_id gnl|my_center|LOCUS_01120 14425 13787 gene locus_tag LOCUS_01130 14425 13787 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393916.1 protein_id gnl|my_center|LOCUS_01130 15773 14454 gene locus_tag LOCUS_01140 gene secY 15773 14454 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_01140 16215 15775 gene locus_tag LOCUS_01150 gene rplO 16215 15775 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966393.1 protein_id gnl|my_center|LOCUS_01150 16415 16236 gene locus_tag LOCUS_01160 gene rpmD 16415 16236 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357637.1 protein_id gnl|my_center|LOCUS_01160 16933 16430 gene locus_tag LOCUS_01170 gene rpsE 16933 16430 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003328273.1 protein_id gnl|my_center|LOCUS_01170 17313 16954 gene locus_tag LOCUS_01180 gene rplR 17313 16954 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357434.1 protein_id gnl|my_center|LOCUS_01180 17881 17333 gene locus_tag LOCUS_01190 gene rplF 17881 17333 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966397.1 protein_id gnl|my_center|LOCUS_01190 18399 18001 gene locus_tag LOCUS_01200 gene rpsH 18399 18001 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_01200 18679 18494 gene locus_tag LOCUS_01210 18679 18494 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_01210 19240 18701 gene locus_tag LOCUS_01220 gene rplE 19240 18701 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435673.1 protein_id gnl|my_center|LOCUS_01220 19590 19267 gene locus_tag LOCUS_01230 gene rplX 19590 19267 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258242.1 protein_id gnl|my_center|LOCUS_01230 19980 19612 gene locus_tag LOCUS_01240 gene rplN 19980 19612 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_01240 20267 20010 gene locus_tag LOCUS_01250 gene rpsQ 20267 20010 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421156.1 protein_id gnl|my_center|LOCUS_01250 20523 20320 gene locus_tag LOCUS_01260 gene rpmC 20523 20320 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 protein_id gnl|my_center|LOCUS_01260 20948 20526 gene locus_tag LOCUS_01270 gene rplP 20948 20526 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_01270 21679 20948 gene locus_tag LOCUS_01280 gene rpsC 21679 20948 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421163.1 protein_id gnl|my_center|LOCUS_01280 21980 21699 gene locus_tag LOCUS_01290 gene rplV 21980 21699 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966407.1 protein_id gnl|my_center|LOCUS_01290 22474 22202 gene locus_tag LOCUS_01300 gene rpsS 22474 22202 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_01300 23337 22504 gene locus_tag LOCUS_01310 gene rplB 23337 22504 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966409.1 protein_id gnl|my_center|LOCUS_01310 23676 23374 gene locus_tag LOCUS_01320 gene rplW 23676 23374 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966410.1 protein_id gnl|my_center|LOCUS_01320 24299 23676 gene locus_tag LOCUS_01330 gene rplD 24299 23676 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966411.1 protein_id gnl|my_center|LOCUS_01330 24954 24328 gene locus_tag LOCUS_01340 gene rplC 24954 24328 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421173.1 protein_id gnl|my_center|LOCUS_01340 25367 25053 gene locus_tag LOCUS_01350 gene rpsJ 25367 25053 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720954.1 protein_id gnl|my_center|LOCUS_01350 26225 25815 gene locus_tag LOCUS_01360 26225 25815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 26357 26569 gene locus_tag LOCUS_01370 26357 26569 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105789.1 protein_id gnl|my_center|LOCUS_01370 26830 26600 gene locus_tag LOCUS_01380 26830 26600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 27117 26827 gene locus_tag LOCUS_01390 27117 26827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 27777 27217 gene locus_tag LOCUS_01400 27777 27217 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_01400 29397 27856 gene locus_tag LOCUS_01410 29397 27856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 30447 29515 gene locus_tag LOCUS_01420 gene cysK 30447 29515 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 protein_id gnl|my_center|LOCUS_01420 31801 30512 gene locus_tag LOCUS_01430 31801 30512 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_01430 >Feature sequence005 66 755 gene locus_tag LOCUS_01440 66 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 1318 2409 gene locus_tag LOCUS_01450 1318 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 2420 3094 gene locus_tag LOCUS_01460 2420 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 3466 3876 gene locus_tag LOCUS_01470 3466 3876 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957066.1 protein_id gnl|my_center|LOCUS_01470 4209 4012 gene locus_tag LOCUS_01480 4209 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 4711 4349 gene locus_tag LOCUS_01490 4711 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01490 5282 4704 gene locus_tag LOCUS_01500 5282 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01500 6711 5935 gene locus_tag LOCUS_01510 6711 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 6782 6958 gene locus_tag LOCUS_01520 6782 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 8478 7366 gene locus_tag LOCUS_01530 8478 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 10344 8692 gene locus_tag LOCUS_01540 10344 8692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 11010 10450 gene locus_tag LOCUS_01550 11010 10450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 11208 11732 gene locus_tag LOCUS_01560 11208 11732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 11807 12262 gene locus_tag LOCUS_01570 11807 12262 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202636.1 protein_id gnl|my_center|LOCUS_01570 12303 13040 gene locus_tag LOCUS_01580 12303 13040 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675715.1 protein_id gnl|my_center|LOCUS_01580 13045 13773 gene locus_tag LOCUS_01590 13045 13773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 13770 14759 gene locus_tag LOCUS_01600 13770 14759 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884064.1 protein_id gnl|my_center|LOCUS_01600 14790 16586 gene locus_tag LOCUS_01610 14790 16586 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814583.1 protein_id gnl|my_center|LOCUS_01610 16602 18629 gene locus_tag LOCUS_01620 16602 18629 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461397.1 protein_id gnl|my_center|LOCUS_01620 18632 19348 gene locus_tag LOCUS_01630 18632 19348 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986406.1 protein_id gnl|my_center|LOCUS_01630 19741 20499 gene locus_tag LOCUS_01640 gene moeB 19741 20499 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460729.1 protein_id gnl|my_center|LOCUS_01640 20514 20837 gene locus_tag LOCUS_01650 20514 20837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 20861 21094 gene locus_tag LOCUS_01660 20861 21094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 21428 22981 gene locus_tag LOCUS_01670 21428 22981 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_01670 23041 23202 gene locus_tag LOCUS_01680 23041 23202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 <27735 23551 gene locus_tag LOCUS_01690 <27735 23551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000052484.1:Ig-like domain-containing protein >Feature sequence006 1513 653 gene locus_tag LOCUS_01700 1513 653 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860980.1 protein_id gnl|my_center|LOCUS_01700 3070 1664 gene locus_tag LOCUS_01710 3070 1664 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667252.1 protein_id gnl|my_center|LOCUS_01710 4012 3101 gene locus_tag LOCUS_01720 4012 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 7590 4024 gene locus_tag LOCUS_01730 gene smc 7590 4024 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861158.1 protein_id gnl|my_center|LOCUS_01730 8588 7581 gene locus_tag LOCUS_01740 8588 7581 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965056.1 protein_id gnl|my_center|LOCUS_01740 9261 8590 gene locus_tag LOCUS_01750 gene rnc 9261 8590 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_01750 10622 9384 gene locus_tag LOCUS_01760 gene fabF 10622 9384 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_01760 10972 10739 gene locus_tag LOCUS_01770 gene acpP 10972 10739 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_01770 11778 11038 gene locus_tag LOCUS_01780 gene fabG 11778 11038 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911773.1 protein_id gnl|my_center|LOCUS_01780 12730 11795 gene locus_tag LOCUS_01790 gene fabD 12730 11795 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_01790 13684 12743 gene locus_tag LOCUS_01800 gene fabK 13684 12743 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460502.1 protein_id gnl|my_center|LOCUS_01800 14715 13738 gene locus_tag LOCUS_01810 14715 13738 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438099.1 protein_id gnl|my_center|LOCUS_01810 15715 14708 gene locus_tag LOCUS_01820 gene plsX 15715 14708 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428446.1 protein_id gnl|my_center|LOCUS_01820 16286 15744 gene locus_tag LOCUS_01830 gene fapR 16286 15744 CDS product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419115.1 protein_id gnl|my_center|LOCUS_01830 17578 16694 gene locus_tag LOCUS_01840 17578 16694 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_01840 18599 17604 gene locus_tag LOCUS_01850 18599 17604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 19038 18529 gene locus_tag LOCUS_01860 19038 18529 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437174.1 protein_id gnl|my_center|LOCUS_01860 19219 19518 gene locus_tag LOCUS_01870 19219 19518 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262048.1 protein_id gnl|my_center|LOCUS_01870 19548 20894 gene locus_tag LOCUS_01880 19548 20894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 20920 21111 gene locus_tag LOCUS_01890 20920 21111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 21111 21740 gene locus_tag LOCUS_01900 gene thiF 21111 21740 CDS product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454457.1 protein_id gnl|my_center|LOCUS_01900 21823 22590 gene locus_tag LOCUS_01910 21823 22590 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015814.1 protein_id gnl|my_center|LOCUS_01910 22606 23766 gene locus_tag LOCUS_01920 gene thiH 22606 23766 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015813.1 protein_id gnl|my_center|LOCUS_01920 23759 24340 gene locus_tag LOCUS_01930 23759 24340 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852949.1 protein_id gnl|my_center|LOCUS_01930 >Feature sequence007 1226 141 gene locus_tag LOCUS_01940 gene leuB 1226 141 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_01940 1718 1230 gene locus_tag LOCUS_01950 gene leuD 1718 1230 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966449.1 protein_id gnl|my_center|LOCUS_01950 2983 1721 gene locus_tag LOCUS_01960 gene leuC 2983 1721 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_01960 5285 3081 gene locus_tag LOCUS_01970 gene pcrA 5285 3081 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225356248.1 protein_id gnl|my_center|LOCUS_01970 5435 6424 gene locus_tag LOCUS_01980 gene spoIVB 5435 6424 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_01980 7540 6488 gene locus_tag LOCUS_01990 7540 6488 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965395.1 protein_id gnl|my_center|LOCUS_01990 7959 7525 gene locus_tag LOCUS_02000 gene aroQ 7959 7525 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757082.1 protein_id gnl|my_center|LOCUS_02000 9020 7956 gene locus_tag LOCUS_02010 gene ispG 9020 7956 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986795.1 protein_id gnl|my_center|LOCUS_02010 10177 9026 gene locus_tag LOCUS_02020 gene rseP 10177 9026 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545838.1 protein_id gnl|my_center|LOCUS_02020 11336 10179 gene locus_tag LOCUS_02030 11336 10179 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_02030 12161 11349 gene locus_tag LOCUS_02040 12161 11349 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434000.1 protein_id gnl|my_center|LOCUS_02040 12902 12165 gene locus_tag LOCUS_02050 12902 12165 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_02050 13533 12982 gene locus_tag LOCUS_02060 gene frr 13533 12982 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293875.1 protein_id gnl|my_center|LOCUS_02060 14277 13558 gene locus_tag LOCUS_02070 gene pyrH 14277 13558 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_02070 15520 14390 gene locus_tag LOCUS_02080 gene tgt 15520 14390 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_02080 15847 20130 gene locus_tag LOCUS_02090 15847 20130 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048163.1 protein_id gnl|my_center|LOCUS_02090 20608 20180 gene locus_tag LOCUS_02100 20608 20180 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381519.1 protein_id gnl|my_center|LOCUS_02100 21747 20689 gene locus_tag LOCUS_02110 21747 20689 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928176.1 protein_id gnl|my_center|LOCUS_02110 22418 21744 gene locus_tag LOCUS_02120 22418 21744 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044826408.1 protein_id gnl|my_center|LOCUS_02120 >Feature sequence008 813 10 gene locus_tag LOCUS_02130 813 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 1279 920 gene locus_tag LOCUS_02140 1279 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 2589 1276 gene locus_tag LOCUS_02150 gene trmFO 2589 1276 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989721.1 protein_id gnl|my_center|LOCUS_02150 4676 2586 gene locus_tag LOCUS_02160 gene topA 4676 2586 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047858.1 protein_id gnl|my_center|LOCUS_02160 5818 4691 gene locus_tag LOCUS_02170 gene dprA 5818 4691 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546585.1 protein_id gnl|my_center|LOCUS_02170 6641 5871 gene locus_tag LOCUS_02180 6641 5871 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965655.1 protein_id gnl|my_center|LOCUS_02180 6781 7569 gene locus_tag LOCUS_02190 gene zupT 6781 7569 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861091.1 protein_id gnl|my_center|LOCUS_02190 8486 7677 gene locus_tag LOCUS_02200 8486 7677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 12420 8722 gene locus_tag LOCUS_02210 12420 8722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 17049 12499 gene locus_tag LOCUS_02220 17049 12499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 17257 18081 gene locus_tag LOCUS_02230 17257 18081 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262870.1 protein_id gnl|my_center|LOCUS_02230 22532 19212 gene locus_tag LOCUS_02240 22532 19212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 >Feature sequence009 730 98 gene locus_tag LOCUS_02250 730 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 2963 708 gene locus_tag LOCUS_02260 2963 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 3629 3264 gene locus_tag LOCUS_02270 3629 3264 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942019.1 protein_id gnl|my_center|LOCUS_02270 4719 3901 gene locus_tag LOCUS_02280 4719 3901 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775508.1 protein_id gnl|my_center|LOCUS_02280 6944 5076 gene locus_tag LOCUS_02290 6944 5076 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390379.1 protein_id gnl|my_center|LOCUS_02290 9660 7303 gene locus_tag LOCUS_02300 9660 7303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 10017 10116 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11744 10776 gene locus_tag LOCUS_02310 11744 10776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 12307 11762 gene locus_tag LOCUS_02320 gene lepB 12307 11762 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014917214.1 protein_id gnl|my_center|LOCUS_02320 13118 12669 gene locus_tag LOCUS_02330 gene spoVAC 13118 12669 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403642.1 protein_id gnl|my_center|LOCUS_02330 13293 14150 gene locus_tag LOCUS_02340 13293 14150 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_02340 14137 14712 gene locus_tag LOCUS_02350 14137 14712 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_02350 14728 15699 gene locus_tag LOCUS_02360 14728 15699 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966170.1 protein_id gnl|my_center|LOCUS_02360 15693 16520 gene locus_tag LOCUS_02370 gene prmC 15693 16520 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_02370 16526 17605 gene locus_tag LOCUS_02380 16526 17605 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_02380 17808 18260 gene locus_tag LOCUS_02390 17808 18260 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765511.1 protein_id gnl|my_center|LOCUS_02390 18425 21850 gene locus_tag LOCUS_02400 18425 21850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 >Feature sequence010 1 408 gene locus_tag LOCUS_02410 1 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 919 485 gene locus_tag LOCUS_02420 919 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 1584 982 gene locus_tag LOCUS_02430 1584 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 1901 2215 gene locus_tag LOCUS_02440 1901 2215 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_02440 2208 2507 gene locus_tag LOCUS_02450 2208 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 3638 2589 gene locus_tag LOCUS_02460 3638 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 7588 3656 gene locus_tag LOCUS_02470 7588 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 8381 7503 gene locus_tag LOCUS_02480 8381 7503 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861832.1 protein_id gnl|my_center|LOCUS_02480 9257 8403 gene locus_tag LOCUS_02490 9257 8403 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263343.1 protein_id gnl|my_center|LOCUS_02490 10611 9271 gene locus_tag LOCUS_02500 10611 9271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 11817 10627 gene locus_tag LOCUS_02510 11817 10627 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460576.1 protein_id gnl|my_center|LOCUS_02510 12071 12913 gene locus_tag LOCUS_02520 12071 12913 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475551.1 protein_id gnl|my_center|LOCUS_02520 13467 13144 gene locus_tag LOCUS_02530 13467 13144 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098568.1 protein_id gnl|my_center|LOCUS_02530 13935 13483 gene locus_tag LOCUS_02540 13935 13483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 14375 13932 gene locus_tag LOCUS_02550 14375 13932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 14845 14663 gene locus_tag LOCUS_02560 14845 14663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 16440 15223 gene locus_tag LOCUS_02570 16440 15223 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861092.1 protein_id gnl|my_center|LOCUS_02570 16741 16544 gene locus_tag LOCUS_02580 16741 16544 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905235.1 protein_id gnl|my_center|LOCUS_02580 17127 17306 gene locus_tag LOCUS_02590 17127 17306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 18152 17991 gene locus_tag LOCUS_02600 18152 17991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 19011 18316 gene locus_tag LOCUS_02610 19011 18316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 19877 19251 gene locus_tag LOCUS_02620 19877 19251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 <21970 19998 gene locus_tag LOCUS_02630 <21970 19998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459233.1:protease Lon-related BREX system protein BrxL >Feature sequence011 2994 1531 gene locus_tag LOCUS_02640 2994 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 7580 3006 gene locus_tag LOCUS_02650 7580 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 8180 7593 gene locus_tag LOCUS_02660 8180 7593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 11752 8189 gene locus_tag LOCUS_02670 gene brxC 11752 8189 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459229.1 protein_id gnl|my_center|LOCUS_02670 12326 11769 gene locus_tag LOCUS_02680 12326 11769 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272229.1 protein_id gnl|my_center|LOCUS_02680 13000 12374 gene locus_tag LOCUS_02690 13000 12374 CDS product DUF1819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459228.1 protein_id gnl|my_center|LOCUS_02690 13717 13586 gene locus_tag LOCUS_02700 13717 13586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 14813 14469 gene locus_tag LOCUS_02710 gene mobC 14813 14469 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368707.1 protein_id gnl|my_center|LOCUS_02710 15261 14965 gene locus_tag LOCUS_02720 15261 14965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02720 15882 15454 gene locus_tag LOCUS_02730 15882 15454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02730 17084 16278 gene locus_tag LOCUS_02740 17084 16278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 17821 17627 gene locus_tag LOCUS_02750 17821 17627 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905235.1 protein_id gnl|my_center|LOCUS_02750 18208 18387 gene locus_tag LOCUS_02760 18208 18387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 19553 18933 gene locus_tag LOCUS_02770 19553 18933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 <21816 19553 gene locus_tag LOCUS_02780 <21816 19553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962713.1:VWA domain-containing protein >Feature sequence012 2323 1160 gene locus_tag LOCUS_02790 2323 1160 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439713.1 protein_id gnl|my_center|LOCUS_02790 2485 3528 gene locus_tag LOCUS_02800 gene rmuC 2485 3528 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765517.1 protein_id gnl|my_center|LOCUS_02800 3945 3595 gene locus_tag LOCUS_02810 3945 3595 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421356.1 protein_id gnl|my_center|LOCUS_02810 4109 3948 gene locus_tag LOCUS_02820 4109 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 5320 4163 gene locus_tag LOCUS_02830 gene alr 5320 4163 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963814.1 protein_id gnl|my_center|LOCUS_02830 6898 5342 gene locus_tag LOCUS_02840 6898 5342 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_02840 7467 6901 gene locus_tag LOCUS_02850 7467 6901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 8060 7464 gene locus_tag LOCUS_02860 8060 7464 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886588.1 protein_id gnl|my_center|LOCUS_02860 9104 8157 gene locus_tag LOCUS_02870 9104 8157 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_02870 11613 9202 gene locus_tag LOCUS_02880 gene leuS 11613 9202 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830785.1 protein_id gnl|my_center|LOCUS_02880 11985 11638 gene locus_tag LOCUS_02890 gene rsfS 11985 11638 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475792.1 protein_id gnl|my_center|LOCUS_02890 12535 11975 gene locus_tag LOCUS_02900 gene yqeK 12535 11975 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964575.1 protein_id gnl|my_center|LOCUS_02900 13359 12766 gene locus_tag LOCUS_02910 gene nadD 13359 12766 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841927.1 protein_id gnl|my_center|LOCUS_02910 13658 13356 gene locus_tag LOCUS_02920 13658 13356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 14349 13786 gene locus_tag LOCUS_02930 14349 13786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 15818 14346 gene locus_tag LOCUS_02940 gene trpE 15818 14346 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_02940 17121 16036 gene locus_tag LOCUS_02950 17121 16036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02950 17935 17138 gene locus_tag LOCUS_02960 17935 17138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02960 18814 17939 gene locus_tag LOCUS_02970 18814 17939 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948298.1 protein_id gnl|my_center|LOCUS_02970 19930 18827 gene locus_tag LOCUS_02980 gene potA 19930 18827 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948297.1 protein_id gnl|my_center|LOCUS_02980 20301 19948 gene locus_tag LOCUS_02990 20301 19948 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060875.1 protein_id gnl|my_center|LOCUS_02990 21210 20440 gene locus_tag LOCUS_03000 21210 20440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 21453 21620 gene locus_tag LOCUS_03010 21453 21620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 >Feature sequence013 1248 37 gene locus_tag LOCUS_03020 1248 37 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461084.1 protein_id gnl|my_center|LOCUS_03020 2116 1274 gene locus_tag LOCUS_03030 gene dapF 2116 1274 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_03030 2664 2140 gene locus_tag LOCUS_03040 2664 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 4019 2691 gene locus_tag LOCUS_03050 gene glnA 4019 2691 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135328.1 protein_id gnl|my_center|LOCUS_03050 4565 4200 gene locus_tag LOCUS_03060 4565 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 8312 4590 gene locus_tag LOCUS_03070 gene addA 8312 4590 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948198.1 protein_id gnl|my_center|LOCUS_03070 11802 8296 gene locus_tag LOCUS_03080 gene addB 11802 8296 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948191.1 protein_id gnl|my_center|LOCUS_03080 11937 12986 gene locus_tag LOCUS_03090 gene xerS 11937 12986 CDS product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131037.1 protein_id gnl|my_center|LOCUS_03090 13642 13040 gene locus_tag LOCUS_03100 13642 13040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 14165 13659 gene locus_tag LOCUS_03110 14165 13659 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896384.1 protein_id gnl|my_center|LOCUS_03110 16816 14360 gene locus_tag LOCUS_03120 16816 14360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 18003 16828 gene locus_tag LOCUS_03130 18003 16828 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931069.1 protein_id gnl|my_center|LOCUS_03130 18768 18004 gene locus_tag LOCUS_03140 18768 18004 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722723.1 protein_id gnl|my_center|LOCUS_03140 21073 18785 gene locus_tag LOCUS_03150 21073 18785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 >Feature sequence014 44 256 gene locus_tag LOCUS_03160 44 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 309 1433 gene locus_tag LOCUS_03170 309 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 1934 2434 gene locus_tag LOCUS_03180 1934 2434 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964287.1 protein_id gnl|my_center|LOCUS_03180 2708 4612 gene locus_tag LOCUS_03190 2708 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 4678 4947 gene locus_tag LOCUS_03200 4678 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 5244 5343 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5460 6863 gene locus_tag LOCUS_03210 5460 6863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03210 6847 7473 gene locus_tag LOCUS_03220 6847 7473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03220 7510 8583 gene locus_tag LOCUS_03230 7510 8583 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202293.1 protein_id gnl|my_center|LOCUS_03230 8567 11545 gene locus_tag LOCUS_03240 8567 11545 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202280.1 protein_id gnl|my_center|LOCUS_03240 11918 13477 gene locus_tag LOCUS_03250 11918 13477 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_03250 14879 13566 gene locus_tag LOCUS_03260 14879 13566 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_03260 15900 15094 gene locus_tag LOCUS_03270 15900 15094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 