>Feature sequence01 1333 74 gene locus_tag LOCUS_00010 1333 74 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227743.1 protein_id gnl|my_center|LOCUS_00010 2680 1478 gene locus_tag LOCUS_00020 gene nadA 2680 1478 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869444.1 protein_id gnl|my_center|LOCUS_00020 4893 2797 gene locus_tag LOCUS_00030 4893 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5007 6170 gene locus_tag LOCUS_00040 5007 6170 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082051.1 protein_id gnl|my_center|LOCUS_00040 6292 6654 gene locus_tag LOCUS_00050 gene erpA 6292 6654 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805013.1 protein_id gnl|my_center|LOCUS_00050 7274 6732 gene locus_tag LOCUS_00060 7274 6732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7630 7271 gene locus_tag LOCUS_00070 7630 7271 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921237.1 protein_id gnl|my_center|LOCUS_00070 7748 8734 gene locus_tag LOCUS_00080 7748 8734 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326033.1 protein_id gnl|my_center|LOCUS_00080 8781 9479 gene locus_tag LOCUS_00090 gene aat 8781 9479 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241650.1 protein_id gnl|my_center|LOCUS_00090 9603 10868 gene locus_tag LOCUS_00100 9603 10868 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230815.1 protein_id gnl|my_center|LOCUS_00100 11234 10875 gene locus_tag LOCUS_00110 11234 10875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00110 12442 11231 gene locus_tag LOCUS_00120 12442 11231 CDS product cysteine desulfurase/sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028169.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00120 12612 13502 gene locus_tag LOCUS_00130 gene coxB 12612 13502 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805014.1 protein_id gnl|my_center|LOCUS_00130 13502 15271 gene locus_tag LOCUS_00140 gene ctaD 13502 15271 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_00140 15274 15678 gene locus_tag LOCUS_00150 15274 15678 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976661.1 protein_id gnl|my_center|LOCUS_00150 15809 17173 gene locus_tag LOCUS_00160 15809 17173 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976662.1 protein_id gnl|my_center|LOCUS_00160 17578 17234 gene locus_tag LOCUS_00170 17578 17234 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 protein_id gnl|my_center|LOCUS_00170 19446 17692 gene locus_tag LOCUS_00180 19446 17692 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805018.1 protein_id gnl|my_center|LOCUS_00180 20576 19446 gene locus_tag LOCUS_00190 20576 19446 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805019.1 protein_id gnl|my_center|LOCUS_00190 21423 20632 gene locus_tag LOCUS_00200 21423 20632 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805020.1 protein_id gnl|my_center|LOCUS_00200 22048 21470 gene locus_tag LOCUS_00210 22048 21470 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_00210 22230 22694 gene locus_tag LOCUS_00220 22230 22694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976663.1 protein_id gnl|my_center|LOCUS_00220 22691 23758 gene locus_tag LOCUS_00230 gene trpD 22691 23758 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028166.1 protein_id gnl|my_center|LOCUS_00230 24101 23817 gene locus_tag LOCUS_00240 24101 23817 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 protein_id gnl|my_center|LOCUS_00240 25849 24125 gene locus_tag LOCUS_00250 25849 24125 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_00250 26018 26266 gene locus_tag LOCUS_00260 26018 26266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 26319 27557 gene locus_tag LOCUS_00270 26319 27557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869422.1 protein_id gnl|my_center|LOCUS_00270 28914 27511 gene locus_tag LOCUS_00280 28914 27511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 30779 29019 gene locus_tag LOCUS_00290 30779 29019 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028155.1 protein_id gnl|my_center|LOCUS_00290 31030 31473 gene locus_tag LOCUS_00300 31030 31473 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224321.1 protein_id gnl|my_center|LOCUS_00300 31483 32610 gene locus_tag LOCUS_00310 31483 32610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 32603 33097 gene locus_tag LOCUS_00320 32603 33097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 33094 34053 gene locus_tag LOCUS_00330 33094 34053 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805026.1 protein_id gnl|my_center|LOCUS_00330 34050 35048 gene locus_tag LOCUS_00340 34050 35048 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00340 35073 34991 gene locus_tag LOCUS_t00010 35073 34991 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 35045 35869 gene locus_tag LOCUS_00350 35045 35869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 36439 35873 gene locus_tag LOCUS_00360 36439 35873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 36544 37434 gene locus_tag LOCUS_00370 36544 37434 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469516.1 protein_id gnl|my_center|LOCUS_00370 37454 38602 gene locus_tag LOCUS_00380 37454 38602 CDS product DUF5931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976694.1 protein_id gnl|my_center|LOCUS_00380 38641 39333 gene locus_tag LOCUS_00390 38641 39333 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976695.1 protein_id gnl|my_center|LOCUS_00390 39420 40772 gene locus_tag LOCUS_00400 39420 40772 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265947.1 protein_id gnl|my_center|LOCUS_00400 40787 41854 gene locus_tag LOCUS_00410 40787 41854 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142473.1 protein_id gnl|my_center|LOCUS_00410 42829 41906 gene locus_tag LOCUS_00420 42829 41906 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869154.1 protein_id gnl|my_center|LOCUS_00420 44706 42829 gene locus_tag LOCUS_00430 gene pknB 44706 42829 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486214.1 protein_id gnl|my_center|LOCUS_00430 45829 44756 gene locus_tag LOCUS_00440 45829 44756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 46002 46400 gene locus_tag LOCUS_00450 46002 46400 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805032.1 protein_id gnl|my_center|LOCUS_00450 47499 46411 gene locus_tag LOCUS_00460 47499 46411 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_00460 47587 48489 gene locus_tag LOCUS_00470 gene metF 47587 48489 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028143.1 protein_id gnl|my_center|LOCUS_00470 49117 48509 gene locus_tag LOCUS_00480 49117 48509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 51251 49410 gene locus_tag LOCUS_00490 51251 49410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 51848 51321 gene locus_tag LOCUS_00500 51848 51321 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224204.1 protein_id gnl|my_center|LOCUS_00500 52120 52398 gene locus_tag LOCUS_00510 52120 52398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 52428 52865 gene locus_tag LOCUS_00520 52428 52865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 52862 56758 gene locus_tag LOCUS_00530 gene dnaE 52862 56758 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027948.1 protein_id gnl|my_center|LOCUS_00530 56798 57568 gene locus_tag LOCUS_00540 56798 57568 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028138.1 protein_id gnl|my_center|LOCUS_00540 57584 58834 gene locus_tag LOCUS_00550 gene dinB 57584 58834 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_00550 58900 59097 gene locus_tag LOCUS_00560 58900 59097 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222993.1 protein_id gnl|my_center|LOCUS_00560 59795 59094 gene locus_tag LOCUS_00570 59795 59094 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973759.1 protein_id gnl|my_center|LOCUS_00570 60044 60475 gene locus_tag LOCUS_00580 60044 60475 CDS product spore wall synthesis complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028137.1 protein_id gnl|my_center|LOCUS_00580 61078 60530 gene locus_tag LOCUS_00590 61078 60530 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726666.1 protein_id gnl|my_center|LOCUS_00590 61296 61078 gene locus_tag LOCUS_00600 61296 61078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805039.1 protein_id gnl|my_center|LOCUS_00600 61592 63733 gene locus_tag LOCUS_00610 61592 63733 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805040.1 protein_id