>Feature sequence001 1817 2518 gene locus_tag LOCUS_00010 1817 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2741 3529 gene locus_tag LOCUS_00020 2741 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3614 5401 gene locus_tag LOCUS_00030 3614 5401 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798670.1 protein_id gnl|my_center|LOCUS_00030 6767 5415 gene locus_tag LOCUS_00040 6767 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7255 8154 gene locus_tag LOCUS_00050 7255 8154 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861671.1 protein_id gnl|my_center|LOCUS_00050 8793 9152 gene locus_tag LOCUS_00060 gene ndhC 8793 9152 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258748.1 protein_id gnl|my_center|LOCUS_00060 9373 10533 gene locus_tag LOCUS_00070 9373 10533 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765765.1 protein_id gnl|my_center|LOCUS_00070 10649 10565 gene locus_tag LOCUS_t00010 10649 10565 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10810 11088 gene locus_tag LOCUS_00080 10810 11088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11509 11129 gene locus_tag LOCUS_00090 11509 11129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11596 13743 gene locus_tag LOCUS_00100 gene uvrB 11596 13743 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_00100 14260 14469 gene locus_tag LOCUS_00110 gene rpmI 14260 14469 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545453.1 protein_id gnl|my_center|LOCUS_00110 14619 15002 gene locus_tag LOCUS_00120 gene rplT 14619 15002 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225461.1 protein_id gnl|my_center|LOCUS_00120 15622 17067 gene locus_tag LOCUS_00130 gene rseP 15622 17067 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243948.1 protein_id gnl|my_center|LOCUS_00130 17101 18486 gene locus_tag LOCUS_00140 17101 18486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 18782 19528 gene locus_tag LOCUS_00150 18782 19528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 22909 19742 gene locus_tag LOCUS_00160 22909 19742 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120396.1 protein_id gnl|my_center|LOCUS_00160 25784 22911 gene locus_tag LOCUS_00170 25784 22911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 26892 26008 gene locus_tag LOCUS_00180 26892 26008 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764292.1 protein_id gnl|my_center|LOCUS_00180 33640 27263 gene locus_tag LOCUS_00190 33640 27263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 34965 33778 gene locus_tag LOCUS_00200 34965 33778 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903257.1 protein_id gnl|my_center|LOCUS_00200 35459 35533 gene locus_tag LOCUS_t00020 35459 35533 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 35939 36418 gene locus_tag LOCUS_00210 35939 36418 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791444.1 protein_id gnl|my_center|LOCUS_00210 37031 36579 gene locus_tag LOCUS_00220 37031 36579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 37662 37141 gene locus_tag LOCUS_00230 37662 37141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 38651 37743 gene locus_tag LOCUS_00240 38651 37743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 38776 39444 gene locus_tag LOCUS_00250 38776 39444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 39517 40659 gene locus_tag LOCUS_00260 gene citZ 39517 40659 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 protein_id gnl|my_center|LOCUS_00260 41547 41083 gene locus_tag LOCUS_00270 41547 41083 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941854.1 protein_id gnl|my_center|LOCUS_00270 41628 42191 gene locus_tag LOCUS_00280 41628 42191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 42267 42485 gene locus_tag LOCUS_00290 42267 42485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 42836 42378 gene locus_tag LOCUS_00300 gene smpB 42836 42378 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057764.1 protein_id gnl|my_center|LOCUS_00300 43172 42951 gene locus_tag LOCUS_00310 43172 42951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 43813 43247 gene locus_tag LOCUS_00320 43813 43247 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035528.1 protein_id gnl|my_center|LOCUS_00320 44288 44695 gene locus_tag LOCUS_00330 44288 44695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 44799 45254 gene locus_tag LOCUS_00340 gene ndk 44799 45254 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770040.1 protein_id gnl|my_center|LOCUS_00340 46222 45401 gene locus_tag LOCUS_00350 46222 45401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 47175 46231 gene locus_tag LOCUS_00360 47175 46231 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289773.1 protein_id gnl|my_center|LOCUS_00360 47969 47301 gene locus_tag LOCUS_00370 47969 47301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 49256 47988 gene locus_tag LOCUS_00380 49256 47988 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_00380 50985 49327 gene locus_tag LOCUS_00390 50985 49327 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_00390 52654 51014 gene locus_tag LOCUS_00400 52654 51014 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922562.1 protein_id gnl|my_center|LOCUS_00400 53871 52867 gene locus_tag LOCUS_00410 gene dusB 53871 52867 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927287.1 protein_id gnl|my_center|LOCUS_00410 54642 54133 gene locus_tag LOCUS_00420 54642 54133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 55967 54801 gene locus_tag LOCUS_00430 55967 54801 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058190.1 protein_id gnl|my_center|LOCUS_00430 57702 56137 gene locus_tag LOCUS_00440 gene murJ 57702 56137 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946821.1 protein_id gnl|my_center|LOCUS_00440 58807 57716 gene locus_tag LOCUS_00450 58807 57716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 59601 58957 gene locus_tag LOCUS_00460 59601 58957 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461598.1 protein_id gnl|my_center|LOCUS_00460 61278 59818 gene locus_tag LOCUS_00470 61278 59818 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193073.1 protein_id gnl|my_center|LOCUS_00470 62131 61376 gene locus_tag LOCUS_00480 gene larB 62131 61376 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100884.1 protein_id gnl|my_center|LOCUS_00480 62943 62128 gene locus_tag LOCUS_00490 gene larE 62943 62128 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357133.1 protein_id gnl|my_center|LOCUS_00490 64126 62915 gene locus_tag LOCUS_00500 gene larC 64126 62915 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964092.1 protein_id gnl|my_center|LOCUS_00500 64338 65348 gene locus_tag LOCUS_00510 64338 65348 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344609.1 protein_id gnl|my_center|LOCUS_00510 66881 65526 gene locus_tag LOCUS_00520 66881 65526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 68761 67022 gene locus_tag LOCUS_00530 68761 67022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 69129 69674 gene locus_tag LOCUS_00540 gene sufT 69129 69674 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_00540 69681 70154 gene locus_tag LOCUS_00550 69681 70154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 70539 70387 gene locus_tag LOCUS_00560 70539 70387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 71426 70542 gene locus_tag LOCUS_00570 71426 70542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 73166 71784 gene locus_tag LOCUS_00580 gene nuoN 73166 71784 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078186264.1 protein_id gnl|my_center|LOCUS_00580 74641 73217 gene locus_tag LOCUS_00590 74641 73217 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813230.1 protein_id gnl|my_center|LOCUS_00590 76496 74664 gene locus_tag LOCUS_00600 gene nuoL 76496 74664 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_00600 76837 76520 gene locus_tag LOCUS_00610 gene nuoK 76837 76520 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258758.1 protein_id gnl|my_center|LOCUS_00610 >Feature sequence002 296 1552 gene locus_tag LOCUS_00620 gene purD 296 1552 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404599.1 protein_id gnl|my_center|LOCUS_00620 1583 2182 gene locus_tag LOCUS_00630 1583 2182 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104401.1 protein_id gnl|my_center|LOCUS_00630 2319 3992 gene locus_tag LOCUS_00640 2319 3992 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966477.1 protein_id gnl|my_center|LOCUS_00640 4020 4937 gene locus_tag LOCUS_00650 4020 4937 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943321.1 protein_id gnl|my_center|LOCUS_00650 4957 5832 gene locus_tag LOCUS_00660 4957 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 5936 6694 gene locus_tag LOCUS_00670 5936 6694 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_00670 6863 7372 gene locus_tag LOCUS_00680 6863 7372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 7379 8251 gene locus_tag LOCUS_00690 7379 8251 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020964298.1 protein_id gnl|my_center|LOCUS_00690 8257 9864 gene locus_tag LOCUS_00700 8257 9864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 9890 12139 gene locus_tag LOCUS_00710 9890 12139 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706661.1 protein_id gnl|my_center|LOCUS_00710 12143 13120 gene locus_tag LOCUS_00720 12143 13120 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261418.1 protein_id gnl|my_center|LOCUS_00720 13139 14146 gene locus_tag LOCUS_00730 13139 14146 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707193.1 protein_id gnl|my_center|LOCUS_00730 15369 14266 gene locus_tag LOCUS_00740 gene alr 15369 14266 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_00740 15579 15653 gene locus_tag LOCUS_t00030 15579 15653 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 15858 16754 gene locus_tag LOCUS_00750 15858 16754 CDS product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109315.1 protein_id gnl|my_center|LOCUS_00750 16801 17718 gene locus_tag LOCUS_00760 16801 17718 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418680.1 protein_id gnl|my_center|LOCUS_00760 17909 20068 gene locus_tag LOCUS_00770 17909 20068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 20140 21456 gene locus_tag LOCUS_00780 20140 21456 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_00780 23734 21494 gene locus_tag LOCUS_00790 23734 21494 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203206.1 protein_id gnl|my_center|LOCUS_00790 25086 24121 gene locus_tag LOCUS_00800 25086 24121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 25943 25272 gene locus_tag LOCUS_00810 25943 25272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 26573 25959 gene locus_tag LOCUS_00820 26573 25959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 27484 26669 gene locus_tag LOCUS_00830 27484 26669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 29536 27713 gene locus_tag LOCUS_00840 gene thiC 29536 27713 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521865.1 protein_id gnl|my_center|LOCUS_00840 31736 29859 gene locus_tag LOCUS_00850 31736 29859 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458920.1 protein_id gnl|my_center|LOCUS_00850 32146 31871 gene locus_tag LOCUS_00860 32146 31871 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458924.1 protein_id gnl|my_center|LOCUS_00860 32732 32442 gene locus_tag LOCUS_00870 32732 32442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00870 33122 33715 gene locus_tag LOCUS_00880 33122 33715 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328552.1 protein_id gnl|my_center|LOCUS_00880 35947 33923 gene locus_tag LOCUS_00890 35947 33923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 36630 36118 gene locus_tag LOCUS_00900 36630 36118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 36819 38753 gene locus_tag LOCUS_00910 36819 38753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 38781 40559 gene locus_tag LOCUS_00920 gene fucI 38781 40559 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724126.1 protein_id gnl|my_center|LOCUS_00920 40680 40871 gene locus_tag LOCUS_00930 40680 40871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 41000 42424 gene locus_tag LOCUS_00940 gene fucK 41000 42424 CDS product L-fuculokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808376.1 protein_id gnl|my_center|LOCUS_00940 42438 43253 gene locus_tag LOCUS_00950 42438 43253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 43694 43428 gene locus_tag LOCUS_00960 43694 43428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 47170 43988 gene locus_tag LOCUS_00970 47170 43988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 46900 46909 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47360 48058 gene locus_tag LOCUS_00980 47360 48058 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766240.1 protein_id gnl|my_center|LOCUS_00980 48683 48120 gene locus_tag LOCUS_00990 48683 48120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 48844 49572 gene locus_tag LOCUS_01000 48844 49572 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081998.1 protein_id gnl|my_center|LOCUS_01000 49983 49837 gene locus_tag LOCUS_01010 49983 49837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 50819 50253 gene locus_tag LOCUS_01020 50819 50253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 52459 50819 gene locus_tag LOCUS_01030 52459 50819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 52888 52962 gene locus_tag LOCUS_t00040 52888 52962 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 52986 53061 gene locus_tag LOCUS_t00050 52986 53061 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 53115 53372 gene locus_tag LOCUS_01040 gene thiS 53115 53372 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140405.1 protein_id gnl|my_center|LOCUS_01040 53415 55316 gene locus_tag LOCUS_01050 gene mutL 53415 55316 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313182.1 protein_id gnl|my_center|LOCUS_01050 55652 57604 gene locus_tag LOCUS_01060 55652 57604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 58001 58357 gene locus_tag LOCUS_01070 58001 58357 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_01070 59671 58694 gene locus_tag LOCUS_01080 gene hemC 59671 58694 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820470.1 protein_id gnl|my_center|LOCUS_01080 60683 59661 gene locus_tag LOCUS_01090 60683 59661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 61441 60683 gene locus_tag LOCUS_01100 61441 60683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 62256 61462 gene locus_tag LOCUS_01110 gene folE2 62256 61462 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_01110 62609 62364 gene locus_tag LOCUS_01120 62609 62364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 62814 62641 gene locus_tag LOCUS_01130 gene rpmG 62814 62641 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933041.1 protein_id gnl|my_center|LOCUS_01130 63672 62848 gene locus_tag LOCUS_01140 63672 62848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 63908 64867 gene locus_tag LOCUS_01150 63908 64867 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933663.1 protein_id gnl|my_center|LOCUS_01150 64872 65840 gene locus_tag LOCUS_01160 64872 65840 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920841.1 protein_id gnl|my_center|LOCUS_01160 65847 66356 gene locus_tag LOCUS_01170 65847 66356 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111658546.1 protein_id gnl|my_center|LOCUS_01170 66353 66760 gene locus_tag LOCUS_01180 gene mutT 66353 66760 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932370.1 protein_id gnl|my_center|LOCUS_01180 67468 68865 gene locus_tag LOCUS_01190 67468 68865 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_01190 68932 69636 gene locus_tag LOCUS_01200 68932 69636 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546598.1 protein_id gnl|my_center|LOCUS_01200 69633 70997 gene locus_tag LOCUS_01210 69633 70997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01210 71019 72392 gene locus_tag LOCUS_01220 71019 72392 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530684.1 protein_id gnl|my_center|LOCUS_01220 73731 72595 gene locus_tag LOCUS_01230 73731 72595 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486733.1 protein_id gnl|my_center|LOCUS_01230 >Feature sequence003 2934 1714 gene locus_tag LOCUS_01240 2934 1714 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545343.1 protein_id gnl|my_center|LOCUS_01240 4504 3020 gene locus_tag LOCUS_01250 4504 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 5116 5790 gene locus_tag LOCUS_01260 5116 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 7473 6202 gene locus_tag LOCUS_01270 7473 6202 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_01270 9073 7685 gene locus_tag LOCUS_01280 9073 7685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 protein_id gnl|my_center|LOCUS_01280 10653 9100 gene locus_tag LOCUS_01290 10653 9100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 13065 10666 gene locus_tag LOCUS_01300 13065 10666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 14093 13455 gene locus_tag LOCUS_01310 gene pth 14093 13455 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287401.1 protein_id gnl|my_center|LOCUS_01310 15047 14145 gene locus_tag LOCUS_01320 15047 14145 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324190.1 protein_id gnl|my_center|LOCUS_01320 16090 15086 gene locus_tag LOCUS_01330 16090 15086 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122095.1 protein_id gnl|my_center|LOCUS_01330 16194 17051 gene locus_tag LOCUS_01340 16194 17051 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933176.1 protein_id gnl|my_center|LOCUS_01340 17074 17583 gene locus_tag LOCUS_01350 17074 17583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 18789 17683 gene locus_tag LOCUS_01360 18789 17683 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967895.1 protein_id gnl|my_center|LOCUS_01360 19150 20430 gene locus_tag LOCUS_01370 gene serS 19150 20430 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_01370 20467 21246 gene locus_tag LOCUS_01380 20467 21246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 22650 21541 gene locus_tag LOCUS_01390 gene hemW 22650 21541 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256118.1 protein_id gnl|my_center|LOCUS_01390 24120 22663 gene locus_tag LOCUS_01400 24120 22663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 25571 24048 gene locus_tag LOCUS_01410 25571 24048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 24141 24150 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26304 25765 gene locus_tag LOCUS_01420 26304 25765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 26544 27113 gene locus_tag LOCUS_01430 gene pyrE 26544 27113 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940203.1 protein_id gnl|my_center|LOCUS_01430 27127 28188 gene locus_tag LOCUS_01440 27127 28188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 29187 28291 gene locus_tag LOCUS_01450 29187 28291 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791347.1 protein_id gnl|my_center|LOCUS_01450 33827 29451 gene locus_tag LOCUS_01460 33827 29451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 34003 35313 gene locus_tag LOCUS_01470 34003 35313 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937721.1 protein_id gnl|my_center|LOCUS_01470 35937 36176 gene locus_tag LOCUS_01480 35937 36176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 36954 36130 gene locus_tag LOCUS_01490 36954 36130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 39006 37405 gene locus_tag LOCUS_01500 gene menD 39006 37405 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259491.1 protein_id gnl|my_center|LOCUS_01500 40619 39012 gene locus_tag LOCUS_01510 gene metG 40619 39012 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939333.1 protein_id gnl|my_center|LOCUS_01510 42092 40890 gene locus_tag LOCUS_01520 42092 40890 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795962.1 protein_id gnl|my_center|LOCUS_01520 42537 42118 gene locus_tag LOCUS_01530 gene fucU 42537 42118 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920848.1 protein_id gnl|my_center|LOCUS_01530 43756 42608 gene locus_tag LOCUS_01540 43756 42608 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_01540 44750 43836 gene locus_tag LOCUS_01550 44750 43836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 47091 45040 gene locus_tag LOCUS_01560 47091 45040 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895699.1 protein_id gnl|my_center|LOCUS_01560 48270 47266 gene locus_tag LOCUS_01570 48270 47266 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064504886.1 protein_id gnl|my_center|LOCUS_01570 49845 48310 gene locus_tag LOCUS_01580 49845 48310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039965.1 protein_id gnl|my_center|LOCUS_01580 50905 49838 gene locus_tag LOCUS_01590 50905 49838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 52181 51177 gene locus_tag LOCUS_01600 52181 51177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 53053 52205 gene locus_tag LOCUS_01610 53053 52205 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_01610 53596 53057 gene locus_tag LOCUS_01620 53596 53057 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974186.1 protein_id gnl|my_center|LOCUS_01620 55204 53630 gene locus_tag LOCUS_01630 55204 53630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 56405 55230 gene locus_tag LOCUS_01640 56405 55230 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107731.1 protein_id gnl|my_center|LOCUS_01640 57541 56402 gene locus_tag LOCUS_01650 57541 56402 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331373.1 protein_id gnl|my_center|LOCUS_01650 58584 57541 gene locus_tag LOCUS_01660 58584 57541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 59417 58587 gene locus_tag LOCUS_01670 59417 58587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 60546 59407 gene locus_tag LOCUS_01680 60546 59407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 61552 60587 gene locus_tag LOCUS_01690 61552 60587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 62721 61549 gene locus_tag LOCUS_01700 62721 61549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 63933 62755 gene locus_tag LOCUS_01710 63933 62755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 65084 63930 gene locus_tag LOCUS_01720 65084 63930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 65895 65119 gene locus_tag LOCUS_01730 65895 65119 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203385.1 protein_id gnl|my_center|LOCUS_01730 66769 65921 gene locus_tag LOCUS_01740 66769 65921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 67479 66808 gene locus_tag LOCUS_01750 67479 66808 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_01750 69944 67542 gene locus_tag LOCUS_01760 69944 67542 CDS product tyrosine-protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765281.1 protein_id gnl|my_center|LOCUS_01760 70857 70075 gene locus_tag LOCUS_01770 70857 70075 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039947.1 protein_id gnl|my_center|LOCUS_01770 >Feature sequence004 122 577 gene locus_tag LOCUS_01780 122 577 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072772321.1 protein_id gnl|my_center|LOCUS_01780 586 1074 gene locus_tag LOCUS_01790 gene elsL 586 1074 CDS product cell wall-recycling L,D-carboxypeptidase ElsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 protein_id gnl|my_center|LOCUS_01790 1226 2605 gene locus_tag LOCUS_01800 1226 2605 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_01800 2628 3665 gene locus_tag LOCUS_01810 gene cydB 2628 3665 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_01810 3728 6493 gene locus_tag LOCUS_01820 3728 6493 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338417.1 protein_id gnl|my_center|LOCUS_01820 6509 7600 gene locus_tag LOCUS_01830 gene odhB 6509 7600 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918229.1 protein_id gnl|my_center|LOCUS_01830 8326 7976 gene locus_tag LOCUS_01840 8326 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 8691 8284 gene locus_tag LOCUS_01850 8691 8284 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_01850 10133 8745 gene locus_tag LOCUS_01860 gene lpdA 10133 8745 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_01860 11602 10280 gene locus_tag LOCUS_01870 11602 10280 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939112.1 protein_id gnl|my_center|LOCUS_01870 11683 12351 gene locus_tag LOCUS_01880 11683 12351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 14951 12609 gene locus_tag LOCUS_01890 14951 12609 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767049.1 protein_id gnl|my_center|LOCUS_01890 17056 15050 gene locus_tag LOCUS_01900 17056 15050 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706661.1 protein_id gnl|my_center|LOCUS_01900 19320 17314 gene locus_tag LOCUS_01910 gene btuB 19320 17314 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_01910 19839 22415 gene locus_tag LOCUS_01920 19839 22415 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052877.1 protein_id gnl|my_center|LOCUS_01920 22419 23411 gene locus_tag LOCUS_01930 gene cbiB 22419 23411 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816688.1 protein_id gnl|my_center|LOCUS_01930 23408 24448 gene locus_tag LOCUS_01940 gene cobT 23408 24448 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943639.1 protein_id gnl|my_center|LOCUS_01940 24468 25208 gene locus_tag LOCUS_01950 gene cobS 24468 25208 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057177.1 protein_id gnl|my_center|LOCUS_01950 25205 26020 gene locus_tag LOCUS_01960 25205 26020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 26037 26585 gene locus_tag LOCUS_01970 gene cobU 26037 26585 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964692.1 protein_id gnl|my_center|LOCUS_01970 27029 27111 gene locus_tag LOCUS_t00060 27029 27111 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 27654 27370 gene locus_tag LOCUS_01980 27654 27370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 28101 29144 gene locus_tag LOCUS_01990 28101 29144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 29144 30190 gene locus_tag LOCUS_02000 29144 30190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 30355 31599 gene locus_tag LOCUS_02010 30355 31599 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_02010 32113 33108 gene locus_tag LOCUS_02020 32113 33108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 33839 33129 gene locus_tag LOCUS_02030 33839 33129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02030 34715 33858 gene locus_tag LOCUS_02040 34715 33858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02040 34975 36363 gene locus_tag LOCUS_02050 34975 36363 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_02050 38934 36358 gene locus_tag LOCUS_02060 38934 36358 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202630.1 protein_id gnl|my_center|LOCUS_02060 42957 39088 gene locus_tag LOCUS_02070 42957 39088 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109085.1 protein_id gnl|my_center|LOCUS_02070 45082 42980 gene locus_tag LOCUS_02080 45082 42980 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201964.1 protein_id gnl|my_center|LOCUS_02080 44069 44078 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 45454 46554 gene locus_tag LOCUS_02090 45454 46554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 48580 46625 gene locus_tag LOCUS_02100 gene speA 48580 46625 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792905.1 protein_id gnl|my_center|LOCUS_02100 49788 48586 gene locus_tag LOCUS_02110 gene nspC 49788 48586 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 protein_id gnl|my_center|LOCUS_02110 49965 50756 gene locus_tag LOCUS_02120 49965 50756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 52737 51073 gene locus_tag LOCUS_02130 52737 51073 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108979.1 protein_id gnl|my_center|LOCUS_02130 52889 55501 gene locus_tag LOCUS_02140 gene leuS 52889 55501 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246072.1 protein_id gnl|my_center|LOCUS_02140 55526 56179 gene locus_tag LOCUS_02150 gene rpe 55526 56179 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545731.1 protein_id gnl|my_center|LOCUS_02150 57213 56317 gene locus_tag LOCUS_02160 57213 56317 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922152.1 protein_id gnl|my_center|LOCUS_02160 58319 57534 gene locus_tag LOCUS_02170 58319 57534 CDS product basic secretory family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764203.1 protein_id gnl|my_center|LOCUS_02170 58559 59823 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaattcacgcacccgtgtgggtgcgac 61709 60306 gene locus_tag LOCUS_02180 gene dnaB 61709 60306 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788141.1 protein_id gnl|my_center|LOCUS_02180 62450 61713 gene locus_tag LOCUS_02190 62450 61713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 63851 62457 gene locus_tag LOCUS_02200 63851 62457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 >Feature sequence005 2112 244 gene locus_tag LOCUS_02210 2112 244 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904125.1 protein_id gnl|my_center|LOCUS_02210 2224 3018 gene locus_tag LOCUS_02220 gene pyrF 2224 3018 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_02220 3198 3914 gene locus_tag LOCUS_02230 3198 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 4233 5627 gene locus_tag LOCUS_02240 4233 5627 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326733.1 protein_id gnl|my_center|LOCUS_02240 6746 5706 gene locus_tag LOCUS_02250 6746 5706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 7055 6759 gene locus_tag LOCUS_02260 7055 6759 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391219.1 protein_id gnl|my_center|LOCUS_02260 9300 7102 gene locus_tag LOCUS_02270 9300 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 9520 10296 gene locus_tag LOCUS_02280 9520 10296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 10344 11159 gene locus_tag LOCUS_02290 10344 11159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 11521 11613 gene locus_tag LOCUS_t00070 11521 11613 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12438 11698 gene locus_tag LOCUS_02300 gene radC 12438 11698 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545736.1 protein_id gnl|my_center|LOCUS_02300 13930 12440 gene locus_tag LOCUS_02310 13930 12440 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958000.1 protein_id gnl|my_center|LOCUS_02310 14389 14024 gene locus_tag LOCUS_02320 14389 14024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 14880 15203 gene locus_tag LOCUS_02330 14880 15203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02330 15218 15613 gene locus_tag LOCUS_02340 gene rpsI 15218 15613 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354786.1 protein_id gnl|my_center|LOCUS_02340 16281 15844 gene locus_tag LOCUS_02350 16281 15844 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227792.1 protein_id gnl|my_center|LOCUS_02350 17856 16288 gene locus_tag LOCUS_02360 17856 16288 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_02360 17968 18759 gene locus_tag LOCUS_02370 17968 18759 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_02370 18799 19245 gene locus_tag LOCUS_02380 18799 19245 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_02380 19287 21674 gene locus_tag LOCUS_02390 19287 21674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 21700 23493 gene locus_tag LOCUS_02400 21700 23493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 23540 24286 gene locus_tag LOCUS_02410 23540 24286 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_02410 24313 24822 gene locus_tag LOCUS_02420 24313 24822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 25802 25071 gene locus_tag LOCUS_02430 25802 25071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 26870 25950 gene locus_tag LOCUS_02440 26870 25950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 28217 26970 gene locus_tag LOCUS_02450 28217 26970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 29653 28328 gene locus_tag LOCUS_02460 29653 28328 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764994.1 protein_id gnl|my_center|LOCUS_02460 30768 