16085 18409 gene locus_tag LOCUS_03280 16085 18409 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027862.1 protein_id gnl|my_center|LOCUS_03280 18722 18465 gene locus_tag LOCUS_03290 18722 18465 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546482.1 protein_id gnl|my_center|LOCUS_03290 19987 18992 gene locus_tag LOCUS_03300 19987 18992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 21064 20012 gene locus_tag LOCUS_03310 gene rhaS 21064 20012 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582803.1 protein_id gnl|my_center|LOCUS_03310 >Feature sequence015 1724 1074 gene locus_tag LOCUS_03320 1724 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03320 3120 1702 gene locus_tag LOCUS_03330 3120 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03330 3911 3123 gene locus_tag LOCUS_03340 3911 3123 CDS product DUF4366 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035394374.1 protein_id gnl|my_center|LOCUS_03340 4134 3901 gene locus_tag LOCUS_03350 4134 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 5578 4172 gene locus_tag LOCUS_03360 5578 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 5864 5499 gene locus_tag LOCUS_03370 5864 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03370 6380 5901 gene locus_tag LOCUS_03380 6380 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 7561 6404 gene locus_tag LOCUS_03390 7561 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 9948 7564 gene locus_tag LOCUS_03400 9948 7564 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_03400 10300 9905 gene locus_tag LOCUS_03410 10300 9905 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861115.1 protein_id gnl|my_center|LOCUS_03410 11198 10329 gene locus_tag LOCUS_03420 11198 10329 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610323.1 protein_id gnl|my_center|LOCUS_03420 11581 12006 gene locus_tag LOCUS_03430 11581 12006 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022043.1 protein_id gnl|my_center|LOCUS_03430 12024 12941 gene locus_tag LOCUS_03440 12024 12941 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027108.1 protein_id gnl|my_center|LOCUS_03440 14718 13024 gene locus_tag LOCUS_03450 14718 13024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 15284 15087 gene locus_tag LOCUS_03460 15284 15087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 15450 15241 gene locus_tag LOCUS_03470 15450 15241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 17908 15614 gene locus_tag LOCUS_03480 17908 15614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 18128 19726 gene locus_tag LOCUS_03490 gene tndX 18128 19726 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_03490 >Feature sequence016 348 3464 gene locus_tag LOCUS_03500 gene ileS 348 3464 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986028.1 protein_id gnl|my_center|LOCUS_03500 3702 3863 gene locus_tag LOCUS_03510 3702 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 3793 4764 gene locus_tag LOCUS_03520 gene cbiD 3793 4764 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836528.1 protein_id gnl|my_center|LOCUS_03520 4792 5544 gene locus_tag LOCUS_03530 gene cobM 4792 5544 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681800.1 protein_id gnl|my_center|LOCUS_03530 5541 6539 gene locus_tag LOCUS_03540 gene cbiG 5541 6539 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948632.1 protein_id gnl|my_center|LOCUS_03540 6540 7268 gene locus_tag LOCUS_03550 gene cobJ 6540 7268 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016778.1 protein_id gnl|my_center|LOCUS_03550 7261 7980 gene locus_tag LOCUS_03560 gene cobK 7261 7980 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721598.1 protein_id gnl|my_center|LOCUS_03560 7982 9139 gene locus_tag LOCUS_03570 7982 9139 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943626.1 protein_id gnl|my_center|LOCUS_03570 9136 10464 gene locus_tag LOCUS_03580 9136 10464 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861968.1 protein_id gnl|my_center|LOCUS_03580 10452 11486 gene locus_tag LOCUS_03590 gene cobT 10452 11486 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_03590 11487 11981 gene locus_tag LOCUS_03600 gene cobU 11487 11981 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948598.1 protein_id gnl|my_center|LOCUS_03600 11993 12754 gene locus_tag LOCUS_03610 gene cobS 11993 12754 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437766.1 protein_id gnl|my_center|LOCUS_03610 12742 13107 gene locus_tag LOCUS_03620 12742 13107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 13361 13912 gene locus_tag LOCUS_03630 gene cobC 13361 13912 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964694.1 protein_id gnl|my_center|LOCUS_03630 13884 14855 gene locus_tag LOCUS_03640 gene cbiB 13884 14855 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861967.1 protein_id gnl|my_center|LOCUS_03640 14852 15862 gene locus_tag LOCUS_03650 14852 15862 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016795.1 protein_id gnl|my_center|LOCUS_03650 15855 17324 gene locus_tag LOCUS_03660 15855 17324 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168494.1 protein_id gnl|my_center|LOCUS_03660 17327 17830 gene locus_tag LOCUS_03670 gene cobO 17327 17830 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546229.1 protein_id gnl|my_center|LOCUS_03670 17830 18459 gene locus_tag LOCUS_03680 17830 18459 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948611.1 protein_id gnl|my_center|LOCUS_03680 19397 18456 gene locus_tag LOCUS_03690 19397 18456 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_03690 19741 19520 gene locus_tag LOCUS_03700 19741 19520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 >Feature sequence017 6615 91 gene locus_tag LOCUS_03710 6615 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 13917 6631 gene locus_tag LOCUS_03720 13917 6631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 14272 13982 gene locus_tag LOCUS_03730 14272 13982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 15657 14428 gene locus_tag LOCUS_03740 15657 14428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 17493 15898 gene locus_tag LOCUS_03750 17493 15898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 18409 17534 gene locus_tag LOCUS_03760 18409 17534 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_03760 19356 18409 gene locus_tag LOCUS_03770 19356 18409 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_03770 >Feature sequence018 <1 1818 gene locus_tag LOCUS_03780 <1 1818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963830.1:excinuclease ABC subunit UvrC 1818 2618 gene locus_tag LOCUS_03790 gene pgeF 1818 2618 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209022.1 protein_id gnl|my_center|LOCUS_03790 2634 4238 gene locus_tag LOCUS_03800 2634 4238 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016819.1 protein_id gnl|my_center|LOCUS_03800 4235 5470 gene locus_tag LOCUS_03810 4235 5470 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_03810 5474 5884 gene locus_tag LOCUS_03820 5474 5884 CDS product HutP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392857.1 protein_id gnl|my_center|LOCUS_03820 5922 6284 gene locus_tag LOCUS_03830 gene aroH 5922 6284 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020790.1 protein_id gnl|my_center|LOCUS_03830 6295 6966 gene locus_tag LOCUS_03840 gene cmk 6295 6966 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361252.1 protein_id gnl|my_center|LOCUS_03840 6956 7558 gene locus_tag LOCUS_03850 6956 7558 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460203.1 protein_id gnl|my_center|LOCUS_03850 7555 9594 gene locus_tag LOCUS_03860 7555 9594 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965152.1 protein_id gnl|my_center|LOCUS_03860 9664 11037 gene locus_tag LOCUS_03870 gene murD 9664 11037 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966471.1 protein_id gnl|my_center|LOCUS_03870 11039 12067 gene locus_tag LOCUS_03880 11039 12067 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459800.1 protein_id gnl|my_center|LOCUS_03880 12052 13062 gene locus_tag LOCUS_03890 12052 13062 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_03890 13204 14193 gene locus_tag LOCUS_03900 13204 14193 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811663.1 protein_id gnl|my_center|LOCUS_03900 14210 14863 gene locus_tag LOCUS_03910 14210 14863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 15906 14866 gene locus_tag LOCUS_03920 gene rsxC 15906 14866 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480691.1 protein_id gnl|my_center|LOCUS_03920 16177 16881 gene locus_tag LOCUS_03930 16177 16881 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_03930 16883 17359 gene locus_tag LOCUS_03940 16883 17359 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656744.1 protein_id gnl|my_center|LOCUS_03940 17843 18664 gene locus_tag LOCUS_03950 gene psrA 17843 18664 CDS product tyrosine-type DNA invertase PsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651183.1 protein_id gnl|my_center|LOCUS_03950 >Feature sequence019 202 852 gene locus_tag LOCUS_03960 202 852 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_03960 920 1735 gene locus_tag LOCUS_03970 920 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679695.1 protein_id gnl|my_center|LOCUS_03970 1779 3740 gene locus_tag LOCUS_03980 gene uvrB 1779 3740 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891935.1 protein_id gnl|my_center|LOCUS_03980 3743 4123 gene locus_tag LOCUS_03990 3743 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 4156 6978 gene locus_tag LOCUS_04000 gene uvrA 4156 6978 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401468.1 protein_id gnl|my_center|LOCUS_04000 7294 9042 gene locus_tag LOCUS_04010 gene thrS 7294 9042 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_04010 9095 9772 gene locus_tag LOCUS_04020 gene yunB 9095 9772 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418439.1 protein_id gnl|my_center|LOCUS_04020 9759 11744 gene locus_tag LOCUS_04030 gene ligA 9759 11744 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_04030 11741 12910 gene locus_tag LOCUS_04040 11741 12910 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016873.1 protein_id gnl|my_center|LOCUS_04040 12963 13661 gene locus_tag LOCUS_04050 12963 13661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439005.1 protein_id gnl|my_center|LOCUS_04050 14412 13714 gene locus_tag LOCUS_04060 14412 13714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 14933 15820 gene locus_tag LOCUS_04070 14933 15820 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716331.1 protein_id gnl|my_center|LOCUS_04070 15822 17513 gene locus_tag LOCUS_04080 15822 17513 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_04080 17510 18421 gene locus_tag LOCUS_04090 17510 18421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 >Feature sequence020 1234 773 gene locus_tag LOCUS_04100 1234 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 1367 1708 gene locus_tag LOCUS_04110 1367 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 1794 2933 gene locus_tag LOCUS_04120 1794 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 3974 3045 gene locus_tag LOCUS_04130 3974 3045 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966067.1 protein_id gnl|my_center|LOCUS_04130 4128 4481 gene locus_tag LOCUS_04140 4128 4481 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104332.1 protein_id gnl|my_center|LOCUS_04140 4570 4716 gene locus_tag LOCUS_04150 4570 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 4864 5166 gene locus_tag LOCUS_04160 4864 5166 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461875.1 protein_id gnl|my_center|LOCUS_04160 5179 7719 gene locus_tag LOCUS_04170 5179 7719 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_04170 7749 8009 gene locus_tag LOCUS_04180 7749 8009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 8098 8529 gene locus_tag LOCUS_04190 8098 8529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 8686 9426 gene locus_tag LOCUS_04200 gene cas6 8686 9426 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899496.1 protein_id gnl|my_center|LOCUS_04200 9429 11705 gene locus_tag LOCUS_04210 gene cas10 9429 11705 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900580.1 protein_id gnl|my_center|LOCUS_04210 11713 12201 gene locus_tag LOCUS_04220 gene csm2 11713 12201 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414296.1 protein_id gnl|my_center|LOCUS_04220 12222 12893 gene locus_tag LOCUS_04230 gene csm3 12222 12893 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414292.1 protein_id gnl|my_center|LOCUS_04230 12883 13809 gene locus_tag LOCUS_04240 gene csm4 12883 13809 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414288.1 protein_id gnl|my_center|LOCUS_04240 13848 14918 gene locus_tag LOCUS_04250 gene csm5 13848 14918 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414285.1 protein_id gnl|my_center|LOCUS_04250 15110 15432 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtataaaaccacctaacccccataggggacggaaac 15482 16486 gene locus_tag LOCUS_04260 gene cas1 15482 16486 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414279.1 protein_id gnl|my_center|LOCUS_04260 16556 16885 gene locus_tag LOCUS_04270 16556 16885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 16912 18237 gene locus_tag LOCUS_04280 gene csm6 16912 18237 CDS product type III-A CRISPR-associated CARF protein Csm6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899494.1 protein_id gnl|my_center|LOCUS_04280 >Feature sequence021 1110 4 gene locus_tag LOCUS_04290 gene recA 1110 4 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_04290 1695 1207 gene locus_tag LOCUS_04300 1695 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 2886 1708 gene locus_tag LOCUS_04310 gene thiI 2886 1708 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_04310 4026 2887 gene locus_tag LOCUS_04320 4026 2887 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_04320 4631 4023 gene locus_tag LOCUS_04330 4631 4023 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454892.1 protein_id gnl|my_center|LOCUS_04330 5291 4662 gene locus_tag LOCUS_04340 gene rpe 5291 4662 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532059.1 protein_id gnl|my_center|LOCUS_04340 6151 5288 gene locus_tag LOCUS_04350 gene rsgA 6151 5288 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_04350 8289 6160 gene locus_tag LOCUS_04360 gene pknB 8289 6160 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733096.1 protein_id gnl|my_center|LOCUS_04360 9022 8276 gene locus_tag LOCUS_04370 9022 8276 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723065.1 protein_id gnl|my_center|LOCUS_04370 10088 9063 gene locus_tag LOCUS_04380 gene rlmN 10088 9063 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_04380 11351 10092 gene locus_tag LOCUS_04390 gene rsmB 11351 10092 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_04390 12043 11351 gene locus_tag LOCUS_04400 12043 11351 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965031.1 protein_id gnl|my_center|LOCUS_04400 12986 12054 gene locus_tag LOCUS_04410 gene fmt 12986 12054 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_04410 13448 12999 gene locus_tag LOCUS_04420 gene def 13448 12999 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388617.1 protein_id gnl|my_center|LOCUS_04420 15899 13464 gene locus_tag LOCUS_04430 gene priA 15899 13464 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_04430 16260 15910 gene locus_tag LOCUS_04440 16260 15910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 16882 16280 gene locus_tag LOCUS_04450 gene gmk 16882 16280 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131468.1 protein_id gnl|my_center|LOCUS_04450 17141 16875 gene locus_tag LOCUS_04460 17141 16875 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388626.1 protein_id gnl|my_center|LOCUS_04460 18076 17153 gene locus_tag LOCUS_04470 18076 17153 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_04470 >Feature sequence022 60 545 gene locus_tag LOCUS_04480 60 545 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853175.1 protein_id gnl|my_center|LOCUS_04480 640 2406 gene locus_tag LOCUS_04490 640 2406 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_04490 2431 3096 gene locus_tag LOCUS_04500 2431 3096 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_04500 3093 4433 gene locus_tag LOCUS_04510 3093 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 4523 4960 gene locus_tag LOCUS_04520 4523 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 5029 6765 gene locus_tag LOCUS_04530 5029 6765 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_04530 6758 8632 gene locus_tag LOCUS_04540 6758 8632 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_04540 8838 9041 gene locus_tag LOCUS_04550 8838 9041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 9070 11403 gene locus_tag LOCUS_04560 9070 11403 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922513.1 protein_id gnl|my_center|LOCUS_04560 11416 12153 gene locus_tag LOCUS_04570 gene cas5c 11416 12153 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205009051.1 protein_id gnl|my_center|LOCUS_04570 12128 14014 gene locus_tag LOCUS_04580 gene cas8c 12128 14014 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922511.1 protein_id gnl|my_center|LOCUS_04580 14050 14886 gene locus_tag LOCUS_04590 gene cas7c 14050 14886 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922510.1 protein_id gnl|my_center|LOCUS_04590 14897 15550 gene locus_tag LOCUS_04600 gene cas4 14897 15550 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 protein_id gnl|my_center|LOCUS_04600 15541 16572 gene locus_tag LOCUS_04610 gene cas1c 15541 16572 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932802.1 protein_id gnl|my_center|LOCUS_04610 16581 16871 gene locus_tag LOCUS_04620 gene cas2 16581 16871 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 protein_id gnl|my_center|LOCUS_04620 17033 >18034 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcgccccactcggggcgcgtggattgaaat >Feature sequence023 127 1068 gene locus_tag LOCUS_04630 127 1068 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966232.1 protein_id gnl|my_center|LOCUS_04630 1481 1065 gene locus_tag LOCUS_04640 1481 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 3531 1603 gene locus_tag LOCUS_04650 gene gyrB 3531 1603 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_04650 3818 3570 gene locus_tag LOCUS_04660 3818 3570 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024026196.1 protein_id gnl|my_center|LOCUS_04660 4912 3818 gene locus_tag LOCUS_04670 gene recF 4912 3818 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470745.1 protein_id gnl|my_center|LOCUS_04670 5142 4912 gene locus_tag LOCUS_04680 gene yaaA 5142 4912 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420479.1 protein_id gnl|my_center|LOCUS_04680 7449 5188 gene locus_tag LOCUS_04690 7449 5188 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422921.1 protein_id gnl|my_center|LOCUS_04690 9195 7480 gene locus_tag LOCUS_04700 9195 7480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 9450 10355 gene locus_tag LOCUS_04710 9450 10355 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716331.1 protein_id gnl|my_center|LOCUS_04710 10352 11209 gene locus_tag LOCUS_04720 gene pstC 10352 11209 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595180.1 protein_id gnl|my_center|LOCUS_04720 11209 12087 gene locus_tag LOCUS_04730 gene pstA 11209 12087 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427927.1 protein_id gnl|my_center|LOCUS_04730 12108 12854 gene locus_tag LOCUS_04740 gene pstB 12108 12854 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_04740 12854 13498 gene locus_tag LOCUS_04750 gene phoU 12854 13498 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_04750 14979 13585 gene locus_tag LOCUS_04760 14979 13585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 15502 15002 gene locus_tag LOCUS_04770 15502 15002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 16670 15825 gene locus_tag LOCUS_04780 16670 15825 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245605.1 protein_id gnl|my_center|LOCUS_04780 <17762 16691 gene locus_tag LOCUS_04790 <17762 16691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003421389.1:peptide chain release factor 1 >Feature sequence024 1061 96 gene locus_tag LOCUS_04800 1061 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 2259 1219 gene locus_tag LOCUS_04810 2259 1219 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895264.1 protein_id gnl|my_center|LOCUS_04810 2299 2308 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2447 4552 gene locus_tag LOCUS_04820 2447 4552 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_04820 4732 5253 gene locus_tag LOCUS_04830 4732 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 5276 6811 gene locus_tag LOCUS_04840 gene cls 5276 6811 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262851.1 protein_id gnl|my_center|LOCUS_04840 7112 6870 gene locus_tag LOCUS_04850 7112 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 7434 8597 gene locus_tag LOCUS_04860 7434 8597 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808433.1 protein_id gnl|my_center|LOCUS_04860 8611 9102 gene locus_tag LOCUS_04870 gene trmL 8611 9102 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_04870 9115 9984 gene locus_tag LOCUS_04880 9115 9984 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438997.1 protein_id gnl|my_center|LOCUS_04880 9985 11202 gene locus_tag LOCUS_04890 9985 11202 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_04890 11245 12432 gene locus_tag LOCUS_04900 11245 12432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 12425 14353 gene locus_tag LOCUS_04910 gene metG 12425 14353 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_04910 14378 15727 gene locus_tag LOCUS_04920 gene glmM 14378 15727 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_04920 15740 16804 gene locus_tag LOCUS_04930 15740 16804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 >Feature sequence025 40 3183 gene locus_tag LOCUS_04940 40 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 3408 6188 gene locus_tag LOCUS_04950 3408 6188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 6362 11074 gene locus_tag LOCUS_04960 6362 11074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 11085 12476 gene locus_tag LOCUS_04970 11085 12476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 12817 12659 gene locus_tag LOCUS_04980 12817 12659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 13095 12913 gene locus_tag LOCUS_04990 13095 12913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 13430 13696 gene locus_tag LOCUS_05000 13430 13696 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054876196.1 protein_id gnl|my_center|LOCUS_05000 13689 13952 gene locus_tag LOCUS_05010 13689 13952 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812414.1 protein_id gnl|my_center|LOCUS_05010 14246 14827 gene locus_tag LOCUS_05020 14246 14827 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887442.1 protein_id gnl|my_center|LOCUS_05020 14878 15270 gene locus_tag LOCUS_05030 14878 15270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 15389 16930 gene locus_tag LOCUS_05040 15389 16930 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680024.1 protein_id gnl|my_center|LOCUS_05040 >Feature sequence026 484 3036 gene locus_tag LOCUS_05050 484 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 3648 4856 gene locus_tag LOCUS_05060 gene ilvA 3648 4856 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272642.1 protein_id gnl|my_center|LOCUS_05060 4860 6047 gene locus_tag LOCUS_05070 4860 6047 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853125.1 protein_id gnl|my_center|LOCUS_05070 6044 6523 gene locus_tag LOCUS_05080 gene recX 6044 6523 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455548.1 protein_id gnl|my_center|LOCUS_05080 6528 7853 gene locus_tag LOCUS_05090 gene rimO 6528 7853 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_05090 7857 8405 gene locus_tag LOCUS_05100 gene pgsA 7857 8405 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244753.1 protein_id gnl|my_center|LOCUS_05100 8420 9058 gene locus_tag LOCUS_05110 gene hisIE 8420 9058 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861249.1 protein_id gnl|my_center|LOCUS_05110 9080 9268 gene locus_tag LOCUS_05120 9080 9268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 9371 12013 gene locus_tag LOCUS_05130 9371 12013 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_05130 12609 13034 gene locus_tag LOCUS_05140 gene infC 12609 13034 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973215.1 protein_id gnl|my_center|LOCUS_05140 13068 13271 gene locus_tag LOCUS_05150 gene rpmI 13068 13271 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942164.1 protein_id gnl|my_center|LOCUS_05150 13294 13647 gene locus_tag LOCUS_05160 gene rplT 13294 13647 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429730.1 protein_id gnl|my_center|LOCUS_05160 13687 13696 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13769 14248 gene locus_tag LOCUS_05170 gene sigM 13769 14248 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224177.1 protein_id gnl|my_center|LOCUS_05170 14238 14801 gene locus_tag LOCUS_05180 14238 14801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 14850 15830 gene locus_tag LOCUS_05190 14850 15830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 15929 16378 gene locus_tag LOCUS_05200 15929 16378 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815996.1 protein_id gnl|my_center|LOCUS_05200 16689 16399 gene locus_tag LOCUS_05210 16689 16399 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398814.1 protein_id gnl|my_center|LOCUS_05210 >Feature sequence027 249 94 gene locus_tag LOCUS_05220 249 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 2744 270 gene locus_tag LOCUS_05230 2744 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 3024 2803 gene locus_tag LOCUS_05240 3024 2803 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_05240 3309 3100 gene locus_tag LOCUS_05250 3309 3100 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_05250 4596 3526 gene locus_tag LOCUS_05260 gene uxuA 4596 3526 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391968.1 protein_id gnl|my_center|LOCUS_05260 6623 4611 gene locus_tag LOCUS_05270 6623 4611 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109145.1 protein_id gnl|my_center|LOCUS_05270 8604 6646 gene locus_tag LOCUS_05280 8604 6646 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575935.1 protein_id gnl|my_center|LOCUS_05280 9449 8733 gene locus_tag LOCUS_05290 9449 8733 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_05290 12976 9479 gene locus_tag LOCUS_05300 12976 9479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 13541 14368 gene locus_tag LOCUS_05310 13541 14368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 14760 15746 gene locus_tag LOCUS_05320 gene mgrA 14760 15746 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640297.1 protein_id gnl|my_center|LOCUS_05320 15878 16162 gene locus_tag LOCUS_05330 15878 16162 CDS product Nif11-like leader peptide family natural product precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439731.1 protein_id gnl|my_center|LOCUS_05330 >Feature sequence028 938 1957 gene locus_tag LOCUS_05340 gene aroF 938 1957 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393889.1 protein_id gnl|my_center|LOCUS_05340 1970 2782 gene locus_tag LOCUS_05350 gene pheA 1970 2782 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060994.1 protein_id gnl|my_center|LOCUS_05350 2977 5604 gene locus_tag LOCUS_05360 gene ppdK 2977 5604 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_05360 5913 9722 gene locus_tag LOCUS_05370 