gnl|my_center|LOCUS_00610 63882 65408 gene locus_tag LOCUS_00620 63882 65408 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897250.1 protein_id gnl|my_center|LOCUS_00620 66622 65615 gene locus_tag LOCUS_00630 66622 65615 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051648.1 protein_id gnl|my_center|LOCUS_00630 67615 66632 gene locus_tag LOCUS_00640 67615 66632 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258586.1 protein_id gnl|my_center|LOCUS_00640 68640 67615 gene locus_tag LOCUS_00650 68640 67615 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313059.1 protein_id gnl|my_center|LOCUS_00650 70100 68718 gene locus_tag LOCUS_00660 70100 68718 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970996.1 protein_id gnl|my_center|LOCUS_00660 72779 70323 gene locus_tag LOCUS_00670 72779 70323 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929932.1 protein_id gnl|my_center|LOCUS_00670 73520 72873 gene locus_tag LOCUS_00680 73520 72873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 73570 76302 gene locus_tag LOCUS_00690 73570 76302 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_00690 76341 76934 gene locus_tag LOCUS_00700 76341 76934 CDS product DUF5998 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030492.1 protein_id gnl|my_center|LOCUS_00700 76931 78073 gene locus_tag LOCUS_00710 76931 78073 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030493.1 protein_id gnl|my_center|LOCUS_00710 78110 78790 gene locus_tag LOCUS_00720 78110 78790 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973175.1 protein_id gnl|my_center|LOCUS_00720 80397 78787 gene locus_tag LOCUS_00730 gene sepH 80397 78787 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805049.1 protein_id gnl|my_center|LOCUS_00730 80508 81635 gene locus_tag LOCUS_00740 80508 81635 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973161.1 protein_id gnl|my_center|LOCUS_00740 81640 82482 gene locus_tag LOCUS_00750 81640 82482 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894144.1 protein_id gnl|my_center|LOCUS_00750 82675 82499 gene locus_tag LOCUS_00760 82675 82499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 82995 83291 gene locus_tag LOCUS_00770 82995 83291 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728564.1 protein_id gnl|my_center|LOCUS_00770 83282 83806 gene locus_tag LOCUS_00780 gene dut 83282 83806 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224478.1 protein_id gnl|my_center|LOCUS_00780 83803 84576 gene locus_tag LOCUS_00790 83803 84576 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805053.1 protein_id gnl|my_center|LOCUS_00790 84576 84956 gene locus_tag LOCUS_00800 84576 84956 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327459.1 protein_id gnl|my_center|LOCUS_00800 84946 85674 gene locus_tag LOCUS_00810 84946 85674 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111515.1 protein_id gnl|my_center|LOCUS_00810 86752 86066 gene locus_tag LOCUS_00820 86752 86066 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_00820 87442 86780 gene locus_tag LOCUS_00830 87442 86780 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_00830 87504 89519 gene locus_tag LOCUS_00840 87504 89519 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742167.1 protein_id gnl|my_center|LOCUS_00840 89516 90739 gene locus_tag LOCUS_00850 89516 90739 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 protein_id gnl|my_center|LOCUS_00850 90870 93545 gene locus_tag LOCUS_00860 gene acnA 90870 93545 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 protein_id gnl|my_center|LOCUS_00860 94460 93621 gene locus_tag LOCUS_00870 94460 93621 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972351.1 protein_id gnl|my_center|LOCUS_00870 95464 94457 gene locus_tag LOCUS_00880 95464 94457 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972350.1 protein_id gnl|my_center|LOCUS_00880 96458 95451 gene locus_tag LOCUS_00890 96458 95451 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992347.1 protein_id gnl|my_center|LOCUS_00890 97390 96455 gene locus_tag LOCUS_00900 gene yclQ 97390 96455 CDS product petrobactin ABC transporter substrate-binding protein YclQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246619.1 protein_id gnl|my_center|LOCUS_00900 97602 98075 gene locus_tag LOCUS_00910 97602 98075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 98143 100035 gene locus_tag LOCUS_00920 gene dxs 98143 100035 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972908.1 protein_id gnl|my_center|LOCUS_00920 100176 101177 gene locus_tag LOCUS_00930 100176 101177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 102924 101086 gene locus_tag LOCUS_00940 102924 101086 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227746.1 protein_id gnl|my_center|LOCUS_00940 103734 102955 gene locus_tag LOCUS_00950 103734 102955 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027518.1 protein_id gnl|my_center|LOCUS_00950 104642 104154 gene locus_tag LOCUS_00960 104642 104154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 106483 104954 gene locus_tag LOCUS_00970 106483 104954 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972925.1 protein_id gnl|my_center|LOCUS_00970 108719 106608 gene locus_tag LOCUS_00980 108719 106608 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030602.1 protein_id gnl|my_center|LOCUS_00980 109932 108721 gene locus_tag LOCUS_00990 109932 108721 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224501.1 protein_id gnl|my_center|LOCUS_00990 111354 110092 gene locus_tag LOCUS_01000 111354 110092 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 protein_id gnl|my_center|LOCUS_01000 111939 111355 gene locus_tag LOCUS_01010 111939 111355 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030605.1 protein_id gnl|my_center|LOCUS_01010 112022 112855 gene locus_tag LOCUS_01020 112022 112855 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027715.1 protein_id gnl|my_center|LOCUS_01020 112902 113933 gene locus_tag LOCUS_01030 gene hemE 112902 113933 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972892.1 protein_id gnl|my_center|LOCUS_01030 114038 115522 gene locus_tag LOCUS_01040 114038 115522 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037523.1 protein_id gnl|my_center|LOCUS_01040 116482 115418 gene locus_tag LOCUS_01050 116482 115418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 116602 117321 gene locus_tag LOCUS_01060 116602 117321 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224514.1 protein_id gnl|my_center|LOCUS_01060 117814 117383 gene locus_tag LOCUS_01070 gene msrB 117814 117383 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224520.1 protein_id gnl|my_center|LOCUS_01070 120335 117933 gene locus_tag LOCUS_01080 120335 117933 CDS product SpnA family nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015235.1 protein_id gnl|my_center|LOCUS_01080 120521 121531 gene locus_tag LOCUS_01090 gene ligD 120521 121531 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 protein_id gnl|my_center|LOCUS_01090 122633 121566 gene locus_tag LOCUS_01100 122633 121566 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917239.1 protein_id gnl|my_center|LOCUS_01100 122786 123856 gene locus_tag LOCUS_01110 122786 123856 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047119416.1 protein_id gnl|my_center|LOCUS_01110 124675 123872 gene locus_tag LOCUS_01120 124675 123872 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069213.1 protein_id gnl|my_center|LOCUS_01120 124656 125600 gene locus_tag LOCUS_01130 124656 125600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776225.1 protein_id gnl|my_center|LOCUS_01130 127253 125607 gene locus_tag LOCUS_01140 127253 125607 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030655.1 protein_id gnl|my_center|LOCUS_01140 127324 128379 gene locus_tag LOCUS_01150 127324 128379 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972813.1 protein_id gnl|my_center|LOCUS_01150 128376 129104 gene locus_tag LOCUS_01160 128376 129104 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 protein_id gnl|my_center|LOCUS_01160 129187 130233 gene locus_tag LOCUS_01170 129187 130233 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_01170 130230 131159 gene locus_tag LOCUS_01180 130230 131159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 131156 132145 gene locus_tag LOCUS_01190 gene rfbB 131156 132145 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222917.1 protein_id gnl|my_center|LOCUS_01190 133161 132226 gene