29680 gene locus_tag LOCUS_02470 30768 29680 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763415.1 protein_id gnl|my_center|LOCUS_02470 31837 30770 gene locus_tag LOCUS_02480 gene gmd 31837 30770 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786803.1 protein_id gnl|my_center|LOCUS_02480 33109 31991 gene locus_tag LOCUS_02490 gene carA 33109 31991 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931760.1 protein_id gnl|my_center|LOCUS_02490 36344 33141 gene locus_tag LOCUS_02500 gene carB 36344 33141 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_02500 38733 36598 gene locus_tag LOCUS_02510 38733 36598 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461804.1 protein_id gnl|my_center|LOCUS_02510 39132 43571 gene locus_tag LOCUS_02520 gene gltB 39132 43571 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964980.1 protein_id gnl|my_center|LOCUS_02520 46252 44366 gene locus_tag LOCUS_02530 46252 44366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 46557 46309 gene locus_tag LOCUS_02540 gene yidD 46557 46309 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816027.1 protein_id gnl|my_center|LOCUS_02540 46901 46554 gene locus_tag LOCUS_02550 46901 46554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 47175 46990 gene locus_tag LOCUS_02560 47175 46990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 49497 47386 gene locus_tag LOCUS_02570 49497 47386 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461804.1 protein_id gnl|my_center|LOCUS_02570 49907 52084 gene locus_tag LOCUS_02580 49907 52084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 52259 53635 gene locus_tag LOCUS_02590 52259 53635 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671898.1 protein_id gnl|my_center|LOCUS_02590 54701 53847 gene locus_tag LOCUS_02600 54701 53847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 55336 54698 gene locus_tag LOCUS_02610 gene pdxH 55336 54698 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210959.1 protein_id gnl|my_center|LOCUS_02610 56221 55358 gene locus_tag LOCUS_02620 gene nadC 56221 55358 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_02620 57130 56237 gene locus_tag LOCUS_02630 57130 56237 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_02630 58179 57169 gene locus_tag LOCUS_02640 58179 57169 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940307.1 protein_id gnl|my_center|LOCUS_02640 59006 58344 gene locus_tag LOCUS_02650 59006 58344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 60208 59519 gene locus_tag LOCUS_02660 60208 59519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 61689 60310 gene locus_tag LOCUS_02670 61689 60310 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113084.1 protein_id gnl|my_center|LOCUS_02670 62689 61760 gene locus_tag LOCUS_02680 gene trxB 62689 61760 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231058.1 protein_id gnl|my_center|LOCUS_02680 63609 62686 gene locus_tag LOCUS_02690 63609 62686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 >Feature sequence006 705 1748 gene locus_tag LOCUS_02700 705 1748 CDS product sensor protein KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764092.1 protein_id gnl|my_center|LOCUS_02700 2100 3086 gene locus_tag LOCUS_02710 2100 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 3236 3457 gene locus_tag LOCUS_02720 3236 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 3622 4461 gene locus_tag LOCUS_02730 3622 4461 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387789.1 protein_id gnl|my_center|LOCUS_02730 4487 5083 gene locus_tag LOCUS_02740 4487 5083 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_02740 5080 7383 gene locus_tag LOCUS_02750 5080 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 7653 8801 gene locus_tag LOCUS_02760 7653 8801 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129649887.1 protein_id gnl|my_center|LOCUS_02760 9493 9029 gene locus_tag LOCUS_02770 9493 9029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 9741 9514 gene locus_tag LOCUS_02780 9741 9514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 9728 10765 gene locus_tag LOCUS_02790 9728 10765 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966690.1 protein_id gnl|my_center|LOCUS_02790 10925 12190 gene locus_tag LOCUS_02800 10925 12190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 14762 12183 gene locus_tag LOCUS_02810 14762 12183 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258469.1 protein_id gnl|my_center|LOCUS_02810 16486 14759 gene locus_tag LOCUS_02820 16486 14759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 17384 16515 gene locus_tag LOCUS_02830 17384 16515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 18866 17418 gene locus_tag LOCUS_02840 18866 17418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 19870 18863 gene locus_tag LOCUS_02850 19870 18863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 21456 19873 gene locus_tag LOCUS_02860 21456 19873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 22506 21481 gene locus_tag LOCUS_02870 22506 21481 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035349.1 protein_id gnl|my_center|LOCUS_02870 23039 23923 gene locus_tag LOCUS_02880 23039 23923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02880 24309 25295 gene locus_tag LOCUS_02890 24309 25295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 25347 26057 gene locus_tag LOCUS_02900 25347 26057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 27147 26095 gene locus_tag LOCUS_02910 27147 26095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 27408 27872 gene locus_tag LOCUS_02920 27408 27872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02920 27856 27865 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27905 28282 gene locus_tag LOCUS_02930 27905 28282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02930 28279 28788 gene locus_tag LOCUS_02940 28279 28788 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094124518.1 protein_id gnl|my_center|LOCUS_02940 29156 30136 gene locus_tag LOCUS_02950 gene ilvC 29156 30136 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218988.1 protein_id gnl|my_center|LOCUS_02950 30236 31033 gene locus_tag LOCUS_02960 30236 31033 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930637.1 protein_id gnl|my_center|LOCUS_02960 31040 31735 gene locus_tag LOCUS_02970 31040 31735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 31926 32612 gene locus_tag LOCUS_02980 31926 32612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 32866 34263 gene locus_tag LOCUS_02990 32866 34263 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921292.1 protein_id gnl|my_center|LOCUS_02990 34747 34379 gene locus_tag LOCUS_03000 34747 34379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 36071 34776 gene locus_tag LOCUS_03010 gene eno 36071 34776 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760327.1 protein_id gnl|my_center|LOCUS_03010 36422 37729 gene locus_tag LOCUS_03020 36422 37729 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125805.1 protein_id gnl|my_center|LOCUS_03020 38174 39118 gene locus_tag LOCUS_03030 38174 39118 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275314.1 protein_id gnl|my_center|LOCUS_03030 39397 40743 gene locus_tag LOCUS_03040 39397 40743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03040 41306 41082 gene locus_tag LOCUS_03050 41306 41082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 41739 41506 gene locus_tag LOCUS_03060 gene rpmB 41739 41506 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556947.1 protein_id gnl|my_center|LOCUS_03060 42220 43221 gene locus_tag LOCUS_03070 42220 43221 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207904.1 protein_id gnl|my_center|LOCUS_03070 43989 43564 gene locus_tag LOCUS_03080 43989 43564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 45071 43986 gene locus_tag LOCUS_03090 45071 43986 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_03090 45793 45077 gene locus_tag LOCUS_03100 45793 45077 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_03100 47657 45816 gene locus_tag LOCUS_03110 47657 45816 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_03110 47782 48630 gene locus_tag LOCUS_03120 gene ispE 47782 48630 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226742.1 protein_id gnl|my_center|LOCUS_03120 48718 49260 gene locus_tag LOCUS_03130 48718 49260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 49281 51266 gene locus_tag LOCUS_03140 49281 51266 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_03140 52044 51274 gene locus_tag LOCUS_03150 52044 51274 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941936.1 protein_id gnl|my_center|LOCUS_03150 52853 52041 gene locus_tag LOCUS_03160 gene cbiQ 52853 52041 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941935.1 protein_id gnl|my_center|LOCUS_03160 53905 52862 gene locus_tag LOCUS_03170 53905 52862 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941934.1 protein_id gnl|my_center|LOCUS_03170 54238 54522 gene locus_tag LOCUS_03180 54238 54522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 54904 54539 gene locus_tag LOCUS_03190 54904 54539 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761537.1 protein_id gnl|my_center|LOCUS_03190 55809 54916 gene locus_tag LOCUS_03200 gene argB 55809 54916 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869561.1 protein_id gnl|my_center|LOCUS_03200 56864 55872 gene locus_tag LOCUS_03210 gene corA 56864 55872 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626268.1 protein_id gnl|my_center|LOCUS_03210 57489 57034 gene locus_tag LOCUS_03220 gene rplI 57489 57034 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_03220 57735 59282 gene locus_tag LOCUS_03230 gene purH 57735 59282 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909162.1 protein_id gnl|my_center|LOCUS_03230 59322 60062 gene locus_tag LOCUS_03240 gene pdxJ 59322 60062 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296302.1 protein_id gnl|my_center|LOCUS_03240 60097 60483 gene locus_tag LOCUS_03250 gene acpS 60097 60483 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882961.1 protein_id gnl|my_center|LOCUS_03250 >Feature sequence007 788 39 gene locus_tag LOCUS_03260 788 39 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402843.1 protein_id gnl|my_center|LOCUS_03260 1888 956 gene locus_tag LOCUS_03270 1888 956 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787404.1 protein_id gnl|my_center|LOCUS_03270 3766 2129 gene locus_tag LOCUS_03280 3766 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 4474 3770 gene locus_tag LOCUS_03290 4474 3770 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461981.1 protein_id gnl|my_center|LOCUS_03290 4945 4574 gene locus_tag LOCUS_03300 4945 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 5997 5002 gene locus_tag LOCUS_03310 gene hemB 5997 5002 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056277.1 protein_id gnl|my_center|LOCUS_03310 7572 6052 gene locus_tag LOCUS_03320 7572 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 7453 7716 gene locus_tag LOCUS_03330 7453 7716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 7935 9827 gene locus_tag LOCUS_03340 gene thrS 7935 9827 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228977.1 protein_id gnl|my_center|LOCUS_03340 9960 10505 gene locus_tag LOCUS_03350 gene infC 9960 10505 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_03350 12254 11022 gene locus_tag LOCUS_03360 12254 11022 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798870.1 protein_id gnl|my_center|LOCUS_03360 13434 12259 gene locus_tag LOCUS_03370 13434 12259 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546435.1 protein_id gnl|my_center|LOCUS_03370 13724 14233 gene locus_tag LOCUS_03380 gene coaD 13724 14233 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692360.1 protein_id gnl|my_center|LOCUS_03380 14620 14258 gene locus_tag LOCUS_03390 14620 14258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 15161 14607 gene locus_tag LOCUS_03400 15161 14607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 16533 15148 gene locus_tag LOCUS_03410 16533 15148 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775783.1 protein_id gnl|my_center|LOCUS_03410 17375 16632 gene locus_tag LOCUS_03420 17375 16632 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890768.1 protein_id gnl|my_center|LOCUS_03420 17529 18377 gene locus_tag LOCUS_03430 17529 18377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 18477 19073 gene locus_tag LOCUS_03440 18477 19073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 19367 20299 gene locus_tag LOCUS_03450 19367 20299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 20296 21651 gene locus_tag LOCUS_03460 20296 21651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 22798 21749 gene locus_tag LOCUS_03470 22798 21749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 23553 22798 gene locus_tag LOCUS_03480 23553 22798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03480 24704 23553 gene locus_tag LOCUS_03490 24704 23553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03490 23600 23609 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25206 26156 gene locus_tag LOCUS_03500 25206 26156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 26272 28278 gene locus_tag LOCUS_03510 26272 28278 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_03510 28784 28404 gene locus_tag LOCUS_03520 28784 28404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 29218 28799 gene locus_tag LOCUS_03530 29218 28799 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_03530 30208 29252 gene locus_tag LOCUS_03540 gene argF 30208 29252 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940828.1 protein_id gnl|my_center|LOCUS_03540 31964 30276 gene locus_tag LOCUS_03550 31964 30276 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108979.1 protein_id gnl|my_center|LOCUS_03550 33871 32093 gene locus_tag LOCUS_03560 gene ptsP 33871 32093 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_03560 34184 33918 gene locus_tag LOCUS_03570 34184 33918 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942527.1 protein_id gnl|my_center|LOCUS_03570 35231 34269 gene locus_tag LOCUS_03580 gene hprK 35231 34269 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228097.1 protein_id gnl|my_center|LOCUS_03580 35330 36727 gene locus_tag LOCUS_03590 35330 36727 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_03590 36735 37613 gene locus_tag LOCUS_03600 36735 37613 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_03600 37580 38170 gene locus_tag LOCUS_03610 37580 38170 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_03610 39870 38203 gene locus_tag LOCUS_03620 39870 38203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 40652 39957 gene locus_tag LOCUS_03630 40652 39957 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_03630 41226 40663 gene locus_tag LOCUS_03640 41226 40663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 42192 41335 gene locus_tag LOCUS_03650 42192 41335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 43720 42203 gene locus_tag LOCUS_03660 43720 42203 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_03660 43855 44745 gene locus_tag LOCUS_03670 43855 44745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 44772 45149 gene locus_tag LOCUS_03680 44772 45149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 48797 45282 gene locus_tag LOCUS_03690 48797 45282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 49178 49585 gene locus_tag LOCUS_03700 49178 49585 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020962.1 protein_id gnl|my_center|LOCUS_03700 49607 50782 gene locus_tag LOCUS_03710 49607 50782 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_03710 50796 51575 gene locus_tag LOCUS_03720 50796 51575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 51620 52282 gene locus_tag LOCUS_03730 51620 52282 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478872.1 protein_id gnl|my_center|LOCUS_03730 52366 53943 gene locus_tag LOCUS_03740 52366 53943 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_03740 54435 55181 gene locus_tag LOCUS_03750 54435 55181 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328901.1 protein_id gnl|my_center|LOCUS_03750 57953 55539 gene locus_tag LOCUS_03760 57953 55539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 >Feature sequence008 1338 724 gene locus_tag LOCUS_03770 1338 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 1632 1402 gene locus_tag LOCUS_03780 1632 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 1879 1954 gene locus_tag LOCUS_t00080 1879 1954 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2105 3109 gene locus_tag LOCUS_03790 2105 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 3549 3106 gene locus_tag LOCUS_03800 3549 3106 CDS product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582775.1 protein_id gnl|my_center|LOCUS_03800 5245 3824 gene locus_tag LOCUS_03810 5245 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 5485 6009 gene locus_tag LOCUS_03820 gene ybaK 5485 6009 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710860.1 protein_id gnl|my_center|LOCUS_03820 6109 6825 gene locus_tag LOCUS_03830 6109 6825 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207090.1 protein_id gnl|my_center|LOCUS_03830 6822 7313 gene locus_tag LOCUS_03840 6822 7313 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903575.1 protein_id gnl|my_center|LOCUS_03840 7313 8017 gene locus_tag LOCUS_03850 7313 8017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 9297 8161 gene locus_tag LOCUS_03860 9297 8161 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103456.1 protein_id gnl|my_center|LOCUS_03860 10030 9413 gene locus_tag LOCUS_03870 10030 9413 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_03870 10061 11077 gene locus_tag LOCUS_03880 10061 11077 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694271.1 protein_id gnl|my_center|LOCUS_03880 11058 11672 gene locus_tag LOCUS_03890 11058 11672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 13508 11697 gene locus_tag LOCUS_03900 13508 11697 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080566.1 protein_id gnl|my_center|LOCUS_03900 14950 13769 gene locus_tag LOCUS_03910 14950 13769 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119310.1 protein_id gnl|my_center|LOCUS_03910 15887 14970 gene locus_tag LOCUS_03920 15887 14970 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921630.1 protein_id gnl|my_center|LOCUS_03920 17847 16291 gene locus_tag LOCUS_03930 17847 16291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 18726 17860 gene locus_tag LOCUS_03940 18726 17860 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879952.1 protein_id gnl|my_center|LOCUS_03940 21479 18726 gene locus_tag LOCUS_03950 21479 18726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 21596 22849 gene locus_tag LOCUS_03960 gene pepT 21596 22849 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460034.1 protein_id gnl|my_center|LOCUS_03960 23103 24527 gene locus_tag LOCUS_03970 gene purB 23103 24527 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230775.1 protein_id gnl|my_center|LOCUS_03970 24757 25212 gene locus_tag LOCUS_03980 24757 25212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 25240 26352 gene locus_tag LOCUS_03990 25240 26352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 29388 26551 gene locus_tag LOCUS_04000 gene polA 29388 26551 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_04000 29627 30169 gene locus_tag LOCUS_04010 gene hpt 29627 30169 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938879.1 protein_id gnl|my_center|LOCUS_04010 30264 30695 gene locus_tag LOCUS_04020 30264 30695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 31025 31624 gene locus_tag LOCUS_04030 31025 31624 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_04030 31879 32985 gene locus_tag LOCUS_04040 31879 32985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 33253 34758 gene locus_tag LOCUS_04050 33253 34758 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963595.1 protein_id gnl|my_center|LOCUS_04050 34775 35863 gene locus_tag LOCUS_04060 34775 35863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 35868 36833 gene locus_tag LOCUS_04070 gene yclN 35868 36833 CDS product petrobactin ABC transporter permease YclN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234491.1 protein_id gnl|my_center|LOCUS_04070 36826 37836 gene locus_tag LOCUS_04080 gene yclO 36826 37836 CDS product petrobactin ABC transporter permease YclO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246705.1 protein_id gnl|my_center|LOCUS_04080 37833 38591 gene locus_tag LOCUS_04090 37833 38591 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948720.1 protein_id gnl|my_center|LOCUS_04090 38634 39557 gene locus_tag LOCUS_04100 gene yclQ 38634 39557 CDS product petrobactin ABC transporter substrate-binding protein YclQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246619.1 protein_id gnl|my_center|LOCUS_04100 39600 40397 gene locus_tag LOCUS_04110 39600 40397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 40669 42201 gene locus_tag LOCUS_04120 40669 42201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 42641 43555 gene locus_tag LOCUS_04130 42641 43555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 45601 43607 gene locus_tag LOCUS_04140 45601 43607 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107274.1 protein_id gnl|my_center|LOCUS_04140 46120 45677 gene locus_tag LOCUS_04150 46120 45677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 46425 46192 gene locus_tag LOCUS_04160 46425 46192 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764038.1 protein_id gnl|my_center|LOCUS_04160 46602 48452 gene locus_tag LOCUS_04170 gene lnt 46602 48452 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210341.1 protein_id gnl|my_center|LOCUS_04170 49168 48419 gene locus_tag LOCUS_04180 49168 48419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 >Feature sequence009 1482 817 gene locus_tag LOCUS_04190 1482 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 4647 1672 gene locus_tag LOCUS_04200 gene acnA 4647 1672 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187807.1 protein_id gnl|my_center|LOCUS_04200 4788 5264 gene locus_tag LOCUS_04210 4788 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 6718 5591 gene locus_tag LOCUS_04220 gene msrB 6718 5591 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203359.1 protein_id gnl|my_center|LOCUS_04220 7374 6859 gene locus_tag LOCUS_04230 7374 6859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 7514 9757 gene locus_tag LOCUS_04240 7514 9757 CDS product M60 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764444.1 protein_id gnl|my_center|LOCUS_04240 10945 9830 gene locus_tag LOCUS_04250 10945 9830 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930902.1 protein_id gnl|my_center|LOCUS_04250 11076 11993 gene locus_tag LOCUS_04260 11076 11993 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109794.1 protein_id gnl|my_center|LOCUS_04260 13237 12005 gene locus_tag LOCUS_04270 13237 12005 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763377.1 protein_id gnl|my_center|LOCUS_04270 14084 13341 gene locus_tag LOCUS_04280 14084 13341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 14231 14788 gene locus_tag LOCUS_04290 14231 14788 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249996.1 protein_id gnl|my_center|LOCUS_04290 15286 14948 gene locus_tag LOCUS_04300 15286 14948 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047981.1 protein_id gnl|my_center|LOCUS_04300 17900 15591 gene locus_tag LOCUS_04310 gene rnr 17900 15591 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391086.1 protein_id gnl|my_center|LOCUS_04310 18148 18426 gene locus_tag LOCUS_04320 18148 18426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 20975 18456 gene locus_tag LOCUS_04330 20975 18456 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140940.1 protein_id gnl|my_center|LOCUS_04330 22205 20991 gene locus_tag LOCUS_04340 22205 20991 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921370.1 protein_id gnl|my_center|LOCUS_04340 23432 22416 gene locus_tag LOCUS_04350 23432 22416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 23636 25018 gene locus_tag LOCUS_04360 23636 25018 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_04360 27779 25092 gene locus_tag LOCUS_04370 27779 25092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 29274 27817 gene locus_tag LOCUS_04380 29274 27817 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_04380 29667 29317 gene locus_tag LOCUS_04390 29667 29317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 29934 30383 gene locus_tag LOCUS_04400 29934 30383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04400 30414 30842 gene locus_tag LOCUS_04410 30414 30842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04410 31068 31295 gene locus_tag LOCUS_04420 31068 31295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 31362 31943 gene locus_tag LOCUS_04430 gene rplE 31362 31943 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357534.1 protein_id gnl|my_center|LOCUS_04430 31956 32357 gene locus_tag LOCUS_04440 gene rpsH 31956 32357 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549038.1 protein_id gnl|my_center|LOCUS_04440 32379 32918 gene locus_tag LOCUS_04450 gene rplF 32379 32918 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379228.1 protein_id gnl|my_center|LOCUS_04450 32954 33316 gene locus_tag LOCUS_04460 gene rplR 32954 33316 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_04460 33333 33995 gene locus_tag LOCUS_04470 33333 33995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 34058 34516 gene locus_tag LOCUS_04480 gene rplO 34058 34516 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810128.1 protein_id gnl|my_center|LOCUS_04480 34523 34660 gene locus_tag LOCUS_04490 34523 34660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 34657 36159 gene locus_tag LOCUS_04500 gene secY 34657 36159 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_04500 36187 36837 gene locus_tag LOCUS_04510 36187 36837 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_04510 36851 37648 gene locus_tag LOCUS_04520 gene map 36851 37648 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_04520 37667 38734 gene locus_tag LOCUS_04530 37667 38734 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765274.1 protein_id gnl|my_center|LOCUS_04530 38900 40456 gene locus_tag LOCUS_04540 38900 40456 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329914.1 protein_id gnl|my_center|LOCUS_04540 40492 42579 gene locus_tag LOCUS_04550 gene ppk1 40492 42579 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932727.1 protein_id gnl|my_center|LOCUS_04550 43807 42692 gene locus_tag LOCUS_04560 43807 42692 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578518.1 protein_id gnl|my_center|LOCUS_04560 44691 44017 gene locus_tag LOCUS_04570 44691 44017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 45388 44645 gene locus_tag LOCUS_04580 45388 44645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 44802 44811 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46533 45403 gene locus_tag LOCUS_04590 46533 45403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 46895 46557 gene locus_tag LOCUS_04600 46895 46557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04600 47429 47094 gene locus_tag LOCUS_04610 47429 47094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 <48536 47473 gene locus_tag LOCUS_04620 <48536 47473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011922118.1:glycosyltransferase family 2 protein >Feature sequence010 439 179 gene locus_tag LOCUS_04630 439 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 668 1135 gene locus_tag LOCUS_04640 668 1135 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189082.1 protein_id gnl|my_center|LOCUS_04640 2567 1158 gene locus_tag LOCUS_04650 gene mdtD 2567 1158 CDS product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154742258.1 protein_id gnl|my_center|LOCUS_04650 3778 2630 gene locus_tag LOCUS_04660 3778 2630 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764054.1 protein_id gnl|my_center|LOCUS_04660 4932 3910 gene locus_tag LOCUS_04670 4932 3910 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_04670 5750 4950 gene locus_tag LOCUS_04680 gene gpmA 5750 4950 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789269.1 protein_id gnl|my_center|LOCUS_04680 5919 7850 gene locus_tag LOCUS_04690 5919 7850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 8752 8222 gene locus_tag LOCUS_04700 8752 8222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 9166 11394 gene locus_tag LOCUS_04710 9166 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 11515 12051 gene locus_tag LOCUS_04720 11515 12051 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869609.1 protein_id gnl|my_center|LOCUS_04720 12071 12556 gene locus_tag LOCUS_04730 12071 12556 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020591.1 protein_id gnl|my_center|LOCUS_04730 12715 12800 gene locus_tag LOCUS_t00090 12715 12800 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 13040 14905 gene locus_tag LOCUS_04740 13040 14905 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795334.1 protein_id gnl|my_center|LOCUS_04740 15030 15263 gene locus_tag LOCUS_04750 15030 15263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 16670 15639 gene locus_tag LOCUS_04760 16670 15639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 18902 16830 gene locus_tag LOCUS_04770 18902 16830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 19982 18984 gene locus_tag LOCUS_04780 19982 18984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 21305 20103 gene locus_tag LOCUS_04790 21305 20103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 22636 21743 gene locus_tag LOCUS_04800 22636 21743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 23818 22664 gene locus_tag LOCUS_04810 23818 22664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 24028 25107 gene locus_tag LOCUS_04820 gene rfaD 24028 25107 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391026.1 protein_id gnl|my_center|LOCUS_04820 25129 26103 gene locus_tag LOCUS_04830 25129 26103 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391122.1 protein_id gnl|my_center|LOCUS_04830 26100 27125 gene locus_tag LOCUS_04840 26100 27125 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383750.1 protein_id gnl|my_center|LOCUS_04840 27136 28122 gene locus_tag LOCUS_04850 27136 28122 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296671.1 protein_id gnl|my_center|LOCUS_04850 29087 28236 gene locus_tag LOCUS_04860 29087 28236 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084355.1 protein_id gnl|my_center|LOCUS_04860 29228 29446 gene locus_tag LOCUS_04870 29228 29446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 29534 30547 gene locus_tag LOCUS_04880 29534 30547 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_04880 30544 31278 gene locus_tag LOCUS_04890 30544 31278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 31282 32217 gene locus_tag LOCUS_04900 31282 32217 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918589.1 protein_id gnl|my_center|LOCUS_04900 32330 32629 gene locus_tag LOCUS_04910 32330 32629 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080623.1 protein_id gnl|my_center|LOCUS_04910 32671 33126 gene locus_tag LOCUS_04920 32671 33126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 33287 33928 gene locus_tag LOCUS_04930 33287 33928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 34087 35154 gene locus_tag LOCUS_04940 gene aroG 34087 35154 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704774.1 protein_id gnl|my_center|LOCUS_04940 35755 35276 gene locus_tag LOCUS_04950 35755 35276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 36995 36009 gene locus_tag LOCUS_04960 36995 36009 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969168.1 protein_id gnl|my_center|LOCUS_04960 37775 37020 gene locus_tag LOCUS_04970 37775 37020 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947780.1 protein_id gnl|my_center|LOCUS_04970 38446 37808 gene locus_tag LOCUS_04980 38446 37808 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478804.1 protein_id gnl|my_center|LOCUS_04980 39045 38443 gene