gene rpoB 5913 9722 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436174.1 protein_id gnl|my_center|LOCUS_05370 9767 13570 gene locus_tag LOCUS_05380 9767 13570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 13691 14998 gene locus_tag LOCUS_05390 13691 14998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 15611 15030 gene locus_tag LOCUS_05400 gene folE 15611 15030 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451708.1 protein_id gnl|my_center|LOCUS_05400 16292 15612 gene locus_tag LOCUS_05410 gene queE 16292 15612 CDS product putative 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966888.1 protein_id gnl|my_center|LOCUS_05410 >Feature sequence029 <1 3257 gene locus_tag LOCUS_05420 <1 3257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109240.1:DUF5107 domain-containing protein 3262 5892 gene locus_tag LOCUS_05430 3262 5892 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202548.1 protein_id gnl|my_center|LOCUS_05430 6452 6066 gene locus_tag LOCUS_05440 6452 6066 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878336.1 protein_id gnl|my_center|LOCUS_05440 7049 6453 gene locus_tag LOCUS_05450 7049 6453 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426696.1 protein_id gnl|my_center|LOCUS_05450 7351 7103 gene locus_tag LOCUS_05460 7351 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 7679 7374 gene locus_tag LOCUS_05470 7679 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 7921 7697 gene locus_tag LOCUS_05480 7921 7697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 8546 8058 gene locus_tag LOCUS_05490 8546 8058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 9029 8562 gene locus_tag LOCUS_05500 9029 8562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 10158 9043 gene locus_tag LOCUS_05510 10158 9043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 12032 10155 gene locus_tag LOCUS_05520 12032 10155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 13575 12037 gene locus_tag LOCUS_05530 gene murJ 13575 12037 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966328.1 protein_id gnl|my_center|LOCUS_05530 15773 13572 gene locus_tag LOCUS_05540 15773 13572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 >Feature sequence030 99 2564 gene locus_tag LOCUS_05550 99 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 2554 4512 gene locus_tag LOCUS_05560 2554 4512 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_05560 4505 5242 gene locus_tag LOCUS_05570 gene folD 4505 5242 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_05570 6981 5287 gene locus_tag LOCUS_05580 6981 5287 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_05580 7172 8944 gene locus_tag LOCUS_05590 gene aspS 7172 8944 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454140.1 protein_id gnl|my_center|LOCUS_05590 9062 8865 gene locus_tag LOCUS_05600 9062 8865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 9040 10392 gene locus_tag LOCUS_05610 9040 10392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 10402 11199 gene locus_tag LOCUS_05620 10402 11199 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966200.1 protein_id gnl|my_center|LOCUS_05620 11730 11566 gene locus_tag LOCUS_05630 11730 11566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 11893 14484 gene locus_tag LOCUS_05640 11893 14484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243379.1 protein_id gnl|my_center|LOCUS_05640 15105 14551 gene locus_tag LOCUS_05650 15105 14551 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_05650 15506 15129 gene locus_tag LOCUS_05660 15506 15129 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_05660 >Feature sequence031 186 2171 gene locus_tag LOCUS_05670 gene glgB 186 2171 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272358.1 protein_id gnl|my_center|LOCUS_05670 2227 3432 gene locus_tag LOCUS_05680 gene glgC 2227 3432 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057619.1 protein_id gnl|my_center|LOCUS_05680 3450 4568 gene locus_tag LOCUS_05690 gene glgD 3450 4568 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_05690 4699 6684 gene locus_tag LOCUS_05700 4699 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 6717 9188 gene locus_tag LOCUS_05710 6717 9188 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680347.1 protein_id gnl|my_center|LOCUS_05710 9307 11238 gene locus_tag LOCUS_05720 9307 11238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 11923 11285 gene locus_tag LOCUS_05730 11923 11285 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965894.1 protein_id gnl|my_center|LOCUS_05730 12379 13197 gene locus_tag LOCUS_05740 12379 13197 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285996.1 protein_id gnl|my_center|LOCUS_05740 13230 14072 gene locus_tag LOCUS_05750 gene kduI 13230 14072 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098576.1 protein_id gnl|my_center|LOCUS_05750 14260 14868 gene locus_tag LOCUS_05760 14260 14868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 15008 15166 gene locus_tag LOCUS_05770 15008 15166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 >Feature sequence032 123 1475 gene locus_tag LOCUS_05780 123 1475 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224972.1 protein_id gnl|my_center|LOCUS_05780 2807 1587 gene locus_tag LOCUS_05790 gene tyrS 2807 1587 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_05790 3085 2900 gene locus_tag LOCUS_05800 3085 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 3783 3082 gene locus_tag LOCUS_05810 3783 3082 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392585.1 protein_id gnl|my_center|LOCUS_05810 3943 4860 gene locus_tag LOCUS_05820 gene metA 3943 4860 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_05820 5399 5136 gene locus_tag LOCUS_05830 gene rpsT 5399 5136 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_05830 6306 5563 gene locus_tag LOCUS_05840 6306 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 6422 6273 gene locus_tag LOCUS_05850 6422 6273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 7442 6540 gene locus_tag LOCUS_05860 gene era 7442 6540 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_05860 7940 7452 gene locus_tag LOCUS_05870 gene ybeY 7940 7452 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047996.1 protein_id gnl|my_center|LOCUS_05870 8922 7933 gene locus_tag LOCUS_05880 8922 7933 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_05880 10141 8885 gene locus_tag LOCUS_05890 gene yqfD 10141 8885 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792478.1 protein_id gnl|my_center|LOCUS_05890 10426 10157 gene locus_tag LOCUS_05900 gene yqfC 10426 10157 CDS product sporulation protein YqfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226191.1 protein_id gnl|my_center|LOCUS_05900 10527 11603 gene locus_tag LOCUS_05910 10527 11603 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438084.1 protein_id gnl|my_center|LOCUS_05910 12923 11643 gene locus_tag LOCUS_05920 gene obgE 12923 11643 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048021.1 protein_id gnl|my_center|LOCUS_05920 13283 13029 gene locus_tag LOCUS_05930 gene rpmA 13283 13029 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053095207.1 protein_id gnl|my_center|LOCUS_05930 13639 13328 gene locus_tag LOCUS_05940 gene rplU 13639 13328 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 protein_id gnl|my_center|LOCUS_05940 15085 13766 gene locus_tag LOCUS_05950 15085 13766 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_05950 >Feature sequence033 61 1002 gene locus_tag LOCUS_05960 gene hprK 61 1002 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_05960 1019 1750 gene locus_tag LOCUS_05970 1019 1750 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393968.1 protein_id gnl|my_center|LOCUS_05970 1801 2700 gene locus_tag LOCUS_05980 gene murB 1801 2700 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_05980 2712 3569 gene locus_tag LOCUS_05990 gene rapZ 2712 3569 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963833.1 protein_id gnl|my_center|LOCUS_05990 3608 4588 gene locus_tag LOCUS_06000 3608 4588 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891913.1 protein_id gnl|my_center|LOCUS_06000 4606 5463 gene locus_tag LOCUS_06010 gene whiA 4606 5463 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357358.1 protein_id gnl|my_center|LOCUS_06010 5639 9106 gene locus_tag LOCUS_06020 5639 9106 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048304.1 protein_id gnl|my_center|LOCUS_06020 9263 9475 gene locus_tag LOCUS_06030 gene mtrB 9263 9475 CDS product trp RNA-binding attenuation protein MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393370.1 protein_id gnl|my_center|LOCUS_06030 9510 9710 gene locus_tag LOCUS_06040 9510 9710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 9734 10711 gene locus_tag LOCUS_06050 gene pfkA 9734 10711 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_06050 10734 11003 gene locus_tag LOCUS_06060 10734 11003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 11045 12799 gene locus_tag LOCUS_06070 gene pyk 11045 12799 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_06070 12843 13271 gene locus_tag LOCUS_06080 12843 13271 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948808.1 protein_id gnl|my_center|LOCUS_06080 13274 14239 gene locus_tag LOCUS_06090 13274 14239 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942316.1 protein_id gnl|my_center|LOCUS_06090 14307 14441 gene locus_tag LOCUS_06100 14307 14441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 >Feature sequence034 132 1256 gene locus_tag LOCUS_06110 132 1256 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_06110 2134 1208 gene locus_tag LOCUS_06120 2134 1208 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964333.1 protein_id gnl|my_center|LOCUS_06120 2382 3269 gene locus_tag LOCUS_06130 2382 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 3269 5149 gene locus_tag LOCUS_06140 gene mnmG 3269 5149 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_06140 5155 6258 gene locus_tag LOCUS_06150 5155 6258 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583054.1 protein_id gnl|my_center|LOCUS_06150 6353 7741 gene locus_tag LOCUS_06160 6353 7741 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_06160 7757 8941 gene locus_tag LOCUS_06170 7757 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 9111 10112 gene locus_tag LOCUS_06180 9111 10112 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439336.1 protein_id gnl|my_center|LOCUS_06180 10109 11014 gene locus_tag LOCUS_06190 10109 11014 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948810.1 protein_id gnl|my_center|LOCUS_06190 11007 11780 gene locus_tag LOCUS_06200 11007 11780 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948811.1 protein_id gnl|my_center|LOCUS_06200 13687 11843 gene locus_tag LOCUS_06210 13687 11843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 14435 13662 gene locus_tag LOCUS_06220 14435 13662 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017012.1 protein_id gnl|my_center|LOCUS_06220 >Feature sequence035 97 297 gene locus_tag LOCUS_06230 97 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 363 590 gene locus_tag LOCUS_06240 363 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 577 1824 gene locus_tag LOCUS_06250 577 1824 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047809.1 protein_id gnl|my_center|LOCUS_06250 1821 3134 gene locus_tag LOCUS_06260 1821 3134 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921892.1 protein_id gnl|my_center|LOCUS_06260 3188 3721 gene locus_tag LOCUS_06270 3188 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 3749 4573 gene locus_tag LOCUS_06280 3749 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 4599 4964 gene locus_tag LOCUS_06290 4599 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 4948 5265 gene locus_tag LOCUS_06300 4948 5265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 5255 5590 gene locus_tag LOCUS_06310 5255 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 5595 5936 gene locus_tag LOCUS_06320 5595 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 5991 6587 gene locus_tag LOCUS_06330 5991 6587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 6669 6938 gene locus_tag LOCUS_06340 6669 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 6956 7123 gene locus_tag LOCUS_06350 6956 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 7126 8856 gene locus_tag LOCUS_06360 7126 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 8899 9744 gene locus_tag LOCUS_06370 8899 9744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 9737 11155 gene locus_tag LOCUS_06380 9737 11155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 11175 11573 gene locus_tag LOCUS_06390 11175 11573 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357842.1 protein_id gnl|my_center|LOCUS_06390 11632 12429 gene locus_tag LOCUS_06400 11632 12429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 14138 12483 gene locus_tag LOCUS_06410 gene leuA 14138 12483 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963596.1 protein_id gnl|my_center|LOCUS_06410 >Feature sequence036 168 2657 gene locus_tag LOCUS_06420 168 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 2739 3395 gene locus_tag LOCUS_06430 2739 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 3668 4354 gene locus_tag LOCUS_06440 3668 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 4403 6778 gene locus_tag LOCUS_06450 4403 6778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 7035 7766 gene locus_tag LOCUS_06460 7035 7766 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_06460 7887 8201 gene locus_tag LOCUS_06470 7887 8201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 8515 8258 gene locus_tag LOCUS_06480 gene spoIIID 8515 8258 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356559.1 protein_id gnl|my_center|LOCUS_06480 8718 9944 gene locus_tag LOCUS_06490 8718 9944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 10091 10504 gene locus_tag LOCUS_06500 gene nusB 10091 10504 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286662.1 protein_id gnl|my_center|LOCUS_06500 10501 11433 gene locus_tag LOCUS_06510 10501 11433 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393029.1 protein_id gnl|my_center|LOCUS_06510 11436 12614 gene locus_tag LOCUS_06520 gene xseA 11436 12614 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965382.1 protein_id gnl|my_center|LOCUS_06520 12649 12876 gene locus_tag LOCUS_06530 12649 12876 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948035.1 protein_id gnl|my_center|LOCUS_06530 12866 13747 gene locus_tag LOCUS_06540 12866 13747 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_06540 13757 14200 gene locus_tag LOCUS_06550 13757 14200 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810945.1 protein_id gnl|my_center|LOCUS_06550 >Feature sequence037 574 23 gene locus_tag LOCUS_06560 574 23 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966371.1 protein_id gnl|my_center|LOCUS_06560 1606 578 gene locus_tag LOCUS_06570 1606 578 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830750.1 protein_id gnl|my_center|LOCUS_06570 2290 1673 gene locus_tag LOCUS_06580 gene hisB 2290 1673 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 protein_id gnl|my_center|LOCUS_06580 3588 2290 gene locus_tag LOCUS_06590 gene hisD 3588 2290 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530482.1 protein_id gnl|my_center|LOCUS_06590 4740 3610 gene locus_tag LOCUS_06600 gene dnaJ 4740 3610 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_06600 6672 4852 gene locus_tag LOCUS_06610 gene dnaK 6672 4852 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_06610 7237 6707 gene locus_tag LOCUS_06620 gene grpE 7237 6707 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964593.1 protein_id gnl|my_center|LOCUS_06620 8313 7276 gene locus_tag LOCUS_06630 gene hrcA 8313 7276 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964592.1 protein_id gnl|my_center|LOCUS_06630 9551 8454 gene locus_tag LOCUS_06640 gene hemW 9551 8454 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099423.1 protein_id gnl|my_center|LOCUS_06640 10099 9629 gene locus_tag LOCUS_06650 10099 9629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428343.1 protein_id gnl|my_center|LOCUS_06650 10688 10128 gene locus_tag LOCUS_06660 gene efp 10688 10128 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_06660 12485 10851 gene locus_tag LOCUS_06670 12485 10851 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_06670 14093 12510 gene locus_tag LOCUS_06680 14093 12510 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_06680 >Feature sequence038 30 479 gene locus_tag LOCUS_06690 gene ctsR 30 479 CDS product transcriptional regulator CtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244565.1 protein_id gnl|my_center|LOCUS_06690 494 865 gene locus_tag LOCUS_06700 494 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 862 1860 gene locus_tag LOCUS_06710 862 1860 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050828.1 protein_id gnl|my_center|LOCUS_06710 1888 4338 gene locus_tag LOCUS_06720 1888 4338 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048366.1 protein_id gnl|my_center|LOCUS_06720 5697 4519 gene locus_tag LOCUS_06730 5697 4519 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 protein_id gnl|my_center|LOCUS_06730 6664 5768 gene locus_tag LOCUS_06740 6664 5768 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101955.1 protein_id gnl|my_center|LOCUS_06740 6906 6661 gene locus_tag LOCUS_06750 6906 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 7943 7068 gene locus_tag LOCUS_06760 7943 7068 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_06760 8481 9821 gene locus_tag LOCUS_06770 8481 9821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038124.1 protein_id gnl|my_center|LOCUS_06770 9814 10422 gene locus_tag LOCUS_06780 9814 10422 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388953.1 protein_id gnl|my_center|LOCUS_06780 10517 10909 gene locus_tag LOCUS_06790 10517 10909 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434285.1 protein_id gnl|my_center|LOCUS_06790 10934 11368 gene locus_tag LOCUS_06800 10934 11368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 11343 12587 gene locus_tag LOCUS_06810 11343 12587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 12651 14141 gene locus_tag LOCUS_06820 12651 14141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 >Feature sequence039 33 1700 gene locus_tag LOCUS_06830 33 1700 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_06830 3325 1925 gene locus_tag LOCUS_06840 3325 1925 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 protein_id gnl|my_center|LOCUS_06840 3956 3399 gene locus_tag LOCUS_06850 3956 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 4319 4017 gene locus_tag LOCUS_06860 4319 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 4769 4443 gene locus_tag LOCUS_06870 gene mobC 4769 4443 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861100.1 protein_id gnl|my_center|LOCUS_06870 5284 4772 gene locus_tag LOCUS_06880 5284 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 5800 5285 gene locus_tag LOCUS_06890 5800 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 13069 5804 gene locus_tag LOCUS_06900 13069 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 13452 13102 gene locus_tag LOCUS_06910 13452 13102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 >Feature sequence040 139 1605 gene locus_tag LOCUS_06920 gene abfB 139 1605 CDS product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 protein_id gnl|my_center|LOCUS_06920 1605 1850 gene locus_tag LOCUS_06930 1605 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 1897 2565 gene locus_tag LOCUS_06940 1897 2565 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402142.1 protein_id gnl|my_center|LOCUS_06940 2622 3278 gene locus_tag LOCUS_06950 gene sleB 2622 3278 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398991.1 protein_id gnl|my_center|LOCUS_06950 3390 3578 gene locus_tag LOCUS_06960 3390 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 4663 3692 gene locus_tag LOCUS_06970 gene prfB 4663 3692 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181244843.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06970 5224 4817 gene locus_tag LOCUS_06980 5224 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 8039 5319 gene locus_tag LOCUS_06990 gene secA 8039 5319 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_06990 8963 8211 gene locus_tag LOCUS_07000 8963 8211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 10107 8974 gene locus_tag LOCUS_07010 10107 8974 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_07010 11117 10302 gene locus_tag LOCUS_07020 gene folK 11117 10302 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966210.1 protein_id gnl|my_center|LOCUS_07020 12004 11201 gene locus_tag LOCUS_07030 gene folP 12004 11201 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966209.1 protein_id gnl|my_center|LOCUS_07030 13687 12014 gene locus_tag LOCUS_07040 13687 12014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 >Feature sequence041 506 246 gene locus_tag LOCUS_07050 506 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 445 2787 gene locus_tag LOCUS_07060 445 2787 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048098.1 protein_id gnl|my_center|LOCUS_07060 3296 2868 gene locus_tag LOCUS_07070 3296 2868 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459277.1 protein_id gnl|my_center|LOCUS_07070 3921 3367 gene locus_tag LOCUS_07080 3921 3367 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_07080 5001 4105 gene locus_tag LOCUS_07090 gene tsf 5001 4105 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_07090 5777 5034 gene locus_tag LOCUS_07100 gene rpsB 5777 5034 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_07100 9787 6038 gene locus_tag LOCUS_07110 9787 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 11567 9903 gene locus_tag LOCUS_07120 11567 9903 CDS product anti-sigma factor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462208.1 protein_id gnl|my_center|LOCUS_07120 12248 11574 gene locus_tag LOCUS_07130 gene sigI 12248 11574 CDS product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181792.1 protein_id gnl|my_center|LOCUS_07130 13682 12294 gene locus_tag LOCUS_07140 13682 12294 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989199.1 protein_id gnl|my_center|LOCUS_07140 13894 13805 gene locus_tag LOCUS_t00020 13894 13805 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence042 <1 1154 gene locus_tag LOCUS_07150 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861386.1:1-propanol dehydrogenase PduQ 1225 2850 gene locus_tag LOCUS_07160 1225 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 2870 4600 gene locus_tag LOCUS_07170 2870 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 4660 6360 gene locus_tag LOCUS_07180 gene argS 4660 6360 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948742.1 protein_id gnl|my_center|LOCUS_07180 6444 6656 gene locus_tag LOCUS_07190 6444 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 9050 6744 gene locus_tag LOCUS_07200 9050 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 10534 9233 gene locus_tag LOCUS_07210 gene lysA 10534 9233 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963928.1 protein_id gnl|my_center|LOCUS_07210 11855 10578 gene locus_tag LOCUS_07220 gene clpX 11855 10578 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 protein_id gnl|my_center|LOCUS_07220 12474 11878 gene locus_tag LOCUS_07230 gene clpP 12474 11878 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_07230 13797 12511 gene locus_tag LOCUS_07240 gene tig 13797 12511 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_07240 >Feature sequence043 <1 831 gene locus_tag LOCUS_07250 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986279.1:homoserine kinase 854 2062 gene locus_tag LOCUS_07260 854 2062 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_07260 2172 2909 gene locus_tag LOCUS_07270 gene rlmB 2172 2909 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_07270 2933 3202 gene locus_tag LOCUS_07280 2933 3202 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963800.1 protein_id gnl|my_center|LOCUS_07280 3217 4584 gene locus_tag LOCUS_07290 3217 4584 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_07290 4618 4929 gene locus_tag LOCUS_07300 4618 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 4942 5988 gene locus_tag LOCUS_07310 4942 5988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 6001 7899 gene locus_tag LOCUS_07320 6001 7899 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_07320 7925 8341 gene locus_tag LOCUS_07330 7925 8341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 8373 8681 gene locus_tag LOCUS_07340 8373 8681 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_07340 8699 9307 gene locus_tag LOCUS_07350 8699 9307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 9332 11104 gene locus_tag LOCUS_07360 9332 11104 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876586.1 protein_id gnl|my_center|LOCUS_07360 11121 12509 gene locus_tag LOCUS_07370 11121 12509 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_07370 12552 13175 gene locus_tag LOCUS_07380 12552 13175 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_07380 <13840 13227 gene locus_tag LOCUS_07390 <13840 13227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003423115.1:fructose-6-phosphate aldolase >Feature sequence044 1 1173 gene locus_tag LOCUS_07400 gene nifS 1 1173 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_07400 1176 1607 gene locus_tag LOCUS_07410 gene nifU 1176 1607 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391905.1 protein_id gnl|my_center|LOCUS_07410 1988 1686 gene locus_tag LOCUS_07420 1988 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 2121 4052 gene locus_tag LOCUS_07430 2121 4052 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948184.1 protein_id gnl|my_center|LOCUS_07430 4225 5538 gene locus_tag LOCUS_07440 4225 5538 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 protein_id gnl|my_center|LOCUS_07440 5528 6193 gene locus_tag LOCUS_07450 5528 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 6193 7113 gene locus_tag LOCUS_07460 6193 7113 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964578.1 protein_id gnl|my_center|LOCUS_07460 7173 8024 gene locus_tag LOCUS_07470 7173 8024 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_07470 8044 9435 gene locus_tag LOCUS_07480 gene gltA 8044 9435 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_07480 10028 9507 gene locus_tag LOCUS_07490 10028 9507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 10342 10418 gene locus_tag LOCUS_t00030 10342 10418 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13698 10489 gene locus_tag LOCUS_07500 13698 10489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 >Feature sequence045 <1 3811 gene locus_tag LOCUS_07510 <1 3811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886436.1:rhamnogalacturonan lyase 2776 2875 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3845 4336 gene locus_tag LOCUS_07520 3845 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 4399 5769 gene locus_tag LOCUS_07530 gene mnmE 4399 5769 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722170.1 protein_id gnl|my_center|LOCUS_07530 5885 6586 gene locus_tag LOCUS_07540 5885 6586 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_07540 6599 7321 gene locus_tag LOCUS_07550 6599 7321 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986547.1 protein_id gnl|my_center|LOCUS_07550 7376 8140 gene locus_tag LOCUS_07560 7376 8140 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071302.1 protein_id gnl|my_center|LOCUS_07560 8209 8901 gene locus_tag LOCUS_07570 8209 