locus_tag LOCUS_01200 gene rfbA 133161 132226 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062166.1 protein_id gnl|my_center|LOCUS_01200 133322 133395 gene locus_tag LOCUS_t00020 133322 133395 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 133419 133490 gene locus_tag LOCUS_t00030 133419 133490 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 133513 133587 gene locus_tag LOCUS_t00040 133513 133587 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 134237 133644 gene locus_tag LOCUS_01210 134237 133644 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804232.1 protein_id gnl|my_center|LOCUS_01210 134716 134237 gene locus_tag LOCUS_01220 134716 134237 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894320.1 protein_id gnl|my_center|LOCUS_01220 134820 136226 gene locus_tag LOCUS_01230 134820 136226 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929838.1 protein_id gnl|my_center|LOCUS_01230 136270 137637 gene locus_tag LOCUS_01240 136270 137637 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403984.1 protein_id gnl|my_center|LOCUS_01240 137714 138913 gene locus_tag LOCUS_01250 137714 138913 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226315.1 protein_id gnl|my_center|LOCUS_01250 140732 138918 gene locus_tag LOCUS_01260 140732 138918 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015020.1 protein_id gnl|my_center|LOCUS_01260 141859 140729 gene locus_tag LOCUS_01270 141859 140729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 143308 141869 gene locus_tag LOCUS_01280 143308 141869 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256492.1 protein_id gnl|my_center|LOCUS_01280 144064 143318 gene locus_tag LOCUS_01290 144064 143318 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223098.1 protein_id gnl|my_center|LOCUS_01290 147315 144067 gene locus_tag LOCUS_01300 147315 144067 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_01300 149325 147358 gene locus_tag LOCUS_01310 149325 147358 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730981.1 protein_id gnl|my_center|LOCUS_01310 149362 149736 gene locus_tag LOCUS_01320 149362 149736 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891506.1 protein_id gnl|my_center|LOCUS_01320 149681 150067 gene locus_tag LOCUS_01330 149681 150067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 150916 150089 gene locus_tag LOCUS_01340 150916 150089 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119932584.1 protein_id gnl|my_center|LOCUS_01340 151059 151952 gene locus_tag LOCUS_01350 151059 151952 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014859.1 protein_id gnl|my_center|LOCUS_01350 152675 151962 gene locus_tag LOCUS_01360 152675 151962 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729647.1 protein_id gnl|my_center|LOCUS_01360 152789 153757 gene locus_tag LOCUS_01370 152789 153757 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972317.1 protein_id gnl|my_center|LOCUS_01370 153769 154812 gene locus_tag LOCUS_01380 153769 154812 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035617.1 protein_id gnl|my_center|LOCUS_01380 156172 154901 gene locus_tag LOCUS_01390 156172 154901 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730960.1 protein_id gnl|my_center|LOCUS_01390 157568 156213 gene locus_tag LOCUS_01400 gene glnA 157568 156213 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496800.1 protein_id gnl|my_center|LOCUS_01400 157761 158372 gene locus_tag LOCUS_01410 157761 158372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 158853 158425 gene locus_tag LOCUS_01420 158853 158425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 158948 159607 gene locus_tag LOCUS_01430 158948 159607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 160394 159621 gene locus_tag LOCUS_01440 160394 159621 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731464.1 protein_id gnl|my_center|LOCUS_01440 161254 160394 gene locus_tag LOCUS_01450 161254 160394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 162267 161308 gene locus_tag LOCUS_01460 162267 161308 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523563.1 protein_id gnl|my_center|LOCUS_01460 163759 162269 gene locus_tag LOCUS_01470 gene hpaE 163759 162269 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528544.1 protein_id gnl|my_center|LOCUS_01470 163934 165451 gene locus_tag LOCUS_01480 163934 165451 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392306.1 protein_id gnl|my_center|LOCUS_01480 165531 166373 gene locus_tag LOCUS_01490 165531 166373 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 protein_id gnl|my_center|LOCUS_01490 166370 166873 gene locus_tag LOCUS_01500 166370 166873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 166933 167007 gene locus_tag LOCUS_t00050 166933 167007 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 167598 167122 gene locus_tag LOCUS_01510 167598 167122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01510 168098 167637 gene locus_tag LOCUS_01520 168098 167637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01520 168508 168029 gene locus_tag LOCUS_01530 168508 168029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01530 169772 169035 gene locus_tag LOCUS_01540 169772 169035 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223018.1 protein_id gnl|my_center|LOCUS_01540 169900 171183 gene locus_tag LOCUS_01550 169900 171183 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230941.1 protein_id gnl|my_center|LOCUS_01550 171229 172584 gene locus_tag LOCUS_01560 171229 172584 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230940.1 protein_id gnl|my_center|LOCUS_01560 172586 173461 gene locus_tag LOCUS_01570 172586 173461 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230939.1 protein_id gnl|my_center|LOCUS_01570 173604 175613 gene locus_tag LOCUS_01580 gene thrS 173604 175613 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804992.1 protein_id gnl|my_center|LOCUS_01580 175815 176198 gene locus_tag LOCUS_01590 175815 176198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 176356 177732 gene locus_tag LOCUS_01600 176356 177732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 177729 178397 gene locus_tag LOCUS_01610 177729 178397 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977081.1 protein_id gnl|my_center|LOCUS_01610 178453 178899 gene locus_tag LOCUS_01620 178453 178899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 178926 179492 gene locus_tag LOCUS_01630 178926 179492 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804993.1 protein_id gnl|my_center|LOCUS_01630 179526 180203 gene locus_tag LOCUS_01640 179526 180203 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027830.1 protein_id gnl|my_center|LOCUS_01640 180209 181120 gene locus_tag LOCUS_01650 180209 181120 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_01650 181117 182280 gene locus_tag LOCUS_01660 181117 182280 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_01660 182277 182849 gene locus_tag LOCUS_01670 182277 182849 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027827.1 protein_id gnl|my_center|LOCUS_01670 183511 183017 gene locus_tag LOCUS_01680 183511 183017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 183889 184647 gene locus_tag LOCUS_01690 183889 184647 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804995.1 protein_id gnl|my_center|LOCUS_01690 184760 185350 gene locus_tag LOCUS_01700 gene ruvC 184760 185350 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284467.1 protein_id gnl|my_center|LOCUS_01700 185347 185955 gene locus_tag LOCUS_01710 gene ruvA 185347 185955 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_01710 185952 187073 gene locus_tag LOCUS_01720 gene ruvB 185952 187073 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804998.1 protein_id gnl|my_center|LOCUS_01720 187246 187512 gene locus_tag LOCUS_01730 187246 187512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 187528 189345 gene locus_tag LOCUS_01740 gene secD 187528 189345 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805000.1 protein_id gnl|my_center|LOCUS_01740 189342 190493 gene locus_tag LOCUS_01750 gene secF 189342 190493 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805001.1 protein_id gnl|my_center|LOCUS_01750 190522 191082 gene locus_tag LOCUS_01760 190522 191082 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325803.1 protein_id gnl|my_center|LOCUS_01760 191150 193456 gene locus_tag LOCUS_01770 gene relA 191150 193456 