locus_tag LOCUS_04990 39045 38443 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993359.1 protein_id gnl|my_center|LOCUS_04990 40654 39131 gene locus_tag LOCUS_05000 gene guaA 40654 39131 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_05000 42118 40667 gene locus_tag LOCUS_05010 gene guaB 42118 40667 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881325.1 protein_id gnl|my_center|LOCUS_05010 42307 42801 gene locus_tag LOCUS_05020 42307 42801 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057647.1 protein_id gnl|my_center|LOCUS_05020 >Feature sequence011 487 335 gene locus_tag LOCUS_05030 487 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 1256 465 gene locus_tag LOCUS_05040 gene cdaA 1256 465 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_05040 1463 2059 gene locus_tag LOCUS_05050 1463 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 3131 2478 gene locus_tag LOCUS_05060 gene lolD 3131 2478 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172452211.1 protein_id gnl|my_center|LOCUS_05060 4006 3161 gene locus_tag LOCUS_05070 gene panC 4006 3161 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_05070 4156 4752 gene locus_tag LOCUS_05080 4156 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 4792 5829 gene locus_tag LOCUS_05090 gene lpxD 4792 5829 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882950.1 protein_id gnl|my_center|LOCUS_05090 6681 5890 gene locus_tag LOCUS_05100 6681 5890 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963435.1 protein_id gnl|my_center|LOCUS_05100 7466 6678 gene locus_tag LOCUS_05110 7466 6678 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963434.1 protein_id gnl|my_center|LOCUS_05110 8509 7463 gene locus_tag LOCUS_05120 8509 7463 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_05120 8738 9397 gene locus_tag LOCUS_05130 8738 9397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 12477 9484 gene locus_tag LOCUS_05140 12477 9484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 13173 12667 gene locus_tag LOCUS_05150 gene gmhB 13173 12667 CDS product D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194255.1 protein_id gnl|my_center|LOCUS_05150 13732 13163 gene locus_tag LOCUS_05160 gene gmhA 13732 13163 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390355.1 protein_id gnl|my_center|LOCUS_05160 15219 13729 gene locus_tag LOCUS_05170 gene rfaE1 15219 13729 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387884.1 protein_id gnl|my_center|LOCUS_05170 15448 15699 gene locus_tag LOCUS_05180 15448 15699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 15784 17064 gene locus_tag LOCUS_05190 gene hemL 15784 17064 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140075.1 protein_id gnl|my_center|LOCUS_05190 17117 18175 gene locus_tag LOCUS_05200 17117 18175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 20301 18394 gene locus_tag LOCUS_05210 20301 18394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 22204 20687 gene locus_tag LOCUS_05220 22204 20687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 22765 24402 gene locus_tag LOCUS_05230 22765 24402 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 protein_id gnl|my_center|LOCUS_05230 24422 25624 gene locus_tag LOCUS_05240 24422 25624 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_05240 25644 26132 gene locus_tag LOCUS_05250 gene ribH 25644 26132 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087790.1 protein_id gnl|my_center|LOCUS_05250 26161 27045 gene locus_tag LOCUS_05260 26161 27045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 27060 27908 gene locus_tag LOCUS_05270 gene ftsY 27060 27908 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081293.1 protein_id gnl|my_center|LOCUS_05270 27927 29006 gene locus_tag LOCUS_05280 gene rlmN 27927 29006 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940164.1 protein_id gnl|my_center|LOCUS_05280 29107 30561 gene locus_tag LOCUS_05290 29107 30561 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048440.1 protein_id gnl|my_center|LOCUS_05290 31019 31780 gene locus_tag LOCUS_05300 31019 31780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 31814 32551 gene locus_tag LOCUS_05310 31814 32551 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425720.1 protein_id gnl|my_center|LOCUS_05310 33785 32541 gene locus_tag LOCUS_05320 33785 32541 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_05320 33898 35319 gene locus_tag LOCUS_05330 gene pyk 33898 35319 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834388.1 protein_id gnl|my_center|LOCUS_05330 35319 35834 gene locus_tag LOCUS_05340 35319 35834 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101942.1 protein_id gnl|my_center|LOCUS_05340 36613 35822 gene locus_tag LOCUS_05350 36613 35822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 37695 36772 gene locus_tag LOCUS_05360 37695 36772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 38725 37841 gene locus_tag LOCUS_05370 38725 37841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 39618 38851 gene locus_tag LOCUS_05380 39618 38851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 40360 39749 gene locus_tag LOCUS_05390 gene rpsD 40360 39749 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258257.1 protein_id gnl|my_center|LOCUS_05390 40947 40396 gene locus_tag LOCUS_05400 40947 40396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 41358 40981 gene locus_tag LOCUS_05410 gene rpsM 41358 40981 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808138.1 protein_id gnl|my_center|LOCUS_05410 42538 41477 gene locus_tag LOCUS_05420 gene queG 42538 41477 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397385.1 protein_id gnl|my_center|LOCUS_05420 42641 43564 gene locus_tag LOCUS_05430 42641 43564 CDS product ELM1/GtrOC1 family putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207641.1 protein_id gnl|my_center|LOCUS_05430 >Feature sequence012 4225 29 gene locus_tag LOCUS_05440 gene rpoC 4225 29 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871661.1 protein_id gnl|my_center|LOCUS_05440 8236 4298 gene locus_tag LOCUS_05450 gene rpoB 8236 4298 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012263639.1 protein_id gnl|my_center|LOCUS_05450 6764 6836 gene locus_tag LOCUS_t00100 6764 6836 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8812 8438 gene locus_tag LOCUS_05460 gene rplL 8812 8438 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975165.1 protein_id gnl|my_center|LOCUS_05460 9474 8971 gene locus_tag LOCUS_05470 gene rplJ 9474 8971 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806888.1 protein_id gnl|my_center|LOCUS_05470 10197 9496 gene locus_tag LOCUS_05480 gene rplA 10197 9496 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811658.1 protein_id gnl|my_center|LOCUS_05480 10677 10249 gene locus_tag LOCUS_05490 gene rplK 10677 10249 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085792.1 protein_id gnl|my_center|LOCUS_05490 11314 10745 gene locus_tag LOCUS_05500 gene nusG 11314 10745 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 protein_id gnl|my_center|LOCUS_05500 11571 11344 gene locus_tag LOCUS_05510 11571 11344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 11680 11605 gene locus_tag LOCUS_t00110 11680 11605 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 12959 11775 gene locus_tag LOCUS_05520 gene tuf 12959 11775 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215366.1 protein_id gnl|my_center|LOCUS_05520 13078 13004 gene locus_tag LOCUS_t00120 13078 13004 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14367 13285 gene locus_tag LOCUS_05530 gene tsaD 14367 13285 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942510.1 protein_id gnl|my_center|LOCUS_05530 15761 14391 gene locus_tag LOCUS_05540 gene clpX 15761 14391 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640796.1 protein_id gnl|my_center|LOCUS_05540 16457 15801 gene locus_tag LOCUS_05550 gene clpP 16457 15801 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327157.1 protein_id gnl|my_center|LOCUS_05550 18001 16580 gene locus_tag LOCUS_05560 gene tig 18001 16580 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851938.1 protein_id gnl|my_center|LOCUS_05560 18210 20576 gene locus_tag LOCUS_05570 gene bamA 18210 20576 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_05570 20610 21359 gene locus_tag LOCUS_05580 20610 21359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 21396 22331 gene locus_tag LOCUS_05590 gene metF 21396 22331 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933036.1 protein_id gnl|my_center|LOCUS_05590 22384 23121 gene locus_tag LOCUS_05600 22384 23121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 23378 23650 gene locus_tag LOCUS_05610 23378 23650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 24369 23743 gene locus_tag LOCUS_05620 24369 23743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 27660 24502 gene locus_tag LOCUS_05630 27660 24502 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803351.1 protein_id gnl|my_center|LOCUS_05630 29175 27751 gene locus_tag LOCUS_05640 29175 27751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 30482 29202 gene locus_tag LOCUS_05650 30482 29202 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146571912.1 protein_id gnl|my_center|LOCUS_05650 31057 30629 gene locus_tag LOCUS_05660 31057 30629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 32165 31140 gene locus_tag LOCUS_05670 32165 31140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 33659 32178 gene locus_tag LOCUS_05680 33659 32178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 34436 33792 gene locus_tag LOCUS_05690 34436 33792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 34766 35350 gene locus_tag LOCUS_05700 34766 35350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 36374 35457 gene locus_tag LOCUS_05710 36374 35457 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937909.1 protein_id gnl|my_center|LOCUS_05710 36412 37596 gene locus_tag LOCUS_05720 gene metK 36412 37596 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817040.1 protein_id gnl|my_center|LOCUS_05720 37620 39035 gene locus_tag LOCUS_05730 gene ahcY 37620 39035 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035988.1 protein_id gnl|my_center|LOCUS_05730 40189 39176 gene locus_tag LOCUS_05740 40189 39176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 40756 41622 gene locus_tag LOCUS_05750 40756 41622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 41636 42916 gene locus_tag LOCUS_05760 41636 42916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 >Feature sequence013 349 2013 gene locus_tag LOCUS_05770 349 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 2050 2829 gene locus_tag LOCUS_05780 2050 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 2891 4387 gene locus_tag LOCUS_05790 2891 4387 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767431.1 protein_id gnl|my_center|LOCUS_05790 4499 5200 gene locus_tag LOCUS_05800 4499 5200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 5316 5507 gene locus_tag LOCUS_05810 5316 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 6337 5474 gene locus_tag LOCUS_05820 gene rfbA 6337 5474 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877393.1 protein_id gnl|my_center|LOCUS_05820 7399 6347 gene locus_tag LOCUS_05830 gene rfbB 7399 6347 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870348.1 protein_id gnl|my_center|LOCUS_05830 8448 7531 gene locus_tag LOCUS_05840 gene pfkA 8448 7531 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761048.1 protein_id gnl|my_center|LOCUS_05840 8604 9335 gene locus_tag LOCUS_05850 8604 9335 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_05850 9673 11139 gene locus_tag LOCUS_05860 gene gatB 9673 11139 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_05860 12924 11194 gene locus_tag LOCUS_05870 gene poxB 12924 11194 CDS product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090021.1 protein_id gnl|my_center|LOCUS_05870 13691 13089 gene locus_tag LOCUS_05880 13691 13089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 14289 16826 gene locus_tag LOCUS_05890 14289 16826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 17590 16937 gene locus_tag LOCUS_05900 17590 16937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 17756 20512 gene locus_tag LOCUS_05910 17756 20512 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203665.1 protein_id gnl|my_center|LOCUS_05910 20539 21768 gene locus_tag LOCUS_05920 gene vmeY 20539 21768 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477351.1 protein_id gnl|my_center|LOCUS_05920 21781 24951 gene locus_tag LOCUS_05930 21781 24951 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_05930 26380 24998 gene locus_tag LOCUS_05940 26380 24998 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038439489.1 protein_id gnl|my_center|LOCUS_05940 26939 26667 gene locus_tag LOCUS_05950 26939 26667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 27913 27125 gene locus_tag LOCUS_05960 gene thiD 27913 27125 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368307.1 protein_id gnl|my_center|LOCUS_05960 28026 28493 gene locus_tag LOCUS_05970 28026 28493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 29533 28490 gene locus_tag LOCUS_05980 29533 28490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 29682 30419 gene locus_tag LOCUS_05990 29682 30419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 31565 30435 gene locus_tag LOCUS_06000 31565 30435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 33977 32019 gene locus_tag LOCUS_06010 33977 32019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 34642 34567 gene locus_tag LOCUS_t00130 34642 34567 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 34754 34679 gene locus_tag LOCUS_t00140 34754 34679 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 34872 34798 gene locus_tag LOCUS_t00150 34872 34798 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 35067 35564 gene locus_tag LOCUS_06020 35067 35564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 36528 35743 gene locus_tag LOCUS_06030 36528 35743 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941357.1 protein_id gnl|my_center|LOCUS_06030 37798 36587 gene locus_tag LOCUS_06040 37798 36587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 38020 38700 gene locus_tag LOCUS_06050 38020 38700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 39849 38812 gene locus_tag LOCUS_06060 gene tdh 39849 38812 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532321.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence014 2391 991 gene locus_tag LOCUS_06070 2391 991 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358927.1 protein_id gnl|my_center|LOCUS_06070 3608 3045 gene locus_tag LOCUS_06080 3608 3045 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460612.1 protein_id gnl|my_center|LOCUS_06080 7137 3613 gene locus_tag LOCUS_06090 7137 3613 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 protein_id gnl|my_center|LOCUS_06090 8171 7170 gene locus_tag LOCUS_06100 8171 7170 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103236.1 protein_id gnl|my_center|LOCUS_06100 8403 8948 gene locus_tag LOCUS_06110 gene thiE 8403 8948 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172766.1 protein_id gnl|my_center|LOCUS_06110 9648 8974 gene locus_tag LOCUS_06120 9648 8974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 10365 9676 gene locus_tag LOCUS_06130 10365 9676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 12739 10436 gene locus_tag LOCUS_06140 12739 10436 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183692.1 protein_id gnl|my_center|LOCUS_06140 14135 12810 gene locus_tag LOCUS_06150 14135 12810 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883976.1 protein_id gnl|my_center|LOCUS_06150 15466 14132 gene locus_tag LOCUS_06160 15466 14132 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883977.1 protein_id gnl|my_center|LOCUS_06160 17895 15751 gene locus_tag LOCUS_06170 gene pnp 17895 15751 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257913.1 protein_id gnl|my_center|LOCUS_06170 19033 18779 gene locus_tag LOCUS_06180 gene rpsO 19033 18779 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385566.1 protein_id gnl|my_center|LOCUS_06180 19776 19135 gene locus_tag LOCUS_06190 19776 19135 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141816.1 protein_id gnl|my_center|LOCUS_06190 20494 19754 gene locus_tag LOCUS_06200 20494 19754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 22365 20734 gene locus_tag LOCUS_06210 22365 20734 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705882.1 protein_id gnl|my_center|LOCUS_06210 27535 22352 gene locus_tag LOCUS_06220 27535 22352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 28806 27535 gene locus_tag LOCUS_06230 28806 27535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 28948 29745 gene locus_tag LOCUS_06240 gene truA 28948 29745 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_06240 30341 29760 gene locus_tag LOCUS_06250 30341 29760 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398676.1 protein_id gnl|my_center|LOCUS_06250 31029 30352 gene locus_tag LOCUS_06260 31029 30352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 31218 33296 gene locus_tag LOCUS_06270 31218 33296 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036446.1 protein_id gnl|my_center|LOCUS_06270 34644 33886 gene locus_tag LOCUS_06280 34644 33886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 35649 34837 gene locus_tag LOCUS_06290 gene rph 35649 34837 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260978.1 protein_id gnl|my_center|LOCUS_06290 35667 37082 gene locus_tag LOCUS_06300 35667 37082 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715488.1 protein_id gnl|my_center|LOCUS_06300 38957 37095 gene locus_tag LOCUS_06310 38957 37095 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202540.1 protein_id gnl|my_center|LOCUS_06310 39727 39458 gene locus_tag LOCUS_06320 39727 39458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 >Feature sequence015 210 136 gene locus_tag LOCUS_t00160 210 136 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 377 1486 gene locus_tag LOCUS_06330 gene leuB 377 1486 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943508.1 protein_id gnl|my_center|LOCUS_06330 1619 2659 gene locus_tag LOCUS_06340 1619 2659 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838662.1 protein_id gnl|my_center|LOCUS_06340 2705 3619 gene locus_tag LOCUS_06350 2705 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 3693 5228 gene locus_tag LOCUS_06360 3693 5228 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404336.1 protein_id gnl|my_center|LOCUS_06360 5733 5341 gene locus_tag LOCUS_06370 5733 5341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 7646 6345 gene locus_tag LOCUS_06380 7646 6345 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_06380 6374 6383 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9152 7905 gene locus_tag LOCUS_06390 gene nirJ1 9152 7905 CDS product putative heme d1 biosynthesis radical SAM protein NirJ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460179.1 protein_id gnl|my_center|LOCUS_06390 10206 9145 gene locus_tag LOCUS_06400 10206 9145 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902856.1 protein_id gnl|my_center|LOCUS_06400 11096 10278 gene locus_tag LOCUS_06410 11096 10278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 11671 11237 gene locus_tag LOCUS_06420 11671 11237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 12739 11729 gene locus_tag LOCUS_06430 12739 11729 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460199.1 protein_id gnl|my_center|LOCUS_06430 13385 12741 gene locus_tag LOCUS_06440 gene plsY 13385 12741 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880403.1 protein_id gnl|my_center|LOCUS_06440 14423 13638 gene locus_tag LOCUS_06450 14423 13638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 15922 14441 gene locus_tag LOCUS_06460 gene lysS 15922 14441 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369668.1 protein_id gnl|my_center|LOCUS_06460 16267 19845 gene locus_tag LOCUS_06470 gene nifJ 16267 19845 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933292.1 protein_id gnl|my_center|LOCUS_06470 20748 20311 gene locus_tag LOCUS_06480 20748 20311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 20873 21193 gene locus_tag LOCUS_06490 20873 21193 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901934.1 protein_id gnl|my_center|LOCUS_06490 23407 21275 gene locus_tag LOCUS_06500 23407 21275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 24228 23461 gene locus_tag LOCUS_06510 gene hisF 24228 23461 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817210.1 protein_id gnl|my_center|LOCUS_06510 24539 24372 gene locus_tag LOCUS_06520 24539 24372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 24542 26290 gene locus_tag LOCUS_06530 24542 26290 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785879.1 protein_id gnl|my_center|LOCUS_06530 26301 27005 gene locus_tag LOCUS_06540 26301 27005 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985723.1 protein_id gnl|my_center|LOCUS_06540 30793 27098 gene locus_tag LOCUS_06550 gene hrpA 30793 27098 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139543.1 protein_id gnl|my_center|LOCUS_06550 31344 30862 gene locus_tag LOCUS_06560 gene ilvN 31344 30862 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_06560 32917 31466 gene locus_tag LOCUS_06570 32917 31466 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_06570 33123 34286 gene locus_tag LOCUS_06580 gene holA 33123 34286 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279906.1 protein_id gnl|my_center|LOCUS_06580 34286 36172 gene locus_tag LOCUS_06590 gene mnmG 34286 36172 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929569.1 protein_id gnl|my_center|LOCUS_06590 37682 36657 gene locus_tag LOCUS_06600 gene ribD 37682 36657 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942331.1 protein_id gnl|my_center|LOCUS_06600 38136 38945 gene locus_tag LOCUS_06610 38136 38945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 >Feature sequence016 709 2427 gene locus_tag LOCUS_06620 709 2427 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940631.1 protein_id gnl|my_center|LOCUS_06620 4713 2479 gene locus_tag LOCUS_06630 4713 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 5264 7360 gene locus_tag LOCUS_06640 5264 7360 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111559.1 protein_id gnl|my_center|LOCUS_06640 7412 7606 gene locus_tag LOCUS_06650 7412 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 7633 8385 gene locus_tag LOCUS_06660 7633 8385 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_06660 8464 10203 gene locus_tag LOCUS_06670 8464 10203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 10271 11713 gene locus_tag LOCUS_06680 10271 11713 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261686.1 protein_id gnl|my_center|LOCUS_06680 11700 12179 gene locus_tag LOCUS_06690 11700 12179 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454901.1 protein_id gnl|my_center|LOCUS_06690 12295 13908 gene locus_tag LOCUS_06700 12295 13908 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327627.1 protein_id gnl|my_center|LOCUS_06700 16380 14230 gene locus_tag LOCUS_06710 16380 14230 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202053.1 protein_id gnl|my_center|LOCUS_06710 16782 16510 gene locus_tag LOCUS_06720 16782 16510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 16936 18405 gene locus_tag LOCUS_06730 16936 18405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 19112 18585 gene locus_tag LOCUS_06740 19112 18585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 19303 19626 gene locus_tag LOCUS_06750 19303 19626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 19642 20865 gene locus_tag LOCUS_06760 gene rlmD 19642 20865 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_06760 20874 22250 gene locus_tag LOCUS_06770 gene miaB 20874 22250 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_06770 24147 22213 gene locus_tag LOCUS_06780 24147 22213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 25401 24337 gene locus_tag LOCUS_06790 25401 24337 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009058447.1 protein_id gnl|my_center|LOCUS_06790 27584 25470 gene locus_tag LOCUS_06800 27584 25470 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036446.1 protein_id gnl|my_center|LOCUS_06800 27723 28556 gene locus_tag LOCUS_06810 27723 28556 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_06810 28711 30000 gene locus_tag LOCUS_06820 gene eno 28711 30000 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785741.1 protein_id gnl|my_center|LOCUS_06820 30364 31665 gene locus_tag LOCUS_06830 30364 31665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 32355 31666 gene locus_tag LOCUS_06840 32355 31666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 32538 33914 gene locus_tag LOCUS_06850 gene argH 32538 33914 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546455.1 protein_id gnl|my_center|LOCUS_06850 34051 35730 gene locus_tag LOCUS_06860 gene sulP 34051 35730 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797091.1 protein_id gnl|my_center|LOCUS_06860 36653 36126 gene locus_tag LOCUS_06870 36653 36126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 37157 36666 gene locus_tag LOCUS_06880 gene nrdR 37157 36666 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_06880 38917 37436 gene locus_tag LOCUS_06890 38917 37436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 >Feature sequence017 1382 204 gene locus_tag LOCUS_06900 1382 204 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123043.1 protein_id gnl|my_center|LOCUS_06900 2174 1389 gene locus_tag LOCUS_06910 2174 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 3260 2289 gene locus_tag LOCUS_06920 gene kdsD 3260 2289 CDS product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134758.1 protein_id gnl|my_center|LOCUS_06920 4076 3297 gene locus_tag LOCUS_06930 4076 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 4585 4091 gene locus_tag LOCUS_06940 4585 4091 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083121.1 protein_id gnl|my_center|LOCUS_06940 5620 4688 gene locus_tag LOCUS_06950 5620 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 5645 6529 gene locus_tag LOCUS_06960 5645 6529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 5652 5661 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6570 6782 gene locus_tag LOCUS_06970 6570 6782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 7139 6933 gene locus_tag LOCUS_06980 7139 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 7806 7411 gene locus_tag LOCUS_06990 7806 7411 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356348.1 protein_id gnl|my_center|LOCUS_06990 7955 8422 gene locus_tag LOCUS_07000 7955 8422 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975016.1 protein_id gnl|my_center|LOCUS_07000 8908 8609 gene locus_tag LOCUS_07010 8908 8609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 11035 9008 gene locus_tag LOCUS_07020 11035 9008 CDS product Sip1-related alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785073.1 protein_id gnl|my_center|LOCUS_07020 12395 11283 gene locus_tag LOCUS_07030 12395 11283 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_07030 12625 13155 gene locus_tag LOCUS_07040 12625 13155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 13215 15683 gene locus_tag LOCUS_07050 13215 15683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 15976 18177 gene locus_tag LOCUS_07060 15976 18177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 18497 19381 gene locus_tag LOCUS_07070 gene atpB 18497 19381 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258899.1 protein_id gnl|my_center|LOCUS_07070 19464 19685 gene locus_tag LOCUS_07080 19464 19685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 19787 20314 gene locus_tag LOCUS_07090 19787 20314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 20322 20729 gene locus_tag LOCUS_07100 20322 20729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 20746 22278 gene locus_tag LOCUS_07110 gene atpA 20746 22278 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599658.1 protein_id gnl|my_center|LOCUS_07110 22300 23172 gene locus_tag LOCUS_07120 gene atpG 22300 23172 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403678.1 protein_id gnl|my_center|LOCUS_07120 23247 24668 gene locus_tag LOCUS_07130 gene atpD 23247 24668 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190491.1 protein_id gnl|my_center|LOCUS_07130 24692 25114 gene locus_tag LOCUS_07140 24692 25114 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258892.1 protein_id gnl|my_center|LOCUS_07140 25111 25674 gene locus_tag LOCUS_07150 25111 25674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 26270 25758 gene locus_tag LOCUS_07160 26270 25758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 26448 27569 gene locus_tag LOCUS_07170 26448 27569 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108695.1 protein_id gnl|my_center|LOCUS_07170 27690 28829 gene locus_tag LOCUS_07180 gene rffA 27690 28829 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099273.1 protein_id gnl|my_center|LOCUS_07180 28826 29326 gene locus_tag LOCUS_07190 28826 29326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 29323 30261 gene locus_tag LOCUS_07200 29323 30261 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407612.1 protein_id gnl|my_center|LOCUS_07200 30288 30626 gene locus_tag LOCUS_07210 30288 30626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 30619 30963 gene locus_tag LOCUS_07220 30619 30963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 31092 32888 gene locus_tag LOCUS_07230 31092 32888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 34084 32954 gene locus_tag LOCUS_07240 34084 32954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 35481 34132 gene locus_tag LOCUS_07250 gene bioA 35481 34132 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964671.1 protein_id gnl|my_center|LOCUS_07250 36505 35510 gene locus_tag LOCUS_07260 gene bioB 36505 35510 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_07260 38062 36560 gene locus_tag LOCUS_07270 38062 36560 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402000.1 protein_id gnl|my_center|LOCUS_07270 >Feature sequence018 295 933 gene locus_tag LOCUS_07280 295 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 2020 1061 gene locus_tag LOCUS_07290 2020 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 3480 2251 gene locus_tag LOCUS_07300 3480 2251 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943175.1 protein_id gnl|my_center|LOCUS_07300 3692 4657 gene locus_tag LOCUS_07310 3692 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 7130 4995 gene locus_tag LOCUS_07320 7130 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 7418 9277 gene locus_tag LOCUS_07330 7418 9277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 9283 10197 gene locus_tag LOCUS_07340 gene oppB 9283 10197 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388349.1 protein_id gnl|my_center|LOCUS_07340 10194 11150 gene locus_tag LOCUS_07350 10194 11150 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144110.1 protein_id gnl|my_center|LOCUS_07350 11169 11531 gene locus_tag LOCUS_07360 11169 11531 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302630.1 protein_id gnl|my_center|LOCUS_07360 11845 11624 gene locus_tag LOCUS_07370 11845 11624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 12101 13252 gene locus_tag LOCUS_07380 gene tyrS 12101 13252 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881135.1 protein_id gnl|my_center|LOCUS_07380 13289 14269 gene locus_tag LOCUS_07390 13289 14269 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100363.1 protein_id gnl|my_center|LOCUS_07390 14650 14294 gene locus_tag LOCUS_07400 14650 14294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 14838 16049 gene locus_tag LOCUS_07410 14838 16049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 18301 16103 gene locus_tag LOCUS_07420 18301 16103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922195.1 protein_id gnl|my_center|LOCUS_07420 20280 18298 gene locus_tag LOCUS_07430 20280 18298 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122098.1 