8901 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989966.1 protein_id gnl|my_center|LOCUS_07570 8898 10118 gene locus_tag LOCUS_07580 8898 10118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 10237 11316 gene locus_tag LOCUS_07590 10237 11316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 11332 12288 gene locus_tag LOCUS_07600 11332 12288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 13444 12536 gene locus_tag LOCUS_07610 13444 12536 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020423.1 protein_id gnl|my_center|LOCUS_07610 13724 13566 gene locus_tag LOCUS_07620 13724 13566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 >Feature sequence046 476 231 gene locus_tag LOCUS_07630 gene rpsR 476 231 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_07630 1007 513 gene locus_tag LOCUS_07640 gene ssb 1007 513 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721668.1 protein_id gnl|my_center|LOCUS_07640 1341 1039 gene locus_tag LOCUS_07650 gene rpsF 1341 1039 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966984.1 protein_id gnl|my_center|LOCUS_07650 1563 1639 gene locus_tag LOCUS_t00040 1563 1639 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1686 1761 gene locus_tag LOCUS_t00050 1686 1761 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2540 1806 gene locus_tag LOCUS_07660 2540 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 2873 2568 gene locus_tag LOCUS_07670 2873 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 3762 2893 gene locus_tag LOCUS_07680 3762 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 4379 3840 gene locus_tag LOCUS_07690 4379 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 4752 4417 gene locus_tag LOCUS_07700 4752 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 5276 4764 gene locus_tag LOCUS_07710 5276 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 5516 5283 gene locus_tag LOCUS_07720 5516 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 5839 5600 gene locus_tag LOCUS_07730 5839 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 7293 5890 gene locus_tag LOCUS_07740 7293 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 5915 6014 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11599 7313 gene locus_tag LOCUS_07750 11599 7313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 13534 11732 gene locus_tag LOCUS_07760 13534 11732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 >Feature sequence047 61 285 gene locus_tag LOCUS_07770 61 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 422 682 gene locus_tag LOCUS_07780 422 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 701 940 gene locus_tag LOCUS_07790 701 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 1084 1401 gene locus_tag LOCUS_07800 1084 1401 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393078.1 protein_id gnl|my_center|LOCUS_07800 1398 1628 gene locus_tag LOCUS_07810 1398 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 1937 2632 gene locus_tag LOCUS_07820 gene plsY 1937 2632 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_07820 2634 3623 gene locus_tag LOCUS_07830 2634 3623 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426955.1 protein_id gnl|my_center|LOCUS_07830 3620 4972 gene locus_tag LOCUS_07840 gene trkA 3620 4972 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_07840 4998 6440 gene locus_tag LOCUS_07850 4998 6440 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016814.1 protein_id gnl|my_center|LOCUS_07850 6458 7810 gene locus_tag LOCUS_07860 6458 7810 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048134.1 protein_id gnl|my_center|LOCUS_07860 7822 8478 gene locus_tag LOCUS_07870 7822 8478 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357824.1 protein_id gnl|my_center|LOCUS_07870 8706 11288 gene locus_tag LOCUS_07880 gene adhE 8706 11288 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035380749.1 protein_id gnl|my_center|LOCUS_07880 11461 11910 gene locus_tag LOCUS_07890 11461 11910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 11933 12796 gene locus_tag LOCUS_07900 11933 12796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 13457 12852 gene locus_tag LOCUS_07910 13457 12852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 >Feature sequence048 91 573 gene locus_tag LOCUS_07920 91 573 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_07920 570 1745 gene locus_tag LOCUS_07930 570 1745 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459619.1 protein_id gnl|my_center|LOCUS_07930 1758 3380 gene locus_tag LOCUS_07940 1758 3380 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947977.1 protein_id gnl|my_center|LOCUS_07940 3392 5140 gene locus_tag LOCUS_07950 3392 5140 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583011.1 protein_id gnl|my_center|LOCUS_07950 5142 6965 gene locus_tag LOCUS_07960 5142 6965 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802963.1 protein_id gnl|my_center|LOCUS_07960 7004 9148 gene locus_tag LOCUS_07970 7004 9148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 9160 9966 gene locus_tag LOCUS_07980 9160 9966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 10019 11335 gene locus_tag LOCUS_07990 10019 11335 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 protein_id gnl|my_center|LOCUS_07990 11349 11840 gene locus_tag LOCUS_08000 11349 11840 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461280.1 protein_id gnl|my_center|LOCUS_08000 11864 12850 gene locus_tag LOCUS_08010 11864 12850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 12879 13046 gene locus_tag LOCUS_08020 12879 13046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 >Feature sequence049 810 73 gene locus_tag LOCUS_08030 810 73 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_08030 1096 803 gene locus_tag LOCUS_08040 1096 803 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965963.1 protein_id gnl|my_center|LOCUS_08040 1255 1956 gene locus_tag LOCUS_08050 1255 1956 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460066.1 protein_id gnl|my_center|LOCUS_08050 1953 2333 gene locus_tag LOCUS_08060 1953 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 2455 3012 gene locus_tag LOCUS_08070 2455 3012 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_08070 3131 3376 gene locus_tag LOCUS_08080 3131 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 3424 4281 gene locus_tag LOCUS_08090 gene rsmA 3424 4281 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226751.1 protein_id gnl|my_center|LOCUS_08090 4282 4533 gene locus_tag LOCUS_08100 4282 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 5101 4586 gene locus_tag LOCUS_08110 5101 4586 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002785057.1 protein_id gnl|my_center|LOCUS_08110 5235 5432 gene locus_tag LOCUS_08120 5235 5432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 5429 5689 gene locus_tag LOCUS_08130 5429 5689 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454698.1 protein_id gnl|my_center|LOCUS_08130 5689 5901 gene locus_tag LOCUS_08140 5689 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 7404 5884 gene locus_tag LOCUS_08150 7404 5884 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860806.1 protein_id gnl|my_center|LOCUS_08150 7583 7410 gene locus_tag LOCUS_08160 7583 7410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 9203 7734 gene locus_tag LOCUS_08170 9203 7734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 10500 9292 gene locus_tag LOCUS_08180 10500 9292 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916221.1 protein_id gnl|my_center|LOCUS_08180 11868 10963 gene locus_tag LOCUS_08190 11868 10963 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966656.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence050 154 2463 gene locus_tag LOCUS_08200 154 2463 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_08200 2466 3524 gene locus_tag LOCUS_08210 gene holA 2466 3524 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430958.1 protein_id gnl|my_center|LOCUS_08210 3767 7651 gene locus_tag LOCUS_08220 3767 7651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 7911 8990 gene locus_tag LOCUS_08230 7911 8990 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476434.1 protein_id gnl|my_center|LOCUS_08230 9011 9511 gene locus_tag LOCUS_08240 9011 9511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 <12568 9582 gene locus_tag LOCUS_08250 <12568 9582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_113034874.1:DUF4838 domain-containing protein >Feature sequence051 1 387 gene locus_tag LOCUS_08260 1 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 374 1096 gene locus_tag LOCUS_08270 gene atpB 374 1096 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437836.1 protein_id gnl|my_center|LOCUS_08270 1122 1376 gene locus_tag LOCUS_08280 gene atpE 1122 1376 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902609.1 protein_id gnl|my_center|LOCUS_08280 1399 1893 gene locus_tag LOCUS_08290 gene atpF 1399 1893 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674409.1 protein_id gnl|my_center|LOCUS_08290 1903 2427 gene locus_tag LOCUS_08300 1903 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 2442 3938 gene locus_tag LOCUS_08310 gene atpA 2442 3938 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421367.1 protein_id gnl|my_center|LOCUS_08310 3945 4784 gene locus_tag LOCUS_08320 gene atpG 3945 4784 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_08320 4894 6288 gene locus_tag LOCUS_08330 gene atpD 4894 6288 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_08330 6293 6580 gene locus_tag LOCUS_08340 6293 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 6670 9591 gene locus_tag LOCUS_08350 gene lacZ 6670 9591 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098161.1 protein_id gnl|my_center|LOCUS_08350 9324 9333 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11038 9644 gene locus_tag LOCUS_08360 11038 9644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 12112 11141 gene locus_tag LOCUS_08370 12112 11141 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385349.1 protein_id gnl|my_center|LOCUS_08370 12303 12482 gene locus_tag LOCUS_08380 12303 12482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 >Feature sequence052 130 2943 gene locus_tag LOCUS_08390 130 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 3073 3609 gene locus_tag LOCUS_08400 gene rsmD 3073 3609 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_08400 3699 4175 gene locus_tag LOCUS_08410 gene coaD 3699 4175 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728846.1 protein_id gnl|my_center|LOCUS_08410 4196 4651 gene locus_tag LOCUS_08420 4196 4651 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460509.1 protein_id gnl|my_center|LOCUS_08420 4730 6400 gene locus_tag LOCUS_08430 4730 6400 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048375.1 protein_id gnl|my_center|LOCUS_08430 6402 6830 gene locus_tag LOCUS_08440 gene tsaE 6402 6830 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048261.1 protein_id gnl|my_center|LOCUS_08440 6827 7546 gene locus_tag LOCUS_08450 gene tsaB 6827 7546 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966124.1 protein_id gnl|my_center|LOCUS_08450 7527 7964 gene locus_tag LOCUS_08460 gene rpiB 7527 7964 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947986.1 protein_id gnl|my_center|LOCUS_08460 8105 8458 gene locus_tag LOCUS_08470 8105 8458 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813375.1 protein_id gnl|my_center|LOCUS_08470 8470 9081 gene locus_tag LOCUS_08480 8470 9081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08480 9059 9068 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9287 10171 gene locus_tag LOCUS_08490 9287 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08490 10184 12217 gene locus_tag LOCUS_08500 gene recG 10184 12217 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence053 439 2832 gene locus_tag LOCUS_08510 439 2832 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860930.1 protein_id gnl|my_center|LOCUS_08510 2844 3335 gene locus_tag LOCUS_08520 gene ybaK 2844 3335 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288577.1 protein_id gnl|my_center|LOCUS_08520 3351 4610 gene locus_tag LOCUS_08530 3351 4610 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_08530 5498 4656 gene locus_tag LOCUS_08540 5498 4656 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437062.1 protein_id gnl|my_center|LOCUS_08540 8651 5511 gene locus_tag LOCUS_08550 8651 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 8835 9374 gene locus_tag LOCUS_08560 gene raiA 8835 9374 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671185.1 protein_id gnl|my_center|LOCUS_08560 9446 9985 gene locus_tag LOCUS_08570 9446 9985 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_08570 11988 10321 gene locus_tag LOCUS_08580 11988 10321 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_08580 >Feature sequence054 485 649 gene locus_tag LOCUS_08590 485 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 681 1274 gene locus_tag LOCUS_08600 681 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986441.1 protein_id gnl|my_center|LOCUS_08600 1285 3123 gene locus_tag LOCUS_08610 gene dxs 1285 3123 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_08610 3127 3927 gene locus_tag LOCUS_08620 3127 3927 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358964.1 protein_id gnl|my_center|LOCUS_08620 3939 4829 gene locus_tag LOCUS_08630 gene ispE 3939 4829 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966185.1 protein_id gnl|my_center|LOCUS_08630 4836 5603 gene locus_tag LOCUS_08640 4836 5603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 5620 6231 gene locus_tag LOCUS_08650 5620 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 6400 6792 gene locus_tag LOCUS_08660 6400 6792 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459856.1 protein_id gnl|my_center|LOCUS_08660 6782 9064 gene locus_tag LOCUS_08670 6782 9064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 9291 9566 gene locus_tag LOCUS_08680 9291 9566 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458924.1 protein_id gnl|my_center|LOCUS_08680 9718 11613 gene locus_tag LOCUS_08690 9718 11613 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458920.1 protein_id gnl|my_center|LOCUS_08690 11610 11798 gene locus_tag LOCUS_08700 11610 11798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 11795 12007 gene locus_tag LOCUS_08710 11795 12007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 >Feature sequence055 227 571 gene locus_tag LOCUS_08720 gene rbfA 227 571 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_08720 585 1538 gene locus_tag LOCUS_08730 585 1538 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_08730 1539 2408 gene locus_tag LOCUS_08740 gene truB 1539 2408 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986789.1 protein_id gnl|my_center|LOCUS_08740 2429 3331 gene locus_tag LOCUS_08750 2429 3331 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986788.1 protein_id gnl|my_center|LOCUS_08750 3344 4702 gene locus_tag LOCUS_08760 gene glmU 3344 4702 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706816.1 protein_id gnl|my_center|LOCUS_08760 4794 5360 gene locus_tag LOCUS_08770 gene pth 4794 5360 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_08770 5370 8867 gene locus_tag LOCUS_08780 gene mfd 5370 8867 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966492.1 protein_id gnl|my_center|LOCUS_08780 8911 9834 gene locus_tag LOCUS_08790 8911 9834 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892066.1 protein_id gnl|my_center|LOCUS_08790 11794 9899 gene locus_tag LOCUS_08800 gene htpG 11794 9899 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_08800 >Feature sequence056 287 1639 gene locus_tag LOCUS_08810 287 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 1639 1800 gene locus_tag LOCUS_08820 1639 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 1852 2343 gene locus_tag LOCUS_08830 1852 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 3148 2390 gene locus_tag LOCUS_08840 gene dapB 3148 2390 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965675.1 protein_id gnl|my_center|LOCUS_08840 4052 3162 gene locus_tag LOCUS_08850 gene dapA 4052 3162 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422063.1 protein_id gnl|my_center|LOCUS_08850 5361 4258 gene locus_tag LOCUS_08860 gene asd 5361 4258 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699652.1 protein_id gnl|my_center|LOCUS_08860 6450 5689 gene locus_tag LOCUS_08870 6450 5689 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578368.1 protein_id gnl|my_center|LOCUS_08870 6637 6963 gene locus_tag LOCUS_08880 6637 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 6816 6825 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7002 7421 gene locus_tag LOCUS_08890 gene rpsL 7002 7421 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_08890 7584 8054 gene locus_tag LOCUS_08900 gene rpsG 7584 8054 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421180.1 protein_id gnl|my_center|LOCUS_08900 8175 10286 gene locus_tag LOCUS_08910 gene fusA 8175 10286 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_08910 10445 11647 gene locus_tag LOCUS_08920 gene tuf 10445 11647 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723640.1 protein_id gnl|my_center|LOCUS_08920 >Feature sequence057 327 851 gene locus_tag LOCUS_08930 327 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08930 871 1644 gene locus_tag LOCUS_08940 871 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08940 1739 2212 gene locus_tag LOCUS_08950 1739 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 2238 3089 gene locus_tag LOCUS_08960 2238 3089 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_08960 3187 3357 gene locus_tag LOCUS_08970 3187 3357 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963626.1 protein_id gnl|my_center|LOCUS_08970 3540 5444 gene locus_tag LOCUS_08980 3540 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 5459 6712 gene locus_tag LOCUS_08990 5459 6712 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_08990 6804 9440 gene locus_tag LOCUS_09000 gene alaS 6804 9440 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964985.1 protein_id gnl|my_center|LOCUS_09000 9445 9852 gene locus_tag LOCUS_09010 9445 9852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 9867 10202 gene locus_tag LOCUS_09020 9867 10202 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_09020 10257 11528 gene locus_tag LOCUS_09030 10257 11528 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_09030 >Feature sequence058 1815 82 gene locus_tag LOCUS_09040 1815 82 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_09040 2023 3102 gene locus_tag LOCUS_09050 2023 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 3119 3784 gene locus_tag LOCUS_09060 3119 3784 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438166.1 protein_id gnl|my_center|LOCUS_09060 3801 5024 gene locus_tag LOCUS_09070 3801 5024 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964994.1 protein_id gnl|my_center|LOCUS_09070 5166 5306 gene locus_tag LOCUS_09080 5166 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 5547 9170 gene locus_tag LOCUS_09090 5547 9170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 >Feature sequence059 1472 105 gene locus_tag LOCUS_09100 1472 105 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891874.1 protein_id gnl|my_center|LOCUS_09100 1580 2452 gene locus_tag LOCUS_09110 gene pdxS 1580 2452 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813582.1 protein_id gnl|my_center|LOCUS_09110 2452 3024 gene locus_tag LOCUS_09120 gene pdxT 2452 3024 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687358.1 protein_id gnl|my_center|LOCUS_09120 5389 3056 gene locus_tag LOCUS_09130 5389 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 11025 5536 gene locus_tag LOCUS_09140 11025 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 >Feature sequence060 2569 92 gene locus_tag LOCUS_09150 2569 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 2903 2604 gene locus_tag LOCUS_09160 2903 2604 CDS product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132491.1 protein_id gnl|my_center|LOCUS_09160 3154 2900 gene locus_tag LOCUS_09170 3154 2900 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965106.1 protein_id gnl|my_center|LOCUS_09170 4269 3247 gene locus_tag LOCUS_09180 gene nusA 4269 3247 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_09180 4746 4288 gene locus_tag LOCUS_09190 4746 4288 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_09190 6293 4890 gene locus_tag LOCUS_09200 6293 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 6568 7629 gene locus_tag LOCUS_09210 6568 7629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 8690 7713 gene locus_tag LOCUS_09220 gene galT 8690 7713 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080138.1 protein_id gnl|my_center|LOCUS_09220 10437 9019 gene locus_tag LOCUS_09230 10437 9019 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048386.1 protein_id gnl|my_center|LOCUS_09230 <11131 10437 gene locus_tag LOCUS_09240 <11131 10437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003359320.1:response regulator transcription factor >Feature sequence061 1435 143 gene locus_tag LOCUS_09250 1435 143 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118023.1 protein_id gnl|my_center|LOCUS_09250 2970 1615 gene locus_tag LOCUS_09260 2970 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 5971 3209 gene locus_tag LOCUS_09270 5971 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 7526 6219 gene locus_tag LOCUS_09280 7526 6219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 9427 7655 gene locus_tag LOCUS_09290 9427 7655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 11059 9440 gene locus_tag LOCUS_09300 11059 9440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence062 151 498 gene locus_tag LOCUS_09310 151 498 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_09310 552 3116 gene locus_tag LOCUS_09320 552 3116 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_09320 3130 3786 gene locus_tag LOCUS_09330 3130 3786 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_09330 4982 3822 gene locus_tag LOCUS_09340 4982 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 5048 5467 gene locus_tag LOCUS_09350 5048 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722815.1 protein_id gnl|my_center|LOCUS_09350 6300 5551 gene locus_tag LOCUS_09360 6300 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 6575 6297 gene locus_tag LOCUS_09370 6575 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 7990 6800 gene locus_tag LOCUS_09380 7990 6800 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094666698.1 protein_id gnl|my_center|LOCUS_09380 8935 8198 gene locus_tag LOCUS_09390 gene larB 8935 8198 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100884.1 protein_id gnl|my_center|LOCUS_09390 9124 9049 gene locus_tag LOCUS_t00060 9124 9049 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 9206 9131 gene locus_tag LOCUS_t00070 9206 9131 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 9325 9249 gene locus_tag LOCUS_t00080 9325 9249 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 9470 9394 gene locus_tag LOCUS_t00090 9470 9394 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9550 9477 gene locus_tag LOCUS_t00100 9550 9477 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 10798 9677 gene locus_tag LOCUS_09400 10798 9677 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434244.1 protein_id gnl|my_center|LOCUS_09400 11039 10785 gene locus_tag LOCUS_09410 11039 10785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 >Feature sequence063 123 1655 gene locus_tag LOCUS_09420 123 1655 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329914.1 protein_id gnl|my_center|LOCUS_09420 1658 3763 gene locus_tag LOCUS_09430 1658 3763 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_09430 3767 4483 gene locus_tag LOCUS_09440 3767 4483 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_09440 5794 5018 gene locus_tag LOCUS_09450 5794 5018 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047988.1 protein_id gnl|my_center|LOCUS_09450 6452 5781 gene locus_tag LOCUS_09460 6452 5781 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889262.1 protein_id gnl|my_center|LOCUS_09460 8224 6953 gene locus_tag LOCUS_09470 gene serS 8224 6953 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963350.1 protein_id gnl|my_center|LOCUS_09470 8689 8246 gene locus_tag LOCUS_09480 8689 8246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 9182 8682 gene locus_tag LOCUS_09490 9182 8682 CDS product DUF4446 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815159.1 protein_id gnl|my_center|LOCUS_09490 10069 9185 gene locus_tag LOCUS_09500 10069 9185 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_09500 10850 10089 gene locus_tag LOCUS_09510 gene soj 10850 10089 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_09510 >Feature sequence064 28 462 gene locus_tag LOCUS_09520 28 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 479 1087 gene locus_tag LOCUS_09530 479 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 1274 3586 gene locus_tag LOCUS_09540 gene lon 1274 3586 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435613.1 protein_id gnl|my_center|LOCUS_09540 3602 4216 gene locus_tag LOCUS_09550 gene yihA 3602 4216 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640795.1 protein_id gnl|my_center|LOCUS_09550 4240 6729 gene locus_tag LOCUS_09560 4240 6729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 <10946 6818 gene locus_tag LOCUS_09570 <10946 6818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_094015776.1:S-layer homology domain-containing protein >Feature sequence065 94 618 gene locus_tag LOCUS_09580 94 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 743 1045 gene locus_tag LOCUS_09590 743 1045 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358168.1 protein_id gnl|my_center|LOCUS_09590 1142 3202 gene locus_tag LOCUS_09600 1142 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 3753 3253 gene locus_tag LOCUS_09610 3753 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 4187 3765 gene locus_tag LOCUS_09620 4187 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 5054 4293 gene locus_tag LOCUS_09630 gene hisF 5054 4293 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949116.1 protein_id gnl|my_center|LOCUS_09630 5682 5071 gene locus_tag LOCUS_09640 gene hisH 5682 5071 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964257.1 protein_id gnl|my_center|LOCUS_09640 5886 7331 gene locus_tag LOCUS_09650 5886 7331 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262174.1 protein_id gnl|my_center|LOCUS_09650 8062 7346 gene locus_tag LOCUS_09660 8062 7346 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_09660 8776 8063 gene locus_tag LOCUS_09670 gene hisA 8776 8063 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256251.1 protein_id gnl|my_center|LOCUS_09670 9411 8773 gene locus_tag LOCUS_09680 gene hisG 9411 8773 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964254.1 protein_id gnl|my_center|LOCUS_09680 10765 9437 gene locus_tag LOCUS_09690 10765 9437 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964253.1 protein_id gnl|my_center|LOCUS_09690 >Feature sequence066 591 412 gene locus_tag LOCUS_09700 gene rpmF 591 412 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813398.1 protein_id gnl|my_center|LOCUS_09700 1134 625 gene locus_tag LOCUS_09710 1134 625 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419111.1 protein_id gnl|my_center|LOCUS_09710 1554 1183 gene locus_tag LOCUS_09720 gene rplL 1554 1183 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966422.1 protein_id gnl|my_center|LOCUS_09720 2214 1594 gene locus_tag