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_01770 193579 194034 gene locus_tag LOCUS_01780 193579 194034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 194205 194882 gene locus_tag LOCUS_01790 194205 194882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 194893 196044 gene locus_tag LOCUS_01800 194893 196044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 196086 196739 gene locus_tag LOCUS_01810 196086 196739 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141078.1 protein_id gnl|my_center|LOCUS_01810 196736 197941 gene locus_tag LOCUS_01820 196736 197941 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230190.1 protein_id gnl|my_center|LOCUS_01820 198447 198100 gene locus_tag LOCUS_01830 198447 198100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 198653 198979 gene locus_tag LOCUS_01840 198653 198979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 199222 198983 gene locus_tag LOCUS_01850 199222 198983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 201279 199588 gene locus_tag LOCUS_01860 201279 199588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 201429 202130 gene locus_tag LOCUS_01870 201429 202130 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_01870 202127 203476 gene locus_tag LOCUS_01880 gene hisS 202127 203476 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805006.1 protein_id gnl|my_center|LOCUS_01880 204208 203597 gene locus_tag LOCUS_01890 204208 203597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085601.1 protein_id gnl|my_center|LOCUS_01890 204207 205178 gene locus_tag LOCUS_01900 gene xerD 204207 205178 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729303.1 protein_id gnl|my_center|LOCUS_01900 205192 206280 gene locus_tag LOCUS_01910 205192 206280 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805130.1 protein_id gnl|my_center|LOCUS_01910 206286 207296 gene locus_tag LOCUS_01920 206286 207296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01920 207289 207966 gene locus_tag LOCUS_01930 gene scpB 207289 207966 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_01930 208146 208913 gene locus_tag LOCUS_01940 208146 208913 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895185.1 protein_id gnl|my_center|LOCUS_01940 208913 210037 gene locus_tag LOCUS_01950 208913 210037 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805132.1 protein_id gnl|my_center|LOCUS_01950 210074 210766 gene locus_tag LOCUS_01960 210074 210766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01960 210804 212303 gene locus_tag LOCUS_01970 gene der 210804 212303 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_01970 212480 212555 gene locus_tag LOCUS_t00060 212480 212555 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 213553 212870 gene locus_tag LOCUS_01980 213553 212870 CDS product heme peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728839.1 protein_id gnl|my_center|LOCUS_01980 213790 214110 gene locus_tag LOCUS_01990 213790 214110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 214376 214690 gene locus_tag LOCUS_02000 214376 214690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 215571 214996 gene locus_tag LOCUS_02010 215571 214996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 216201 215605 gene locus_tag LOCUS_02020 gene pdxT 216201 215605 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977305.1 protein_id gnl|my_center|LOCUS_02020 217097 216198 gene locus_tag LOCUS_02030 gene pdxS 217097 216198 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803695.1 protein_id gnl|my_center|LOCUS_02030 217205 218689 gene locus_tag LOCUS_02040 217205 218689 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223637.1 protein_id gnl|my_center|LOCUS_02040 220130 218661 gene locus_tag LOCUS_02050 220130 218661 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110177.1 protein_id gnl|my_center|LOCUS_02050 221045 220146 gene locus_tag LOCUS_02060 221045 220146 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084944.1 protein_id gnl|my_center|LOCUS_02060 221146 221751 gene locus_tag LOCUS_02070 221146 221751 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221514425.1 protein_id gnl|my_center|LOCUS_02070 221748 222647 gene locus_tag LOCUS_02080 221748 222647 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977439.1 protein_id gnl|my_center|LOCUS_02080 222644 222976 gene locus_tag LOCUS_02090 222644 222976 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977440.1 protein_id gnl|my_center|LOCUS_02090 222973 223779 gene locus_tag LOCUS_02100 222973 223779 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027758.1 protein_id gnl|my_center|LOCUS_02100 223829 224218 gene locus_tag LOCUS_02110 gene gcvH 223829 224218 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226819.1 protein_id gnl|my_center|LOCUS_02110 224309 224779 gene locus_tag LOCUS_02120 224309 224779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 224813 225496 gene locus_tag LOCUS_02130 224813 225496 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467185.1 protein_id gnl|my_center|LOCUS_02130 225597 226064 gene locus_tag LOCUS_02140 225597 226064 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_02140 226240 226815 gene locus_tag LOCUS_02150 226240 226815 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805153.1 protein_id gnl|my_center|LOCUS_02150 227071 229962 gene locus_tag LOCUS_02160 gene gcvP 227071 229962 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_02160 233444 230064 gene locus_tag LOCUS_02170 233444 230064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 234666 233446 gene locus_tag LOCUS_02180 234666 233446 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977530.1 protein_id gnl|my_center|LOCUS_02180 234726 236285 gene locus_tag LOCUS_02190 234726 236285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731144.1 protein_id gnl|my_center|LOCUS_02190 236332 237660 gene locus_tag LOCUS_02200 236332 237660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 238220 237564 gene locus_tag LOCUS_02210 238220 237564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 238834 238217 gene locus_tag LOCUS_02220 238834 238217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 239496 238831 gene locus_tag LOCUS_02230 239496 238831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 240237 239554 gene locus_tag LOCUS_02240 240237 239554 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972709.1 protein_id gnl|my_center|LOCUS_02240 240251 240790 gene locus_tag LOCUS_02250 240251 240790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 240787 241251 gene locus_tag LOCUS_02260 240787 241251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 243729 241264 gene locus_tag LOCUS_02270 243729 241264 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_02270 243927 244598 gene locus_tag LOCUS_02280 243927 244598 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228646.1 protein_id gnl|my_center|LOCUS_02280 244738 245280 gene locus_tag LOCUS_02290 244738 245280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02290 245341 246177 gene locus_tag LOCUS_02300 245341 246177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02300 247098 246217 gene locus_tag LOCUS_02310 247098 246217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086484.1 protein_id gnl|my_center|LOCUS_02310 247215 248555 gene locus_tag LOCUS_02320 247215 248555 CDS product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014103.1 protein_id gnl|my_center|LOCUS_02320 250056 248620 gene locus_tag LOCUS_02330 250056 248620 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028390.1 protein_id gnl|my_center|LOCUS_02330 250139 250900 gene locus_tag LOCUS_02340 250139 250900 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062378.1 protein_id gnl|my_center|LOCUS_02340 251420 250908 gene locus_tag LOCUS_02350 251420 250908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 252295 251417 gene locus_tag LOCUS_02360 252295 251417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 252763 252338 gene locus_tag LOCUS_02370 252763 252338 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557493.1 protein_id gnl|my_center|LOCUS_02370 253353 252865 gene locus_tag LOCUS_02380 253353 252865 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063011.1 protein_id gnl|my_center|LOCUS_02380 254530 253403 gene locus_tag LOCUS_02390 gene rlmC 254530 253403 CDS product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149722.1 protein_id gnl|my_center|LOCUS_02390 254568 255065 