protein_id gnl|my_center|LOCUS_07430 21263 20319 gene locus_tag LOCUS_07440 21263 20319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 22167 21283 gene locus_tag LOCUS_07450 gene spo0J 22167 21283 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226832.1 protein_id gnl|my_center|LOCUS_07450 22509 22835 gene locus_tag LOCUS_07460 22509 22835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 22954 23337 gene locus_tag LOCUS_07470 22954 23337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 24037 23477 gene locus_tag LOCUS_07480 24037 23477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 24466 24392 gene locus_tag LOCUS_t00170 24466 24392 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 26663 24570 gene locus_tag LOCUS_07490 26663 24570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 27209 26829 gene locus_tag LOCUS_07500 27209 26829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 27581 29890 gene locus_tag LOCUS_07510 27581 29890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 30786 30037 gene locus_tag LOCUS_07520 30786 30037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 31031 32338 gene locus_tag LOCUS_07530 31031 32338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 33917 32667 gene locus_tag LOCUS_07540 33917 32667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 34559 34071 gene locus_tag LOCUS_07550 34559 34071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 36159 34579 gene locus_tag LOCUS_07560 36159 34579 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107897.1 protein_id gnl|my_center|LOCUS_07560 36620 36219 gene locus_tag LOCUS_07570 36620 36219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07570 <37348 36648 gene locus_tag LOCUS_07580 <37348 36648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002118385.1:AI-2E family transporter note possible pseudo, internal stop codon >Feature sequence019 4565 2877 gene locus_tag LOCUS_07590 4565 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 5380 4595 gene locus_tag LOCUS_07600 5380 4595 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058149.1 protein_id gnl|my_center|LOCUS_07600 6420 5377 gene locus_tag LOCUS_07610 6420 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 7107 6454 gene locus_tag LOCUS_07620 7107 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 9228 8038 gene locus_tag LOCUS_07630 9228 8038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 10399 9218 gene locus_tag LOCUS_07640 10399 9218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 10752 10949 gene locus_tag LOCUS_07650 10752 10949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 10942 11529 gene locus_tag LOCUS_07660 10942 11529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 11543 11881 gene locus_tag LOCUS_07670 11543 11881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 12077 11991 gene locus_tag LOCUS_t00180 12077 11991 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12324 14078 gene locus_tag LOCUS_07680 12324 14078 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785879.1 protein_id gnl|my_center|LOCUS_07680 14258 15553 gene locus_tag LOCUS_07690 gene bexA 14258 15553 CDS product multidrug efflux MATE transporter BexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107339.1 protein_id gnl|my_center|LOCUS_07690 16630 15809 gene locus_tag LOCUS_07700 16630 15809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 16950 16687 gene locus_tag LOCUS_07710 16950 16687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 17603 17142 gene locus_tag LOCUS_07720 17603 17142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 18969 17590 gene locus_tag LOCUS_07730 18969 17590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 19204 20241 gene locus_tag LOCUS_07740 gene galE 19204 20241 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929113.1 protein_id gnl|my_center|LOCUS_07740 20643 22166 gene locus_tag LOCUS_07750 20643 22166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 22316 23818 gene locus_tag LOCUS_07760 22316 23818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 23967 24494 gene locus_tag LOCUS_07770 23967 24494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 24512 25885 gene locus_tag LOCUS_07780 24512 25885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 28523 26133 gene locus_tag LOCUS_07790 28523 26133 CDS product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776819.1 protein_id gnl|my_center|LOCUS_07790 28716 29873 gene locus_tag LOCUS_07800 28716 29873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 31822 29936 gene locus_tag LOCUS_07810 31822 29936 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 protein_id gnl|my_center|LOCUS_07810 33032 31926 gene locus_tag LOCUS_07820 gene thiH 33032 31926 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704418.1 protein_id gnl|my_center|LOCUS_07820 33263 34168 gene locus_tag LOCUS_07830 33263 34168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 >Feature sequence020 184 1818 gene locus_tag LOCUS_07840 gene cimA 184 1818 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939200.1 protein_id gnl|my_center|LOCUS_07840 2161 2373 gene locus_tag LOCUS_07850 2161 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 2627 3703 gene locus_tag LOCUS_07860 gene apbC 2627 3703 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257064.1 protein_id gnl|my_center|LOCUS_07860 3845 5221 gene locus_tag LOCUS_07870 3845 5221 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262007.1 protein_id gnl|my_center|LOCUS_07870 5425 6180 gene locus_tag LOCUS_07880 5425 6180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 7773 6250 gene locus_tag LOCUS_07890 gene oadA 7773 6250 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_07890 9334 7880 gene locus_tag LOCUS_07900 gene cls 9334 7880 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144064.1 protein_id gnl|my_center|LOCUS_07900 9479 10294 gene locus_tag LOCUS_07910 9479 10294 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_07910 10317 10796 gene locus_tag LOCUS_07920 gene dfrA 10317 10796 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637205.1 protein_id gnl|my_center|LOCUS_07920 14007 10900 gene locus_tag LOCUS_07930 14007 10900 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393549.1 protein_id gnl|my_center|LOCUS_07930 15151 14015 gene locus_tag LOCUS_07940 15151 14015 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817170.1 protein_id gnl|my_center|LOCUS_07940 15628 15158 gene locus_tag LOCUS_07950 15628 15158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 15864 15941 gene locus_tag LOCUS_t00190 15864 15941 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 16250 17251 gene locus_tag LOCUS_07960 gene pyrC 16250 17251 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258604.1 protein_id gnl|my_center|LOCUS_07960 17343 17972 gene locus_tag LOCUS_07970 17343 17972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 18070 19236 gene locus_tag LOCUS_07980 18070 19236 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07980 19284 19787 gene locus_tag LOCUS_07990 gene ruvC 19284 19787 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947018.1 protein_id gnl|my_center|LOCUS_07990 20402 19881 gene locus_tag LOCUS_08000 20402 19881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 22114 20639 gene locus_tag LOCUS_08010 22114 20639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 22463 22939 gene locus_tag LOCUS_08020 22463 22939 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852091.1 protein_id gnl|my_center|LOCUS_08020 23933 22914 gene locus_tag LOCUS_08030 gene meaB 23933 22914 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099360647.1 protein_id gnl|my_center|LOCUS_08030 25436 23952 gene locus_tag LOCUS_08040 25436 23952 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303178.1 protein_id gnl|my_center|LOCUS_08040 26982 25501 gene locus_tag LOCUS_08050 26982 25501 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303178.1 protein_id gnl|my_center|LOCUS_08050 27209 27135 gene locus_tag LOCUS_t00200 27209 27135 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 27830 27345 gene locus_tag LOCUS_08060 27830 27345 CDS product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143885.1 protein_id gnl|my_center|LOCUS_08060 28933 28118 gene locus_tag LOCUS_08070 gene thiM 28933 28118 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047875.1 protein_id gnl|my_center|LOCUS_08070 29595 28981 gene locus_tag LOCUS_08080 gene thiE 29595 28981 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263207.1 protein_id gnl|my_center|LOCUS_08080 30543 29614 gene locus_tag LOCUS_08090 gene cysK 30543 29614 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_08090 31866 30580 gene locus_tag LOCUS_08100 31866 30580 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_08100 32445 32002 gene locus_tag LOCUS_08110 32445 32002 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_08110 33648 32542 gene locus_tag LOCUS_08120 gene alr 33648 32542 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence021 718 278 gene locus_tag LOCUS_08130 718 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1162 824 gene locus_tag LOCUS_08140 1162 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 1523 1278 gene locus_tag LOCUS_08150 1523 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 4361 2679 gene locus_tag LOCUS_08160 gene recJ 4361 2679 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_08160 7441 4610 gene locus_tag LOCUS_08170 7441 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 7937 8869 gene locus_tag LOCUS_08180 7937 8869 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883886.1 protein_id gnl|my_center|LOCUS_08180 8866 9300 gene locus_tag LOCUS_08190 8866 9300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 9291 10097 gene locus_tag LOCUS_08200 9291 10097 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257863.1 protein_id gnl|my_center|LOCUS_08200 10094 10957 gene locus_tag LOCUS_08210 10094 10957 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728286.1 protein_id gnl|my_center|LOCUS_08210 11025 11561 gene locus_tag LOCUS_08220 11025 11561 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421255.1 protein_id gnl|my_center|LOCUS_08220 11567 12622 gene locus_tag LOCUS_08230 11567 12622 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_08230 12651 15233 gene locus_tag LOCUS_08240 12651 15233 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010892034.1 protein_id gnl|my_center|LOCUS_08240 15364 17910 gene locus_tag LOCUS_08250 15364 17910 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918428.1 protein_id gnl|my_center|LOCUS_08250 18418 18050 gene locus_tag LOCUS_08260 18418 18050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 19505 18627 gene locus_tag LOCUS_08270 19505 18627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 19673 21229 gene locus_tag LOCUS_08280 19673 21229 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393738.1 protein_id gnl|my_center|LOCUS_08280 21351 22265 gene locus_tag LOCUS_08290 21351 22265 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963694.1 protein_id gnl|my_center|LOCUS_08290 22385 22840 gene locus_tag LOCUS_08300 22385 22840 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939079.1 protein_id gnl|my_center|LOCUS_08300 22837 23532 gene locus_tag LOCUS_08310 gene ispD 22837 23532 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_08310 23529 24383 gene locus_tag LOCUS_08320 23529 24383 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096618.1 protein_id gnl|my_center|LOCUS_08320 24573 25538 gene locus_tag LOCUS_08330 gene trpS 24573 25538 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120916.1 protein_id gnl|my_center|LOCUS_08330 25627 26097 gene locus_tag LOCUS_08340 25627 26097 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963082.1 protein_id gnl|my_center|LOCUS_08340 26131 26934 gene locus_tag LOCUS_08350 26131 26934 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_08350 27259 28053 gene locus_tag LOCUS_08360 gene tcdA 27259 28053 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173260.1 protein_id gnl|my_center|LOCUS_08360 28050 28565 gene locus_tag LOCUS_08370 28050 28565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 28669 28754 gene locus_tag LOCUS_t00210 28669 28754 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 29928 28966 gene locus_tag LOCUS_08380 29928 28966 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_08380 30423 30926 gene locus_tag LOCUS_08390 30423 30926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 31423 31686 gene locus_tag LOCUS_08400 31423 31686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 31916 31683 gene locus_tag LOCUS_08410 31916 31683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 32371 31931 gene locus_tag LOCUS_08420 32371 31931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 33009 32368 gene locus_tag LOCUS_08430 33009 32368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 33154 32999 gene locus_tag LOCUS_08440 33154 32999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 33668 33147 gene locus_tag LOCUS_08450 33668 33147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 >Feature sequence022 236 703 gene locus_tag LOCUS_08460 236 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 791 1429 gene locus_tag LOCUS_08470 gene nth 791 1429 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778932.1 protein_id gnl|my_center|LOCUS_08470 1522 2313 gene locus_tag LOCUS_08480 1522 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 2392 2898 gene locus_tag LOCUS_08490 2392 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 2910 3368 gene locus_tag LOCUS_08500 2910 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 4577 7810 gene locus_tag LOCUS_08510 4577 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 7858 8880 gene locus_tag LOCUS_08520 7858 8880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 10407 9286 gene locus_tag LOCUS_08530 10407 9286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 12067 10472 gene locus_tag LOCUS_08540 gene rng 12067 10472 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_08540 13295 12264 gene locus_tag LOCUS_08550 13295 12264 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_08550 13512 16307 gene locus_tag LOCUS_08560 13512 16307 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202510.1 protein_id gnl|my_center|LOCUS_08560 16321 16794 gene locus_tag LOCUS_08570 16321 16794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 18166 17087 gene locus_tag LOCUS_08580 18166 17087 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405202.1 protein_id gnl|my_center|LOCUS_08580 19073 18294 gene locus_tag LOCUS_08590 19073 18294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 19821 19114 gene locus_tag LOCUS_08600 gene purQ 19821 19114 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256638.1 protein_id gnl|my_center|LOCUS_08600 22272 19870 gene locus_tag LOCUS_08610 gene purL 22272 19870 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259203.1 protein_id gnl|my_center|LOCUS_08610 22797 22294 gene locus_tag LOCUS_08620 22797 22294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 23525 22815 gene locus_tag LOCUS_08630 23525 22815 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420966.1 protein_id gnl|my_center|LOCUS_08630 23757 25616 gene locus_tag LOCUS_08640 23757 25616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 28142 26109 gene locus_tag LOCUS_08650 gene tkt 28142 26109 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245397.1 protein_id gnl|my_center|LOCUS_08650 28551 29336 gene locus_tag LOCUS_08660 gene proB 28551 29336 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_08660 29320 30603 gene locus_tag LOCUS_08670 29320 30603 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_08670 31678 30812 gene locus_tag LOCUS_08680 gene cysE 31678 30812 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704210.1 protein_id gnl|my_center|LOCUS_08680 >Feature sequence023 <1 2690 gene locus_tag LOCUS_08690 <1 2690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009937746.1:MFS transporter 2680 3147 gene locus_tag LOCUS_08700 2680 3147 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932428.1 protein_id gnl|my_center|LOCUS_08700 3599 3159 gene locus_tag LOCUS_08710 3599 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 4159 3752 gene locus_tag LOCUS_08720 4159 3752 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_08720 4223 6556 gene locus_tag LOCUS_08730 4223 6556 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530052.1 protein_id gnl|my_center|LOCUS_08730 7363 6632 gene locus_tag LOCUS_08740 7363 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 8008 7415 gene locus_tag LOCUS_08750 8008 7415 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700597.1 protein_id gnl|my_center|LOCUS_08750 10481 8010 gene locus_tag LOCUS_08760 gene mutS 10481 8010 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_08760 11177 10827 gene locus_tag LOCUS_08770 gene rsfS 11177 10827 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418177.1 protein_id gnl|my_center|LOCUS_08770 13559 11199 gene locus_tag LOCUS_08780 13559 11199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 14611 13814 gene locus_tag LOCUS_08790 14611 13814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 15659 14601 gene locus_tag LOCUS_08800 15659 14601 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215055.1 protein_id gnl|my_center|LOCUS_08800 15889 16713 gene locus_tag LOCUS_08810 gene menB 15889 16713 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927101.1 protein_id gnl|my_center|LOCUS_08810 16733 17563 gene locus_tag LOCUS_08820 16733 17563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 18662 17634 gene locus_tag LOCUS_08830 18662 17634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 19963 18674 gene locus_tag LOCUS_08840 19963 18674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 20163 20678 gene locus_tag LOCUS_08850 20163 20678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 20707 21183 gene locus_tag LOCUS_08860 20707 21183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 22500 21355 gene locus_tag LOCUS_08870 22500 21355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 23095 22463 gene locus_tag LOCUS_08880 23095 22463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 24048 23092 gene locus_tag LOCUS_08890 24048 23092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 24637 24209 gene locus_tag LOCUS_08900 24637 24209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 28546 24962 gene locus_tag LOCUS_08910 28546 24962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 28690 29112 gene locus_tag LOCUS_08920 28690 29112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 29348 30193 gene locus_tag LOCUS_08930 29348 30193 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057728.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence024 355 951 gene locus_tag LOCUS_08940 355 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 1032 1919 gene locus_tag LOCUS_08950 1032 1919 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_08950 2003 4261 gene locus_tag LOCUS_08960 2003 4261 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765172.1 protein_id gnl|my_center|LOCUS_08960 4277 5023 gene locus_tag LOCUS_08970 4277 5023 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339558.1 protein_id gnl|my_center|LOCUS_08970 5029 7845 gene locus_tag LOCUS_08980 5029 7845 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123057.1 protein_id gnl|my_center|LOCUS_08980 8708 9343 gene locus_tag LOCUS_08990 8708 9343 CDS product CatA-like O-acetyltransferase, family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705203.1 protein_id gnl|my_center|LOCUS_08990 10554 9586 gene locus_tag LOCUS_09000 10554 9586 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 protein_id gnl|my_center|LOCUS_09000 11967 10573 gene locus_tag LOCUS_09010 gene der 11967 10573 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165530.1 protein_id gnl|my_center|LOCUS_09010 13134 12043 gene locus_tag LOCUS_09020 13134 12043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 13822 13286 gene locus_tag LOCUS_09030 13822 13286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 14595 13822 gene locus_tag LOCUS_09040 14595 13822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 16489 14603 gene locus_tag LOCUS_09050 gene dxs 16489 14603 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393020.1 protein_id gnl|my_center|LOCUS_09050 16730 16470 gene locus_tag LOCUS_09060 16730 16470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 18615 16738 gene locus_tag LOCUS_09070 18615 16738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 20003 18612 gene locus_tag LOCUS_09080 20003 18612 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_09080 21202 20000 gene locus_tag LOCUS_09090 21202 20000 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679701.1 protein_id gnl|my_center|LOCUS_09090 21283 21714 gene locus_tag LOCUS_09100 21283 21714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 21720 23264 gene locus_tag LOCUS_09110 gene gpmI 21720 23264 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_09110 23839 24222 gene locus_tag LOCUS_09120 gene rpsL 23839 24222 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545079.1 protein_id gnl|my_center|LOCUS_09120 24249 24722 gene locus_tag LOCUS_09130 gene rpsG 24249 24722 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583341.1 protein_id gnl|my_center|LOCUS_09130 24786 26933 gene locus_tag LOCUS_09140 gene fusA 24786 26933 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_09140 26971 27279 gene locus_tag LOCUS_09150 gene rpsJ 26971 27279 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_09150 27325 27960 gene locus_tag LOCUS_09160 gene rplC 27325 27960 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417224.1 protein_id gnl|my_center|LOCUS_09160 28002 28610 gene locus_tag LOCUS_09170 gene rplD 28002 28610 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424397.1 protein_id gnl|my_center|LOCUS_09170 28617 28901 gene locus_tag LOCUS_09180 28617 28901 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_09180 28928 29764 gene locus_tag LOCUS_09190 gene rplB 28928 29764 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933839.1 protein_id gnl|my_center|LOCUS_09190 >Feature sequence025 518 766 gene locus_tag LOCUS_09200 518 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 779 958 gene locus_tag LOCUS_09210 779 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 12022 959 gene locus_tag LOCUS_09220 12022 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 14488 12425 gene locus_tag LOCUS_09230 14488 12425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 15194 14475 gene locus_tag LOCUS_09240 15194 14475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 15807 15196 gene locus_tag LOCUS_09250 15807 15196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 16993 15860 gene locus_tag LOCUS_09260 16993 15860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 17186 17112 gene locus_tag LOCUS_t00220 17186 17112 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 17326 17505 gene locus_tag LOCUS_09270 17326 17505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 17518 18282 gene locus_tag LOCUS_09280 17518 18282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 18279 19298 gene locus_tag LOCUS_09290 18279 19298 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017578.1 protein_id gnl|my_center|LOCUS_09290 20241 19399 gene locus_tag LOCUS_09300 20241 19399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 21799 20276 gene locus_tag LOCUS_09310 21799 20276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 22735 21815 gene locus_tag LOCUS_09320 22735 21815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 23026 22739 gene locus_tag LOCUS_09330 23026 22739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 23859 23023 gene locus_tag LOCUS_09340 23859 23023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 24190 24777 gene locus_tag LOCUS_09350 24190 24777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 24774 25106 gene locus_tag LOCUS_09360 24774 25106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 25146 25439 gene locus_tag LOCUS_09370 gene gatC 25146 25439 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086999.1 protein_id gnl|my_center|LOCUS_09370 25494 26906 gene locus_tag LOCUS_09380 gene gatA 25494 26906 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_09380 26961 27944 gene locus_tag LOCUS_09390 26961 27944 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_09390 28043 28933 gene locus_tag LOCUS_09400 28043 28933 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence026 120 1220 gene locus_tag LOCUS_09410 gene dnaN 120 1220 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725022.1 protein_id gnl|my_center|LOCUS_09410 1965 1525 gene locus_tag LOCUS_09420 1965 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 3120 2068 gene locus_tag LOCUS_09430 3120 2068 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947883.1 protein_id gnl|my_center|LOCUS_09430 4700 3321 gene locus_tag LOCUS_09440 4700 3321 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292596.1 protein_id gnl|my_center|LOCUS_09440 4858 4885 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5701 4970 gene locus_tag LOCUS_09450 5701 4970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 6225 5731 gene locus_tag LOCUS_09460 6225 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 7095 6280 gene locus_tag LOCUS_09470 7095 6280 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396453.1 protein_id gnl|my_center|LOCUS_09470 7241 8281 gene locus_tag LOCUS_09480 7241 8281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 8475 12212 gene locus_tag LOCUS_09490 8475 12212 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109085.1 protein_id gnl|my_center|LOCUS_09490 13086 12403 gene locus_tag LOCUS_09500 13086 12403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 14052 13093 gene locus_tag LOCUS_09510 14052 13093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 14545 17223 gene locus_tag LOCUS_09520 14545 17223 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529647.1 protein_id gnl|my_center|LOCUS_09520 17237 17935 gene locus_tag LOCUS_09530 17237 17935 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103914.1 protein_id gnl|my_center|LOCUS_09530 18089 18868 gene locus_tag LOCUS_09540 18089 18868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 19074 20681 gene locus_tag LOCUS_09550 gene kdpA 19074 20681 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388910.1 protein_id gnl|my_center|LOCUS_09550 20704 22824 gene locus_tag LOCUS_09560 gene kdpB 20704 22824 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529645.1 protein_id gnl|my_center|LOCUS_09560 22854 23429 gene locus_tag LOCUS_09570 gene kdpC 22854 23429 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576697.1 protein_id gnl|my_center|LOCUS_09570 24055 23702 gene locus_tag LOCUS_09580 24055 23702 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098568.1 protein_id gnl|my_center|LOCUS_09580 24782 24057 gene locus_tag LOCUS_09590 24782 24057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 25515 28097 gene locus_tag LOCUS_09600 gene clpB 25515 28097 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_09600 >Feature sequence027 145 2703 gene locus_tag LOCUS_09610 gene gyrB 145 2703 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458663.1 protein_id gnl|my_center|LOCUS_09610 2727 5348 gene locus_tag LOCUS_09620 gene gyrA 2727 5348 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_09620 5507 6040 gene locus_tag LOCUS_09630 5507 6040 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939415.1 protein_id gnl|my_center|LOCUS_09630 6071 7315 gene locus_tag LOCUS_09640 6071 7315 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555746.1 protein_id gnl|my_center|LOCUS_09640 7656 7384 gene locus_tag LOCUS_09650 7656 7384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 7914 11309 gene locus_tag LOCUS_09660 7914 11309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 11324 13186 gene locus_tag LOCUS_09670 11324 13186 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_09670 13201 14328 gene locus_tag LOCUS_09680 13201 14328 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680414.1 protein_id gnl|my_center|LOCUS_09680 14408 14791 gene locus_tag LOCUS_09690 14408 14791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 16673 15033 gene locus_tag LOCUS_09700 gene cysI 16673 15033 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243849.1 protein_id gnl|my_center|LOCUS_09700 16997 16689 gene locus_tag LOCUS_09710 16997 16689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 18250 17453 gene locus_tag LOCUS_09720 18250 17453 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963434.1 protein_id gnl|my_center|LOCUS_09720 19316 18243 gene locus_tag LOCUS_09730 19316 18243 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_09730 21030 19303 gene locus_tag LOCUS_09740 gene cysN 21030 19303 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121644.1 protein_id gnl|my_center|LOCUS_09740 21987 21076 gene locus_tag LOCUS_09750 gene cysD 21987 21076 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776455.1 protein_id gnl|my_center|LOCUS_09750 22689 22006 gene locus_tag LOCUS_09760 22689 22006 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192841.1 protein_id gnl|my_center|LOCUS_09760 23675 22746 gene locus_tag LOCUS_09770 gene cysK 23675 22746 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_09770 25023 24349 gene locus_tag LOCUS_09780 gene phoU 25023 24349 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096661.1 protein_id gnl|my_center|LOCUS_09780 25829 25050 gene locus_tag LOCUS_09790 gene pstB 25829 25050 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096663.1 protein_id gnl|my_center|LOCUS_09790 <27383 25852 gene locus_tag LOCUS_09800 <27383 25852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114377.1:phosphate ABC transporter permease PstA >Feature sequence028 99 515 gene locus_tag LOCUS_09810 99 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1136 684 gene locus_tag LOCUS_09820 gene dtd 1136 684 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796976.1 protein_id gnl|my_center|LOCUS_09820 1861 1133 gene locus_tag LOCUS_09830 1861 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 2435 1866 gene locus_tag LOCUS_09840 2435 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 2746 2504 gene locus_tag LOCUS_09850 gene acpP 2746 2504 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_09850 3589 2939 gene locus_tag LOCUS_09860 3589 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 2955 2964 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4722 3595 gene locus_tag LOCUS_09870 4722 3595 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349606.1 protein_id gnl|my_center|LOCUS_09870 4932 5876 gene locus_tag LOCUS_09880 gene fmt 4932 5876 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768186.1 protein_id gnl|my_center|LOCUS_09880 5877 7883 gene locus_tag LOCUS_09890 5877 7883 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941556.1 protein_id gnl|my_center|LOCUS_09890 10390 8093 gene locus_tag LOCUS_09900 10390 8093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 11578 10400 gene locus_tag LOCUS_09910 gene galK 11578 10400 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053415.1 protein_id gnl|my_center|LOCUS_09910 13173 11797 gene locus_tag LOCUS_09920 13173 11797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 13575 14240 gene locus_tag LOCUS_09930 13575 14240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 15181 14447 gene locus_tag LOCUS_09940 15181 14447 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928634.1 protein_id gnl|my_center|LOCUS_09940 17139 15265 gene locus_tag LOCUS_09950 17139 15265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 17552 17175 gene locus_tag LOCUS_09960 17552 17175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 19432 17660 gene locus_tag LOCUS_09970 19432 17660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 21495 19738 gene locus_tag LOCUS_09980 21495 19738 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765637.1 protein_id gnl|my_center|LOCUS_09980 22421 21573 gene locus_tag LOCUS_09990 22421 