LOCUS_09730 gene rplJ 2214 1594 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832306.1 protein_id gnl|my_center|LOCUS_09730 3243 2440 gene locus_tag LOCUS_09740 3243 2440 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965542.1 protein_id gnl|my_center|LOCUS_09740 3704 3243 gene locus_tag LOCUS_09750 gene ribE 3704 3243 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454467.1 protein_id gnl|my_center|LOCUS_09750 4933 3734 gene locus_tag LOCUS_09760 4933 3734 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456640.1 protein_id gnl|my_center|LOCUS_09760 5587 4949 gene locus_tag LOCUS_09770 gene ribE 5587 4949 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493908.1 protein_id gnl|my_center|LOCUS_09770 6678 5590 gene locus_tag LOCUS_09780 gene ribD 6678 5590 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975998.1 protein_id gnl|my_center|LOCUS_09780 8169 6970 gene locus_tag LOCUS_09790 8169 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 9573 8284 gene locus_tag LOCUS_09800 9573 8284 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861628.1 protein_id gnl|my_center|LOCUS_09800 10830 9577 gene locus_tag LOCUS_09810 10830 9577 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_09810 >Feature sequence067 38 1579 gene locus_tag LOCUS_09820 38 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1715 3121 gene locus_tag LOCUS_09830 gene cysS 1715 3121 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048360.1 protein_id gnl|my_center|LOCUS_09830 3157 3555 gene locus_tag LOCUS_09840 3157 3555 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357282.1 protein_id gnl|my_center|LOCUS_09840 3582 4430 gene locus_tag LOCUS_09850 3582 4430 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_09850 4430 5359 gene locus_tag LOCUS_09860 4430 5359 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_09860 5377 5898 gene locus_tag LOCUS_09870 5377 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 6019 7491 gene locus_tag LOCUS_09880 6019 7491 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 protein_id gnl|my_center|LOCUS_09880 7658 8143 gene locus_tag LOCUS_09890 7658 8143 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_09890 8198 8890 gene locus_tag LOCUS_09900 gene ispD 8198 8890 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966461.1 protein_id gnl|my_center|LOCUS_09900 8887 9354 gene locus_tag LOCUS_09910 gene ispF 8887 9354 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_09910 9368 10324 gene locus_tag LOCUS_09920 9368 10324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 >Feature sequence068 901 83 gene locus_tag LOCUS_09930 901 83 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811435.1 protein_id gnl|my_center|LOCUS_09930 1051 2169 gene locus_tag LOCUS_09940 gene rmgQ 1051 2169 CDS product unsaturated rhamnogalacturonyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906487.1 protein_id gnl|my_center|LOCUS_09940 2166 5837 gene locus_tag LOCUS_09950 2166 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 7327 6101 gene locus_tag LOCUS_09960 7327 6101 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287705.1 protein_id gnl|my_center|LOCUS_09960 8577 7375 gene locus_tag LOCUS_09970 8577 7375 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287705.1 protein_id gnl|my_center|LOCUS_09970 9364 8984 gene locus_tag LOCUS_09980 9364 8984 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355703.1 protein_id gnl|my_center|LOCUS_09980 10273 9938 gene locus_tag LOCUS_09990 10273 9938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 10370 10227 gene locus_tag LOCUS_10000 10370 10227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 >Feature sequence069 97 1494 gene locus_tag LOCUS_10010 97 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 2910 1561 gene locus_tag LOCUS_10020 2910 1561 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461202.1 protein_id gnl|my_center|LOCUS_10020 3600 2923 gene locus_tag LOCUS_10030 3600 2923 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461203.1 protein_id gnl|my_center|LOCUS_10030 4793 3723 gene locus_tag LOCUS_10040 4793 3723 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_10040 5705 4935 gene locus_tag LOCUS_10050 gene rhaR 5705 4935 CDS product rhamnose catabolism operon transcriptional regulator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968057.1 protein_id gnl|my_center|LOCUS_10050 6130 5762 gene locus_tag LOCUS_10060 6130 5762 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022772.1 protein_id gnl|my_center|LOCUS_10060 7876 6212 gene locus_tag LOCUS_10070 7876 6212 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680024.1 protein_id gnl|my_center|LOCUS_10070 8115 7936 gene locus_tag LOCUS_10080 8115 7936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 8315 8112 gene locus_tag LOCUS_10090 8315 8112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 9735 8326 gene locus_tag LOCUS_10100 9735 8326 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861101.1 protein_id gnl|my_center|LOCUS_10100 10022 9684 gene locus_tag LOCUS_10110 gene mobC 10022 9684 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861100.1 protein_id gnl|my_center|LOCUS_10110 >Feature sequence070 622 990 gene locus_tag LOCUS_10120 622 990 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_10120 1813 1151 gene locus_tag LOCUS_10130 1813 1151 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643206.1 protein_id gnl|my_center|LOCUS_10130 2730 1831 gene locus_tag LOCUS_10140 2730 1831 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_10140 4632 2752 gene locus_tag LOCUS_10150 4632 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 6001 4625 gene locus_tag LOCUS_10160 6001 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 7440 6151 gene locus_tag LOCUS_10170 7440 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 8017 7433 gene locus_tag LOCUS_10180 8017 7433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 9124 8018 gene locus_tag LOCUS_10190 9124 8018 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142191.1 protein_id gnl|my_center|LOCUS_10190 10339 9146 gene locus_tag LOCUS_10200 10339 9146 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261147.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence071 601 89 gene locus_tag LOCUS_10210 601 89 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946061.1 protein_id gnl|my_center|LOCUS_10210 1248 598 gene locus_tag LOCUS_10220 1248 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021681.1 protein_id gnl|my_center|LOCUS_10220 2857 1238 gene locus_tag LOCUS_10230 2857 1238 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966231.1 protein_id gnl|my_center|LOCUS_10230 2980 3684 gene locus_tag LOCUS_10240 2980 3684 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068399.1 protein_id gnl|my_center|LOCUS_10240 5460 3739 gene locus_tag LOCUS_10250 5460 3739 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_10250 7105 5447 gene locus_tag LOCUS_10260 7105 5447 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_10260 7259 7062 gene locus_tag LOCUS_10270 7259 7062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 7760 7275 gene locus_tag LOCUS_10280 7760 7275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 8556 7819 gene locus_tag LOCUS_10290 8556 7819 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814285.1 protein_id gnl|my_center|LOCUS_10290 10220 8682 gene locus_tag LOCUS_10300 gene putP 10220 8682 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence072 117 686 gene locus_tag LOCUS_10310 117 686 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938908.1 protein_id gnl|my_center|LOCUS_10310 2213 987 gene locus_tag LOCUS_10320 2213 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 2545 5157 gene locus_tag LOCUS_10330 gene polA 2545 5157 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964413.1 protein_id gnl|my_center|LOCUS_10330 5559 6410 gene locus_tag LOCUS_10340 5559 6410 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728914.1 protein_id gnl|my_center|LOCUS_10340 6410 7150 gene locus_tag LOCUS_10350 6410 7150 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059649.1 protein_id gnl|my_center|LOCUS_10350 7143 7949 gene locus_tag LOCUS_10360 7143 7949 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815052.1 protein_id gnl|my_center|LOCUS_10360 7956 8354 gene locus_tag LOCUS_10370 7956 8354 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458892.1 protein_id gnl|my_center|LOCUS_10370 8458 9366 gene locus_tag LOCUS_10380 8458 9366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 10136 9381 gene locus_tag LOCUS_10390 10136 9381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 >Feature sequence073 260 1066 gene locus_tag LOCUS_10400 gene noc 260 1066 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_10400 1179 2543 gene locus_tag LOCUS_10410 1179 2543 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_10410 2789 4810 gene locus_tag LOCUS_10420 2789 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 4974 5765 gene locus_tag LOCUS_10430 4974 5765 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287872.1 protein_id gnl|my_center|LOCUS_10430 5740 6576 gene locus_tag LOCUS_10440 gene panB 5740 6576 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287874.1 protein_id gnl|my_center|LOCUS_10440 6578 7417 gene locus_tag LOCUS_10450 gene panC 6578 7417 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966198.1 protein_id gnl|my_center|LOCUS_10450 7431 7814 gene locus_tag LOCUS_10460 7431 7814 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287876.1 protein_id gnl|my_center|LOCUS_10460 7827 9002 gene locus_tag LOCUS_10470 7827 9002 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775184.1 protein_id gnl|my_center|LOCUS_10470 9199 9459 gene locus_tag LOCUS_10480 9199 9459 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812262.1 protein_id gnl|my_center|LOCUS_10480 9452 9715 gene locus_tag LOCUS_10490 9452 9715 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113436.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence074 89 592 gene locus_tag LOCUS_10500 89 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 598 2664 gene locus_tag LOCUS_10510 598 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 2740 3285 gene locus_tag LOCUS_10520 2740 3285 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_10520 3303 4304 gene locus_tag LOCUS_10530 3303 4304 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403487.1 protein_id gnl|my_center|LOCUS_10530 4332 5156 gene locus_tag LOCUS_10540 gene mreC 4332 5156 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700471.1 protein_id gnl|my_center|LOCUS_10540 5182 5682 gene locus_tag LOCUS_10550 5182 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 5696 7810 gene locus_tag LOCUS_10560 5696 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 7829 8536 gene locus_tag LOCUS_10570 7829 8536 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902702.1 protein_id gnl|my_center|LOCUS_10570 8633 9424 gene locus_tag LOCUS_10580 gene minD 8633 9424 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419057.1 protein_id gnl|my_center|LOCUS_10580 9448 9852 gene locus_tag LOCUS_10590 gene mgsA 9448 9852 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684755.1 protein_id gnl|my_center|LOCUS_10590 >Feature sequence075 646 774 gene locus_tag LOCUS_10600 646 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 834 1220 gene locus_tag LOCUS_10610 834 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 3259 1607 gene locus_tag LOCUS_10620 3259 1607 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080425.1 protein_id gnl|my_center|LOCUS_10620 4083 3256 gene locus_tag LOCUS_10630 4083 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 8832 4618 gene locus_tag LOCUS_10640 8832 4618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 8750 8950 gene locus_tag LOCUS_10650 8750 8950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 9823 8975 gene locus_tag LOCUS_10660 9823 8975 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence076 348 1775 gene locus_tag LOCUS_10670 gene miaB 348 1775 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_10670 1772 2152 gene locus_tag LOCUS_10680 1772 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 2615 5212 gene locus_tag LOCUS_10690 gene mutS 2615 5212 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_10690 5214 7151 gene locus_tag LOCUS_10700 gene mutL 5214 7151 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861409.1 protein_id gnl|my_center|LOCUS_10700 7144 8082 gene locus_tag LOCUS_10710 gene miaA 7144 8082 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_10710 9775 8102 gene locus_tag LOCUS_10720 9775 8102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 >Feature sequence077 335 784 gene locus_tag LOCUS_10730 335 784 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966482.1 protein_id gnl|my_center|LOCUS_10730 862 2940 gene locus_tag LOCUS_10740 862 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 2966 4411 gene locus_tag LOCUS_10750 2966 4411 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964320.1 protein_id gnl|my_center|LOCUS_10750 4423 5454 gene locus_tag LOCUS_10760 4423 5454 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868714.1 protein_id gnl|my_center|LOCUS_10760 5454 5903 gene locus_tag LOCUS_10770 5454 5903 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437844.1 protein_id gnl|my_center|LOCUS_10770 5905 6360 gene locus_tag LOCUS_10780 gene rimI 5905 6360 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367190.1 protein_id gnl|my_center|LOCUS_10780 6365 7366 gene locus_tag LOCUS_10790 gene tsaD 6365 7366 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_10790 7385 8479 gene locus_tag LOCUS_10800 gene aroB 7385 8479 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070659.1 protein_id gnl|my_center|LOCUS_10800 8476 8943 gene locus_tag LOCUS_10810 gene lspA 8476 8943 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549207.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence078 1663 95 gene locus_tag LOCUS_10820 1663 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 1897 1673 gene locus_tag LOCUS_10830 1897 1673 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723866.1 protein_id gnl|my_center|LOCUS_10830 3334 1931 gene locus_tag LOCUS_10840 3334 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 3842 3339 gene locus_tag LOCUS_10850 3842 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 4071 4955 gene locus_tag LOCUS_10860 4071 4955 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531164.1 protein_id gnl|my_center|LOCUS_10860 4962 5588 gene locus_tag LOCUS_10870 4962 5588 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170003.1 protein_id gnl|my_center|LOCUS_10870 5603 7186 gene locus_tag LOCUS_10880 5603 7186 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861896.1 protein_id gnl|my_center|LOCUS_10880 8023 7220 gene locus_tag LOCUS_10890 8023 7220 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948300.1 protein_id gnl|my_center|LOCUS_10890 9586 8108 gene locus_tag LOCUS_10900 gene araA 9586 8108 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229499.1 protein_id gnl|my_center|LOCUS_10900 >Feature sequence079 119 295 gene locus_tag LOCUS_10910 119 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 301 1308 gene locus_tag LOCUS_10920 gene asnA 301 1308 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_10920 1333 2736 gene locus_tag LOCUS_10930 gene asnS 1333 2736 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462263.1 protein_id gnl|my_center|LOCUS_10930 2810 3619 gene locus_tag LOCUS_10940 2810 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 3681 5591 gene locus_tag LOCUS_10950 3681 5591 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107164.1 protein_id gnl|my_center|LOCUS_10950 5772 6626 gene locus_tag LOCUS_10960 5772 6626 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055270852.1 protein_id gnl|my_center|LOCUS_10960 7290 6694 gene locus_tag LOCUS_10970 gene recR 7290 6694 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_10970 7649 7296 gene locus_tag LOCUS_10980 7649 7296 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_10980 9511 7673 gene locus_tag LOCUS_10990 gene dnaX 9511 7673 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421622.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence080 229 154 gene locus_tag LOCUS_t00110 229 154 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1782 478 gene locus_tag LOCUS_11000 gene thiC 1782 478 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047970.1 protein_id gnl|my_center|LOCUS_11000 2109 2801 gene locus_tag LOCUS_11010 2109 2801 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_11010 2823 3824 gene locus_tag LOCUS_11020 2823 3824 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_11020 7408 4088 gene locus_tag LOCUS_11030 7408 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 8706 7480 gene locus_tag LOCUS_11040 gene larC 8706 7480 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438754.1 protein_id gnl|my_center|LOCUS_11040 9451 8708 gene locus_tag LOCUS_11050 gene larE 9451 8708 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964093.1 protein_id gnl|my_center|LOCUS_11050 >Feature sequence081 505 134 gene locus_tag LOCUS_11060 gene ridA 505 134 CDS product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298042.1 protein_id gnl|my_center|LOCUS_11060 1445 564 gene locus_tag LOCUS_11070 1445 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 3194 1548 gene locus_tag LOCUS_11080 3194 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531443.1 protein_id gnl|my_center|LOCUS_11080 6316 3209 gene locus_tag LOCUS_11090 6316 3209 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272308.1 protein_id gnl|my_center|LOCUS_11090 7069 6566 gene locus_tag LOCUS_11100 7069 6566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 8420 7059 gene locus_tag LOCUS_11110 8420 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 8759 8959 gene locus_tag LOCUS_11120 8759 8959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 9263 9187 gene locus_tag LOCUS_t00120 9263 9187 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9435 9361 gene locus_tag LOCUS_t00130 9435 9361 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence082 629 36 gene locus_tag LOCUS_11130 629 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 820 1656 gene locus_tag LOCUS_11140 820 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1893 1693 gene locus_tag LOCUS_11150 1893 1693 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519083.1 protein_id gnl|my_center|LOCUS_11150 3715 1880 gene locus_tag LOCUS_11160 gene ftsH 3715 1880 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_11160 3508 3517 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5064 3727 gene locus_tag LOCUS_11170 gene tilS 5064 3727 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434952.1 protein_id gnl|my_center|LOCUS_11170 6422 5064 gene locus_tag LOCUS_11180 6422 5064 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048440.1 protein_id gnl|my_center|LOCUS_11180 6885 6439 gene locus_tag LOCUS_11190 gene rplI 6885 6439 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226915.1 protein_id gnl|my_center|LOCUS_11190 8919 6904 gene locus_tag LOCUS_11200 8919 6904 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_11200 9257 8955 gene locus_tag LOCUS_11210 9257 8955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 >Feature sequence083 307 2238 gene locus_tag LOCUS_11220 307 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11220 2174 3622 gene locus_tag LOCUS_11230 2174 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 5131 3833 gene locus_tag LOCUS_11240 5131 3833 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_11240 5801 5238 gene locus_tag LOCUS_11250 5801 5238 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_11250 7545 5806 gene locus_tag LOCUS_11260 gene iorA 7545 5806 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_11260 9331 7706 gene locus_tag LOCUS_11270 9331 7706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 >Feature sequence084 1598 156 gene locus_tag LOCUS_11280 1598 156 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033065833.1 protein_id gnl|my_center|LOCUS_11280 3140 1617 gene locus_tag LOCUS_11290 3140 1617 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963421.1 protein_id gnl|my_center|LOCUS_11290 3440 4750 gene locus_tag LOCUS_11300 3440 4750 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_11300 4767 5402 gene locus_tag LOCUS_11310 4767 5402 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_11310 6090 6189 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6426 6650 gene locus_tag LOCUS_11320 6426 6650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 6721 7689 gene locus_tag LOCUS_11330 6721 7689 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_11330 8346 7942 gene locus_tag LOCUS_11340 8346 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 9183 8395 gene locus_tag LOCUS_11350 9183 8395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 >Feature sequence085 35 991 gene locus_tag LOCUS_11360 35 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 2010 1051 gene locus_tag LOCUS_11370 2010 1051 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767297.1 protein_id gnl|my_center|LOCUS_11370 2186 3052 gene locus_tag LOCUS_11380 gene dpsA 2186 3052 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439770.1 protein_id gnl|my_center|LOCUS_11380 3056 3637 gene locus_tag LOCUS_11390 3056 3637 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460384.1 protein_id gnl|my_center|LOCUS_11390 4984 3716 gene locus_tag LOCUS_11400 gene eno 4984 3716 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228333.1 protein_id gnl|my_center|LOCUS_11400 5121 7127 gene locus_tag LOCUS_11410 5121 7127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 7149 8147 gene locus_tag LOCUS_11420 7149 8147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 9121 8198 gene locus_tag LOCUS_11430 9121 8198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence086 2463 1741 gene locus_tag LOCUS_11440 gene cas5c 2463 1741 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932806.1 protein_id gnl|my_center|LOCUS_11440 4610 2475 gene locus_tag LOCUS_11450 4610 2475 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787402.1 protein_id gnl|my_center|LOCUS_11450 4715 4724 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5243 4800 gene locus_tag LOCUS_11460 5243 4800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 7447 5345 gene locus_tag LOCUS_11470 7447 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 8530 7469 gene locus_tag LOCUS_11480 8530 7469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 9011 8523 gene locus_tag LOCUS_11490 9011 8523 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816021.1 protein_id gnl|my_center|LOCUS_11490 >Feature sequence087 708 163 gene locus_tag LOCUS_11500 708 163 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815271.1 protein_id gnl|my_center|LOCUS_11500 2056 722 gene locus_tag LOCUS_11510 2056 722 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868840.1 protein_id gnl|my_center|LOCUS_11510 2508 2248 gene locus_tag LOCUS_11520 2508 2248 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016131.1 protein_id gnl|my_center|LOCUS_11520 3183 2545 gene locus_tag LOCUS_11530 3183 2545 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865105.1 protein_id gnl|my_center|LOCUS_11530 3598 3323 gene locus_tag LOCUS_11540 gene pduA 3598 3323 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388660.1 protein_id gnl|my_center|LOCUS_11540 4124 3684 gene locus_tag LOCUS_11550 4124 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 4413 4144 gene locus_tag LOCUS_11560 gene pduA 4413 4144 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183614.1 protein_id gnl|my_center|LOCUS_11560 4767 4426 gene locus_tag LOCUS_11570 4767 4426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 6033 4801 gene locus_tag LOCUS_11580 6033 4801 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015646101.1 protein_id gnl|my_center|LOCUS_11580 7497 6070 gene locus_tag LOCUS_11590 7497 6070 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388669.1 protein_id gnl|my_center|LOCUS_11590 8075 7515 gene locus_tag LOCUS_11600 8075 7515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 9010 8132 gene locus_tag LOCUS_11610 9010 8132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 >Feature sequence088 159 779 gene locus_tag LOCUS_11620 159 779 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986495.1 protein_id gnl|my_center|LOCUS_11620 1139 810 gene locus_tag LOCUS_11630 1139 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1291 3537 gene locus_tag LOCUS_11640 1291 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 5481 3751 gene locus_tag LOCUS_11650 5481 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 5742 6485 gene locus_tag LOCUS_11660 5742 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 8150 6546 gene locus_tag LOCUS_11670 8150 6546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 8883 8233 gene locus_tag LOCUS_11680 8883 8233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 >Feature sequence089 420 1820 gene locus_tag LOCUS_11690 gene uxaC 420 1820 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_11690 1823 3190 gene locus_tag LOCUS_11700 1823 3190 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964014.1 protein_id gnl|my_center|LOCUS_11700 3194 4606 gene locus_tag LOCUS_11710 3194 4606 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964015.1 protein_id gnl|my_center|LOCUS_11710 4969 4895 gene locus_tag LOCUS_t00140 4969 4895 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6230 5046 gene locus_tag LOCUS_11720 6230 5046 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476087.1 protein_id gnl|my_center|LOCUS_11720 7844 6297 gene locus_tag LOCUS_11730 7844 6297 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101306.1 protein_id gnl|my_center|LOCUS_11730 <8849 7871 gene locus_tag LOCUS_11740 <8849 7871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003020707.1:glycosyltransferase >Feature sequence090 925 503 gene locus_tag LOCUS_11750 925 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1629 946 gene locus_tag LOCUS_11760 1629 946 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088892.1 protein_id gnl|my_center|LOCUS_11760 2388 1702 gene locus_tag LOCUS_11770 2388 1702 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088892.1 protein_id gnl|my_center|LOCUS_11770 3542 2409 gene locus_tag LOCUS_11780 3542 2409 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938366.1 protein_id gnl|my_center|LOCUS_11780 4512 3601 gene locus_tag LOCUS_11790 4512 3601 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938368.1 protein_id gnl|my_center|LOCUS_11790 5546 4509 gene locus_tag LOCUS_11800 5546 4509 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878388.1 protein_id gnl|my_center|LOCUS_11800 7083 5536 gene locus_tag LOCUS_11810 7083 5536 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289202.1 protein_id gnl|my_center|LOCUS_11810 8668 7085 gene locus_tag LOCUS_11820 8668 7085 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393615.1 protein_id gnl|my_center|LOCUS_11820 >Feature sequence091 236 1831 gene locus_tag LOCUS_11830 gene rny 236 1831 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_11830 2033 2812 gene locus_tag LOCUS_11840 gene ymdB 2033 2812 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_11840 3530 2799 gene locus_tag LOCUS_11850 3530 2799 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722817.1 protein_id gnl|my_center|LOCUS_11850 3651 5036 gene locus_tag LOCUS_11860 3651 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 5291 7117 gene locus_tag LOCUS_11870 gene typA 5291 7117 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964991.1 protein_id gnl|my_center|LOCUS_11870 7712 7293 gene locus_tag LOCUS_11880 7712 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 <8746 7725 gene locus_tag LOCUS_11890 <8746 7725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876134.1:DNA cytosine methyltransferase >Feature sequence092 1614 76 gene locus_tag LOCUS_11900 1614 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1891 1628 gene locus_tag LOCUS_11910 1891 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 2850 2071 gene locus_tag LOCUS_11920 2850 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 3359 2862 gene locus_tag LOCUS_11930 3359 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047734.1 protein_id gnl|my_center|LOCUS_11930 4246 3368 gene locus_tag LOCUS_11940 4246 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 5290 4409 gene locus_tag LOCUS_11950 5290 4409 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_11950 5456 7312 gene locus_tag LOCUS_11960 5456 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 7360 8613 gene locus_tag LOCUS_11970 gene rhaA 7360 8613 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244294.