gene locus_tag LOCUS_02400 gene tpx 254568 255065 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776224.1 protein_id gnl|my_center|LOCUS_02400 255657 255136 gene locus_tag LOCUS_02410 255657 255136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 256196 256699 gene locus_tag LOCUS_02420 256196 256699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 257209 256808 gene locus_tag LOCUS_02430 257209 256808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 259621 257228 gene locus_tag LOCUS_02440 259621 257228 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224401.1 protein_id gnl|my_center|LOCUS_02440 260043 259705 gene locus_tag LOCUS_02450 260043 259705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 261342 260167 gene locus_tag LOCUS_02460 261342 260167 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405139.1 protein_id gnl|my_center|LOCUS_02460 261434 262987 gene locus_tag LOCUS_02470 261434 262987 CDS product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111683.1 protein_id gnl|my_center|LOCUS_02470 262959 263816 gene locus_tag LOCUS_02480 262959 263816 CDS product YjjW family glycine radical enzyme activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263780.1 protein_id gnl|my_center|LOCUS_02480 263899 264189 gene locus_tag LOCUS_02490 263899 264189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 264186 268541 gene locus_tag LOCUS_02500 264186 268541 CDS product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223320.1 protein_id gnl|my_center|LOCUS_02500 268541 268915 gene locus_tag LOCUS_02510 268541 268915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 269125 269634 gene locus_tag LOCUS_02520 269125 269634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 269640 270089 gene locus_tag LOCUS_02530 269640 270089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 270086 270496 gene locus_tag LOCUS_02540 270086 270496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 270775 272076 gene locus_tag LOCUS_02550 270775 272076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 272158 273537 gene locus_tag LOCUS_02560 272158 273537 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258886.1 protein_id gnl|my_center|LOCUS_02560 273771 274127 gene locus_tag LOCUS_02570 273771 274127 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805194.1 protein_id gnl|my_center|LOCUS_02570 274704 274207 gene locus_tag LOCUS_02580 274704 274207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 275513 274728 gene locus_tag LOCUS_02590 275513 274728 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_02590 277104 275506 gene locus_tag LOCUS_02600 gene lnt 277104 275506 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027519.1 protein_id gnl|my_center|LOCUS_02600 279000 277465 gene locus_tag LOCUS_02610 279000 277465 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866976.1 protein_id gnl|my_center|LOCUS_02610 279070 279570 gene locus_tag LOCUS_02620 gene ybaK 279070 279570 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229713.1 protein_id gnl|my_center|LOCUS_02620 >Feature sequence02 6418 4208 gene locus_tag LOCUS_02630 6418 4208 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223681.1 protein_id gnl|my_center|LOCUS_02630 7520 6492 gene locus_tag LOCUS_02640 7520 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 7621 9150 gene locus_tag LOCUS_02650 gene purD 7621 9150 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_02650 9179 10084 gene locus_tag LOCUS_02660 9179 10084 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974901.1 protein_id gnl|my_center|LOCUS_02660 11297 10110 gene locus_tag LOCUS_02670 11297 10110 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419356.1 protein_id gnl|my_center|LOCUS_02670 12141 11335 gene locus_tag LOCUS_02680 12141 11335 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028594.1 protein_id gnl|my_center|LOCUS_02680 12888 12151 gene locus_tag LOCUS_02690 12888 12151 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367926.1 protein_id gnl|my_center|LOCUS_02690 13001 13372 gene locus_tag LOCUS_02700 13001 13372 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284386.1 protein_id gnl|my_center|LOCUS_02700 13441 13677 gene locus_tag LOCUS_02710 13441 13677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 13687 13911 gene locus_tag LOCUS_02720 13687 13911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 13986 15674 gene locus_tag LOCUS_02730 gene purF 13986 15674 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804524.1 protein_id gnl|my_center|LOCUS_02730 17564 15804 gene locus_tag LOCUS_02740 17564 15804 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971843.1 protein_id gnl|my_center|LOCUS_02740 17666 18781 gene locus_tag LOCUS_02750 gene purM 17666 18781 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804525.1 protein_id gnl|my_center|LOCUS_02750 19499 18921 gene locus_tag LOCUS_02760 19499 18921 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888647.1 protein_id gnl|my_center|LOCUS_02760 19583 19813 gene locus_tag LOCUS_02770 19583 19813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 20390 19800 gene locus_tag LOCUS_02780 20390 19800 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777028.1 protein_id gnl|my_center|LOCUS_02780 21949 20390 gene locus_tag LOCUS_02790 21949 20390 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777024.1 protein_id gnl|my_center|LOCUS_02790 22272 22075 gene locus_tag LOCUS_02800 22272 22075 CDS product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804526.1 protein_id gnl|my_center|LOCUS_02800 22600 22794 gene locus_tag LOCUS_02810 gene bldC 22600 22794 CDS product developmental transcriptional regulator BldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949541.1 protein_id gnl|my_center|LOCUS_02810 22807 23325 gene locus_tag LOCUS_02820 22807 23325 CDS product DUF664 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224874.1 protein_id gnl|my_center|LOCUS_02820 23333 24535 gene locus_tag LOCUS_02830 23333 24535 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015900.1 protein_id gnl|my_center|LOCUS_02830 25032 24556 gene locus_tag LOCUS_02840 25032 24556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 26293 25043 gene locus_tag LOCUS_02850 gene ilvA 26293 25043 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223532.1 protein_id gnl|my_center|LOCUS_02850 26765 26379 gene locus_tag LOCUS_02860 gene trxA 26765 26379 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224532.1 protein_id gnl|my_center|LOCUS_02860 26993 28999 gene locus_tag LOCUS_02870 26993 28999 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110220.1 protein_id gnl|my_center|LOCUS_02870 28996 29805 gene locus_tag LOCUS_02880 28996 29805 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111618.1 protein_id gnl|my_center|LOCUS_02880 30313 29789 gene locus_tag LOCUS_02890 30313 29789 CDS product DUF3995 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887751.1 protein_id gnl|my_center|LOCUS_02890 30456 30737 gene locus_tag LOCUS_02900 30456 30737 CDS product DUF2218 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080013.1 protein_id gnl|my_center|LOCUS_02900 30865 31011 gene locus_tag LOCUS_02910 30865 31011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 31090 31821 gene locus_tag LOCUS_02920 31090 31821 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804566.1 protein_id gnl|my_center|LOCUS_02920 31821 34355 gene locus_tag LOCUS_02930 31821 34355 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804565.1 protein_id gnl|my_center|LOCUS_02930 34394 34882 gene locus_tag LOCUS_02940 34394 34882 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899982.1 protein_id gnl|my_center|LOCUS_02940 34894 36087 gene locus_tag LOCUS_02950 34894 36087 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973241.1 protein_id gnl|my_center|LOCUS_02950 36084 36584 gene locus_tag LOCUS_02960 36084 36584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 36827 38377 gene locus_tag LOCUS_02970 36827 38377 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726673.1 protein_id gnl|my_center|LOCUS_02970 38374 39810 gene locus_tag LOCUS_02980 gene pntB 38374 39810 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729555.1 protein_id gnl|my_center|LOCUS_02980 40006 40842 gene locus_tag LOCUS_02990 40006 40842 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_02990 40848 43385 gene locus_tag LOCUS_03000 40848 43385 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975721.1 