21573 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107441.1 protein_id gnl|my_center|LOCUS_09990 22372 23226 gene locus_tag LOCUS_10000 22372 23226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 23878 23258 gene locus_tag LOCUS_10010 23878 23258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 24678 23917 gene locus_tag LOCUS_10020 24678 23917 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615807.1 protein_id gnl|my_center|LOCUS_10020 24933 26228 gene locus_tag LOCUS_10030 gene nusA 24933 26228 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311294.1 protein_id gnl|my_center|LOCUS_10030 >Feature sequence029 1542 1048 gene locus_tag LOCUS_10040 1542 1048 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938859.1 protein_id gnl|my_center|LOCUS_10040 3303 1660 gene locus_tag LOCUS_10050 3303 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 3448 3918 gene locus_tag LOCUS_10060 3448 3918 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008130072.1 protein_id gnl|my_center|LOCUS_10060 3988 4071 gene locus_tag LOCUS_t00230 3988 4071 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4392 5087 gene locus_tag LOCUS_10070 4392 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 5578 5653 gene locus_tag LOCUS_t00240 5578 5653 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6545 5727 gene locus_tag LOCUS_10080 6545 5727 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784150.1 protein_id gnl|my_center|LOCUS_10080 7321 7728 gene locus_tag LOCUS_10090 7321 7728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 8521 8162 gene locus_tag LOCUS_tm00010 8521 8162 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 8679 8603 gene locus_tag LOCUS_t00250 8679 8603 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8893 11043 gene locus_tag LOCUS_10100 8893 11043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 11403 11495 gene locus_tag LOCUS_t00260 11403 11495 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12057 12779 gene locus_tag LOCUS_10110 12057 12779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268017.1 protein_id gnl|my_center|LOCUS_10110 13862 12975 gene locus_tag LOCUS_10120 gene sucD 13862 12975 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941720.1 protein_id gnl|my_center|LOCUS_10120 15065 13884 gene locus_tag LOCUS_10130 gene sucC 15065 13884 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388966.1 protein_id gnl|my_center|LOCUS_10130 15267 16565 gene locus_tag LOCUS_10140 gene hisD 15267 16565 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461463.1 protein_id gnl|my_center|LOCUS_10140 16830 17726 gene locus_tag LOCUS_10150 16830 17726 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790916.1 protein_id gnl|my_center|LOCUS_10150 17944 19611 gene locus_tag LOCUS_10160 17944 19611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 19689 21281 gene locus_tag LOCUS_10170 19689 21281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 23480 22116 gene locus_tag LOCUS_10180 gene xseA 23480 22116 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162234453.1 protein_id gnl|my_center|LOCUS_10180 25646 23484 gene locus_tag LOCUS_10190 25646 23484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence030 2053 443 gene locus_tag LOCUS_10200 2053 443 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973389.1 protein_id gnl|my_center|LOCUS_10200 2176 2883 gene locus_tag LOCUS_10210 2176 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 3221 3093 gene locus_tag LOCUS_10220 3221 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 4028 3435 gene locus_tag LOCUS_10230 gene raiA 4028 3435 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903257.1 protein_id gnl|my_center|LOCUS_10230 4377 4453 gene locus_tag LOCUS_t00270 4377 4453 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4610 5923 gene locus_tag LOCUS_10240 4610 5923 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963488.1 protein_id gnl|my_center|LOCUS_10240 7073 6177 gene locus_tag LOCUS_10250 7073 6177 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101946.1 protein_id gnl|my_center|LOCUS_10250 8508 7255 gene locus_tag LOCUS_10260 8508 7255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 9693 8560 gene locus_tag LOCUS_10270 9693 8560 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211252.1 protein_id gnl|my_center|LOCUS_10270 10884 9832 gene locus_tag LOCUS_10280 10884 9832 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859695.1 protein_id gnl|my_center|LOCUS_10280 12047 11007 gene locus_tag LOCUS_10290 12047 11007 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182588488.1 protein_id gnl|my_center|LOCUS_10290 12187 13083 gene locus_tag LOCUS_10300 12187 13083 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_10300 13623 17534 gene locus_tag LOCUS_10310 13623 17534 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202282.1 protein_id gnl|my_center|LOCUS_10310 17818 19104 gene locus_tag LOCUS_10320 17818 19104 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938380.1 protein_id gnl|my_center|LOCUS_10320 18220 18229 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19367 19852 gene locus_tag LOCUS_10330 19367 19852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 20012 20851 gene locus_tag LOCUS_10340 20012 20851 CDS product DUF2589 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788700.1 protein_id gnl|my_center|LOCUS_10340 20890 21696 gene locus_tag LOCUS_10350 20890 21696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 21703 22299 gene locus_tag LOCUS_10360 21703 22299 CDS product DUF2589 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788696.1 protein_id gnl|my_center|LOCUS_10360 22314 22544 gene locus_tag LOCUS_10370 22314 22544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 22541 22894 gene locus_tag LOCUS_10380 22541 22894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 23232 22912 gene locus_tag LOCUS_10390 23232 22912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 23933 23229 gene locus_tag LOCUS_10400 gene menH 23933 23229 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704503.1 protein_id gnl|my_center|LOCUS_10400 24555 23950 gene locus_tag LOCUS_10410 24555 23950 CDS product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174792.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence031 488 153 gene locus_tag LOCUS_10420 488 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 677 952 gene locus_tag LOCUS_10430 677 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 965 1252 gene locus_tag LOCUS_10440 965 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1256 1978 gene locus_tag LOCUS_10450 1256 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1985 2641 gene locus_tag LOCUS_10460 1985 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 2634 2852 gene locus_tag LOCUS_10470 2634 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 2868 3005 gene locus_tag LOCUS_10480 2868 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 3021 4661 gene locus_tag LOCUS_10490 3021 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 4681 5622 gene locus_tag LOCUS_10500 4681 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 5619 5885 gene locus_tag LOCUS_10510 5619 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 5887 7767 gene locus_tag LOCUS_10520 5887 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 7764 8060 gene locus_tag LOCUS_10530 7764 8060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 8020 8430 gene locus_tag LOCUS_10540 8020 8430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 8495 9214 gene locus_tag LOCUS_10550 8495 9214 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038090.1 protein_id gnl|my_center|LOCUS_10550 11415 9562 gene locus_tag LOCUS_10560 gene ilvB 11415 9562 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327661.1 protein_id gnl|my_center|LOCUS_10560 12173 11565 gene locus_tag LOCUS_10570 12173 11565 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706953.1 protein_id gnl|my_center|LOCUS_10570 12334 12597 gene locus_tag LOCUS_10580 12334 12597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 12678 12899 gene locus_tag LOCUS_10590 12678 12899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 14181 13036 gene locus_tag LOCUS_10600 14181 13036 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056884.1 protein_id gnl|my_center|LOCUS_10600 14306 15364 gene locus_tag LOCUS_10610 14306 15364 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267361.1 protein_id gnl|my_center|LOCUS_10610 15377 16516 gene locus_tag LOCUS_10620 15377 16516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 16513 17370 gene locus_tag LOCUS_10630 16513 17370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 18294 17512 gene locus_tag LOCUS_10640 18294 17512 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582796.1 protein_id gnl|my_center|LOCUS_10640 19237 18362 gene locus_tag LOCUS_10650 gene folD 19237 18362 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_10650 19938 19210 gene locus_tag LOCUS_10660 19938 19210 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053541.1 protein_id gnl|my_center|LOCUS_10660 21594 19954 gene locus_tag LOCUS_10670 21594 19954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 24117 21616 gene locus_tag LOCUS_10680 24117 21616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 <24777 24253 gene locus_tag LOCUS_10690 <24777 24253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202799.1:alpha-amylase family glycosyl hydrolase >Feature sequence032 624 145 gene locus_tag LOCUS_10700 624 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 1436 621 gene locus_tag LOCUS_10710 gene kdsA 1436 621 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_10710 1721 2479 gene locus_tag LOCUS_10720 1721 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 2718 3413 gene locus_tag LOCUS_10730 gene rpsB 2718 3413 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005645552.1 protein_id gnl|my_center|LOCUS_10730 3443 4321 gene locus_tag LOCUS_10740 gene tsf 3443 4321 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201392.1 protein_id gnl|my_center|LOCUS_10740 4844 5629 gene locus_tag LOCUS_10750 4844 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 7346 6159 gene locus_tag LOCUS_10760 7346 6159 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110716881.1 protein_id gnl|my_center|LOCUS_10760 8940 7360 gene locus_tag LOCUS_10770 8940 7360 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944579.1 protein_id gnl|my_center|LOCUS_10770 10520 8946 gene locus_tag LOCUS_10780 10520 8946 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_10780 11683 10562 gene locus_tag LOCUS_10790 11683 10562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 12336 11728 gene locus_tag LOCUS_10800 gene leuD 12336 11728 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228533.1 protein_id gnl|my_center|LOCUS_10800 13768 12356 gene locus_tag LOCUS_10810 gene leuC 13768 12356 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173294.1 protein_id gnl|my_center|LOCUS_10810 14609 13971 gene locus_tag LOCUS_10820 gene lipB 14609 13971 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943071.1 protein_id gnl|my_center|LOCUS_10820 15664 14645 gene locus_tag LOCUS_10830 15664 14645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 16864 15824 gene locus_tag LOCUS_10840 gene recA 16864 15824 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_10840 17990 17091 gene locus_tag LOCUS_10850 17990 17091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 19024 18089 gene locus_tag LOCUS_10860 19024 18089 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814571.1 protein_id gnl|my_center|LOCUS_10860 21356 19047 gene locus_tag LOCUS_10870 21356 19047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 22461 21337 gene locus_tag LOCUS_10880 gene murG 22461 21337 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545433.1 protein_id gnl|my_center|LOCUS_10880 23600 22458 gene locus_tag LOCUS_10890 gene spoVE 23600 22458 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753520.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence033 164 817 gene locus_tag LOCUS_10900 164 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 955 1872 gene locus_tag LOCUS_10910 955 1872 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122104.1 protein_id gnl|my_center|LOCUS_10910 1862 3304 gene locus_tag LOCUS_10920 1862 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 3316 4743 gene locus_tag LOCUS_10930 3316 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 5587 4811 gene locus_tag LOCUS_10940 gene proC 5587 4811 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392379.1 protein_id gnl|my_center|LOCUS_10940 6350 5688 gene locus_tag LOCUS_10950 6350 5688 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764076.1 protein_id gnl|my_center|LOCUS_10950 7288 6362 gene locus_tag LOCUS_10960 7288 6362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 7388 8335 gene locus_tag LOCUS_10970 7388 8335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 8415 9464 gene locus_tag LOCUS_10980 8415 9464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 11054 9591 gene locus_tag LOCUS_10990 11054 9591 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461272.1 protein_id gnl|my_center|LOCUS_10990 11208 11801 gene locus_tag LOCUS_11000 11208 11801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 12813 11791 gene locus_tag LOCUS_11010 12813 11791 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035992.1 protein_id gnl|my_center|LOCUS_11010 15393 12874 gene locus_tag LOCUS_11020 gene pheT 15393 12874 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_11020 16439 15414 gene locus_tag LOCUS_11030 gene pheS 16439 15414 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018596.1 protein_id gnl|my_center|LOCUS_11030 17790 16606 gene locus_tag LOCUS_11040 17790 16606 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114593.1 protein_id gnl|my_center|LOCUS_11040 19842 17986 gene locus_tag LOCUS_11050 19842 17986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 20034 21698 gene locus_tag LOCUS_11060 gene htpG 20034 21698 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460040.1 protein_id gnl|my_center|LOCUS_11060 21676 21685 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21716 21877 gene locus_tag LOCUS_11070 21716 21877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 21979 22788 gene locus_tag LOCUS_11080 21979 22788 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964627.1 protein_id gnl|my_center|LOCUS_11080 >Feature sequence034 414 890 gene locus_tag LOCUS_11090 414 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 1619 1152 gene locus_tag LOCUS_11100 1619 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 2237 1674 gene locus_tag LOCUS_11110 2237 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 3059 2334 gene locus_tag LOCUS_11120 3059 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 3896 3426 gene locus_tag LOCUS_11130 3896 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 4161 3907 gene locus_tag LOCUS_11140 4161 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 4971 4408 gene locus_tag LOCUS_11150 4971 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 5935 5944 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6008 6421 gene locus_tag LOCUS_11160 6008 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 7275 7201 gene locus_tag LOCUS_t00280 7275 7201 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9079 7559 gene locus_tag LOCUS_11170 gene proS 9079 7559 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921836.1 protein_id gnl|my_center|LOCUS_11170 9829 9137 gene locus_tag LOCUS_11180 9829 9137 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325327.1 protein_id gnl|my_center|LOCUS_11180 9933 10652 gene locus_tag LOCUS_11190 9933 10652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 10761 11636 gene locus_tag LOCUS_11200 10761 11636 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_11200 11649 12743 gene locus_tag LOCUS_11210 11649 12743 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_11210 12770 13696 gene locus_tag LOCUS_11220 12770 13696 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024341.1 protein_id gnl|my_center|LOCUS_11220 14063 14458 gene locus_tag LOCUS_11230 14063 14458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 14565 15968 gene locus_tag LOCUS_11240 14565 15968 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403748.1 protein_id gnl|my_center|LOCUS_11240 17389 16172 gene locus_tag LOCUS_11250 17389 16172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 19634 17406 gene locus_tag LOCUS_11260 19634 17406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 20382 19744 gene locus_tag LOCUS_11270 20382 19744 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940170.1 protein_id gnl|my_center|LOCUS_11270 21518 20808 gene locus_tag LOCUS_11280 21518 20808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 21697 23055 gene locus_tag LOCUS_11290 gene rpoN 21697 23055 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462176.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence035 3160 1499 gene locus_tag LOCUS_11300 3160 1499 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001969726.1 protein_id gnl|my_center|LOCUS_11300 3343 3966 gene locus_tag LOCUS_11310 3343 3966 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_11310 4251 5144 gene locus_tag LOCUS_11320 4251 5144 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403573.1 protein_id gnl|my_center|LOCUS_11320 5289 5936 gene locus_tag LOCUS_11330 gene pyrH 5289 5936 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056115.1 protein_id gnl|my_center|LOCUS_11330 5988 6554 gene locus_tag LOCUS_11340 gene frr 5988 6554 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259405.1 protein_id gnl|my_center|LOCUS_11340 6579 6899 gene locus_tag LOCUS_11350 6579 6899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 7634 8095 gene locus_tag LOCUS_11360 7634 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 8092 9006 gene locus_tag LOCUS_11370 8092 9006 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814554.1 protein_id gnl|my_center|LOCUS_11370 9003 9938 gene locus_tag LOCUS_11380 9003 9938 CDS product radical SAM mobile pair protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679438.1 protein_id gnl|my_center|LOCUS_11380 11120 10503 gene locus_tag LOCUS_11390 11120 10503 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948614.1 protein_id gnl|my_center|LOCUS_11390 14850 12328 gene locus_tag LOCUS_11400 14850 12328 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_11400 15089 15352 gene locus_tag LOCUS_11410 15089 15352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 15477 15956 gene locus_tag LOCUS_11420 15477 15956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021820.1 protein_id gnl|my_center|LOCUS_11420 15992 16951 gene locus_tag LOCUS_11430 15992 16951 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326127.1 protein_id gnl|my_center|LOCUS_11430 17683 17036 gene locus_tag LOCUS_11440 gene phoU 17683 17036 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401254.1 protein_id gnl|my_center|LOCUS_11440 18651 17869 gene locus_tag LOCUS_11450 gene pstB 18651 17869 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096663.1 protein_id gnl|my_center|LOCUS_11450 18800 19816 gene locus_tag LOCUS_11460 18800 19816 CDS product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269390.1 protein_id gnl|my_center|LOCUS_11460 19908 22262 gene locus_tag LOCUS_11470 19908 22262 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071862.1 protein_id gnl|my_center|LOCUS_11470 >Feature sequence036 917 1492 gene locus_tag LOCUS_11480 gene rsmD 917 1492 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_11480 1494 2780 gene locus_tag LOCUS_11490 gene waaA 1494 2780 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_11490 3732 2764 gene locus_tag LOCUS_11500 3732 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 4907 3786 gene locus_tag LOCUS_11510 gene rsgA 4907 3786 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459864.1 protein_id gnl|my_center|LOCUS_11510 5672 4989 gene locus_tag LOCUS_11520 5672 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 5734 6924 gene locus_tag LOCUS_11530 gene nifS 5734 6924 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670052.1 protein_id gnl|my_center|LOCUS_11530 7148 7591 gene locus_tag LOCUS_11540 7148 7591 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704430.1 protein_id gnl|my_center|LOCUS_11540 8400 7651 gene locus_tag LOCUS_11550 8400 7651 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975619.1 protein_id gnl|my_center|LOCUS_11550 9959 8616 gene locus_tag LOCUS_11560 9959 8616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 12638 9978 gene locus_tag LOCUS_11570 12638 9978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 13689 12646 gene locus_tag LOCUS_11580 13689 12646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 14340 13711 gene locus_tag LOCUS_11590 14340 13711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 14899 14360 gene locus_tag LOCUS_11600 14899 14360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 15281 14913 gene locus_tag LOCUS_11610 15281 14913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 16268 15393 gene locus_tag LOCUS_11620 16268 15393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 16796 16275 gene locus_tag LOCUS_11630 16796 16275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 17475 16903 gene locus_tag LOCUS_11640 gene rpoE 17475 16903 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_11640 19455 17536 gene locus_tag LOCUS_11650 19455 17536 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_11650 20520 19519 gene locus_tag LOCUS_11660 gene purM 20520 19519 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880467.1 protein_id gnl|my_center|LOCUS_11660 21085 20624 gene locus_tag LOCUS_11670 21085 20624 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123285.1 protein_id gnl|my_center|LOCUS_11670 <22179 21326 gene locus_tag LOCUS_11680 <22179 21326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202541.1:GDSL-type esterase/lipase family protein >Feature sequence037 686 240 gene locus_tag LOCUS_11690 686 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 2272 707 gene locus_tag LOCUS_11700 2272 707 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387812.1 protein_id gnl|my_center|LOCUS_11700 2726 2304 gene locus_tag LOCUS_11710 gene mce 2726 2304 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_11710 2893 4431 gene locus_tag LOCUS_11720 2893 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 4541 4888 gene locus_tag LOCUS_11730 gene rplS 4541 4888 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_11730 6935 5319 gene locus_tag LOCUS_11740 6935 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 9165 7432 gene locus_tag LOCUS_11750 9165 7432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 10429 9203 gene locus_tag LOCUS_11760 10429 9203 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707892.1 protein_id gnl|my_center|LOCUS_11760 10914 10432 gene locus_tag LOCUS_11770 10914 10432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 11594 10932 gene locus_tag LOCUS_11780 11594 10932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 12375 11602 gene locus_tag LOCUS_11790 12375 11602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 15135 12406 gene locus_tag LOCUS_11800 gene ileS 15135 12406 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081557.1 protein_id gnl|my_center|LOCUS_11800 16247 15207 gene locus_tag LOCUS_11810 16247 15207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 17314 16244 gene locus_tag LOCUS_11820 17314 16244 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721273.1 protein_id gnl|my_center|LOCUS_11820 19717 17351 gene locus_tag LOCUS_11830 19717 17351 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055503.1 protein_id gnl|my_center|LOCUS_11830 20048 19773 gene locus_tag LOCUS_11840 20048 19773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 20750 20247 gene locus_tag LOCUS_11850 20750 20247 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480055.1 protein_id gnl|my_center|LOCUS_11850 20879 21802 gene locus_tag LOCUS_11860 gene bla 20879 21802 CDS product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140598.1 protein_id gnl|my_center|LOCUS_11860 >Feature sequence038 1696 707 gene locus_tag LOCUS_11870 gene queA 1696 707 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081288.1 protein_id gnl|my_center|LOCUS_11870 1779 2840 gene locus_tag LOCUS_11880 gene floA 1779 2840 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 protein_id gnl|my_center|LOCUS_11880 2895 3536 gene locus_tag LOCUS_11890 2895 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 3642 4424 gene locus_tag LOCUS_11900 3642 4424 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945667.1 protein_id gnl|my_center|LOCUS_11900 5770 4466 gene locus_tag LOCUS_11910 5770 4466 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982162.1 protein_id gnl|my_center|LOCUS_11910 5923 6588 gene locus_tag LOCUS_11920 5923 6588 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203326.1 protein_id gnl|my_center|LOCUS_11920 6591 7760 gene locus_tag LOCUS_11930 6591 7760 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211853.1 protein_id gnl|my_center|LOCUS_11930 7764 9053 gene locus_tag LOCUS_11940 gene lysA 7764 9053 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_11940 9381 10379 gene locus_tag LOCUS_11950 gene fbaA 9381 10379 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015363.1 protein_id gnl|my_center|LOCUS_11950 12578 10743 gene locus_tag LOCUS_11960 gene typA 12578 10743 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933091.1 protein_id gnl|my_center|LOCUS_11960 12786 13652 gene locus_tag LOCUS_11970 gene ilvE 12786 13652 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_11970 14813 13941 gene locus_tag LOCUS_11980 14813 13941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 15062 15547 gene locus_tag LOCUS_11990 15062 15547 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949083.1 protein_id gnl|my_center|LOCUS_11990 16168 15572 gene locus_tag LOCUS_12000 16168 15572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 17035 18105 gene locus_tag LOCUS_12010 17035 18105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 18138 19295 gene locus_tag LOCUS_12020 18138 19295 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_12020 19477 20448 gene locus_tag LOCUS_12030 19477 20448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 21447 20497 gene locus_tag LOCUS_12040 21447 20497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 >Feature sequence039 3510 781 gene locus_tag LOCUS_12050 3510 781 CDS product polymorphic outer membrane protein middle domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883089.1 protein_id gnl|my_center|LOCUS_12050 3899 4138 gene locus_tag LOCUS_12060 3899 4138 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205394.1 protein_id gnl|my_center|LOCUS_12060 6295 4775 gene locus_tag LOCUS_12070 6295 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 6730 7914 gene locus_tag LOCUS_12080 6730 7914 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_12080 9039 8014 gene locus_tag LOCUS_12090 9039 8014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 10536 9226 gene locus_tag LOCUS_12100 10536 9226 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203529.1 protein_id gnl|my_center|LOCUS_12100 11268 10555 gene locus_tag LOCUS_12110 11268 10555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 11582 11917 gene locus_tag LOCUS_12120 11582 11917 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169602550.1 protein_id gnl|my_center|LOCUS_12120 13919 11985 gene locus_tag LOCUS_12130 13919 11985 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_12130 14238 14987 gene locus_tag LOCUS_12140 14238 14987 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858645.1 protein_id gnl|my_center|LOCUS_12140 15434 15039 gene locus_tag LOCUS_12150 15434 15039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 15776 16555 gene locus_tag LOCUS_12160 15776 16555 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_12160 19891 16697 gene locus_tag LOCUS_12170 gene carB 19891 16697 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_12170 20239 20952 gene locus_tag LOCUS_12180 20239 20952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 >Feature sequence040 153 1070 gene locus_tag LOCUS_12190 153 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 1621 3027 gene locus_tag LOCUS_12200 1621 3027 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937772.1 protein_id gnl|my_center|LOCUS_12200 3011 4603 gene locus_tag LOCUS_12210 3011 4603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 4593 5378 gene locus_tag LOCUS_12220 4593 5378 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937775.1 protein_id gnl|my_center|LOCUS_12220 5375 6022 gene locus_tag LOCUS_12230 5375 6022 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404413.1 protein_id gnl|my_center|LOCUS_12230 6019 7191 gene locus_tag LOCUS_12240 gene trpB 6019 7191 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937777.1 protein_id gnl|my_center|LOCUS_12240 7205 7993 gene locus_tag LOCUS_12250 gene trpA 7205 7993 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937778.1 protein_id gnl|my_center|LOCUS_12250 8401 17832 gene locus_tag LOCUS_12260 8401 17832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 18364 17954 gene locus_tag LOCUS_12270 18364 17954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 19726 18563 gene locus_tag LOCUS_12280 19726 18563 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259309.1 protein_id gnl|my_center|LOCUS_12280 19950 19813 gene locus_tag LOCUS_12290 19950 19813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 >Feature sequence041 1436 468 gene locus_tag LOCUS_12300 1436 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1523 2014 gene locus_tag LOCUS_12310 gene hisI 1523 2014 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088269.1 protein_id gnl|my_center|LOCUS_12310 2078 3028 gene locus_tag LOCUS_12320 2078 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 3047 3562 gene locus_tag LOCUS_12330 3047 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 3592 4293 gene locus_tag LOCUS_12340 gene rsmI 3592 4293 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707588.1 protein_id gnl|my_center|LOCUS_12340 4980 4312 gene locus_tag LOCUS_12350 4980 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 5339 5641 gene locus_tag LOCUS_12360 5339 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 7071 5740 gene locus_tag LOCUS_12370 7071 5740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 7910 7215 gene locus_tag LOCUS_12380 gene rncS 7910 7215 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_12380 8071 8577 gene locus_tag LOCUS_12390 8071 8577 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107336.1 protein_id gnl|my_center|LOCUS_12390 9687 8632 gene locus_tag LOCUS_12400 gene recF 9687 8632 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906242.1 protein_id gnl|my_center|LOCUS_12400 10315 9704 gene locus_tag LOCUS_12410 10315 9704 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869529.1 protein_id gnl|my_center|LOCUS_12410 10953 10312 gene locus_tag LOCUS_12420 gene cmk 10953 10312 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640590.1 protein_id gnl|my_center|LOCUS_12420 11092 12933 gene locus_tag LOCUS_12430 11092 12933 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453777.1 protein_id gnl|my_center|LOCUS_12430 13874 12978 gene locus_tag LOCUS_12440 gene thiL 13874 12978 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_12440 14727 13864 gene locus_tag LOCUS_12450 14727 13864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 14928 16310 gene locus_tag LOCUS_12460 14928 16310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 16443 19025 gene locus_tag LOCUS_12470 16443 19025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence042 2295 1180 gene locus_tag LOCUS_12480 2295 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 3412 2288 gene locus_tag LOCUS_12490 3412 2288 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942549.1 protein_id gnl|my_center|LOCUS_12490 3622 4746 gene locus_tag LOCUS_12500 3622 4746 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_12500 4783 5193 gene locus_tag LOCUS_12510 gene rplQ 4783 5193 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531439.1 protein_id gnl|my_center|LOCUS_12510 5338 6264 gene locus_tag LOCUS_12520 gene fabD 5338 6264 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_12520 7425 6730 gene locus_tag LOCUS_12530 7425 6730 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258011.1 protein_id gnl|my_center|LOCUS_12530 8722 7412 gene locus_tag LOCUS_12540 8722 7412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 9058 10170 gene locus_tag LOCUS_12550 9058 10170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 10167 11603 gene locus_tag LOCUS_12560 10167 11603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 11603 12469 gene locus_tag LOCUS_12570 11603 12469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 12573 14555 gene locus_tag LOCUS_12580 12573 14555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 14639 15889 gene locus_tag LOCUS_12590 14639 15889 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230206.1 protein_id gnl|my_center|LOCUS_12590 17626 16049 gene locus_tag LOCUS_12600 17626 16049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 18503 17817 gene locus_tag LOCUS_12610 18503 17817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 18627 19637 gene locus_tag LOCUS_12620 18627 19637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 >Feature sequence043 61 951 gene locus_tag LOCUS_12630 61 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 1269 1194 gene locus_tag LOCUS_t00290 1269 1194 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1786 1355 gene locus_tag LOCUS_12640 1786 1355 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107647.1 protein_id gnl|my_center|LOCUS_12640 2251 1826 gene locus_tag LOCUS_12650 2251 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 2579 2292 gene locus_tag LOCUS_12660 2579 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12660 2913 2611 gene locus_tag LOCUS_12670 2913 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 2999 3808 gene locus_tag LOCUS_12680 gene mazG 2999 3808 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383231.1 protein_id gnl|my_center|LOCUS_12680 4150 3821 gene locus_tag LOCUS_12690 4150 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 4276 5334 gene locus_tag LOCUS_12700 4276 5334 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_12700 5911 6630 gene locus_tag LOCUS_12710 5911 6630 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047987.1 protein_id gnl|my_center|LOCUS_12710 6662 7867 gene locus_tag LOCUS_12720 gene lpxK 6662 7867 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_12720 7999 8538 gene locus_tag LOCUS_12730 7999 8538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 8942 13270 gene locus_tag LOCUS_12740 8942 13270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 13397 13930 gene locus_tag LOCUS_12750 13397 13930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 13964 15466 gene locus_tag LOCUS_12760 13964 15466 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785160.1 protein_id gnl|my_center|LOCUS_12760 15997 16143 gene locus_tag LOCUS_12770 15997 16143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 16556 16413 gene locus_tag LOCUS_12780 16556 16413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 16681 16690 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16826 17707 gene locus_tag LOCUS_12790 16826 17707 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203408.1 protein_id gnl|my_center|LOCUS_12790 18536 17802 gene locus_tag LOCUS_12800 18536 17802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 18771 19340 gene locus_tag LOCUS_12810 18771 19340 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568299.