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence093 1100 561 gene locus_tag LOCUS_11980 1100 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11980 1440 1240 gene locus_tag LOCUS_11990 1440 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11990 2719 1454 gene locus_tag LOCUS_12000 2719 1454 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416818.1 protein_id gnl|my_center|LOCUS_12000 2936 3127 gene locus_tag LOCUS_12010 2936 3127 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_12010 3823 3203 gene locus_tag LOCUS_12020 gene spoIIR 3823 3203 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966181.1 protein_id gnl|my_center|LOCUS_12020 3970 4428 gene locus_tag LOCUS_12030 3970 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 4444 5793 gene locus_tag LOCUS_12040 gene ypeB 4444 5793 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947975.1 protein_id gnl|my_center|LOCUS_12040 7250 5838 gene locus_tag LOCUS_12050 gene hydG 7250 5838 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_12050 7415 8128 gene locus_tag LOCUS_12060 gene pduB 7415 8128 CDS product propanediol utilization microcompartment protein PduB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012539884.1 protein_id gnl|my_center|LOCUS_12060 8642 8193 gene locus_tag LOCUS_12070 8642 8193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence094 690 106 gene locus_tag LOCUS_12080 690 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1916 726 gene locus_tag LOCUS_12090 1916 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 2344 1937 gene locus_tag LOCUS_12100 2344 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957009.1 protein_id gnl|my_center|LOCUS_12100 3610 3023 gene locus_tag LOCUS_12110 3610 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 4374 3646 gene locus_tag LOCUS_12120 4374 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 4784 4380 gene locus_tag LOCUS_12130 4784 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 5685 4756 gene locus_tag LOCUS_12140 5685 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 6805 6194 gene locus_tag LOCUS_12150 6805 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 7337 6753 gene locus_tag LOCUS_12160 7337 6753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 8358 7639 gene locus_tag LOCUS_12170 8358 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 >Feature sequence095 4827 787 gene locus_tag LOCUS_12180 4827 787 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_12180 8616 4891 gene locus_tag LOCUS_12190 8616 4891 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272602.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence096 2431 1181 gene locus_tag LOCUS_12200 2431 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 3184 2609 gene locus_tag LOCUS_12210 3184 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 5463 3184 gene locus_tag LOCUS_12220 5463 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12220 <8420 5444 gene locus_tag LOCUS_12230 <8420 5444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000014727.1:RHS element core protein >Feature sequence097 1092 304 gene locus_tag LOCUS_12240 1092 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 1551 1105 gene locus_tag LOCUS_12250 gene fabZ 1551 1105 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531753.1 protein_id gnl|my_center|LOCUS_12250 2279 1548 gene locus_tag LOCUS_12260 gene fabG 2279 1548 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_12260 4639 2303 gene locus_tag LOCUS_12270 4639 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 4914 4660 gene locus_tag LOCUS_12280 gene acpP 4914 4660 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583309.1 protein_id gnl|my_center|LOCUS_12280 5653 4997 gene locus_tag LOCUS_12290 5653 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 6513 5662 gene locus_tag LOCUS_12300 6513 5662 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767761.1 protein_id gnl|my_center|LOCUS_12300 7087 6626 gene locus_tag LOCUS_12310 gene crtO 7087 6626 CDS product glycosyl-4,4'-diaponeurosporenoate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001805835.1 protein_id gnl|my_center|LOCUS_12310 8259 7123 gene locus_tag LOCUS_12320 8259 7123 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836498.1 protein_id gnl|my_center|LOCUS_12320 >Feature sequence098 1753 89 gene locus_tag LOCUS_12330 gene ilvD 1753 89 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_12330 2418 1768 gene locus_tag LOCUS_12340 2418 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 3837 2431 gene locus_tag LOCUS_12350 3837 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 4568 3834 gene locus_tag LOCUS_12360 gene truA 4568 3834 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_12360 5403 4585 gene locus_tag LOCUS_12370 5403 4585 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_12370 6256 5396 gene locus_tag LOCUS_12380 6256 5396 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_12380 7101 6253 gene locus_tag LOCUS_12390 7101 6253 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226187.1 protein_id gnl|my_center|LOCUS_12390 8079 7216 gene locus_tag LOCUS_12400 8079 7216 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_12400 >Feature sequence099 1693 65 gene locus_tag LOCUS_12410 1693 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 3178 1742 gene locus_tag LOCUS_12420 3178 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 3551 3198 gene locus_tag LOCUS_12430 3551 3198 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461150.1 protein_id gnl|my_center|LOCUS_12430 4591 4019 gene locus_tag LOCUS_12440 4591 4019 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818015.1 protein_id gnl|my_center|LOCUS_12440 4805 5575 gene locus_tag LOCUS_12450 4805 5575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 8204 5667 gene locus_tag LOCUS_12460 8204 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 >Feature sequence100 212 541 gene locus_tag LOCUS_12470 212 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 866 579 gene locus_tag LOCUS_12480 866 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 4651 1037 gene locus_tag LOCUS_12490 4651 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 6840 4756 gene locus_tag LOCUS_12500 6840 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 7596 7066 gene locus_tag LOCUS_12510 7596 7066 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018035.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12510 >Feature sequence101 131 1390 gene locus_tag LOCUS_12520 gene hflX 131 1390 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895824.1 protein_id gnl|my_center|LOCUS_12520 1462 2103 gene locus_tag LOCUS_12530 1462 2103 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895825.1 protein_id gnl|my_center|LOCUS_12530 2103 2726 gene locus_tag LOCUS_12540 2103 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 2749 3066 gene locus_tag LOCUS_12550 gene trxA 2749 3066 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056655.1 protein_id gnl|my_center|LOCUS_12550 3218 4408 gene locus_tag LOCUS_12560 3218 4408 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_12560 4551 5468 gene locus_tag LOCUS_12570 gene argF 4551 5468 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808622.1 protein_id gnl|my_center|LOCUS_12570 5485 5982 gene locus_tag LOCUS_12580 5485 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 6116 6388 gene locus_tag LOCUS_12590 6116 6388 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812262.1 protein_id gnl|my_center|LOCUS_12590 6381 6644 gene locus_tag LOCUS_12600 6381 6644 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_12600 6701 7363 gene locus_tag LOCUS_12610 gene trmB 6701 7363 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398646.1 protein_id gnl|my_center|LOCUS_12610 7851 7408 gene locus_tag LOCUS_12620 gene tadA 7851 7408 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287154.1 protein_id gnl|my_center|LOCUS_12620 8180 7929 gene locus_tag LOCUS_12630 8180 7929 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385813.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence102 1 1083 gene locus_tag LOCUS_12640 gene dacB 1 1083 CDS product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230505.1 protein_id gnl|my_center|LOCUS_12640 1102 1827 gene locus_tag LOCUS_12650 1102 1827 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_12650 2033 3583 gene locus_tag LOCUS_12660 2033 3583 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392670.1 protein_id gnl|my_center|LOCUS_12660 3606 4010 gene locus_tag LOCUS_12670 3606 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 4024 4401 gene locus_tag LOCUS_12680 4024 4401 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869046.1 protein_id gnl|my_center|LOCUS_12680 4441 5703 gene locus_tag LOCUS_12690 4441 5703 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_12690 5762 7171 gene locus_tag LOCUS_12700 gene oadA 5762 7171 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_12700 7251 8066 gene locus_tag LOCUS_12710 gene proC 7251 8066 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048171.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence103 <1 950 gene locus_tag LOCUS_12720 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966178.1:D-alanine--D-alanine ligase family protein 950 1762 gene locus_tag LOCUS_12730 gene murI 950 1762 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_12730 1743 2168 gene locus_tag LOCUS_12740 1743 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 2174 3646 gene locus_tag LOCUS_12750 2174 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 3677 4519 gene locus_tag LOCUS_12760 3677 4519 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_12760 4542 4988 gene locus_tag LOCUS_12770 4542 4988 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_12770 5196 6866 gene locus_tag LOCUS_12780 gene recN 5196 6866 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699855.1 protein_id gnl|my_center|LOCUS_12780 6916 7353 gene locus_tag LOCUS_12790 6916 7353 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941462.1 protein_id gnl|my_center|LOCUS_12790 7390 7863 gene locus_tag LOCUS_12800 gene smpB 7390 7863 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence104 344 90 gene locus_tag LOCUS_12810 344 90 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388120.1 protein_id gnl|my_center|LOCUS_12810 1421 456 gene locus_tag LOCUS_12820 1421 456 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404855.1 protein_id gnl|my_center|LOCUS_12820 2821 1628 gene locus_tag LOCUS_12830 gene coaBC 2821 1628 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_12830 3027 3602 gene locus_tag LOCUS_12840 gene spmA 3027 3602 CDS product spore maturation protein SpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398980.1 protein_id gnl|my_center|LOCUS_12840 3599 4102 gene locus_tag LOCUS_12850 gene spmB 3599 4102 CDS product spore maturation protein SpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029511.1 protein_id gnl|my_center|LOCUS_12850 4199 5383 gene locus_tag LOCUS_12860 4199 5383 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_12860 5408 6160 gene locus_tag LOCUS_12870 gene tpiA 5408 6160 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_12870 6243 7760 gene locus_tag LOCUS_12880 gene gpmI 6243 7760 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861866.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence105 1780 80 gene locus_tag LOCUS_12890 1780 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 2265 1822 gene locus_tag LOCUS_12900 gene dtd 2265 1822 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426448.1 protein_id gnl|my_center|LOCUS_12900 4169 2262 gene locus_tag LOCUS_12910 4169 2262 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048250.1 protein_id gnl|my_center|LOCUS_12910 5270 4182 gene locus_tag LOCUS_12920 5270 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 6524 5358 gene locus_tag LOCUS_12930 6524 5358 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428267.1 protein_id gnl|my_center|LOCUS_12930 7778 6894 gene locus_tag LOCUS_12940 gene xerD 7778 6894 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence106 1604 2335 gene locus_tag LOCUS_12950 1604 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 2436 7628 gene locus_tag LOCUS_12960 2436 7628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence107 <1 1406 gene locus_tag LOCUS_12970 <1 1406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965689.1:ABC transporter ATP-binding protein 1410 3173 gene locus_tag LOCUS_12980 1410 3173 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_12980 3900 3211 gene locus_tag LOCUS_12990 3900 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 5400 4261 gene locus_tag LOCUS_13000 5400 4261 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944494.1 protein_id gnl|my_center|LOCUS_13000 <7614 5401 gene locus_tag LOCUS_13010 <7614 5401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948032.1:ribonuclease R >Feature sequence108 605 3205 gene locus_tag LOCUS_13020 gene mgtA 605 3205 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861944.1 protein_id gnl|my_center|LOCUS_13020 3218 3712 gene locus_tag LOCUS_13030 3218 3712 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861943.1 protein_id gnl|my_center|LOCUS_13030 3815 4492 gene locus_tag LOCUS_13040 3815 4492 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898609.1 protein_id gnl|my_center|LOCUS_13040 4494 7259 gene locus_tag LOCUS_13050 gene mgtA 4494 7259 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861942.1 protein_id gnl|my_center|LOCUS_13050 >Feature sequence109 166 339 gene locus_tag LOCUS_13060 166 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 367 810 gene locus_tag LOCUS_13070 367 810 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430905.1 protein_id gnl|my_center|LOCUS_13070 844 918 gene locus_tag LOCUS_t00150 844 918 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2028 958 gene locus_tag LOCUS_13080 gene mnmA 2028 958 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_13080 2716 2042 gene locus_tag LOCUS_13090 2716 2042 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_13090 3107 2967 gene locus_tag LOCUS_13100 3107 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 4060 3389 gene locus_tag LOCUS_13110 4060 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13110 4656 4075 gene locus_tag LOCUS_13120 4656 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 5466 4723 gene locus_tag LOCUS_13130 5466 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 6191 5463 gene locus_tag LOCUS_13140 6191 5463 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812187.1 protein_id gnl|my_center|LOCUS_13140 7414 6485 gene locus_tag LOCUS_13150 7414 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence110 516 2840 gene locus_tag LOCUS_13160 516 2840 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_13160 2934 3107 gene locus_tag LOCUS_13170 2934 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 3183 4127 gene locus_tag LOCUS_13180 3183 4127 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868031.1 protein_id gnl|my_center|LOCUS_13180 4773 4147 gene locus_tag LOCUS_13190 4773 4147 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048153.1 protein_id gnl|my_center|LOCUS_13190 5427 5352 gene locus_tag LOCUS_t00160 5427 5352 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5595 6230 gene locus_tag LOCUS_13200 gene thiE 5595 6230 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078223.1 protein_id gnl|my_center|LOCUS_13200 6227 7009 gene locus_tag LOCUS_13210 gene thiD 6227 7009 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence111 417 2834 gene locus_tag LOCUS_13220 417 2834 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_13220 2949 4328 gene locus_tag LOCUS_13230 gene purF 2949 4328 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785566.1 protein_id gnl|my_center|LOCUS_13230 4356 5774 gene locus_tag LOCUS_13240 4356 5774 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_13240 5807 6589 gene locus_tag LOCUS_13250 5807 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13250 6568 7167 gene locus_tag LOCUS_13260 6568 7167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13260 >Feature sequence112 7044 658 gene locus_tag LOCUS_13270 7044 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence113 5066 210 gene locus_tag LOCUS_13280 5066 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 6906 5107 gene locus_tag LOCUS_13290 6906 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence114 812 3 gene locus_tag LOCUS_13300 812 3 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_13300 977 2101 gene locus_tag LOCUS_13310 977 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 2183 3367 gene locus_tag LOCUS_13320 2183 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 3375 4070 gene locus_tag LOCUS_13330 3375 4070 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_13330 4094 4549 gene locus_tag LOCUS_13340 4094 4549 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213920.1 protein_id gnl|my_center|LOCUS_13340 4614 5366 gene locus_tag LOCUS_13350 4614 5366 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897805.1 protein_id gnl|my_center|LOCUS_13350 5380 5820 gene locus_tag LOCUS_13360 5380 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 6983 5874 gene locus_tag LOCUS_13370 6983 5874 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891452.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence115 1417 107 gene locus_tag LOCUS_13380 gene aspS 1417 107 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948698.1 protein_id gnl|my_center|LOCUS_13380 2852 1434 gene locus_tag LOCUS_13390 gene gatB 2852 1434 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_13390 4285 2849 gene locus_tag LOCUS_13400 gene gatA 4285 2849 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002458553.1 protein_id gnl|my_center|LOCUS_13400 4593 4315 gene locus_tag LOCUS_13410 4593 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 6526 4793 gene locus_tag LOCUS_13420 6526 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 7073 6558 gene locus_tag LOCUS_13430 7073 6558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 >Feature sequence116 589 62 gene locus_tag LOCUS_13440 589 62 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963829.1 protein_id gnl|my_center|LOCUS_13440 1148 690 gene locus_tag LOCUS_13450 1148 690 CDS product DUF5684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028234.1 protein_id gnl|my_center|LOCUS_13450 1886 1182 gene locus_tag LOCUS_13460 1886 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 2837 2160 gene locus_tag LOCUS_13470 2837 2160 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243015.1 protein_id gnl|my_center|LOCUS_13470 3375 2875 gene locus_tag LOCUS_13480 3375 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 4263 3409 gene locus_tag LOCUS_13490 4263 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 5156 4263 gene locus_tag LOCUS_13500 5156 4263 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_13500 6094 5195 gene locus_tag LOCUS_13510 6094 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 6641 6228 gene locus_tag LOCUS_13520 6641 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence117 3375 163 gene locus_tag LOCUS_13530 gene carB 3375 163 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_13530 4429 3377 gene locus_tag LOCUS_13540 gene carA 4429 3377 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 protein_id gnl|my_center|LOCUS_13540 4790 5962 gene locus_tag LOCUS_13550 4790 5962 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_13550 6594 6058 gene locus_tag LOCUS_13560 gene spoVT 6594 6058 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_13560 7063 6716 gene locus_tag LOCUS_13570 7063 6716 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901934.1 protein_id gnl|my_center|LOCUS_13570 >Feature sequence118 <1 635 gene locus_tag LOCUS_13580 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392875.1:site-2 protease family protein 645 1373 gene locus_tag LOCUS_13590 645 1373 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545170.1 protein_id gnl|my_center|LOCUS_13590 1366 1941 gene locus_tag LOCUS_13600 gene scpB 1366 1941 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392873.1 protein_id gnl|my_center|LOCUS_13600 1943 2575 gene locus_tag LOCUS_13610 1943 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 2568 2999 gene locus_tag LOCUS_13620 gene ytfJ 2568 2999 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965359.1 protein_id gnl|my_center|LOCUS_13620 2986 4827 gene locus_tag LOCUS_13630 2986 4827 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_13630 4820 5473 gene locus_tag LOCUS_13640 4820 5473 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048024.1 protein_id gnl|my_center|LOCUS_13640 5555 5944 gene locus_tag LOCUS_13650 5555 5944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 5992 6792 gene locus_tag LOCUS_13660 5992 6792 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762840.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence119 1386 109 gene locus_tag LOCUS_13670 1386 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 1642 1484 gene locus_tag LOCUS_13680 1642 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 1749 2399 gene locus_tag LOCUS_13690 gene sigK 1749 2399 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 protein_id gnl|my_center|LOCUS_13690 2770 2477 gene locus_tag LOCUS_13700 2770 2477 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002300557.1 protein_id gnl|my_center|LOCUS_13700 3111 2773 gene locus_tag LOCUS_13710 3111 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 3926 3198 gene locus_tag LOCUS_13720 gene trmD 3926 3198 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384686.1 protein_id gnl|my_center|LOCUS_13720 4435 3926 gene locus_tag LOCUS_13730 gene rimM 4435 3926 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170278.1 protein_id gnl|my_center|LOCUS_13730 4755 4522 gene locus_tag LOCUS_13740 4755 4522 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362589.1 protein_id gnl|my_center|LOCUS_13740 5015 4773 gene locus_tag LOCUS_13750 gene rpsP 5015 4773 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_13750 6446 5103 gene locus_tag LOCUS_13760 gene ffh 6446 5103 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965061.1 protein_id gnl|my_center|LOCUS_13760 6807 6475 gene locus_tag LOCUS_13770 6807 6475 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393779.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence120 85 1110 gene locus_tag LOCUS_13780 85 1110 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_13780 1128 1589 gene locus_tag LOCUS_13790 gene fabZ 1128 1589 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462206.1 protein_id gnl|my_center|LOCUS_13790 1589 2344 gene locus_tag LOCUS_13800 1589 2344 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_13800 2341 3183 gene locus_tag LOCUS_13810 gene rsmI 2341 3183 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435873.1 protein_id gnl|my_center|LOCUS_13810 3272 3553 gene locus_tag LOCUS_13820 3272 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 3743 3922 gene locus_tag LOCUS_13830 3743 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 6703 4103 gene locus_tag LOCUS_13840 gene rhgX 6703 4103 CDS product rhamnogalacturonan exolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886437.