protein_id gnl|my_center|LOCUS_03000 45450 43726 gene locus_tag LOCUS_03010 45450 43726 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350815.1 protein_id gnl|my_center|LOCUS_03010 46328 45573 gene locus_tag LOCUS_03020 46328 45573 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 protein_id gnl|my_center|LOCUS_03020 46602 46528 gene locus_tag LOCUS_t00070 46602 46528 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 46831 46757 gene locus_tag LOCUS_t00080 46831 46757 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 46924 46851 gene locus_tag LOCUS_t00090 46924 46851 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 47452 47072 gene locus_tag LOCUS_03030 47452 47072 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027943.1 protein_id gnl|my_center|LOCUS_03030 48375 47449 gene locus_tag LOCUS_03040 48375 47449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 49295 48387 gene locus_tag LOCUS_03050 49295 48387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 50440 49397 gene locus_tag LOCUS_03060 50440 49397 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869314.1 protein_id gnl|my_center|LOCUS_03060 50836 50456 gene locus_tag LOCUS_03070 50836 50456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 51937 50864 gene locus_tag LOCUS_03080 51937 50864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 52013 52546 gene locus_tag LOCUS_03090 52013 52546 CDS product glycine cleavage system regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775899.1 protein_id gnl|my_center|LOCUS_03090 52703 53959 gene locus_tag LOCUS_03100 52703 53959 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222356.1 protein_id gnl|my_center|LOCUS_03100 54159 56264 gene locus_tag LOCUS_03110 54159 56264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 57801 56365 gene locus_tag LOCUS_03120 57801 56365 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164279790.1 protein_id gnl|my_center|LOCUS_03120 58243 57842 gene locus_tag LOCUS_03130 58243 57842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 58362 58838 gene locus_tag LOCUS_03140 58362 58838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 59257 58835 gene locus_tag LOCUS_03150 59257 58835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495154.1 protein_id gnl|my_center|LOCUS_03150 59578 59348 gene locus_tag LOCUS_03160 59578 59348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 59577 59888 gene locus_tag LOCUS_03170 59577 59888 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899493.1 protein_id gnl|my_center|LOCUS_03170 59909 60865 gene locus_tag LOCUS_03180 59909 60865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03180 61037 60964 gene locus_tag LOCUS_t00100 61037 60964 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 61127 61702 gene locus_tag LOCUS_03190 61127 61702 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199702189.1 protein_id gnl|my_center|LOCUS_03190 63304 61721 gene locus_tag LOCUS_03200 gene hutH 63304 61721 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727479.1 protein_id gnl|my_center|LOCUS_03200 64317 63301 gene locus_tag LOCUS_03210 gene hutG 64317 63301 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777037.1 protein_id gnl|my_center|LOCUS_03210 64407 65174 gene locus_tag LOCUS_03220 64407 65174 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157773333.1 protein_id gnl|my_center|LOCUS_03220 65320 67011 gene locus_tag LOCUS_03230 65320 67011 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777035.1 protein_id gnl|my_center|LOCUS_03230 67011 68246 gene locus_tag LOCUS_03240 gene hutI 67011 68246 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223171.1 protein_id gnl|my_center|LOCUS_03240 69574 68357 gene locus_tag LOCUS_03250 69574 68357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 70530 69685 gene locus_tag LOCUS_03260 70530 69685 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776954.1 protein_id gnl|my_center|LOCUS_03260 70586 71188 gene locus_tag LOCUS_03270 70586 71188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804371.1 protein_id gnl|my_center|LOCUS_03270 71719 71504 gene locus_tag LOCUS_03280 71719 71504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 71879 72064 gene locus_tag LOCUS_03290 71879 72064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 72248 73384 gene locus_tag LOCUS_03300 gene pstS 72248 73384 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730786.1 protein_id gnl|my_center|LOCUS_03300 73475 74488 gene locus_tag LOCUS_03310 gene pstC 73475 74488 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112723.1 protein_id gnl|my_center|LOCUS_03310 74485 75414 gene locus_tag LOCUS_03320 gene pstA 74485 75414 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230713.1 protein_id gnl|my_center|LOCUS_03320 75473 76249 gene locus_tag LOCUS_03330 gene pstB 75473 76249 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230712.1 protein_id gnl|my_center|LOCUS_03330 77338 76394 gene locus_tag LOCUS_03340 77338 76394 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776549.1 protein_id gnl|my_center|LOCUS_03340 79631 77361 gene locus_tag LOCUS_03350 79631 77361 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 protein_id gnl|my_center|LOCUS_03350 80587 79676 gene locus_tag LOCUS_03360 gene mshD 80587 79676 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974818.1 protein_id gnl|my_center|LOCUS_03360 81285 80584 gene locus_tag LOCUS_03370 gene glnR 81285 80584 CDS product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 protein_id gnl|my_center|LOCUS_03370 81306 81599 gene locus_tag LOCUS_03380 81306 81599 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230244.1 protein_id gnl|my_center|LOCUS_03380 81613 82455 gene locus_tag LOCUS_03390 81613 82455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 82872 82510 gene locus_tag LOCUS_03400 82872 82510 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974797.1 protein_id gnl|my_center|LOCUS_03400 82895 83398 gene locus_tag LOCUS_03410 82895 83398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 83402 83848 gene locus_tag LOCUS_03420 83402 83848 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_03420 83845 84957 gene locus_tag LOCUS_03430 83845 84957 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974789.1 protein_id gnl|my_center|LOCUS_03430 85179 85751 gene locus_tag LOCUS_03440 85179 85751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 85761 86630 gene locus_tag LOCUS_03450 85761 86630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 86750 87721 gene locus_tag LOCUS_03460 86750 87721 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 protein_id gnl|my_center|LOCUS_03460 87721 88146 gene locus_tag LOCUS_03470 gene dtd 87721 88146 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804517.1 protein_id gnl|my_center|LOCUS_03470 88200 88502 gene locus_tag LOCUS_03480 88200 88502 CDS product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776557.1 protein_id gnl|my_center|LOCUS_03480 88536 88934 gene locus_tag LOCUS_03490 88536 88934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 89734 88889 gene locus_tag LOCUS_03500 89734 88889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974768.1 protein_id gnl|my_center|LOCUS_03500 89812 90522 gene locus_tag LOCUS_03510 89812 90522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 90547 91851 gene locus_tag LOCUS_03520 gene mshA 90547 91851 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742053.1 protein_id gnl|my_center|LOCUS_03520 92178 91858 gene locus_tag LOCUS_03530 92178 91858 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776253.1 protein_id gnl|my_center|LOCUS_03530 92228 92809 gene locus_tag LOCUS_03540 92228 92809 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974766.1 protein_id gnl|my_center|LOCUS_03540 92819 93562 gene locus_tag LOCUS_03550 92819 93562 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804515.1 protein_id gnl|my_center|LOCUS_03550 95586 93643 gene locus_tag LOCUS_03560 95586 93643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 96472 95741 gene locus_tag LOCUS_03570 gene phoU 96472 95741 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_03570 96639 97895 gene locus_tag LOCUS_03580 96639 97895 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_03580 97892 98575 gene locus_tag LOCUS_03590 97892 98575 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_03590 99167 98649 gene locus_tag LOCUS_03600 99167 