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence044 2021 93 gene locus_tag LOCUS_12820 2021 93 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265628.1 protein_id gnl|my_center|LOCUS_12820 2381 4996 gene locus_tag LOCUS_12830 2381 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 8304 5128 gene locus_tag LOCUS_12840 8304 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 9643 8432 gene locus_tag LOCUS_12850 9643 8432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 12204 9652 gene locus_tag LOCUS_12860 12204 9652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 13220 12237 gene locus_tag LOCUS_12870 13220 12237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 14129 14138 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15092 14283 gene locus_tag LOCUS_12880 15092 14283 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_12880 15237 16328 gene locus_tag LOCUS_12890 gene pta 15237 16328 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023515.1 protein_id gnl|my_center|LOCUS_12890 17286 16282 gene locus_tag LOCUS_12900 17286 16282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 17192 17383 gene locus_tag LOCUS_12910 17192 17383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 17722 17393 gene locus_tag LOCUS_12920 17722 17393 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882762.1 protein_id gnl|my_center|LOCUS_12920 17820 18695 gene locus_tag LOCUS_12930 17820 18695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 18828 18903 gene locus_tag LOCUS_t00300 18828 18903 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 18939 19015 gene locus_tag LOCUS_t00310 18939 19015 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence045 549 1292 gene locus_tag LOCUS_12940 549 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 1289 1579 gene locus_tag LOCUS_12950 1289 1579 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921449.1 protein_id gnl|my_center|LOCUS_12950 1714 2268 gene locus_tag LOCUS_12960 gene grpE 1714 2268 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_12960 2293 3450 gene locus_tag LOCUS_12970 gene dnaJ 2293 3450 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262455.1 protein_id gnl|my_center|LOCUS_12970 3473 4210 gene locus_tag LOCUS_12980 gene rsmE 3473 4210 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261219.1 protein_id gnl|my_center|LOCUS_12980 4231 5223 gene locus_tag LOCUS_12990 4231 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 6843 5236 gene locus_tag LOCUS_13000 6843 5236 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767406.1 protein_id gnl|my_center|LOCUS_13000 8046 7111 gene locus_tag LOCUS_13010 8046 7111 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258542.1 protein_id gnl|my_center|LOCUS_13010 9381 8086 gene locus_tag LOCUS_13020 9381 8086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 10801 9425 gene locus_tag LOCUS_13030 10801 9425 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_13030 11389 10805 gene locus_tag LOCUS_13040 11389 10805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 11470 12135 gene locus_tag LOCUS_13050 11470 12135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 12873 12151 gene locus_tag LOCUS_13060 12873 12151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 13838 12888 gene locus_tag LOCUS_13070 13838 12888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 13921 14850 gene locus_tag LOCUS_13080 13921 14850 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546354.1 protein_id gnl|my_center|LOCUS_13080 14984 15589 gene locus_tag LOCUS_13090 14984 15589 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311165.1 protein_id gnl|my_center|LOCUS_13090 15731 16957 gene locus_tag LOCUS_13100 15731 16957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 17244 17834 gene locus_tag LOCUS_13110 gene hisB 17244 17834 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083477.1 protein_id gnl|my_center|LOCUS_13110 17840 18448 gene locus_tag LOCUS_13120 gene hisH 17840 18448 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207858.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence046 268 978 gene locus_tag LOCUS_13130 268 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1017 1355 gene locus_tag LOCUS_13140 gene rplV 1017 1355 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083595.1 protein_id gnl|my_center|LOCUS_13140 1395 2084 gene locus_tag LOCUS_13150 gene rpsC 1395 2084 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390432.1 protein_id gnl|my_center|LOCUS_13150 2146 2559 gene locus_tag LOCUS_13160 gene rplP 2146 2559 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_13160 2574 2777 gene locus_tag LOCUS_13170 2574 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 2826 3098 gene locus_tag LOCUS_13180 gene rpsQ 2826 3098 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963461.1 protein_id gnl|my_center|LOCUS_13180 3136 3501 gene locus_tag LOCUS_13190 gene rplN 3136 3501 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081816.1 protein_id gnl|my_center|LOCUS_13190 4961 4119 gene locus_tag LOCUS_13200 4961 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 7652 4980 gene locus_tag LOCUS_13210 7652 4980 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933216.1 protein_id gnl|my_center|LOCUS_13210 10127 7806 gene locus_tag LOCUS_13220 gene galB 10127 7806 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109366.1 protein_id gnl|my_center|LOCUS_13220 10766 10398 gene locus_tag LOCUS_13230 10766 10398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 12217 11063 gene locus_tag LOCUS_13240 12217 11063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 12387 13085 gene locus_tag LOCUS_13250 12387 13085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 13141 13791 gene locus_tag LOCUS_13260 13141 13791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 13816 14247 gene locus_tag LOCUS_13270 13816 14247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 14267 15031 gene locus_tag LOCUS_13280 14267 15031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 15738 15295 gene locus_tag LOCUS_13290 15738 15295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 16015 15752 gene locus_tag LOCUS_13300 16015 15752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 16598 16095 gene locus_tag LOCUS_13310 16598 16095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 17139 16834 gene locus_tag LOCUS_13320 17139 16834 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871614.1 protein_id gnl|my_center|LOCUS_13320 17334 18239 gene locus_tag LOCUS_13330 gene rnhC 17334 18239 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872309.1 protein_id gnl|my_center|LOCUS_13330 >Feature sequence047 <1 777 gene locus_tag LOCUS_13340 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202637.1:carboxymuconolactone decarboxylase family protein 974 1531 gene locus_tag LOCUS_13350 974 1531 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789913.1 protein_id gnl|my_center|LOCUS_13350 2179 1694 gene locus_tag LOCUS_13360 2179 1694 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183068.1 protein_id gnl|my_center|LOCUS_13360 2413 2865 gene locus_tag LOCUS_13370 2413 2865 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761472.1 protein_id gnl|my_center|LOCUS_13370 4398 2935 gene locus_tag LOCUS_13380 4398 2935 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109383.1 protein_id gnl|my_center|LOCUS_13380 6114 4729 gene locus_tag LOCUS_13390 6114 4729 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761372.1 protein_id gnl|my_center|LOCUS_13390 6292 6738 gene locus_tag LOCUS_13400 6292 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 6885 9026 gene locus_tag LOCUS_13410 6885 9026 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202540.1 protein_id gnl|my_center|LOCUS_13410 10232 9282 gene locus_tag LOCUS_13420 10232 9282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 10270 11229 gene locus_tag LOCUS_13430 gene rfbD 10270 11229 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929228.1 protein_id gnl|my_center|LOCUS_13430 11226 12527 gene locus_tag LOCUS_13440 11226 12527 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039292.1 protein_id gnl|my_center|LOCUS_13440 12616 15084 gene locus_tag LOCUS_13450 12616 15084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 15380 15099 gene locus_tag LOCUS_13460 15380 15099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 16896 15712 gene locus_tag LOCUS_13470 16896 15712 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929520.1 protein_id gnl|my_center|LOCUS_13470 17082 17825 gene locus_tag LOCUS_13480 17082 17825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence048 1314 160 gene locus_tag LOCUS_13490 1314 160 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993669.1 protein_id gnl|my_center|LOCUS_13490 5355 1774 gene locus_tag LOCUS_13500 5355 1774 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121781.1 protein_id gnl|my_center|LOCUS_13500 6510 5515 gene locus_tag LOCUS_13510 6510 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 6959 6510 gene locus_tag LOCUS_13520 6959 6510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 7091 7342 gene locus_tag LOCUS_13530 7091 7342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 7346 7355 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7510 9744 gene locus_tag LOCUS_13540 gene katE 7510 9744 CDS product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077853.1 protein_id gnl|my_center|LOCUS_13540 10044 9970 gene locus_tag LOCUS_t00320 10044 9970 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 12891 10240 gene locus_tag LOCUS_13550 12891 10240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 13557 12982 gene locus_tag LOCUS_13560 13557 12982 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783570.1 protein_id gnl|my_center|LOCUS_13560 13858 14454 gene locus_tag LOCUS_13570 13858 14454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 15173 14529 gene locus_tag LOCUS_13580 15173 14529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 17583 15178 gene locus_tag LOCUS_13590 17583 15178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence049 694 53 gene locus_tag LOCUS_13600 gene fabG 694 53 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225891.1 protein_id gnl|my_center|LOCUS_13600 2488 731 gene locus_tag LOCUS_13610 2488 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 5256 2665 gene locus_tag LOCUS_13620 5256 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 6103 5264 gene locus_tag LOCUS_13630 gene folP 6103 5264 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809626.1 protein_id gnl|my_center|LOCUS_13630 6168 6683 gene locus_tag LOCUS_13640 6168 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 7780 6956 gene locus_tag LOCUS_13650 gene pssA 7780 6956 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770492.1 protein_id gnl|my_center|LOCUS_13650 10641 7813 gene locus_tag LOCUS_13660 gene alaS 10641 7813 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931860.1 protein_id gnl|my_center|LOCUS_13660 10775 11797 gene locus_tag LOCUS_13670 10775 11797 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 protein_id gnl|my_center|LOCUS_13670 11794 13554 gene locus_tag LOCUS_13680 11794 13554 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812261.1 protein_id gnl|my_center|LOCUS_13680 13551 14657 gene locus_tag LOCUS_13690 13551 14657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 14662 15774 gene locus_tag LOCUS_13700 14662 15774 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937438.1 protein_id gnl|my_center|LOCUS_13700 15927 16001 gene locus_tag LOCUS_t00330 15927 16001 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 17111 16266 gene locus_tag LOCUS_13710 17111 16266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 >Feature sequence050 5449 7074 gene locus_tag LOCUS_13720 5449 7074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 7087 7953 gene locus_tag LOCUS_13730 7087 7953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 8047 8799 gene locus_tag LOCUS_13740 gene lpxA 8047 8799 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071796.1 protein_id gnl|my_center|LOCUS_13740 8804 9505 gene locus_tag LOCUS_13750 8804 9505 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937441.1 protein_id gnl|my_center|LOCUS_13750 10916 9663 gene locus_tag LOCUS_13760 10916 9663 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004137617.1 protein_id gnl|my_center|LOCUS_13760 13525 10934 gene locus_tag LOCUS_13770 13525 10934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 13839 14759 gene locus_tag LOCUS_13780 13839 14759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 14756 15928 gene locus_tag LOCUS_13790 14756 15928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 17007 16195 gene locus_tag LOCUS_13800 17007 16195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 >Feature sequence051 103 516 gene locus_tag LOCUS_13810 103 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 540 1049 gene locus_tag LOCUS_13820 540 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1087 3519 gene locus_tag LOCUS_13830 1087 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 3536 5707 gene locus_tag LOCUS_13840 3536 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 5802 6608 gene locus_tag LOCUS_13850 5802 6608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 7004 8203 gene locus_tag LOCUS_13860 gene kbl 7004 8203 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213823.1 protein_id gnl|my_center|LOCUS_13860 8239 10857 gene locus_tag LOCUS_13870 8239 10857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 11020 11790 gene locus_tag LOCUS_13880 11020 11790 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257306.1 protein_id gnl|my_center|LOCUS_13880 12030 14120 gene locus_tag LOCUS_13890 12030 14120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 13890 13899 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14038 14769 gene locus_tag LOCUS_13900 14038 14769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 14855 15433 gene locus_tag LOCUS_13910 14855 15433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 16222 15749 gene locus_tag LOCUS_13920 16222 15749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 >Feature sequence052 1439 603 gene locus_tag LOCUS_13930 1439 603 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_13930 2612 1464 gene locus_tag LOCUS_13940 2612 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 2707 4065 gene locus_tag LOCUS_13950 gene gltX 2707 4065 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869827.1 protein_id gnl|my_center|LOCUS_13950 4295 6730 gene locus_tag LOCUS_13960 4295 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 6757 7167 gene locus_tag LOCUS_13970 gene queF 6757 7167 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938262.1 protein_id gnl|my_center|LOCUS_13970 7176 7847 gene locus_tag LOCUS_13980 gene queC 7176 7847 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061849.1 protein_id gnl|my_center|LOCUS_13980 8531 7911 gene locus_tag LOCUS_13990 gene tmk 8531 7911 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039005.1 protein_id gnl|my_center|LOCUS_13990 9898 8528 gene locus_tag LOCUS_14000 9898 8528 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404676.1 protein_id gnl|my_center|LOCUS_14000 10440 10727 gene locus_tag LOCUS_14010 10440 10727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 10751 11443 gene locus_tag LOCUS_14020 10751 11443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 11581 12828 gene locus_tag LOCUS_14030 gene icd 11581 12828 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479852.1 protein_id gnl|my_center|LOCUS_14030 14033 12912 gene locus_tag LOCUS_14040 14033 12912 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764020.1 protein_id gnl|my_center|LOCUS_14040 14174 14458 gene locus_tag LOCUS_14050 14174 14458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 <16776 15078 gene locus_tag LOCUS_14060 <16776 15078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004528780.1:copper-containing nitrite reductase >Feature sequence053 226 1416 gene locus_tag LOCUS_14070 226 1416 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462130.1 protein_id gnl|my_center|LOCUS_14070 2570 1425 gene locus_tag LOCUS_14080 2570 1425 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794948.1 protein_id gnl|my_center|LOCUS_14080 3073 2660 gene locus_tag LOCUS_14090 gene mscL 3073 2660 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948242.1 protein_id gnl|my_center|LOCUS_14090 3262 4518 gene locus_tag LOCUS_14100 3262 4518 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_14100 4546 5004 gene locus_tag LOCUS_14110 4546 5004 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545228.1 protein_id gnl|my_center|LOCUS_14110 5128 5694 gene locus_tag LOCUS_14120 gene efp 5128 5694 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720643.1 protein_id gnl|my_center|LOCUS_14120 6741 5800 gene locus_tag LOCUS_14130 6741 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 6921 9173 gene locus_tag LOCUS_14140 6921 9173 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_14140 10886 9204 gene locus_tag LOCUS_14150 gene recN 10886 9204 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_14150 10915 11700 gene locus_tag LOCUS_14160 10915 11700 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_14160 11723 12517 gene locus_tag LOCUS_14170 11723 12517 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920874.1 protein_id gnl|my_center|LOCUS_14170 12621 13370 gene locus_tag LOCUS_14180 12621 13370 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016732.1 protein_id gnl|my_center|LOCUS_14180 13418 13801 gene locus_tag LOCUS_14190 13418 13801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 13880 14209 gene locus_tag LOCUS_14200 13880 14209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 14244 14432 gene locus_tag LOCUS_14210 14244 14432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 15387 14524 gene locus_tag LOCUS_14220 gene lpxI 15387 14524 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_14220 16690 15416 gene locus_tag LOCUS_14230 16690 15416 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089073.1 protein_id gnl|my_center|LOCUS_14230 >Feature sequence054 1648 260 gene locus_tag LOCUS_14240 1648 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 3105 1648 gene locus_tag LOCUS_14250 gene ftsZ 3105 1648 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546805.1 protein_id gnl|my_center|LOCUS_14250 4342 3131 gene locus_tag LOCUS_14260 gene ftsA 4342 3131 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073897.1 protein_id gnl|my_center|LOCUS_14260 5063 4458 gene locus_tag LOCUS_14270 5063 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 7059 5104 gene locus_tag LOCUS_14280 7059 5104 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_14280 8949 7165 gene locus_tag LOCUS_14290 8949 7165 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938960.1 protein_id gnl|my_center|LOCUS_14290 10793 8943 gene locus_tag LOCUS_14300 gene msbA 10793 8943 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_14300 10973 12379 gene locus_tag LOCUS_14310 10973 12379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 12455 13255 gene locus_tag LOCUS_14320 12455 13255 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815039.1 protein_id gnl|my_center|LOCUS_14320 13271 14089 gene locus_tag LOCUS_14330 13271 14089 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_14330 14108 15112 gene locus_tag LOCUS_14340 14108 15112 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545262.1 protein_id gnl|my_center|LOCUS_14340 15256 15582 gene locus_tag LOCUS_14350 15256 15582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 15652 16098 gene locus_tag LOCUS_14360 15652 16098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 16098 16442 gene locus_tag LOCUS_14370 16098 16442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence055 698 608 gene locus_tag LOCUS_t00340 698 608 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1387 2325 gene locus_tag LOCUS_14380 gene ruvB 1387 2325 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814231.1 protein_id gnl|my_center|LOCUS_14380 1684 1693 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2447 3466 gene locus_tag LOCUS_14390 2447 3466 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545989.1 protein_id gnl|my_center|LOCUS_14390 3496 4626 gene locus_tag LOCUS_14400 3496 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 5996 4932 gene locus_tag LOCUS_14410 5996 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 6371 7843 gene locus_tag LOCUS_14420 6371 7843 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048253.1 protein_id gnl|my_center|LOCUS_14420 7848 9191 gene locus_tag LOCUS_14430 gene lplT 7848 9191 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703329.1 protein_id gnl|my_center|LOCUS_14430 9348 9941 gene locus_tag LOCUS_14440 9348 9941 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036141.1 protein_id gnl|my_center|LOCUS_14440 10086 11234 gene locus_tag LOCUS_14450 gene nagA 10086 11234 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080848.1 protein_id gnl|my_center|LOCUS_14450 11768 11304 gene locus_tag LOCUS_14460 11768 11304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 11695 12348 gene locus_tag LOCUS_14470 11695 12348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 11717 11726 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12412 12975 gene locus_tag LOCUS_14480 12412 12975 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987052.1 protein_id gnl|my_center|LOCUS_14480 14131 13055 gene locus_tag LOCUS_14490 14131 13055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 >Feature sequence056 1465 683 gene locus_tag LOCUS_14500 1465 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 1659 2162 gene locus_tag LOCUS_14510 1659 2162 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036141.1 protein_id gnl|my_center|LOCUS_14510 2243 4237 gene locus_tag LOCUS_14520 2243 4237 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_14520 5344 4430 gene locus_tag LOCUS_14530 5344 4430 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234873.1 protein_id gnl|my_center|LOCUS_14530 5681 5349 gene locus_tag LOCUS_14540 5681 5349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 7101 5686 gene locus_tag LOCUS_14550 gene cysS 7101 5686 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873400.1 protein_id gnl|my_center|LOCUS_14550 8767 7223 gene locus_tag LOCUS_14560 8767 7223 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109236.1 protein_id gnl|my_center|LOCUS_14560 10637 8892 gene locus_tag LOCUS_14570 10637 8892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 12152 10869 gene locus_tag LOCUS_14580 12152 10869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 14321 12522 gene locus_tag LOCUS_14590 gene lepA 14321 12522 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816487.1 protein_id gnl|my_center|LOCUS_14590 14569 14772 gene locus_tag LOCUS_14600 14569 14772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence057 2287 1511 gene locus_tag LOCUS_14610 2287 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 2481 4301 gene locus_tag LOCUS_14620 2481 4301 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_14620 4642 6801 gene locus_tag LOCUS_14630 4642 6801 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119288.1 protein_id gnl|my_center|LOCUS_14630 6810 7442 gene locus_tag LOCUS_14640 6810 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 8439 7474 gene locus_tag LOCUS_14650 8439 7474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 11641 8795 gene locus_tag LOCUS_14660 gene gcvP 11641 8795 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115850.1 protein_id gnl|my_center|LOCUS_14660 12117 11737 gene locus_tag LOCUS_14670 gene gcvH 12117 11737 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001355634.1 protein_id gnl|my_center|LOCUS_14670 13273 12188 gene locus_tag LOCUS_14680 gene gcvT 13273 12188 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631769.1 protein_id gnl|my_center|LOCUS_14680 14470 13349 gene locus_tag LOCUS_14690 gene ychF 14470 13349 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815179.1 protein_id gnl|my_center|LOCUS_14690 <15126 14529 gene locus_tag LOCUS_14700 <15126 14529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965357.1:D-alanyl-D-alanine carboxypeptidase family protein >Feature sequence058 113 1135 gene locus_tag LOCUS_14710 113 1135 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659065.1 protein_id gnl|my_center|LOCUS_14710 1517 2590 gene locus_tag LOCUS_14720 1517 2590 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888750.1 protein_id gnl|my_center|LOCUS_14720 2920 4173 gene locus_tag LOCUS_14730 2920 4173 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963345.1 protein_id gnl|my_center|LOCUS_14730 4193 5764 gene locus_tag LOCUS_14740 gene serA 4193 5764 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_14740 5909 6958 gene locus_tag LOCUS_14750 5909 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 7065 7748 gene locus_tag LOCUS_14760 7065 7748 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761795.1 protein_id gnl|my_center|LOCUS_14760 9819 7840 gene locus_tag LOCUS_14770 9819 7840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 10626 9871 gene locus_tag LOCUS_14780 10626 9871 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904156.1 protein_id gnl|my_center|LOCUS_14780 11163 12593 gene locus_tag LOCUS_14790 11163 12593 CDS product cation-efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939066.1 protein_id gnl|my_center|LOCUS_14790 14445 12700 gene locus_tag LOCUS_14800 14445 12700 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940935.