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence121 1779 3332 gene locus_tag LOCUS_13850 1779 3332 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903217.1 protein_id gnl|my_center|LOCUS_13850 3467 4840 gene locus_tag LOCUS_13860 3467 4840 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021843.1 protein_id gnl|my_center|LOCUS_13860 4929 6605 gene locus_tag LOCUS_13870 4929 6605 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109250.1 protein_id gnl|my_center|LOCUS_13870 >Feature sequence122 <1 4372 gene locus_tag LOCUS_13880 <1 4372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010890799.1:glycoside hydrolase family 43 protein 5958 4426 gene locus_tag LOCUS_13890 5958 4426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 <6672 5976 gene locus_tag LOCUS_13900 <6672 5976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393842.1:WecB/TagA/CpsF family glycosyltransferase >Feature sequence123 419 183 gene locus_tag LOCUS_13910 419 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 674 2791 gene locus_tag LOCUS_13920 gene nrdD 674 2791 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 protein_id gnl|my_center|LOCUS_13920 2791 3282 gene locus_tag LOCUS_13930 gene nrdG 2791 3282 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_13930 3294 3800 gene locus_tag LOCUS_13940 3294 3800 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986111.1 protein_id gnl|my_center|LOCUS_13940 5679 3862 gene locus_tag LOCUS_13950 gene walK 5679 3862 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722908.1 protein_id gnl|my_center|LOCUS_13950 6461 5763 gene locus_tag LOCUS_13960 gene yycF 6461 5763 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100856.1 protein_id gnl|my_center|LOCUS_13960 >Feature sequence124 388 2367 gene locus_tag LOCUS_13970 gene ftsH 388 2367 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963922.1 protein_id gnl|my_center|LOCUS_13970 2357 2713 gene locus_tag LOCUS_13980 2357 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 2825 3337 gene locus_tag LOCUS_13990 2825 3337 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_13990 3874 3386 gene locus_tag LOCUS_14000 3874 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 4269 3982 gene locus_tag LOCUS_14010 4269 3982 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391827.1 protein_id gnl|my_center|LOCUS_14010 4562 6061 gene locus_tag LOCUS_14020 4562 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence125 257 27 gene locus_tag LOCUS_14030 257 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 450 1745 gene locus_tag LOCUS_14040 gene mtaB 450 1745 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_14040 1853 2851 gene locus_tag LOCUS_14050 1853 2851 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901873.1 protein_id gnl|my_center|LOCUS_14050 3205 2909 gene locus_tag LOCUS_14060 3205 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 3762 3226 gene locus_tag LOCUS_14070 3762 3226 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357379.1 protein_id gnl|my_center|LOCUS_14070 4514 3762 gene locus_tag LOCUS_14080 4514 3762 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_14080 5574 4516 gene locus_tag LOCUS_14090 5574 4516 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357407.1 protein_id gnl|my_center|LOCUS_14090 5787 5578 gene locus_tag LOCUS_14100 5787 5578 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_14100 6486 5815 gene locus_tag LOCUS_14110 6486 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 protein_id gnl|my_center|LOCUS_14110 >Feature sequence126 261 1406 gene locus_tag LOCUS_14120 gene aroC 261 1406 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269384.1 protein_id gnl|my_center|LOCUS_14120 1448 2014 gene locus_tag LOCUS_14130 1448 2014 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_14130 2080 3231 gene locus_tag LOCUS_14140 2080 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 3413 3337 gene locus_tag LOCUS_t00170 3413 3337 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3570 4043 gene locus_tag LOCUS_14150 3570 4043 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548951.1 protein_id gnl|my_center|LOCUS_14150 4138 5070 gene locus_tag LOCUS_14160 4138 5070 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_14160 5859 5868 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence127 990 157 gene locus_tag LOCUS_14170 990 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1885 1157 gene locus_tag LOCUS_14180 1885 1157 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167121746.1 protein_id gnl|my_center|LOCUS_14180 2972 2016 gene locus_tag LOCUS_14190 2972 2016 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837553.1 protein_id gnl|my_center|LOCUS_14190 3846 2983 gene locus_tag LOCUS_14200 3846 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 3992 5464 gene locus_tag LOCUS_14210 3992 5464 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_14210 5475 5897 gene locus_tag LOCUS_14220 5475 5897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 5925 6203 gene locus_tag LOCUS_14230 5925 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 >Feature sequence128 1718 483 gene locus_tag LOCUS_14240 1718 483 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610375.1 protein_id gnl|my_center|LOCUS_14240 1940 1767 gene locus_tag LOCUS_14250 1940 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 2297 2088 gene locus_tag LOCUS_14260 2297 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 3265 2303 gene locus_tag LOCUS_14270 3265 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 4839 3508 gene locus_tag LOCUS_14280 4839 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 5471 4836 gene locus_tag LOCUS_14290 5471 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence129 1419 76 gene locus_tag LOCUS_14300 1419 76 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_14300 1633 3105 gene locus_tag LOCUS_14310 1633 3105 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_14310 3137 4063 gene locus_tag LOCUS_14320 3137 4063 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797938.1 protein_id gnl|my_center|LOCUS_14320 5258 4113 gene locus_tag LOCUS_14330 5258 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 6424 5258 gene locus_tag LOCUS_14340 6424 5258 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence130 228 935 gene locus_tag LOCUS_14350 228 935 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964700.1 protein_id gnl|my_center|LOCUS_14350 950 2383 gene locus_tag LOCUS_14360 gene purB 950 2383 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_14360 2417 3241 gene locus_tag LOCUS_14370 2417 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 3282 4556 gene locus_tag LOCUS_14380 3282 4556 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545033.1 protein_id gnl|my_center|LOCUS_14380 4581 6404 gene locus_tag LOCUS_14390 4581 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence131 180 268 gene locus_tag LOCUS_t00180 180 268 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 418 2814 gene locus_tag LOCUS_14400 418 2814 CDS product beta-galactosidase GalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036450.1 protein_id gnl|my_center|LOCUS_14400 4536 2851 gene locus_tag LOCUS_14410 4536 2851 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109116.1 protein_id gnl|my_center|LOCUS_14410 4712 5548 gene locus_tag LOCUS_14420 4712 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 6327 5545 gene locus_tag LOCUS_14430 6327 5545 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184249093.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence132 46 432 gene locus_tag LOCUS_14440 46 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 459 890 gene locus_tag LOCUS_14450 459 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 993 1127 gene locus_tag LOCUS_14460 993 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 1233 1874 gene locus_tag LOCUS_14470 1233 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 1871 4141 gene locus_tag LOCUS_14480 1871 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 4165 5346 gene locus_tag LOCUS_14490 4165 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 >Feature sequence133 76 4773 gene locus_tag LOCUS_14500 gene gltB 76 4773 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853155.1 protein_id gnl|my_center|LOCUS_14500 4788 6242 gene locus_tag LOCUS_14510 4788 6242 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_14510 >Feature sequence134 52 1233 gene locus_tag LOCUS_14520 52 1233 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173870.1 protein_id gnl|my_center|LOCUS_14520 1252 2529 gene locus_tag LOCUS_14530 1252 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 2541 3245 gene locus_tag LOCUS_14540 2541 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 3314 4033 gene locus_tag LOCUS_14550 3314 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 4053 4718 gene locus_tag LOCUS_14560 4053 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 4735 5349 gene locus_tag LOCUS_14570 4735 5349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 6028 5546 gene locus_tag LOCUS_14580 6028 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 >Feature sequence135 2 2893 gene locus_tag LOCUS_14590 2 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 3716 4477 gene locus_tag LOCUS_14600 3716 4477 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254593.1 protein_id gnl|my_center|LOCUS_14600 5855 4560 gene locus_tag LOCUS_14610 5855 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 >Feature sequence136 18 209 gene locus_tag LOCUS_14620 18 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 793 200 gene locus_tag LOCUS_14630 793 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 1497 790 gene locus_tag LOCUS_14640 1497 790 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_14640 2268 1522 gene locus_tag LOCUS_14650 2268 1522 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_14650 3139 2261 gene locus_tag LOCUS_14660 3139 2261 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812947.1 protein_id gnl|my_center|LOCUS_14660 3521 3165 gene locus_tag LOCUS_14670 3521 3165 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438259.1 protein_id gnl|my_center|LOCUS_14670 4168 3518 gene locus_tag LOCUS_14680 4168 3518 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_14680 4247 4789 gene locus_tag LOCUS_14690 4247 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 5470 4784 gene locus_tag LOCUS_14700 5470 4784 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990639.1 protein_id gnl|my_center|LOCUS_14700 5834 5451 gene locus_tag LOCUS_14710 5834 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence137 74 253 gene locus_tag LOCUS_14720 74 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 876 364 gene locus_tag LOCUS_14730 876 364 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900176.1 protein_id gnl|my_center|LOCUS_14730 1742 891 gene locus_tag LOCUS_14740 gene nadC 1742 891 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360683.1 protein_id gnl|my_center|LOCUS_14740 3012 1735 gene locus_tag LOCUS_14750 3012 1735 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016070.1 protein_id gnl|my_center|LOCUS_14750 3979 3023 gene locus_tag LOCUS_14760 gene nadA 3979 3023 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016069.1 protein_id gnl|my_center|LOCUS_14760 5052 4072 gene locus_tag LOCUS_14770 5052 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 6031 5054 gene locus_tag LOCUS_14780 6031 5054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 >Feature sequence138 2230 740 gene locus_tag LOCUS_14790 2230 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 3418 2249 gene locus_tag LOCUS_14800 3418 2249 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_14800 4900 3512 gene locus_tag LOCUS_14810 4900 3512 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582827.1 protein_id gnl|my_center|LOCUS_14810 5940 4975 gene locus_tag LOCUS_14820 5940 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence139 79 744 gene locus_tag LOCUS_14830 79 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 768 1724 gene locus_tag LOCUS_14840 768 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 2327 1782 gene locus_tag LOCUS_14850 2327 1782 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024220.1 protein_id gnl|my_center|LOCUS_14850 2511 4190 gene locus_tag LOCUS_14860 2511 4190 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975395.1 protein_id gnl|my_center|LOCUS_14860 4206 4379 gene locus_tag LOCUS_14870 4206 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 4389 4949 gene locus_tag LOCUS_14880 4389 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 4967 5767 gene locus_tag LOCUS_14890 4967 5767 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_14890 >Feature sequence140 610 885 gene locus_tag LOCUS_14900 610 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1847 936 gene locus_tag LOCUS_14910 1847 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 2618 1935 gene locus_tag LOCUS_14920 2618 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 3424 2654 gene locus_tag LOCUS_14930 3424 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 3797 3429 gene locus_tag LOCUS_14940 3797 3429 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184510.1 protein_id gnl|my_center|LOCUS_14940 3941 5791 gene locus_tag LOCUS_14950 gene asnB 3941 5791 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233080.1 protein_id gnl|my_center|LOCUS_14950 >Feature sequence141 <1 1084 gene locus_tag LOCUS_14960 <1 1084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003427022.1:redox-regulated ATPase YchF 1097 2047 gene locus_tag LOCUS_14970 1097 2047 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389346.1 protein_id gnl|my_center|LOCUS_14970 2066 3289 gene locus_tag LOCUS_14980 2066 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 4443 3328 gene locus_tag LOCUS_14990 4443 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 5252 4446 gene locus_tag LOCUS_15000 5252 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 <5886 5253 gene locus_tag LOCUS_15010 <5886 5253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057478.1:endonuclease III >Feature sequence142 3599 366 gene locus_tag LOCUS_15020 3599 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 4506 3574 gene locus_tag LOCUS_15030 4506 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 5527 4565 gene locus_tag LOCUS_15040 5527 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 >Feature sequence143 <1 799 gene locus_tag LOCUS_15050 <1 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009890959.1:UTP--glucose-1-phosphate uridylyltransferase GalU 1765 1529 gene locus_tag LOCUS_15060 1765 1529 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_15060 2098 1775 gene locus_tag LOCUS_15070 2098 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 3043 2570 gene locus_tag LOCUS_15080 3043 2570 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016060.1 protein_id gnl|my_center|LOCUS_15080 3207 5510 gene locus_tag LOCUS_15090 gene spoIIE 3207 5510 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243026.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence144 124 1050 gene locus_tag LOCUS_15100 gene hydE 124 1050 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048412.1 protein_id gnl|my_center|LOCUS_15100 1111 1120 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1396 1211 gene locus_tag LOCUS_15110 1396 1211 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965947.1 protein_id gnl|my_center|LOCUS_15110 1616 2011 gene locus_tag LOCUS_15120 1616 2011 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392939.1 protein_id gnl|my_center|LOCUS_15120 2292 2678 gene locus_tag LOCUS_15130 2292 2678 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459154.1 protein_id gnl|my_center|LOCUS_15130 2713 3126 gene locus_tag LOCUS_15140 2713 3126 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890794.1 protein_id gnl|my_center|LOCUS_15140 3537 3163 gene locus_tag LOCUS_15150 3537 3163 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_15150 4098 3550 gene locus_tag LOCUS_15160 4098 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 4925 4134 gene locus_tag LOCUS_15170 4925 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 5771 4926 gene locus_tag LOCUS_15180 5771 4926 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence145 108 2270 gene locus_tag LOCUS_15190 108 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 2285 3238 gene locus_tag LOCUS_15200 2285 3238 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081773.1 protein_id gnl|my_center|LOCUS_15200 3440 4690 gene locus_tag LOCUS_15210 gene murA 3440 4690 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence146 2603 2121 gene locus_tag LOCUS_15220 2603 2121 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_15220 3246 2647 gene locus_tag LOCUS_15230 3246 2647 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_15230 5622 3271 gene locus_tag LOCUS_15240 gene feoB 5622 3271 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence147 324 1019 gene locus_tag LOCUS_15250 324 1019 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841205.1 protein_id gnl|my_center|LOCUS_15250 3269 1101 gene locus_tag LOCUS_15260 gene ptsG 3269 1101 CDS product glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948935.1 protein_id gnl|my_center|LOCUS_15260 3790 3359 gene locus_tag LOCUS_15270 3790 3359 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395139.1 protein_id gnl|my_center|LOCUS_15270 4802 4101 gene locus_tag LOCUS_15280 4802 4101 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_15280 5598 4822 gene locus_tag LOCUS_15290 5598 4822 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence148 44 1012 gene locus_tag LOCUS_15300 44 1012 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245533.1 protein_id gnl|my_center|LOCUS_15300 1012 1944 gene locus_tag LOCUS_15310 gene trxB 1012 1944 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869571.1 protein_id gnl|my_center|LOCUS_15310 1941 3095 gene locus_tag LOCUS_15320 1941 3095 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 protein_id gnl|my_center|LOCUS_15320 3263 3397 gene locus_tag LOCUS_15330 gene rpmH 3263 3397 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359452.1 protein_id gnl|my_center|LOCUS_15330 3473 3805 gene locus_tag LOCUS_15340 gene rnpA 3473 3805 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_15340 3802 4038 gene locus_tag LOCUS_15350 gene yidD 3802 4038 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016065.1 protein_id gnl|my_center|LOCUS_15350 4044 5027 gene locus_tag LOCUS_15360 4044 5027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence149 1171 206 gene locus_tag LOCUS_15370 1171 206 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964247.1 protein_id gnl|my_center|LOCUS_15370 3323 1173 gene locus_tag LOCUS_15380 3323 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 3727 3320 gene locus_tag LOCUS_15390 3727 3320 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138156903.1 protein_id gnl|my_center|LOCUS_15390 5663 4110 gene locus_tag LOCUS_15400 gene lysS 5663 4110 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288202.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence150 3618 1396 gene locus_tag LOCUS_15410 gene gyrA 3618 1396 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_15410 5655 3637 gene locus_tag LOCUS_15420 gene gyrB 5655 3637 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence151 156 950 gene locus_tag LOCUS_15430 156 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1003 2217 gene locus_tag LOCUS_15440 1003 2217 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359361.1 protein_id gnl|my_center|LOCUS_15440 2355 4121 gene locus_tag LOCUS_15450 2355 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 4114 5391 gene locus_tag LOCUS_15460 4114 5391 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681414.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence152 92 3613 gene locus_tag LOCUS_15470 gene nifJ 92 3613 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 protein_id gnl|my_center|LOCUS_15470 5582 3771 gene locus_tag LOCUS_15480 gene lepA 5582 3771 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357725.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence153 74 2857 gene locus_tag LOCUS_15490 74 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 3445 3618 gene locus_tag LOCUS_15500 3445 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 3629 4342 gene locus_tag LOCUS_15510 3629 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 4967 4323 gene locus_tag LOCUS_15520 4967 4323 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_15520 5296 5087 gene locus_tag LOCUS_15530 5296 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence154 2449 5 gene locus_tag LOCUS_15540 2449 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 3055 2741 gene locus_tag LOCUS_15550 gene rhaM 3055 2741 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288247.1 protein_id gnl|my_center|LOCUS_15550 4444 3074 gene locus_tag LOCUS_15560 gene scfB 4444 3074 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_15560 4688 4545 gene locus_tag LOCUS_15570 gene scfA 4688 4545 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_15570 5153 4797 gene locus_tag LOCUS_15580 5153 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 5166 5175 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5641 5228 gene locus_tag LOCUS_15590 5641 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 >Feature sequence155 49 600 gene locus_tag LOCUS_15600 gene pyrR 49 600 CDS product bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156491.1 protein_id gnl|my_center|LOCUS_15600 604 1524 gene locus_tag LOCUS_15610 604 1524 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_15610 1541 2833 gene locus_tag LOCUS_15620 1541 2833 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_15620 2849 3763 gene locus_tag LOCUS_15630 gene pyrF 2849 3763 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_15630 3805 4572 gene locus_tag LOCUS_15640 gene pyrK 3805 4572 CDS product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983359.1 protein_id gnl|my_center|LOCUS_15640 4565 5476 gene locus_tag LOCUS_15650 4565 5476 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765720.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence156 25 189 gene locus_tag LOCUS_15660 25 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 201 509 gene locus_tag LOCUS_15670 201 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 1050 568 gene locus_tag LOCUS_15680 1050 568 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_15680 2577 1321 gene locus_tag LOCUS_15690 gene purD 2577 1321 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_15690 3686 2616 gene locus_tag LOCUS_15700 3686 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 5241 4069 gene locus_tag LOCUS_15710 5241 4069 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860970.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence157 131 2653 gene locus_tag LOCUS_15720 gene gyrA 131 2653 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947899.1 protein_id gnl|my_center|LOCUS_15720 2656 3471 gene locus_tag LOCUS_15730 2656 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 3500 3973 gene locus_tag LOCUS_15740 3500 3973 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966054.1 protein_id gnl|my_center|LOCUS_15740 4843 4022 gene locus_tag LOCUS_15750 4843 4022 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706548.1 protein_id gnl|my_center|LOCUS_15750 5481 4858 gene locus_tag LOCUS_15760 5481 4858 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence158 31 2562 gene locus_tag LOCUS_15770 31 2562 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388658.1 protein_id gnl|my_center|LOCUS_15770 2576 3364 gene locus_tag LOCUS_15780 2576 3364 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406170.1 protein_id gnl|my_center|LOCUS_15780 3367 3810 gene locus_tag LOCUS_15790 3367 3810 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812737.1 protein_id gnl|my_center|LOCUS_15790 5277 3898 gene locus_tag LOCUS_15800 gene argH 5277 3898 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence159 185 1195 gene locus_tag LOCUS_15810 gene trpD 185 1195 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966438.1 protein_id gnl|my_center|LOCUS_15810 1208 1987 gene locus_tag LOCUS_15820 gene trpC 1208 1987 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966437.1 protein_id gnl|my_center|LOCUS_15820 1977 2579 gene locus_tag LOCUS_15830 1977 2579 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 protein_id gnl|my_center|LOCUS_15830 2582 3373 gene locus_tag LOCUS_15840 gene trpA 2582 3373 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966434.1 protein_id gnl|my_center|LOCUS_15840 3402 4616 gene locus_tag LOCUS_15850 3402 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 4633 5163 gene locus_tag LOCUS_15860 4633 5163 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence160 2652 73 gene locus_tag LOCUS_15870 2652 73 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948276.1 protein_id gnl|my_center|LOCUS_15870 2804 3292 gene locus_tag LOCUS_15880 2804 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 3362 4114 gene locus_tag LOCUS_15890 gene pdaB 3362 4114 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965679.1 protein_id gnl|my_center|LOCUS_15890 4179 5126 gene locus_tag LOCUS_15900 4179 5126 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964837.1 protein_id gnl|my_center|LOCUS_15900 >Feature sequence161 22 210 gene locus_tag LOCUS_15910 gene rpmB 22 210 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965040.1 protein_id gnl|my_center|LOCUS_15910 368 1648 gene locus_tag LOCUS_15920 368 1648 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_15920 1709 2488 gene locus_tag LOCUS_15930 1709 2488 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_15930 2503 2979 gene locus_tag LOCUS_15940 gene rlmH 2503 2979 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048404.1 protein_id gnl|my_center|LOCUS_15940 3010 3180 gene locus_tag LOCUS_15950 3010 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 3352 3747 gene locus_tag LOCUS_15960 3352 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 3722 4045 gene locus_tag LOCUS_15970 3722 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 4127 4804 gene locus_tag LOCUS_15980 4127 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 4797 5030 gene locus_tag LOCUS_15990 4797 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 >Feature sequence162 681 932 gene locus_tag LOCUS_16000 681 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 2325 997 gene locus_tag LOCUS_16010 2325 997 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_16010 2937 2584 gene locus_tag LOCUS_16020 2937 2584 CDS product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705325.1 protein_id gnl|my_center|LOCUS_16020 4420 2942 gene locus_tag LOCUS_16030 gene malQ 4420 2942 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747274.1 protein_id gnl|my_center|LOCUS_16030 5094 4438 gene locus_tag LOCUS_16040 5094 4438 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680765.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence163 664 215 gene locus_tag LOCUS_16050 664 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1738 668 gene locus_tag LOCUS_16060 1738 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 2111 1719 gene locus_tag LOCUS_16070 gene spoIIIAD 2111 1719 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393042.1 protein_id gnl|my_center|LOCUS_16070 2455 2261 gene locus_tag LOCUS_16080 gene spoIIIAC 2455 2261 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153142.1 protein_id gnl|my_center|LOCUS_16080 2960 2469 gene locus_tag LOCUS_16090 2960 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 3880 2954 gene locus_tag LOCUS_16100 gene spoIIIAA 3880 2954 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358945.1 protein_id gnl|my_center|LOCUS_16100 4737 4216 gene locus_tag LOCUS_16110 4737 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 >Feature sequence164 2663 9 gene locus_tag LOCUS_16120 2663 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 4472 2709 gene locus_tag LOCUS_16130 4472 2709 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_16130 >Feature sequence165 <1 1027 gene locus_tag LOCUS_16140 <1 1027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007245976.1:galactose mutarotase 1143 2423 gene locus_tag LOCUS_16150 1143 2423 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_16150 2528 3712 gene locus_tag LOCUS_16160 2528 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 3717 4727 gene locus_tag LOCUS_16170 3717 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence166 20 751 gene locus_tag LOCUS_16180 20 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 2551 815 gene locus_tag LOCUS_16190 2551 815 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_16190 4442 2565 gene locus_tag LOCUS_16200 gene nuoF 4442 2565 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_16200 4966 4457 gene locus_tag LOCUS_16210 gene nuoE 4966 4457 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986413.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence167 60 3395 gene locus_tag LOCUS_16220 60 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 3578 4018 gene locus_tag LOCUS_16230 3578 4018 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_16230 <4997 4049 gene locus_tag LOCUS_16240 <4997 4049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948009.1:nucleoid-associated protein >Feature sequence168 34 666 gene locus_tag LOCUS_16250 gene sigH 34 666 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942746.1 protein_id gnl|my_center|LOCUS_16250 713 985 gene locus_tag LOCUS_16260 713 985 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815560.1 protein_id gnl|my_center|LOCUS_16260 1175 1648 gene locus_tag LOCUS_16270 gene greA 1175 1648 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422204.1 protein_id gnl|my_center|LOCUS_16270 1718 2743 gene locus_tag LOCUS_16280 1718 2743 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462321.1 protein_id gnl|my_center|LOCUS_16280 2879 2955 gene locus_tag LOCUS_t00190 2879 2955 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2964 3039 gene locus_tag LOCUS_t00200 2964 3039 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3116 3191 gene locus_tag LOCUS_t00210 3116 3191 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3228 3312 gene locus_tag LOCUS_t00220 3228 3312 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3456 3532 gene locus_tag LOCUS_t00230 3456 3532 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence169 92 772 gene locus_tag LOCUS_16290 92 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 777 1205 gene locus_tag LOCUS_16300 777 1205 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964777.1 protein_id gnl|my_center|LOCUS_16300 1339 1992 gene locus_tag LOCUS_16310 1339 1992 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562571.1 protein_id gnl|my_center|LOCUS_16310 2018 3049 gene locus_tag LOCUS_16320 2018 3049 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793314.1 protein_id gnl|my_center|LOCUS_16320 3186 3572 gene locus_tag LOCUS_16330 3186 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 4806 3625 gene locus_tag LOCUS_16340 4806 3625 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964082.1 protein_id gnl|my_center|LOCUS_16340 >Feature sequence170 <1 1345 gene locus_tag LOCUS_16350 <1 1345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861997.