98649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 99513 99995 gene locus_tag LOCUS_03610 99513 99995 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804554.1 protein_id gnl|my_center|LOCUS_03610 100067 100750 gene locus_tag LOCUS_03620 gene ispD 100067 100750 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731019.1 protein_id gnl|my_center|LOCUS_03620 100775 101266 gene locus_tag LOCUS_03630 gene ispF 100775 101266 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804549.1 protein_id gnl|my_center|LOCUS_03630 102106 101726 gene locus_tag LOCUS_03640 102106 101726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 102291 103376 gene locus_tag LOCUS_03650 102291 103376 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_03650 103373 104056 gene locus_tag LOCUS_03660 103373 104056 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089210.1 protein_id gnl|my_center|LOCUS_03660 104226 105680 gene locus_tag LOCUS_03670 gene cysS 104226 105680 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 protein_id gnl|my_center|LOCUS_03670 105680 106654 gene locus_tag LOCUS_03680 gene rlmB 105680 106654 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230407.1 protein_id gnl|my_center|LOCUS_03680 106837 107265 gene locus_tag LOCUS_03690 106837 107265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 107273 107716 gene locus_tag LOCUS_03700 107273 107716 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028111.1 protein_id gnl|my_center|LOCUS_03700 108780 107887 gene locus_tag LOCUS_03710 108780 107887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 110198 108954 gene locus_tag LOCUS_03720 110198 108954 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804886.1 protein_id gnl|my_center|LOCUS_03720 111379 110279 gene locus_tag LOCUS_03730 gene ugpC 111379 110279 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804887.1 protein_id gnl|my_center|LOCUS_03730 111635 112063 gene locus_tag LOCUS_03740 111635 112063 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224278.1 protein_id gnl|my_center|LOCUS_03740 112203 114152 gene locus_tag LOCUS_03750 112203 114152 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009482185.1 protein_id gnl|my_center|LOCUS_03750 112804 112883 gene locus_tag LOCUS_t00110 112804 112883 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 114149 115810 gene locus_tag LOCUS_03760 114149 115810 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230391.1 protein_id gnl|my_center|LOCUS_03760 116223 116951 gene locus_tag LOCUS_03770 116223 116951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 117759 117100 gene locus_tag LOCUS_03780 117759 117100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 117849 118727 gene locus_tag LOCUS_03790 117849 118727 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228542.1 protein_id gnl|my_center|LOCUS_03790 118724 120160 gene locus_tag LOCUS_03800 118724 120160 CDS product multidrug efflux ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950505.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03800 120064 120318 gene locus_tag LOCUS_03810 120064 120318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 120665 121402 gene locus_tag LOCUS_03820 120665 121402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 121567 122130 gene locus_tag LOCUS_03830 121567 122130 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484893.1 protein_id gnl|my_center|LOCUS_03830 122561 122488 gene locus_tag LOCUS_t00120 122561 122488 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 123132 122659 gene locus_tag LOCUS_03840 123132 122659 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286612.1 protein_id gnl|my_center|LOCUS_03840 123352 124893 gene locus_tag LOCUS_03850 123352 124893 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405217.1 protein_id gnl|my_center|LOCUS_03850 124918 126180 gene locus_tag LOCUS_03860 124918 126180 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731181.1 protein_id gnl|my_center|LOCUS_03860 127833 126274 gene locus_tag LOCUS_03870 127833 126274 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731469.1 protein_id gnl|my_center|LOCUS_03870 127992 128738 gene locus_tag LOCUS_03880 127992 128738 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898096.1 protein_id gnl|my_center|LOCUS_03880 128731 129495 gene locus_tag LOCUS_03890 128731 129495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 129652 130857 gene locus_tag LOCUS_03900 129652 130857 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731466.1 protein_id gnl|my_center|LOCUS_03900 130920 131108 gene locus_tag LOCUS_03910 130920 131108 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898093.1 protein_id gnl|my_center|LOCUS_03910 131111 132325 gene locus_tag LOCUS_03920 131111 132325 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727657.1 protein_id gnl|my_center|LOCUS_03920 132397 133779 gene locus_tag LOCUS_03930 132397 133779 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731465.1 protein_id gnl|my_center|LOCUS_03930 133776 134486 gene locus_tag LOCUS_03940 133776 134486 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898091.1 protein_id gnl|my_center|LOCUS_03940 134483 135196 gene locus_tag LOCUS_03950 134483 135196 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731464.1 protein_id gnl|my_center|LOCUS_03950 135193 136032 gene locus_tag LOCUS_03960 135193 136032 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898089.1 protein_id gnl|my_center|LOCUS_03960 136064 137497 gene locus_tag LOCUS_03970 gene hemG 136064 137497 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_03970 137657 137833 gene locus_tag LOCUS_03980 137657 137833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 138714 137950 gene locus_tag LOCUS_03990 138714 137950 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225704.1 protein_id gnl|my_center|LOCUS_03990 138848 139726 gene locus_tag LOCUS_04000 138848 139726 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898763.1 protein_id gnl|my_center|LOCUS_04000 139723 140667 gene locus_tag LOCUS_04010 139723 140667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 140730 142448 gene locus_tag LOCUS_04020 140730 142448 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407366.1 protein_id gnl|my_center|LOCUS_04020 143705 142545 gene locus_tag LOCUS_04030 143705 142545 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891441.1 protein_id gnl|my_center|LOCUS_04030 144589 143780 gene locus_tag LOCUS_04040 144589 143780 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972223.1 protein_id gnl|my_center|LOCUS_04040 145263 144586 gene locus_tag LOCUS_04050 145263 144586 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223644.1 protein_id gnl|my_center|LOCUS_04050 145439 146083 gene locus_tag LOCUS_04060 145439 146083 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014416.1 protein_id gnl|my_center|LOCUS_04060 146093 146740 gene locus_tag LOCUS_04070 146093 146740 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393503.1 protein_id gnl|my_center|LOCUS_04070 146765 148132 gene locus_tag LOCUS_04080 146765 148132 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929838.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04080 148261 148599 gene locus_tag LOCUS_04090 148261 148599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 148708 149736 gene locus_tag LOCUS_04100 148708 149736 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028819.1 protein_id gnl|my_center|LOCUS_04100 150571 149825 gene locus_tag LOCUS_04110 150571 149825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 150965 150666 gene locus_tag LOCUS_04120 150965 150666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 152195 150978 gene locus_tag LOCUS_04130 152195 150978 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098430.1 protein_id gnl|my_center|LOCUS_04130 153618 152314 gene locus_tag LOCUS_04140 153618 152314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 154043 153615 gene locus_tag LOCUS_04150 154043 153615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 154124 154588 gene locus_tag LOCUS_04160 154124 154588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 154783 156408 gene locus_tag LOCUS_04170 gene groL 154783 156408 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_04170 156825 156535 gene locus_tag LOCUS_04180 156825 156535 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053189.1 protein_id gnl|my_center|LOCUS_04180 158885 156840 gene locus_tag LOCUS_04190 158885 156840 