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence059 173 1702 gene locus_tag LOCUS_14810 173 1702 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016681.1 protein_id gnl|my_center|LOCUS_14810 1792 1995 gene locus_tag LOCUS_14820 1792 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 2304 3161 gene locus_tag LOCUS_14830 2304 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 3840 3187 gene locus_tag LOCUS_14840 3840 3187 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095644.1 protein_id gnl|my_center|LOCUS_14840 4648 3869 gene locus_tag LOCUS_14850 4648 3869 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_14850 4805 5260 gene locus_tag LOCUS_14860 4805 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 5270 6832 gene locus_tag LOCUS_14870 5270 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 6855 7199 gene locus_tag LOCUS_14880 6855 7199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 7216 9315 gene locus_tag LOCUS_14890 7216 9315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 9323 10828 gene locus_tag LOCUS_14900 9323 10828 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_14900 10851 12224 gene locus_tag LOCUS_14910 10851 12224 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246696.1 protein_id gnl|my_center|LOCUS_14910 12230 13333 gene locus_tag LOCUS_14920 gene mraY 12230 13333 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769458.1 protein_id gnl|my_center|LOCUS_14920 13346 14656 gene locus_tag LOCUS_14930 gene murD 13346 14656 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_14930 >Feature sequence060 489 1211 gene locus_tag LOCUS_14940 489 1211 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107446.1 protein_id gnl|my_center|LOCUS_14940 1340 1936 gene locus_tag LOCUS_14950 1340 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 2035 3075 gene locus_tag LOCUS_14960 gene tgt 2035 3075 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_14960 3072 3404 gene locus_tag LOCUS_14970 3072 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 3529 4380 gene locus_tag LOCUS_14980 3529 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 4391 5293 gene locus_tag LOCUS_14990 gene xerC 4391 5293 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005692390.1 protein_id gnl|my_center|LOCUS_14990 5309 5935 gene locus_tag LOCUS_15000 5309 5935 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768796.1 protein_id gnl|my_center|LOCUS_15000 6101 6343 gene locus_tag LOCUS_15010 gene rpsP 6101 6343 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813195.1 protein_id gnl|my_center|LOCUS_15010 7038 6508 gene locus_tag LOCUS_15020 7038 6508 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535019.1 protein_id gnl|my_center|LOCUS_15020 7261 8346 gene locus_tag LOCUS_15030 7261 8346 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338457.1 protein_id gnl|my_center|LOCUS_15030 8402 8746 gene locus_tag LOCUS_15040 8402 8746 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_15040 8857 9348 gene locus_tag LOCUS_15050 8857 9348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 9372 9563 gene locus_tag LOCUS_15060 gene rpmF 9372 9563 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638547.1 protein_id gnl|my_center|LOCUS_15060 9712 10761 gene locus_tag LOCUS_15070 gene plsX 9712 10761 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_15070 10767 12527 gene locus_tag LOCUS_15080 10767 12527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 12511 13008 gene locus_tag LOCUS_15090 12511 13008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 13076 13152 gene locus_tag LOCUS_t00350 13076 13152 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14216 13590 gene locus_tag LOCUS_15100 14216 13590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 14701 14318 gene locus_tag LOCUS_15110 14701 14318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence061 1663 101 gene locus_tag LOCUS_15120 1663 101 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107733.1 protein_id gnl|my_center|LOCUS_15120 2020 3243 gene locus_tag LOCUS_15130 2020 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 3266 4411 gene locus_tag LOCUS_15140 3266 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 4411 5028 gene locus_tag LOCUS_15150 4411 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 5356 5108 gene locus_tag LOCUS_15160 5356 5108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 5372 6178 gene locus_tag LOCUS_15170 5372 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 6159 6899 gene locus_tag LOCUS_15180 6159 6899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 6983 7888 gene locus_tag LOCUS_15190 gene miaA 6983 7888 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265761.1 protein_id gnl|my_center|LOCUS_15190 8200 9240 gene locus_tag LOCUS_15200 gene mnmA 8200 9240 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131114.1 protein_id gnl|my_center|LOCUS_15200 9237 10586 gene locus_tag LOCUS_15210 gene mnmE 9237 10586 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880529.1 protein_id gnl|my_center|LOCUS_15210 10852 11751 gene locus_tag LOCUS_15220 10852 11751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 11854 12078 gene locus_tag LOCUS_15230 11854 12078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 12182 12883 gene locus_tag LOCUS_15240 12182 12883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 12883 13695 gene locus_tag LOCUS_15250 12883 13695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 13692 13919 gene locus_tag LOCUS_15260 13692 13919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 13880 14098 gene locus_tag LOCUS_15270 13880 14098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 14083 14544 gene locus_tag LOCUS_15280 14083 14544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 >Feature sequence062 494 1327 gene locus_tag LOCUS_15290 494 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 1328 1681 gene locus_tag LOCUS_15300 1328 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 3073 1766 gene locus_tag LOCUS_15310 gene aroA 3073 1766 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392845.1 protein_id gnl|my_center|LOCUS_15310 4001 5278 gene locus_tag LOCUS_15320 gene murA 4001 5278 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_15320 5360 5629 gene locus_tag LOCUS_15330 5360 5629 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476580.1 protein_id gnl|my_center|LOCUS_15330 5830 6846 gene locus_tag LOCUS_15340 gene aroC 5830 6846 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_15340 6879 7772 gene locus_tag LOCUS_15350 6879 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 8415 7981 gene locus_tag LOCUS_15360 8415 7981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 9038 8559 gene locus_tag LOCUS_15370 9038 8559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 9926 9132 gene locus_tag LOCUS_15380 9926 9132 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970168.1 protein_id gnl|my_center|LOCUS_15380 10144 10836 gene locus_tag LOCUS_15390 10144 10836 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780363.1 protein_id gnl|my_center|LOCUS_15390 10882 11889 gene locus_tag LOCUS_15400 10882 11889 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_15400 12570 12016 gene locus_tag LOCUS_15410 12570 12016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 12819 13913 gene locus_tag LOCUS_15420 12819 13913 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857221.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence063 1985 378 gene locus_tag LOCUS_15430 1985 378 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050547433.1 protein_id gnl|my_center|LOCUS_15430 2777 2166 gene locus_tag LOCUS_15440 2777 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 3591 2908 gene locus_tag LOCUS_15450 3591 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 4503 3739 gene locus_tag LOCUS_15460 gene tpiA 4503 3739 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_15460 5794 4556 gene locus_tag LOCUS_15470 gene rsmB 5794 4556 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_15470 7386 5881 gene locus_tag LOCUS_15480 7386 5881 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427770.1 protein_id gnl|my_center|LOCUS_15480 8833 7541 gene locus_tag LOCUS_15490 8833 7541 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545761.1 protein_id gnl|my_center|LOCUS_15490 9727 10038 gene locus_tag LOCUS_15500 gene rpsN 9727 10038 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085703.1 protein_id gnl|my_center|LOCUS_15500 10111 10371 gene locus_tag LOCUS_15510 10111 10371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 10430 11842 gene locus_tag LOCUS_15520 10430 11842 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_15520 11847 12491 gene locus_tag LOCUS_15530 11847 12491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 12514 12870 gene locus_tag LOCUS_15540 12514 12870 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081582.1 protein_id gnl|my_center|LOCUS_15540 13808 13023 gene locus_tag LOCUS_15550 13808 13023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 <14620 13812 gene locus_tag LOCUS_15560 <14620 13812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063171746.1:uracil-DNA glycosylase >Feature sequence064 576 3077 gene locus_tag LOCUS_15570 gene uvrA 576 3077 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122979.1 protein_id gnl|my_center|LOCUS_15570 3255 4280 gene locus_tag LOCUS_15580 3255 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 4411 5553 gene locus_tag LOCUS_15590 4411 5553 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116269310.1 protein_id gnl|my_center|LOCUS_15590 7456 6203 gene locus_tag LOCUS_15600 gene argJ 7456 6203 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546755.1 protein_id gnl|my_center|LOCUS_15600 8533 7490 gene locus_tag LOCUS_15610 gene argC 8533 7490 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546077.1 protein_id gnl|my_center|LOCUS_15610 8636 8712 gene locus_tag LOCUS_t00360 8636 8712 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9160 10644 gene locus_tag LOCUS_15620 9160 10644 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476410.1 protein_id gnl|my_center|LOCUS_15620 10637 11386 gene locus_tag LOCUS_15630 10637 11386 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355616.1 protein_id gnl|my_center|LOCUS_15630 12031 11516 gene locus_tag LOCUS_15640 12031 11516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292012.1 protein_id gnl|my_center|LOCUS_15640 12222 12028 gene locus_tag LOCUS_15650 12222 12028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 13816 12434 gene locus_tag LOCUS_15660 13816 12434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence065 1345 2091 gene locus_tag LOCUS_15670 1345 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 3386 2133 gene locus_tag LOCUS_15680 gene sufD 3386 2133 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_15680 4834 3398 gene locus_tag LOCUS_15690 gene sufB 4834 3398 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329803.1 protein_id gnl|my_center|LOCUS_15690 5616 4858 gene locus_tag LOCUS_15700 gene sufC 5616 4858 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888738.1 protein_id gnl|my_center|LOCUS_15700 6072 5632 gene locus_tag LOCUS_15710 6072 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 6491 6228 gene locus_tag LOCUS_15720 gene rpmA 6491 6228 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327901.1 protein_id gnl|my_center|LOCUS_15720 6835 6518 gene locus_tag LOCUS_15730 gene rplU 6835 6518 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564642.1 protein_id gnl|my_center|LOCUS_15730 6924 7373 gene locus_tag LOCUS_15740 gene tsaE 6924 7373 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234079.1 protein_id gnl|my_center|LOCUS_15740 8200 7382 gene locus_tag LOCUS_15750 8200 7382 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401910.1 protein_id gnl|my_center|LOCUS_15750 8664 8197 gene locus_tag LOCUS_15760 8664 8197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 8920 11073 gene locus_tag LOCUS_15770 gene glaB 8920 11073 CDS product alpha-1,3-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202199.1 protein_id gnl|my_center|LOCUS_15770 12176 11955 gene locus_tag LOCUS_15780 12176 11955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 12793 13716 gene locus_tag LOCUS_15790 12793 13716 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928954.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence066 1981 71 gene locus_tag LOCUS_15800 1981 71 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_15800 2190 2822 gene locus_tag LOCUS_15810 2190 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 2836 4935 gene locus_tag LOCUS_15820 gene recG 2836 4935 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_15820 5073 5516 gene locus_tag LOCUS_15830 5073 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 8488 5624 gene locus_tag LOCUS_15840 8488 5624 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228900.1 protein_id gnl|my_center|LOCUS_15840 9575 8871 gene locus_tag LOCUS_15850 9575 8871 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228901.1 protein_id gnl|my_center|LOCUS_15850 10851 9607 gene locus_tag LOCUS_15860 10851 9607 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_15860 11185 11598 gene locus_tag LOCUS_15870 11185 11598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 12929 11817 gene locus_tag LOCUS_15880 gene aroB 12929 11817 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382321.1 protein_id gnl|my_center|LOCUS_15880 13568 13005 gene locus_tag LOCUS_15890 13568 13005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence067 104 838 gene locus_tag LOCUS_15900 104 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 873 2444 gene locus_tag LOCUS_15910 873 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 2473 4527 gene locus_tag LOCUS_15920 2473 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 4541 5320 gene locus_tag LOCUS_15930 4541 5320 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480305.1 protein_id gnl|my_center|LOCUS_15930 5337 6308 gene locus_tag LOCUS_15940 5337 6308 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_15940 6682 7839 gene locus_tag LOCUS_15950 gene pheA 6682 7839 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_15950 7885 9501 gene locus_tag LOCUS_15960 7885 9501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 9526 11910 gene locus_tag LOCUS_15970 gene ligA 9526 11910 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114675.1 protein_id gnl|my_center|LOCUS_15970 12088 12696 gene locus_tag LOCUS_15980 12088 12696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 >Feature sequence068 3 221 gene locus_tag LOCUS_15990 3 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 780 1790 gene locus_tag LOCUS_16000 780 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 2393 3748 gene locus_tag LOCUS_16010 gene gdhA 2393 3748 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_16010 5246 4128 gene locus_tag LOCUS_16020 gene lpxB 5246 4128 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_16020 5357 6031 gene locus_tag LOCUS_16030 5357 6031 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943605.1 protein_id gnl|my_center|LOCUS_16030 6046 6561 gene locus_tag LOCUS_16040 6046 6561 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_16040 6923 6579 gene locus_tag LOCUS_16050 6923 6579 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943454.1 protein_id gnl|my_center|LOCUS_16050 7577 7206 gene locus_tag LOCUS_16060 7577 7206 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943454.1 protein_id gnl|my_center|LOCUS_16060 8233 7730 gene locus_tag LOCUS_16070 8233 7730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 8407 8481 gene locus_tag LOCUS_t00370 8407 8481 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8644 9855 gene locus_tag LOCUS_16080 8644 9855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 12578 9852 gene locus_tag LOCUS_16090 12578 9852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 13160 12582 gene locus_tag LOCUS_16100 13160 12582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 13502 13167 gene locus_tag LOCUS_16110 13502 13167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 >Feature sequence069 1143 2075 gene locus_tag LOCUS_16120 1143 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 3258 2185 gene locus_tag LOCUS_16130 3258 2185 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879940.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16130 3507 3274 gene locus_tag LOCUS_16140 3507 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16140 3692 4681 gene locus_tag LOCUS_16150 3692 4681 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048017.1 protein_id gnl|my_center|LOCUS_16150 4825 6975 gene locus_tag LOCUS_16160 4825 6975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 6985 8904 gene locus_tag LOCUS_16170 6985 8904 CDS product NPCBM/NEW2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615476.1 protein_id gnl|my_center|LOCUS_16170 8984 11371 gene locus_tag LOCUS_16180 8984 11371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 11716 12363 gene locus_tag LOCUS_16190 11716 12363 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058035.1 protein_id gnl|my_center|LOCUS_16190 13152 12376 gene locus_tag LOCUS_16200 13152 12376 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017868968.1 protein_id gnl|my_center|LOCUS_16200 >Feature sequence070 2475 991 gene locus_tag LOCUS_16210 2475 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 3237 2749 gene locus_tag LOCUS_16220 3237 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 3393 3605 gene locus_tag LOCUS_16230 3393 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 3602 3739 gene locus_tag LOCUS_16240 3602 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 4074 5165 gene locus_tag LOCUS_16250 gene hisC 4074 5165 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_16250 5198 5845 gene locus_tag LOCUS_16260 5198 5845 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058035.1 protein_id gnl|my_center|LOCUS_16260 6217 8487 gene locus_tag LOCUS_16270 6217 8487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 9408 8677 gene locus_tag LOCUS_16280 9408 8677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 9596 9997 gene locus_tag LOCUS_16290 9596 9997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 11041 10094 gene locus_tag LOCUS_16300 11041 10094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 11507 11166 gene locus_tag LOCUS_16310 11507 11166 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225637.1 protein_id gnl|my_center|LOCUS_16310 12045 11500 gene locus_tag LOCUS_16320 12045 11500 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706346.1 protein_id gnl|my_center|LOCUS_16320 13239 12067 gene locus_tag LOCUS_16330 13239 12067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 >Feature sequence071 165 1268 gene locus_tag LOCUS_16340 165 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 2169 1270 gene locus_tag LOCUS_16350 2169 1270 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554743.1 protein_id gnl|my_center|LOCUS_16350 3659 2166 gene locus_tag LOCUS_16360 3659 2166 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933195.1 protein_id gnl|my_center|LOCUS_16360 5677 3890 gene locus_tag LOCUS_16370 5677 3890 CDS product ClcB-like voltage-gated chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192418.1 protein_id gnl|my_center|LOCUS_16370 5704 5877 gene locus_tag LOCUS_16380 5704 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 6641 5847 gene locus_tag LOCUS_16390 6641 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 6863 8860 gene locus_tag LOCUS_16400 6863 8860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 9664 9185 gene locus_tag LOCUS_16410 9664 9185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 12294 9718 gene locus_tag LOCUS_16420 12294 9718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence072 6908 1386 gene locus_tag LOCUS_16430 gene uvrA 6908 1386 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814283.1 protein_id gnl|my_center|LOCUS_16430 7125 10478 gene locus_tag LOCUS_16440 gene secA 7125 10478 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932908.1 protein_id gnl|my_center|LOCUS_16440 10554 11654 gene locus_tag LOCUS_16450 10554 11654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 >Feature sequence073 92 823 gene locus_tag LOCUS_16460 92 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 1070 2002 gene locus_tag LOCUS_16470 gene aroE 1070 2002 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257813.1 protein_id gnl|my_center|LOCUS_16470 1995 3020 gene locus_tag LOCUS_16480 gene mutY 1995 3020 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_16480 3017 3598 gene locus_tag LOCUS_16490 gene aat 3017 3598 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259206.1 protein_id gnl|my_center|LOCUS_16490 6796 4052 gene locus_tag LOCUS_16500 gene ppdK 6796 4052 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933346.1 protein_id gnl|my_center|LOCUS_16500 8715 7168 gene locus_tag LOCUS_16510 8715 7168 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941965.1 protein_id gnl|my_center|LOCUS_16510 9819 8731 gene locus_tag LOCUS_16520 9819 8731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 10853 9915 gene locus_tag LOCUS_16530 10853 9915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 11453 11010 gene locus_tag LOCUS_16540 11453 11010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 11452 11730 gene locus_tag LOCUS_16550 11452 11730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 >Feature sequence074 199 780 gene locus_tag LOCUS_16560 gene nuoB 199 780 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403172.1 protein_id gnl|my_center|LOCUS_16560 826 1410 gene locus_tag LOCUS_16570 826 1410 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403173.1 protein_id gnl|my_center|LOCUS_16570 1446 2246 gene locus_tag LOCUS_16580 1446 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 2243 2554 gene locus_tag LOCUS_16590 2243 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 2567 3697 gene locus_tag LOCUS_16600 2567 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 3983 6754 gene locus_tag LOCUS_16610 3983 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 10510 7052 gene locus_tag LOCUS_16620 10510 7052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 11377 10904 gene locus_tag LOCUS_16630 11377 10904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence075 9302 8469 gene locus_tag LOCUS_16640 9302 8469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 10028 9441 gene locus_tag LOCUS_16650 gene purN 10028 9441 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_16650 10110 11219 gene locus_tag LOCUS_16660 10110 11219 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence076 2505 634 gene locus_tag LOCUS_16670 2505 634 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873546.1 protein_id gnl|my_center|LOCUS_16670 2872 3480 gene locus_tag LOCUS_16680 2872 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 4953 3595 gene locus_tag LOCUS_16690 gene rimO 4953 3595 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_16690 6416 4980 gene locus_tag LOCUS_16700 6416 4980 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230024.1 protein_id gnl|my_center|LOCUS_16700 6596 8395 gene locus_tag LOCUS_16710 gene dnaG 6596 8395 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943711.1 protein_id gnl|my_center|LOCUS_16710 8455 10521 gene locus_tag LOCUS_16720 8455 10521 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883393.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence077 640 822 gene locus_tag LOCUS_16730 640 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 2625 832 gene locus_tag LOCUS_16740 gene aspS 2625 832 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229758.1 protein_id gnl|my_center|LOCUS_16740 3872 2661 gene locus_tag LOCUS_16750 gene hisS 3872 2661 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222811.1 protein_id gnl|my_center|LOCUS_16750 4482 5165 gene locus_tag LOCUS_16760 gene hypB 4482 5165 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940974.1 protein_id gnl|my_center|LOCUS_16760 5146 7473 gene locus_tag LOCUS_16770 gene hypF 5146 7473 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_16770 7477 7719 gene locus_tag LOCUS_16780 7477 7719 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250951.1 protein_id gnl|my_center|LOCUS_16780 7753 8820 gene locus_tag LOCUS_16790 gene hypD 7753 8820 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_16790 8825 9859 gene locus_tag LOCUS_16800 gene hypE 8825 9859 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893646.1 protein_id gnl|my_center|LOCUS_16800 <11144 10017 gene locus_tag LOCUS_16810 <11144 10017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_149496819.1:SEL1-like repeat protein >Feature sequence078 933 502 gene locus_tag LOCUS_16820 933 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 1900 974 gene locus_tag LOCUS_16830 1900 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 2627 1920 gene locus_tag LOCUS_16840 2627 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 2988 3782 gene locus_tag LOCUS_16850 2988 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 4908 3988 gene locus_tag LOCUS_16860 4908 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 5805 5134 gene locus_tag LOCUS_16870 5805 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 5970 6701 gene locus_tag LOCUS_16880 5970 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 6848 7810 gene locus_tag LOCUS_16890 6848 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 8059 10440 gene locus_tag LOCUS_16900 gene secDF 8059 10440 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531306.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence079 201 662 gene locus_tag LOCUS_16910 201 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 739 1254 gene locus_tag LOCUS_16920 739 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 3154 1454 gene locus_tag LOCUS_16930 3154 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 5536 3317 gene locus_tag LOCUS_16940 gene prc 5536 3317 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650135.1 protein_id gnl|my_center|LOCUS_16940 6062 7024 gene locus_tag LOCUS_16950 gene cdsA 6062 7024 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173216.1 protein_id gnl|my_center|LOCUS_16950 7061 9646 gene locus_tag LOCUS_16960 gene hrpB 7061 9646 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942482.1 protein_id gnl|my_center|LOCUS_16960 9761 10825 gene locus_tag LOCUS_16970 9761 10825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence080 75 1739 gene locus_tag LOCUS_16980 gene glgP 75 1739 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871155.1 protein_id gnl|my_center|LOCUS_16980 2611 1841 gene locus_tag LOCUS_16990 2611 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 2979 2620 gene locus_tag LOCUS_17000 2979 2620 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760124.1 protein_id gnl|my_center|LOCUS_17000 4553 3147 gene locus_tag LOCUS_17010 4553 3147 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_17010 5357 5058 gene locus_tag LOCUS_17020 5357 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 6713 5415 gene locus_tag LOCUS_17030 6713 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 8264 6861 gene locus_tag LOCUS_17040 8264 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 8623 8468 gene locus_tag LOCUS_17050 8623 8468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 9464 8745 gene locus_tag LOCUS_17060 gene trmD 9464 8745 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686892.1 protein_id gnl|my_center|LOCUS_17060 10466 9477 gene locus_tag LOCUS_17070 gene prfB 10466 9477 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096948712.1 protein_id gnl|my_center|LOCUS_17070 >Feature sequence081 196 1803 gene locus_tag LOCUS_17080 gene fumA 196 1803 CDS product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167385.1 protein_id gnl|my_center|LOCUS_17080 2476 1940 gene locus_tag LOCUS_17090 2476 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 2652 3104 gene locus_tag LOCUS_17100 2652 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 3959 3201 gene locus_tag LOCUS_17110 3959 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 4571 4080 gene locus_tag LOCUS_17120 4571 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17120 5730 4552 gene locus_tag LOCUS_17130 5730 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17130 4686 4695 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7352 5859 gene locus_tag LOCUS_17140 gene ffh 7352 5859 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392481.1 protein_id gnl|my_center|LOCUS_17140 7401 8336 gene locus_tag LOCUS_17150 gene nadA 7401 8336 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056086.1 protein_id gnl|my_center|LOCUS_17150 8353 9375 gene locus_tag LOCUS_17160 8353 9375 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189567.1 protein_id gnl|my_center|LOCUS_17160 >Feature sequence082 1683 121 gene locus_tag LOCUS_17170 1683 121 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121424.1 protein_id gnl|my_center|LOCUS_17170 3357 1750 gene locus_tag LOCUS_17180 3357 1750 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723607.1 protein_id gnl|my_center|LOCUS_17180 4117 3368 gene locus_tag LOCUS_17190 gene kdsB 4117 3368 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317470.1 protein_id gnl|my_center|LOCUS_17190 5758 4211 gene locus_tag LOCUS_17200 5758 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 5886 5811 gene locus_tag LOCUS_t00380 5886 5811 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7254 6181 gene locus_tag LOCUS_17210 7254 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 8373 7279 gene locus_tag LOCUS_17220 8373 7279 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_17220 9481 8399 gene locus_tag LOCUS_17230 9481 8399 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence083 651 1808 gene locus_tag LOCUS_17240 651 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1847 2479 gene locus_tag LOCUS_17250 1847 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 2487 2915 gene locus_tag LOCUS_17260 2487 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 2947 3495 gene locus_tag LOCUS_17270 gene def 2947 3495 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528469.1 protein_id gnl|my_center|LOCUS_17270 4843 3656 gene locus_tag LOCUS_17280 4843 3656 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_17280 6192 4894 gene locus_tag LOCUS_17290 6192 4894 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_17290 6413 8809 gene locus_tag LOCUS_17300 6413 8809 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140201.1 protein_id gnl|my_center|LOCUS_17300 >Feature sequence084 1172 759 gene locus_tag LOCUS_17310 1172 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 2901 1729 gene locus_tag LOCUS_17320 2901 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 4120 2975 gene locus_tag LOCUS_17330 4120 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 4524 4117 gene locus_tag LOCUS_17340 4524 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 5202 4621 gene locus_tag LOCUS_17350 5202 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 5414 5208 gene locus_tag LOCUS_17360 5414 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 5874 5404 gene locus_tag LOCUS_17370 5874 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 6284 5871 gene locus_tag LOCUS_17380 6284 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 6693 6298 gene locus_tag LOCUS_17390 6693 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 7748 6726 gene locus_tag LOCUS_17400 7748 6726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 8820 7768 gene locus_tag LOCUS_17410 8820 7768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence085 485 24 gene locus_tag LOCUS_17420 485 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 1056 493 gene locus_tag LOCUS_17430 1056 493 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582689.1 protein_id gnl|my_center|LOCUS_17430 2394 1258 gene locus_tag LOCUS_17440 2394 1258 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267808.1 protein_id gnl|my_center|LOCUS_17440 3603 2485 gene locus_tag LOCUS_17450 3603 2485 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202725.1 protein_id gnl|my_center|LOCUS_17450 4620 3646 gene locus_tag LOCUS_17460 4620 3646 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_17460 5595 4747 gene locus_tag LOCUS_17470 5595 4747 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 protein_id gnl|my_center|LOCUS_17470 6648 5641 gene locus_tag LOCUS_17480 6648 5641 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_17480 7893 6688 gene locus_tag LOCUS_17490 7893 6688 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 protein_id gnl|my_center|LOCUS_17490 8762 7890 gene locus_tag LOCUS_17500 8762 7890 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764890.1 protein_id gnl|my_center|LOCUS_17500 >Feature sequence086 115 354 gene locus_tag LOCUS_17510 115 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 1920 487 gene locus_tag LOCUS_17520 1920 487 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_17520 5175 1960 gene locus_tag LOCUS_17530 5175 1960 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532875.1 protein_id gnl|my_center|LOCUS_17530 6496 5237 gene locus_tag LOCUS_17540 6496 5237 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706757.1 protein_id gnl|my_center|LOCUS_17540 <8834 6719 gene locus_tag LOCUS_17550 <8834 6719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888294.1:M3 family metallopeptidase >Feature sequence087 1396 74 gene locus_tag LOCUS_17560 1396 74 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_17560 3530 1428 gene locus_tag LOCUS_17570 3530 1428 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888294.1 protein_id gnl|my_center|LOCUS_17570 5531 3918 gene locus_tag LOCUS_17580 5531 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 7302 5545 gene locus_tag LOCUS_17590 gene argS 7302 5545 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225071.