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme 1338 3581 gene locus_tag LOCUS_16360 1338 3581 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_16360 4815 3634 gene locus_tag LOCUS_16370 4815 3634 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence171 1510 485 gene locus_tag LOCUS_16380 gene queA 1510 485 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_16380 3169 1613 gene locus_tag LOCUS_16390 3169 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 4232 3225 gene locus_tag LOCUS_16400 gene ruvB 4232 3225 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_16400 4835 4251 gene locus_tag LOCUS_16410 gene ruvA 4835 4251 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_16410 >Feature sequence172 188 2314 gene locus_tag LOCUS_16420 gene nrdD 188 2314 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263171.1 protein_id gnl|my_center|LOCUS_16420 2324 2821 gene locus_tag LOCUS_16430 gene nrdG 2324 2821 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_16430 4082 2874 gene locus_tag LOCUS_16440 4082 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 >Feature sequence173 1971 1336 gene locus_tag LOCUS_16450 1971 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 3182 2490 gene locus_tag LOCUS_16460 gene rplA 3182 2490 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_16460 3666 3241 gene locus_tag LOCUS_16470 gene rplK 3666 3241 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_16470 4323 3799 gene locus_tag LOCUS_16480 gene nusG 4323 3799 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966426.1 protein_id gnl|my_center|LOCUS_16480 4591 4361 gene locus_tag LOCUS_16490 4591 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 4768 4619 gene locus_tag LOCUS_16500 gene rpmG 4768 4619 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence174 213 1937 gene locus_tag LOCUS_16510 213 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 2153 2407 gene locus_tag LOCUS_16520 2153 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 2551 3006 gene locus_tag LOCUS_16530 gene nrdR 2551 3006 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_16530 2996 3850 gene locus_tag LOCUS_16540 2996 3850 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870266.1 protein_id gnl|my_center|LOCUS_16540 >Feature sequence175 <1 1367 gene locus_tag LOCUS_16550 <1 1367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083864.1:allophanate hydrolase 2277 1420 gene locus_tag LOCUS_16560 gene ylqF 2277 1420 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861161.1 protein_id gnl|my_center|LOCUS_16560 2974 2291 gene locus_tag LOCUS_16570 gene lepB 2974 2291 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948309.1 protein_id gnl|my_center|LOCUS_16570 3457 3104 gene locus_tag LOCUS_16580 gene rplS 3457 3104 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362586.1 protein_id gnl|my_center|LOCUS_16580 3637 4782 gene locus_tag LOCUS_16590 3637 4782 CDS product stage II sporulation protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048006.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence176 932 147 gene locus_tag LOCUS_16600 gene spo0A 932 147 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393014.1 protein_id gnl|my_center|LOCUS_16600 3193 1172 gene locus_tag LOCUS_16610 3193 1172 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 protein_id gnl|my_center|LOCUS_16610 3372 4379 gene locus_tag LOCUS_16620 gene spoVAD 3372 4379 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437476.1 protein_id gnl|my_center|LOCUS_16620 4410 4766 gene locus_tag LOCUS_16630 gene spoVAE 4410 4766 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811048.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence177 98 1738 gene locus_tag LOCUS_16640 98 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1798 1974 gene locus_tag LOCUS_16650 1798 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 1990 2379 gene locus_tag LOCUS_16660 1990 2379 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263544.1 protein_id gnl|my_center|LOCUS_16660 3282 2710 gene locus_tag LOCUS_16670 3282 2710 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426023.1 protein_id gnl|my_center|LOCUS_16670 3693 3439 gene locus_tag LOCUS_16680 3693 3439 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129080272.1 protein_id gnl|my_center|LOCUS_16680 3922 3674 gene locus_tag LOCUS_16690 3922 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 4199 3948 gene locus_tag LOCUS_16700 4199 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 4402 4196 gene locus_tag LOCUS_16710 4402 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence178 4525 185 gene locus_tag LOCUS_16720 4525 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence179 148 1485 gene locus_tag LOCUS_16730 148 1485 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931271.1 protein_id gnl|my_center|LOCUS_16730 2706 1888 gene locus_tag LOCUS_16740 gene yidA 2706 1888 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861537.1 protein_id gnl|my_center|LOCUS_16740 3889 2912 gene locus_tag LOCUS_16750 3889 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 4564 3971 gene locus_tag LOCUS_16760 4564 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 >Feature sequence180 26 1675 gene locus_tag LOCUS_16770 gene ade 26 1675 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964205.1 protein_id gnl|my_center|LOCUS_16770 4596 2092 gene locus_tag LOCUS_16780 4596 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 >Feature sequence181 32 1267 gene locus_tag LOCUS_16790 32 1267 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_16790 1400 1612 gene locus_tag LOCUS_16800 gene rpmE 1400 1612 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_16800 1729 1995 gene locus_tag LOCUS_16810 gene rpsO 1729 1995 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388351.1 protein_id gnl|my_center|LOCUS_16810 2378 4465 gene locus_tag LOCUS_16820 gene pnp 2378 4465 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_16820 >Feature sequence182 346 224 gene locus_tag LOCUS_16830 346 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 509 2320 gene locus_tag LOCUS_16840 509 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 4478 2379 gene locus_tag LOCUS_16850 4478 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence183 1687 314 gene locus_tag LOCUS_16860 1687 314 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_16860 1861 2394 gene locus_tag LOCUS_16870 1861 2394 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_16870 2391 2942 gene locus_tag LOCUS_16880 2391 2942 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964405.1 protein_id gnl|my_center|LOCUS_16880 2948 3715 gene locus_tag LOCUS_16890 2948 3715 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_16890 4297 4306 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence184 <1 510 gene locus_tag LOCUS_16900 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851996.1:manganese efflux pump MntP family protein 546 1439 gene locus_tag LOCUS_16910 546 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 1554 3695 gene locus_tag LOCUS_16920 gene gnpA 1554 3695 CDS product 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389962.1 protein_id gnl|my_center|LOCUS_16920 4283 3756 gene locus_tag LOCUS_16930 gene hpt 4283 3756 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356260.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence185 94 4311 gene locus_tag LOCUS_16940 94 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 >Feature sequence186 265 2340 gene locus_tag LOCUS_16950 gene pflB 265 2340 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721911.1 protein_id gnl|my_center|LOCUS_16950 2359 2595 gene locus_tag LOCUS_16960 2359 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16960 2592 3332 gene locus_tag LOCUS_16970 gene pflA 2592 3332 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289264.1 protein_id gnl|my_center|LOCUS_16970 3790 3368 gene locus_tag LOCUS_16980 3790 3368 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555719.1 protein_id gnl|my_center|LOCUS_16980 <4347 3811 gene locus_tag LOCUS_16990 <4347 3811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003435799.1:HAD family hydrolase >Feature sequence187 144 1286 gene locus_tag LOCUS_17000 144 1286 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963477.1 protein_id gnl|my_center|LOCUS_17000 1432 1965 gene locus_tag LOCUS_17010 1432 1965 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_17010 2085 4235 gene locus_tag LOCUS_17020 2085 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence188 911 165 gene locus_tag LOCUS_17030 911 165 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_17030 1081 1575 gene locus_tag LOCUS_17040 gene purE 1081 1575 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544997.1 protein_id gnl|my_center|LOCUS_17040 1608 2666 gene locus_tag LOCUS_17050 gene purM 1608 2666 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081095.1 protein_id gnl|my_center|LOCUS_17050 2666 3262 gene locus_tag LOCUS_17060 gene purN 2666 3262 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047940.1 protein_id gnl|my_center|LOCUS_17060 3262 3975 gene locus_tag LOCUS_17070 3262 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence189 1162 77 gene locus_tag LOCUS_17080 1162 77 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_17080 2300 1152 gene locus_tag LOCUS_17090 2300 1152 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386882.1 protein_id gnl|my_center|LOCUS_17090 4295 2379 gene locus_tag LOCUS_17100 4295 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 >Feature sequence190 117 1445 gene locus_tag LOCUS_17110 117 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 1603 2445 gene locus_tag LOCUS_17120 1603 2445 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_17120 2516 3241 gene locus_tag LOCUS_17130 2516 3241 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811435.1 protein_id gnl|my_center|LOCUS_17130 3396 4199 gene locus_tag LOCUS_17140 3396 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence191 506 664 gene locus_tag LOCUS_17150 506 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 >Feature sequence192 145 321 gene locus_tag LOCUS_17160 145 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 337 513 gene locus_tag LOCUS_17170 337 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 1619 681 gene locus_tag LOCUS_17180 1619 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 3066 1651 gene locus_tag LOCUS_17190 3066 1651 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814305.1 protein_id gnl|my_center|LOCUS_17190 3784 3101 gene locus_tag LOCUS_17200 gene yycF 3784 3101 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131580.1 protein_id gnl|my_center|LOCUS_17200 4206 3841 gene locus_tag LOCUS_17210 4206 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 >Feature sequence193 51 914 gene locus_tag LOCUS_17220 gene cas7c 51 914 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_17220 911 1561 gene locus_tag LOCUS_17230 gene cas4 911 1561 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118772.1 protein_id gnl|my_center|LOCUS_17230 1561 2580 gene locus_tag LOCUS_17240 gene cas1c 1561 2580 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205009055.1 protein_id gnl|my_center|LOCUS_17240 2596 2886 gene locus_tag LOCUS_17250 gene cas2 2596 2886 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626042.1 protein_id gnl|my_center|LOCUS_17250 3046 3871 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcgccccgcaggggcgtgtgagttgaaat >Feature sequence194 915 592 gene locus_tag LOCUS_17260 915 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 1081 1887 gene locus_tag LOCUS_17270 1081 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 3308 1920 gene locus_tag LOCUS_17280 3308 1920 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016772.1 protein_id gnl|my_center|LOCUS_17280 3550 3987 gene locus_tag LOCUS_17290 3550 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence195 <1 987 gene locus_tag LOCUS_17300 <1 987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244686.1:long-chain-fatty-acid--CoA ligase LcfB 2120 1032 gene locus_tag LOCUS_17310 2120 1032 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109136.1 protein_id gnl|my_center|LOCUS_17310 4100 2139 gene locus_tag LOCUS_17320 4100 2139 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence196 23 536 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcgccccactcggggcgcgtggattgaaat >Feature sequence197 72 749 gene locus_tag LOCUS_17330 72 749 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243015.1 protein_id gnl|my_center|LOCUS_17330 880 1782 gene locus_tag LOCUS_17340 880 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 2014 2649 gene locus_tag LOCUS_17350 2014 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 3189 2677 gene locus_tag LOCUS_17360 gene yfcE 3189 2677 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_17360 3901 3203 gene locus_tag LOCUS_17370 3901 3203 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357219.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence198 192 1229 gene locus_tag LOCUS_17380 192 1229 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_17380 1242 2048 gene locus_tag LOCUS_17390 1242 2048 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_17390 2071 2865 gene locus_tag LOCUS_17400 2071 2865 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_17400 >Feature sequence199 2033 708 gene locus_tag LOCUS_17410 2033 708 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461524.1 protein_id gnl|my_center|LOCUS_17410 >Feature sequence200 40 1038 gene locus_tag LOCUS_17420 gene pta 40 1038 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965049.1 protein_id gnl|my_center|LOCUS_17420 1329 2528 gene locus_tag LOCUS_17430 1329 2528 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986808.1 protein_id gnl|my_center|LOCUS_17430 2647 3486 gene locus_tag LOCUS_17440 2647 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 >Feature sequence201 <1 558 gene locus_tag LOCUS_17450 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357618.1:phenyllactyl-CoA dehydratase activase FldI 564 1232 gene locus_tag LOCUS_17460 564 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 1347 1481 gene locus_tag LOCUS_17470 1347 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 1426 1435 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3051 1585 gene locus_tag LOCUS_17480 gene rlmD 3051 1585 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861959.1 protein_id gnl|my_center|LOCUS_17480 3904 3230 gene locus_tag LOCUS_17490 3904 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 >Feature sequence202 1462 197 gene locus_tag LOCUS_17500 1462 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 1744 1532 gene locus_tag LOCUS_17510 1744 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 3386 1809 gene locus_tag LOCUS_17520 3386 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 3986 3684 gene locus_tag LOCUS_17530 3986 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence203 3945 772 gene locus_tag LOCUS_17540 3945 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 >Feature sequence204 3930 526 gene locus_tag LOCUS_17550 3930 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 >Feature sequence205 76 675 gene locus_tag LOCUS_17560 76 675 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 protein_id gnl|my_center|LOCUS_17560 685 2556 gene locus_tag LOCUS_17570 685 2556 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814523.1 protein_id gnl|my_center|LOCUS_17570 2573 3112 gene locus_tag LOCUS_17580 2573 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 >Feature sequence206 81 1610 gene locus_tag LOCUS_17590 81 1610 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964334.1 protein_id gnl|my_center|LOCUS_17590 1677 2453 gene locus_tag LOCUS_17600 1677 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 2609 2884 gene locus_tag LOCUS_17610 2609 2884 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043904.1 protein_id gnl|my_center|LOCUS_17610 2943 3182 gene locus_tag LOCUS_17620 2943 3182 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_17620 3248 3514 gene locus_tag LOCUS_17630 3248 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence207 2166 97 gene locus_tag LOCUS_17640 gene fusA 2166 97 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_17640 2968 2318 gene locus_tag LOCUS_17650 gene sigF 2968 2318 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 protein_id gnl|my_center|LOCUS_17650 3460 3041 gene locus_tag LOCUS_17660 gene spoIIAB 3460 3041 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357714.1 protein_id gnl|my_center|LOCUS_17660 3800 3453 gene locus_tag LOCUS_17670 gene spoIIAA 3800 3453 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965605.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence208 276 626 gene locus_tag LOCUS_17680 276 626 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964000.1 protein_id gnl|my_center|LOCUS_17680 651 1940 gene locus_tag LOCUS_17690 651 1940 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765058.1 protein_id gnl|my_center|LOCUS_17690 <3822 2066 gene locus_tag LOCUS_17700 <3822 2066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861612.1:NFACT RNA binding domain-containing protein >Feature sequence209 64 348 gene locus_tag LOCUS_17710 64 348 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_17710 368 1993 gene locus_tag LOCUS_17720 gene groL 368 1993 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_17720 3713 2049 gene locus_tag LOCUS_17730 gene ptsP 3713 2049 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_17730 >Feature sequence210 3590 369 gene locus_tag LOCUS_17740 3590 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 >Feature sequence211 3706 1580 gene locus_tag LOCUS_17750 3706 1580 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583217.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence212 <1 961 gene locus_tag LOCUS_17760 <1 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943503.1:N-acetyl-gamma-glutamyl-phosphate reductase 980 1852 gene locus_tag LOCUS_17770 gene argB 980 1852 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940826.1 protein_id gnl|my_center|LOCUS_17770 1871 3577 gene locus_tag LOCUS_17780 1871 3577 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966455.1 protein_id gnl|my_center|LOCUS_17780 >Feature sequence213 107 604 gene locus_tag LOCUS_17790 107 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 601 2223 gene locus_tag LOCUS_17800 601 2223 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_17800 3456 2278 gene locus_tag LOCUS_17810 3456 2278 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_17810 >Feature sequence214 431 270 gene locus_tag LOCUS_17820 431 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 607 3492 gene locus_tag LOCUS_17830 607 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence215 >Feature sequence216 <1 3519 gene locus_tag LOCUS_17840 <1 3519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030997.1:rhamnogalacturonan lyase >Feature sequence217 3391 602 gene locus_tag LOCUS_17850 3391 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 >Feature sequence218 3053 108 gene locus_tag LOCUS_17860 3053 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 >Feature sequence219 224 1345 gene locus_tag LOCUS_17870 224 1345 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435637.1 protein_id gnl|my_center|LOCUS_17870 1367 3274 gene locus_tag LOCUS_17880 1367 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 >Feature sequence220 1303 152 gene locus_tag LOCUS_17890 1303 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 2355 1300 gene locus_tag LOCUS_17900 2355 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 2930 2301 gene locus_tag LOCUS_17910 2930 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 3236 3161 gene locus_tag LOCUS_t00240 3236 3161 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3340 3265 gene locus_tag LOCUS_t00250 3340 3265 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence221 999 454 gene locus_tag LOCUS_17920 999 454 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824008.1 protein_id gnl|my_center|LOCUS_17920 2390 1143 gene locus_tag LOCUS_17930 2390 1143 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966528.1 protein_id gnl|my_center|LOCUS_17930 3205 2390 gene locus_tag LOCUS_17940 gene proB 3205 2390 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence222 1370 84 gene locus_tag LOCUS_17950 1370 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 <3294 1432 gene locus_tag LOCUS_17960 <3294 1432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461226.1:AAA family ATPase >Feature sequence223 222 479 gene locus_tag LOCUS_17970 222 479 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_17970 2005 512 gene locus_tag LOCUS_17980 2005 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 3048 2011 gene locus_tag LOCUS_17990 3048 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence224 371 1336 gene locus_tag LOCUS_18000 gene dusB 371 1336 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_18000 1426 2892 gene locus_tag LOCUS_18010 gene guaB 1426 2892 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264088.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence225 <3196 206 gene locus_tag LOCUS_18020 <3196 206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_094015776.1:S-layer homology domain-containing protein >Feature sequence226 49 1395 gene locus_tag LOCUS_18030 gene gdhA 49 1395 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476262.1 protein_id gnl|my_center|LOCUS_18030 1735 3078 gene locus_tag LOCUS_18040 gene mgtE 1735 3078 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence227 223 1500 gene locus_tag LOCUS_18050 223 1500 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814758.1 protein_id gnl|my_center|LOCUS_18050 1668 2927 gene locus_tag LOCUS_18060 gene rhaA 1668 2927 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288249.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence228 1955 1317 gene locus_tag LOCUS_18070 1955 1317 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740920.1 protein_id gnl|my_center|LOCUS_18070 2613 1936 gene locus_tag LOCUS_18080 2613 1936 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054641.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence229 <1 2835 gene locus_tag LOCUS_18090 <1 2835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886437.1:rhamnogalacturonan exolyase >Feature sequence230 10 798 gene locus_tag LOCUS_18100 10 798 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814594.1 protein_id gnl|my_center|LOCUS_18100 823 1767 gene locus_tag LOCUS_18110 823 1767 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929426.1 protein_id gnl|my_center|LOCUS_18110 1764 2693 gene locus_tag LOCUS_18120 1764 2693 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143966.1 protein_id gnl|my_center|LOCUS_18120 >Feature sequence231 47 889 gene locus_tag LOCUS_18130 gene cdaA 47 889 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966360.1 protein_id gnl|my_center|LOCUS_18130 886 2073 gene locus_tag LOCUS_18140 886 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 2076 2960 gene locus_tag LOCUS_18150 gene hslO 2076 2960 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965667.1 protein_id gnl|my_center|LOCUS_18150 >Feature sequence232 1393 68 gene locus_tag LOCUS_18160 gene der 1393 68 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426959.1 protein_id gnl|my_center|LOCUS_18160 2717 1395 gene locus_tag LOCUS_18170 2717 1395 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903281.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence233 131 616 gene locus_tag LOCUS_18180 131 616 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 protein_id gnl|my_center|LOCUS_18180 >Feature sequence234 1403 222 gene locus_tag LOCUS_18190 gene hydF 1403 222 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048414.1 protein_id gnl|my_center|LOCUS_18190 2702 1470 gene locus_tag LOCUS_18200 2702 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 >Feature sequence235 1476 322 gene locus_tag LOCUS_18210 1476 322 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_18210 2636 1557 gene locus_tag LOCUS_18220 gene serC 2636 1557 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence236 656 171 gene locus_tag LOCUS_18230 656 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 2658 670 gene locus_tag LOCUS_18240 2658 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 >Feature sequence237 2650 569 gene locus_tag LOCUS_18250 2650 569 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_18250 >Feature sequence238 805 122 gene locus_tag LOCUS_18260 gene bioD 805 122 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986727.1 protein_id gnl|my_center|LOCUS_18260 1769 798 gene locus_tag LOCUS_18270 gene bioB 1769 798 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_18270 2379 1774 gene locus_tag LOCUS_18280 2379 1774 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963535.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence239 81 827 gene locus_tag LOCUS_18290 81 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 1267 875 gene locus_tag LOCUS_18300 1267 875 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963442.1 protein_id gnl|my_center|LOCUS_18300 1776 1264 gene locus_tag LOCUS_18310 1776 1264 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_18310 2630 1773 gene locus_tag LOCUS_18320 gene aroE 2630 1773 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870596.1 protein_id gnl|my_center|LOCUS_18320 >Feature sequence240 652 257 gene locus_tag LOCUS_18330 gene rpsI 652 257 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_18330 1106 666 gene locus_tag LOCUS_18340 gene rplM 1106 666 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459272.1 protein_id gnl|my_center|LOCUS_18340 1417 2535 gene locus_tag LOCUS_18350 1417 2535 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510611.1 protein_id gnl|my_center|LOCUS_18350 >Feature sequence241 91 687 gene locus_tag LOCUS_18360 91 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 864 736 gene locus_tag LOCUS_18370 864 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 1142 900 gene locus_tag LOCUS_18380 1142 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18380 <2547 1167 gene locus_tag LOCUS_18390 <2547 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966472.1:glycine--tRNA ligase >Feature sequence242 93 929 gene locus_tag LOCUS_18400 93 929 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_18400 952 1770 gene locus_tag LOCUS_18410 952 1770 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963680.1 protein_id gnl|my_center|LOCUS_18410 1767 2474 gene locus_tag LOCUS_18420 1767 2474 CDS product DUF2161 domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966295.1 protein_id gnl|my_center|LOCUS_18420 >Feature sequence243 2439 1267 gene locus_tag LOCUS_18430 2439 1267 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460576.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence244 <2519 900 gene locus_tag LOCUS_18440 <2519 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393538.1:spore germination protein