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence088 1688 759 gene locus_tag LOCUS_17600 1688 759 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545982.1 protein_id gnl|my_center|LOCUS_17600 2250 1717 gene locus_tag LOCUS_17610 gene pyrR 2250 1717 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887753.1 protein_id gnl|my_center|LOCUS_17610 2687 2277 gene locus_tag LOCUS_17620 gene purE 2687 2277 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763604.1 protein_id gnl|my_center|LOCUS_17620 3424 2852 gene locus_tag LOCUS_17630 3424 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 5300 3708 gene locus_tag LOCUS_17640 5300 3708 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613941.1 protein_id gnl|my_center|LOCUS_17640 6352 5297 gene locus_tag LOCUS_17650 6352 5297 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_17650 6764 6369 gene locus_tag LOCUS_17660 6764 6369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 7096 8415 gene locus_tag LOCUS_17670 7096 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 >Feature sequence089 175 930 gene locus_tag LOCUS_17680 175 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 1026 4025 gene locus_tag LOCUS_17690 1026 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 4792 4172 gene locus_tag LOCUS_17700 4792 4172 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922130.1 protein_id gnl|my_center|LOCUS_17700 5431 4892 gene locus_tag LOCUS_17710 5431 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 5621 6094 gene locus_tag LOCUS_17720 5621 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 6091 7881 gene locus_tag LOCUS_17730 6091 7881 CDS product ClcB-like voltage-gated chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192418.1 protein_id gnl|my_center|LOCUS_17730 >Feature sequence090 21 488 gene locus_tag LOCUS_17740 21 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 660 2891 gene locus_tag LOCUS_17750 660 2891 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766433.1 protein_id gnl|my_center|LOCUS_17750 3220 3147 gene locus_tag LOCUS_t00390 3220 3147 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3364 3437 gene locus_tag LOCUS_t00400 3364 3437 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3474 4148 gene locus_tag LOCUS_17760 3474 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 4174 5388 gene locus_tag LOCUS_17770 4174 5388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 5481 7688 gene locus_tag LOCUS_17780 5481 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 7700 8305 gene locus_tag LOCUS_17790 7700 8305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 >Feature sequence091 1655 630 gene locus_tag LOCUS_17800 1655 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 3253 1649 gene locus_tag LOCUS_17810 gene nadB 3253 1649 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_17810 3360 3941 gene locus_tag LOCUS_17820 3360 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 3975 4796 gene locus_tag LOCUS_17830 3975 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 4885 5103 gene locus_tag LOCUS_17840 4885 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 5225 5632 gene locus_tag LOCUS_17850 5225 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 7791 5695 gene locus_tag LOCUS_17860 7791 5695 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808998.1 protein_id gnl|my_center|LOCUS_17860 8184 7915 gene locus_tag LOCUS_17870 8184 7915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence092 59 424 gene locus_tag LOCUS_17880 59 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 2870 861 gene locus_tag LOCUS_17890 2870 861 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080037.1 protein_id gnl|my_center|LOCUS_17890 4272 2953 gene locus_tag LOCUS_17900 4272 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 5679 4297 gene locus_tag LOCUS_17910 gene mpl 5679 4297 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933145.1 protein_id gnl|my_center|LOCUS_17910 6589 5705 gene locus_tag LOCUS_17920 6589 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 7332 6610 gene locus_tag LOCUS_17930 gene lptB 7332 6610 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392029.1 protein_id gnl|my_center|LOCUS_17930 >Feature sequence093 518 1759 gene locus_tag LOCUS_17940 518 1759 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918720.1 protein_id gnl|my_center|LOCUS_17940 1871 2479 gene locus_tag LOCUS_17950 1871 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 2818 2489 gene locus_tag LOCUS_17960 2818 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 2975 4420 gene locus_tag LOCUS_17970 2975 4420 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_17970 4722 5864 gene locus_tag LOCUS_17980 gene eboE 4722 5864 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_17980 5869 6828 gene locus_tag LOCUS_17990 5869 6828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 7998 6847 gene locus_tag LOCUS_18000 7998 6847 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171044.1 protein_id gnl|my_center|LOCUS_18000 >Feature sequence094 838 1719 gene locus_tag LOCUS_18010 gene dapA 838 1719 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880718.1 protein_id gnl|my_center|LOCUS_18010 1732 2472 gene locus_tag LOCUS_18020 gene dapB 1732 2472 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766439.1 protein_id gnl|my_center|LOCUS_18020 2524 3039 gene locus_tag LOCUS_18030 gene folK 2524 3039 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886816.1 protein_id gnl|my_center|LOCUS_18030 3052 3849 gene locus_tag LOCUS_18040 gene panB 3052 3849 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_18040 3918 4799 gene locus_tag LOCUS_18050 3918 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 4847 5716 gene locus_tag LOCUS_18060 4847 5716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 6577 5732 gene locus_tag LOCUS_18070 6577 5732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 7122 7937 gene locus_tag LOCUS_18080 7122 7937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 >Feature sequence095 2018 834 gene locus_tag LOCUS_18090 2018 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 2714 2034 gene locus_tag LOCUS_18100 2714 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529371.1 protein_id gnl|my_center|LOCUS_18100 2903 3580 gene locus_tag LOCUS_18110 2903 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 3619 3936 gene locus_tag LOCUS_18120 gene trxA 3619 3936 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_18120 4163 5443 gene locus_tag LOCUS_18130 4163 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 5519 6919 gene locus_tag LOCUS_18140 gene asnS 5519 6919 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937318.1 protein_id gnl|my_center|LOCUS_18140 7900 7082 gene locus_tag LOCUS_18150 7900 7082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence096 175 885 gene locus_tag LOCUS_18160 175 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 1069 836 gene locus_tag LOCUS_18170 1069 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 1257 5312 gene locus_tag LOCUS_18180 1257 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 5988 5506 gene locus_tag LOCUS_18190 5988 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 <7974 6025 gene locus_tag LOCUS_18200 <7974 6025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942233.1:translation initiation factor IF-2 >Feature sequence097 <1 1260 gene locus_tag LOCUS_18210 <1 1260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000179608.1:transcription termination factor Rho 3351 1426 gene locus_tag LOCUS_18220 3351 1426 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459352.1 protein_id gnl|my_center|LOCUS_18220 4408 3410 gene locus_tag LOCUS_18230 4408 3410 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532940.1 protein_id gnl|my_center|LOCUS_18230 4577 5098 gene locus_tag LOCUS_18240 gene tadA 4577 5098 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391574.1 protein_id gnl|my_center|LOCUS_18240 5161 6099 gene locus_tag LOCUS_18250 gene lipA 5161 6099 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222888.1 protein_id gnl|my_center|LOCUS_18250 6166 7545 gene locus_tag LOCUS_18260 6166 7545 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793956.1 protein_id gnl|my_center|LOCUS_18260 >Feature sequence098 879 34 gene locus_tag LOCUS_18270 gene gluQRS 879 34 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 protein_id gnl|my_center|LOCUS_18270 1011 2885 gene locus_tag LOCUS_18280 1011 2885 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720836.1 protein_id gnl|my_center|LOCUS_18280 4000 3398 gene locus_tag LOCUS_18290 gene gmk 4000 3398 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388624.1 protein_id gnl|my_center|LOCUS_18290 4872 3997 gene locus_tag LOCUS_18300 4872 3997 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_18300 6167 4893 gene locus_tag LOCUS_18310 6167 4893 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200164.1 protein_id gnl|my_center|LOCUS_18310 6276 6737 gene locus_tag LOCUS_18320 6276 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 >Feature sequence099 3282 178 gene locus_tag LOCUS_18330 gene mexY 3282 178 CDS product multidrug efflux RND transporter permease subunit MexY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113508.1 protein_id gnl|my_center|LOCUS_18330 4416 3289 gene locus_tag LOCUS_18340 gene mexX 4416 3289 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113509.1 protein_id gnl|my_center|LOCUS_18340 4740 5552 gene locus_tag LOCUS_18350 4740 5552 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262367.1 protein_id gnl|my_center|LOCUS_18350 5737 6738 gene locus_tag LOCUS_18360 5737 6738 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258973.1 protein_id gnl|my_center|LOCUS_18360 >Feature sequence100 724 119 gene locus_tag LOCUS_18370 gene coaE 724 119 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387006.1 protein_id gnl|my_center|LOCUS_18370 3533 813 gene locus_tag LOCUS_18380 3533 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 4618 3605 gene locus_tag LOCUS_18390 4618 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 5607 4654 gene locus_tag LOCUS_18400 5607 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 7421 5637 gene locus_tag LOCUS_18410 7421 5637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence101 <1 1178 gene locus_tag LOCUS_18420 <1 1178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941009.1:NADH dehydrogenase (quinone) subunit D 1228 1809 gene locus_tag LOCUS_18430 1228 1809 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082449.1 protein_id gnl|my_center|LOCUS_18430 1841 3241 gene locus_tag LOCUS_18440 gene nuoF 1841 3241 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829484.1 protein_id gnl|my_center|LOCUS_18440 3294 5030 gene locus_tag LOCUS_18450 3294 5030 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_18450 5066 6334 gene locus_tag LOCUS_18460 gene nuoH 5066 6334 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964314.1 protein_id gnl|my_center|LOCUS_18460 6368 6931 gene locus_tag LOCUS_18470 6368 6931 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537600.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence102 2653 4707 gene locus_tag LOCUS_18480 2653 4707 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258368.1 protein_id gnl|my_center|LOCUS_18480 4731 6875 gene locus_tag LOCUS_18490 gene scpA 4731 6875 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258367.1 protein_id gnl|my_center|LOCUS_18490 >Feature sequence103 761 1249 gene locus_tag LOCUS_18500 761 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 2891 1674 gene locus_tag LOCUS_18510 2891 1674 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_18510 4240 2912 gene locus_tag LOCUS_18520 4240 2912 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813074.1 protein_id gnl|my_center|LOCUS_18520 4574 4500 gene locus_tag LOCUS_t00410 4574 4500 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5172 4669 gene locus_tag LOCUS_18530 5172 4669 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788377.1 protein_id gnl|my_center|LOCUS_18530 5945 5169 gene locus_tag LOCUS_18540 5945 5169 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788374.1 protein_id gnl|my_center|LOCUS_18540 7060 5963 gene locus_tag LOCUS_18550 7060 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 >Feature sequence104 336 1691 gene locus_tag LOCUS_18560 336 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 3168 1702 gene locus_tag LOCUS_18570 3168 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 3359 4972 gene locus_tag LOCUS_18580 3359 4972 CDS product putative Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807020.1 protein_id gnl|my_center|LOCUS_18580 4997 5599 gene locus_tag LOCUS_18590 4997 5599 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103236.1 protein_id gnl|my_center|LOCUS_18590 6657 5797 gene locus_tag LOCUS_18600 gene prmA 6657 5797 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023220.1 protein_id gnl|my_center|LOCUS_18600 >Feature sequence105 1 495 gene locus_tag LOCUS_18610 1 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 528 1328 gene locus_tag LOCUS_18620 528 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 1359 2429 gene locus_tag LOCUS_18630 1359 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 2520 3260 gene locus_tag LOCUS_18640 2520 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 3286 4275 gene locus_tag LOCUS_18650 gene mgrA 3286 4275 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098184.1 protein_id gnl|my_center|LOCUS_18650 4406 6634 gene locus_tag LOCUS_18660 4406 6634 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783961.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence106 1080 313 gene locus_tag LOCUS_18670 1080 313 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_18670 3079 1121 gene locus_tag LOCUS_18680 3079 1121 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_18680 3802 3101 gene locus_tag LOCUS_18690 3802 3101 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941836.1 protein_id gnl|my_center|LOCUS_18690 4003 4275 gene locus_tag LOCUS_18700 4003 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 4308 5093 gene locus_tag LOCUS_18710 4308 5093 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_18710 5360 5127 gene locus_tag LOCUS_18720 5360 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 6497 5790 gene locus_tag LOCUS_18730 6497 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence107 90 980 gene locus_tag LOCUS_18740 90 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 2770 1112 gene locus_tag LOCUS_18750 2770 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2858 4756 gene locus_tag LOCUS_18760 2858 4756 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105472.1 protein_id gnl|my_center|LOCUS_18760 5949 4753 gene locus_tag LOCUS_18770 5949 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 >Feature sequence108 <1 848 gene locus_tag LOCUS_18780 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000625631.1:phosphodiesterase YaeI 867 2594 gene locus_tag LOCUS_18790 867 2594 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023875.1 protein_id gnl|my_center|LOCUS_18790 2601 3272 gene locus_tag LOCUS_18800 2601 3272 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963856.1 protein_id gnl|my_center|LOCUS_18800 3454 5139 gene locus_tag LOCUS_18810 3454 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 5301 6206 gene locus_tag LOCUS_18820 5301 6206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 6221 6385 gene locus_tag LOCUS_18830 6221 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence109 1444 272 gene locus_tag LOCUS_18840 1444 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 4166 1557 gene locus_tag LOCUS_18850 4166 1557 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525850.1 protein_id gnl|my_center|LOCUS_18850 4407 4841 gene locus_tag LOCUS_18860 4407 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 <6332 4910 gene locus_tag LOCUS_18870 <6332 4910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938035.1:uroporphyrinogen-III C-methyltransferase >Feature sequence110 2929 2024 gene locus_tag LOCUS_18880 gene prmC 2929 2024 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122233.1 protein_id gnl|my_center|LOCUS_18880 4022 2946 gene locus_tag LOCUS_18890 gene prfA 4022 2946 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940174.1 protein_id gnl|my_center|LOCUS_18890 4337 4262 gene locus_tag LOCUS_t00420 4337 4262 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5834 4425 gene locus_tag LOCUS_18900 5834 4425 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307517.1 protein_id gnl|my_center|LOCUS_18900 5912 6190 gene locus_tag LOCUS_18910 5912 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 >Feature sequence111 84 2330 gene locus_tag LOCUS_18920 84 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2645 2558 gene locus_tag LOCUS_t00430 2645 2558 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3536 2775 gene locus_tag LOCUS_18930 3536 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 3846 4130 gene locus_tag LOCUS_18940 3846 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 5178 4168 gene locus_tag LOCUS_18950 5178 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 5132 5368 gene locus_tag LOCUS_18960 5132 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 5846 5346 gene locus_tag LOCUS_18970 5846 5346 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765089.1 protein_id gnl|my_center|LOCUS_18970 >Feature sequence112 2035 413 gene locus_tag LOCUS_18980 gene ilvD 2035 413 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880508.1 protein_id gnl|my_center|LOCUS_18980 2306 3010 gene locus_tag LOCUS_18990 2306 3010 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_18990 3023 4300 gene locus_tag LOCUS_19000 3023 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence113 3332 198 gene locus_tag LOCUS_19010 3332 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 5718 3847 gene locus_tag LOCUS_19020 5718 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 >Feature sequence114 146 1045 gene locus_tag LOCUS_19030 gene yghA 146 1045 CDS product NADP(+)-dependent aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018758.1 protein_id gnl|my_center|LOCUS_19030 1275 2240 gene locus_tag LOCUS_19040 1275 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 2721 2335 gene locus_tag LOCUS_19050 2721 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 2875 3147 gene locus_tag LOCUS_19060 2875 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 3413 3219 gene locus_tag LOCUS_19070 3413 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 3945 3430 gene locus_tag LOCUS_19080 3945 3430 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002987925.1 protein_id gnl|my_center|LOCUS_19080 5237 3942 gene locus_tag LOCUS_19090 5237 3942 CDS product DUF3440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723446.1 protein_id gnl|my_center|LOCUS_19090 5443 5234 gene locus_tag LOCUS_19100 5443 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 >Feature sequence115 400 116 gene locus_tag LOCUS_19110 400 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 1758 889 gene locus_tag LOCUS_19120 gene pdxA 1758 889 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086877.1 protein_id gnl|my_center|LOCUS_19120 2038 1778 gene locus_tag LOCUS_19130 2038 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 2609 2199 gene locus_tag LOCUS_19140 2609 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 2807 3754 gene locus_tag LOCUS_19150 2807 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 3799 4878 gene locus_tag LOCUS_19160 3799 4878 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256167.1 protein_id gnl|my_center|LOCUS_19160 <5946 4954 gene locus_tag LOCUS_19170 <5946 4954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001198807.1:DUF805 domain-containing protein >Feature sequence116 1100 120 gene locus_tag LOCUS_19180 1100 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 2556 1345 gene locus_tag LOCUS_19190 2556 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 3749 2724 gene locus_tag LOCUS_19200 gene gap 3749 2724 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228284.1 protein_id gnl|my_center|LOCUS_19200 4569 3976 gene locus_tag LOCUS_19210 gene ruvA 4569 3976 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_19210 5168 4635 gene locus_tag LOCUS_19220 5168 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 >Feature sequence117 471 1580 gene locus_tag LOCUS_19230 471 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 2126 2533 gene locus_tag LOCUS_19240 2126 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 2817 2632 gene locus_tag LOCUS_19250 2817 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 5113 2852 gene locus_tag LOCUS_19260 gene feoB 5113 2852 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948706.1 protein_id gnl|my_center|LOCUS_19260 5420 5190 gene locus_tag LOCUS_19270 5420 5190 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_19270 >Feature sequence118 <1 1183 gene locus_tag LOCUS_19280 <1 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766433.1:inorganic phosphate transporter 1687 2985 gene locus_tag LOCUS_19290 1687 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2982 4376 gene locus_tag LOCUS_19300 2982 4376 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence119 972 697 gene locus_tag LOCUS_19310 972 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 1144 3147 gene locus_tag LOCUS_19320 1144 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 3195 3638 gene locus_tag LOCUS_19330 3195 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 4631 3873 gene locus_tag LOCUS_19340 4631 3873 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_19340 5204 4746 gene locus_tag LOCUS_19350 5204 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 >Feature sequence120 383 3 gene locus_tag LOCUS_19360 383 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 622 380 gene locus_tag LOCUS_19370 622 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 1044 619 gene locus_tag LOCUS_19380 1044 619 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922068.1 protein_id gnl|my_center|LOCUS_19380 1605 1054 gene locus_tag LOCUS_19390 1605 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 2774 1611 gene locus_tag LOCUS_19400 2774 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 3766 2771 gene locus_tag LOCUS_19410 3766 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 4084 3851 gene locus_tag LOCUS_19420 4084 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 4281 4084 gene locus_tag LOCUS_19430 4281 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 4539 4357 gene locus_tag LOCUS_19440 4539 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 4694 5482 gene locus_tag LOCUS_19450 4694 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence121 206 1030 gene locus_tag LOCUS_19460 gene dapF 206 1030 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939153.1 protein_id gnl|my_center|LOCUS_19460 1772 1074 gene locus_tag LOCUS_19470 1772 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 2259 1993 gene locus_tag LOCUS_19480 2259 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 2469 2544 gene locus_tag LOCUS_t00440 2469 2544 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2576 3280 gene locus_tag LOCUS_19490 gene ubiE 2576 3280 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_19490 3277 4782 gene locus_tag LOCUS_19500 3277 4782 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867488.1 protein_id gnl|my_center|LOCUS_19500 4903 4978 gene locus_tag LOCUS_t00450 4903 4978 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5469 5245 gene locus_tag LOCUS_19510 5469 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence122 1898 666 gene locus_tag LOCUS_19520 1898 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922553.1 protein_id gnl|my_center|LOCUS_19520 2557 1895 gene locus_tag LOCUS_19530 2557 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 3114 2554 gene locus_tag LOCUS_19540 3114 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 4397 3111 gene locus_tag LOCUS_19550 gene nrfD 4397 3111 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_19550 >Feature sequence123 216 515 gene locus_tag LOCUS_19560 216 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 509 2104 gene locus_tag LOCUS_19570 509 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 2109 2438 gene locus_tag LOCUS_19580 2109 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 2435 2923 gene locus_tag LOCUS_19590 2435 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689093.1 protein_id gnl|my_center|LOCUS_19590 2899 4416 gene locus_tag LOCUS_19600 2899 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 >Feature sequence124 2214 526 gene locus_tag LOCUS_19610 gene rpsA 2214 526 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872374.1 protein_id gnl|my_center|LOCUS_19610 2519 3100 gene locus_tag LOCUS_19620 2519 3100 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760532.1 protein_id gnl|my_center|LOCUS_19620 3654 3178 gene locus_tag LOCUS_19630 3654 3178 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965933.1 protein_id gnl|my_center|LOCUS_19630 3750 3826 gene locus_tag LOCUS_t00460 3750 3826 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3939 3948 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence125 842 2158 gene locus_tag LOCUS_19640 842 2158 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_19640 3303 2341 gene locus_tag LOCUS_19650 3303 2341 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403526.1 protein_id gnl|my_center|LOCUS_19650 3615 3983 gene locus_tag LOCUS_19660 gene crcB 3615 3983 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764721.1 protein_id gnl|my_center|LOCUS_19660 >Feature sequence126 1291 836 gene locus_tag LOCUS_19670 1291 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 2707 1544 gene locus_tag LOCUS_19680 gene bioF 2707 1544 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_19680 3945 2731 gene locus_tag LOCUS_19690 3945 2731 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043779541.1 protein_id gnl|my_center|LOCUS_19690 >Feature sequence127 2231 1293 gene locus_tag LOCUS_19700 2231 1293 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929187.1 protein_id gnl|my_center|LOCUS_19700 3553 2330 gene locus_tag LOCUS_19710 gene trpB 3553 2330 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722206.1 protein_id gnl|my_center|LOCUS_19710 4148 3714 gene locus_tag LOCUS_19720 4148 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 >Feature sequence128 528 454 gene locus_tag LOCUS_t00470 528 454 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1299 739 gene locus_tag LOCUS_19730 1299 739 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439149.1 protein_id gnl|my_center|LOCUS_19730 1891 3234 gene locus_tag LOCUS_19740 gene dnaA 1891 3234 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_19740 >Feature sequence129 1812 160 gene locus_tag LOCUS_19750 gene groL 1812 160 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_19750 2148 1858 gene locus_tag LOCUS_19760 gene groES 2148 1858 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171493.1 protein_id gnl|my_center|LOCUS_19760 4172 2244 gene locus_tag LOCUS_19770 gene dnaK 4172 2244 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557108.1 protein_id gnl|my_center|LOCUS_19770 >Feature sequence130 >Feature sequence131 570 2279 gene locus_tag LOCUS_19780 570 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 2489 3058 gene locus_tag LOCUS_19790 2489 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 >Feature sequence132 2047 14 gene locus_tag LOCUS_19800 gene kdpB 2047 14 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763738.1 protein_id gnl|my_center|LOCUS_19800 3841 2132 gene locus_tag LOCUS_19810 gene kdpA 3841 2132 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108291.1 protein_id gnl|my_center|LOCUS_19810 >Feature sequence133 892 1830 gene locus_tag LOCUS_19820 892 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 1984 2790 gene locus_tag LOCUS_19830 1984 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 3559 3014 gene locus_tag LOCUS_19840 3559 3014 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704720.1 protein_id gnl|my_center|LOCUS_19840 >Feature sequence134 136 795 gene locus_tag LOCUS_19850 136 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 1850 792 gene locus_tag LOCUS_19860 gene lgt 1850 792 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388399.1 protein_id gnl|my_center|LOCUS_19860 2941 1862 gene locus_tag LOCUS_19870 2941 1862 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583847.1 protein_id gnl|my_center|LOCUS_19870 >Feature sequence135 155 3310 gene locus_tag LOCUS_19880 155 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19880 3314 3697 gene locus_tag LOCUS_19890 3314 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 >Feature sequence136 <1 698 gene locus_tag LOCUS_19900 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203436.1:glycoside hydrolase family 43 protein 719 1828 gene locus_tag LOCUS_19910 719 1828 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203436.1 protein_id gnl|my_center|LOCUS_19910 1818 2321 gene locus_tag LOCUS_19920 1818 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2737 2318 gene locus_tag LOCUS_19930 2737 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 2912 3811 gene locus_tag LOCUS_19940 2912 3811 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760345.1 protein_id gnl|my_center|LOCUS_19940 >Feature sequence137 116 856 gene locus_tag LOCUS_19950 116 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 1521 1321 gene locus_tag LOCUS_19960 1521 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19960 2740 1535 gene locus_tag LOCUS_19970 2740 1535 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922462.1 protein_id gnl|my_center|LOCUS_19970 <3614 2764 gene locus_tag LOCUS_19980 <3614 2764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966837.1:3-oxoacyl-[acyl-carrier-protein] reductase >Feature sequence138 268 858 gene locus_tag LOCUS_19990 268 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 845 854 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2124 976 gene locus_tag LOCUS_20000 2124 976 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_20000 <3599 2215 gene locus_tag LOCUS_20010 <3599 2215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107598.1:family 20 glycosylhydrolase >Feature sequence139 263 340 gene locus_tag LOCUS_t00480 263 340 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 426 2042 gene locus_tag LOCUS_20020 gene ilvA 426 2042 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125079.1 protein_id gnl|my_center|LOCUS_20020 2109 2678 gene locus_tag LOCUS_20030 2109 2678 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398496.1 protein_id gnl|my_center|LOCUS_20030 <3550 2782 gene locus_tag LOCUS_20040 <3550 2782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965596.1:GTPase HflX >Feature sequence140 2256 1849 gene locus_tag LOCUS_20050 2256 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 3289 2324 gene locus_tag LOCUS_20060 3289 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 >Feature sequence141 814 1620 gene locus_tag LOCUS_20070 814 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 2028 3209 gene locus_tag LOCUS_20080 2028 3209 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764054.1 protein_id gnl|my_center|LOCUS_20080 >Feature sequence142 1265 561 gene locus_tag LOCUS_20090 1265 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 1525 1262 gene locus_tag LOCUS_20100 1525 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 2886 1549 gene locus_tag LOCUS_20110 2886 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence143 2377 1598 gene locus_tag LOCUS_20120 gene pflA 2377 1598 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799649.1 protein_id gnl|my_center|LOCUS_20120 3230 2394 gene locus_tag LOCUS_20130 3230 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20130 >Feature sequence144 308 1792 gene locus_tag LOCUS_20140 308 1792 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174157.1 protein_id gnl|my_center|LOCUS_20140 1785 2726 gene locus_tag LOCUS_20150 gene glsA 1785 2726 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883028.1 protein_id gnl|my_center|LOCUS_20150 >Feature sequence145 191 661 gene locus_tag LOCUS_20160 191 661 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109521.1 protein_id gnl|my_center|LOCUS_20160 1203 1937 gene locus_tag LOCUS_20170 1203 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 1746 1755 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence146 2308 1322 gene locus_tag LOCUS_20180 2308 1322 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence147 >Feature sequence148 1139 240 gene locus_tag LOCUS_20190 gene hisG 1139 240 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_20190 2464 1181 gene locus_tag LOCUS_20200 2464 1181 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_20200 >Feature sequence149 470 1159 gene locus_tag LOCUS_20210 gene tsaA 470 1159 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_20210 >Feature sequence150 2122 155 gene locus_tag LOCUS_20220 2122 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220