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112452.1 protein_id gnl|my_center|LOCUS_04190 159812 159003 gene locus_tag LOCUS_04200 159812 159003 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228103.1 protein_id gnl|my_center|LOCUS_04200 162062 159993 gene locus_tag LOCUS_04210 162062 159993 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029575.1 protein_id gnl|my_center|LOCUS_04210 163529 162228 gene locus_tag LOCUS_04220 163529 162228 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930000.1 protein_id gnl|my_center|LOCUS_04220 165104 163653 gene locus_tag LOCUS_04230 gene phoR 165104 163653 CDS product sensory box histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916717.1 protein_id gnl|my_center|LOCUS_04230 165811 165104 gene locus_tag LOCUS_04240 165811 165104 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804420.1 protein_id gnl|my_center|LOCUS_04240 166153 165893 gene locus_tag LOCUS_04250 166153 165893 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978241.1 protein_id gnl|my_center|LOCUS_04250 167967 166324 gene locus_tag LOCUS_04260 167967 166324 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063651.1 protein_id gnl|my_center|LOCUS_04260 168680 167988 gene locus_tag LOCUS_04270 168680 167988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 168837 169769 gene locus_tag LOCUS_04280 168837 169769 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223361.1 protein_id gnl|my_center|LOCUS_04280 172347 170092 gene locus_tag LOCUS_04290 172347 170092 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230251.1 protein_id gnl|my_center|LOCUS_04290 172385 173290 gene locus_tag LOCUS_04300 172385 173290 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230161.1 protein_id gnl|my_center|LOCUS_04300 174563 173265 gene locus_tag LOCUS_04310 174563 173265 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029449.1 protein_id gnl|my_center|LOCUS_04310 174681 175076 gene locus_tag LOCUS_04320 174681 175076 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230216.1 protein_id gnl|my_center|LOCUS_04320 175079 175813 gene locus_tag LOCUS_04330 175079 175813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 176111 175839 gene locus_tag LOCUS_04340 176111 175839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 176187 177692 gene locus_tag LOCUS_04350 176187 177692 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804962.1 protein_id gnl|my_center|LOCUS_04350 177840 178268 gene locus_tag LOCUS_04360 177840 178268 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027124.1 protein_id gnl|my_center|LOCUS_04360 178265 179554 gene locus_tag LOCUS_04370 178265 179554 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_04370 180882 179761 gene locus_tag LOCUS_04380 gene serC 180882 179761 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072623621.1 protein_id gnl|my_center|LOCUS_04380 181622 180984 gene locus_tag LOCUS_04390 181622 180984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 182529 181630 gene locus_tag LOCUS_04400 gene ccsB 182529 181630 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393687.1 protein_id gnl|my_center|LOCUS_04400 184011 182533 gene locus_tag LOCUS_04410 184011 182533 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941275.1 protein_id gnl|my_center|LOCUS_04410 184751 184014 gene locus_tag LOCUS_04420 184751 184014 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086292.1 protein_id gnl|my_center|LOCUS_04420 185674 184757 gene locus_tag LOCUS_04430 185674 184757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 185558 185830 gene locus_tag LOCUS_04440 185558 185830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 187613 186204 gene locus_tag LOCUS_04450 187613 186204 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810724.1 protein_id gnl|my_center|LOCUS_04450 188160 187672 gene locus_tag LOCUS_04460 188160 187672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 189133 188447 gene locus_tag LOCUS_04470 189133 188447 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_04470 190119 189130 gene locus_tag LOCUS_04480 190119 189130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 191516 190386 gene locus_tag LOCUS_04490 191516 190386 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029624.1 protein_id gnl|my_center|LOCUS_04490 191696 192289 gene locus_tag LOCUS_04500 191696 192289 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326845.1 protein_id gnl|my_center|LOCUS_04500 192346 193623 gene locus_tag LOCUS_04510 192346 193623 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092746.1 protein_id gnl|my_center|LOCUS_04510 193760 194305 gene locus_tag LOCUS_04520 193760 194305 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977487.1 protein_id gnl|my_center|LOCUS_04520 195265 194372 gene locus_tag LOCUS_04530 gene ppk2 195265 194372 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776404.1 protein_id gnl|my_center|LOCUS_04530 198199 195302 gene locus_tag LOCUS_04540 198199 195302 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138169592.1 protein_id gnl|my_center|LOCUS_04540 199535 198249 gene locus_tag LOCUS_04550 199535 198249 CDS product hydroxyacid-oxoacid transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_04550 199556 199936 gene locus_tag LOCUS_04560 199556 199936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 199933 200688 gene locus_tag LOCUS_04570 199933 200688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 200774 201040 gene locus_tag LOCUS_04580 200774 201040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 201037 201765 gene locus_tag LOCUS_04590 201037 201765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 201762 202316 gene locus_tag LOCUS_04600 201762 202316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 202356 202751 gene locus_tag LOCUS_04610 202356 202751 CDS product DUF3224 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775867.1 protein_id gnl|my_center|LOCUS_04610 203873 202956 gene locus_tag LOCUS_04620 203873 202956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 204783 204028 gene locus_tag LOCUS_04630 204783 204028 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975536.1 protein_id gnl|my_center|LOCUS_04630 205573 204824 gene locus_tag LOCUS_04640 205573 204824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088487.1 protein_id gnl|my_center|LOCUS_04640 205613 206011 gene locus_tag LOCUS_04650 205613 206011 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027070.1 protein_id gnl|my_center|LOCUS_04650 206008 207237 gene locus_tag LOCUS_04660 206008 207237 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814398.1 protein_id gnl|my_center|LOCUS_04660 207719 207285 gene locus_tag LOCUS_04670 207719 207285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 207631 208110 gene locus_tag LOCUS_04680 207631 208110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 208207 208896 gene locus_tag LOCUS_04690 208207 208896 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 protein_id gnl|my_center|LOCUS_04690 209177 210148 gene locus_tag LOCUS_04700 209177 210148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 210229 210942 gene locus_tag LOCUS_04710 210229 210942 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015217.1 protein_id gnl|my_center|LOCUS_04710 211472 210951 gene locus_tag LOCUS_04720 211472 210951 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776976.1 protein_id gnl|my_center|LOCUS_04720 211688 212593 gene locus_tag LOCUS_04730 211688 212593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 212864 212679 gene locus_tag LOCUS_04740 212864 212679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 213616 212960 gene locus_tag LOCUS_04750 213616 212960 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_04750 214967 213609 gene locus_tag LOCUS_04760 214967 213609 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_04760 216364 215012 gene locus_tag LOCUS_04770 216364 215012 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_04770 217854 216448 gene locus_tag LOCUS_04780 217854 216448 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406218.1 protein_id gnl|my_center|LOCUS_04780 218308 217961 gene locus_tag LOCUS_04790 218308 217961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 218892 218362 gene locus_tag LOCUS_04800 218892 218362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 219153 219785 gene locus_tag LOCUS_04810 219153 219785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 220434 219775 gene locus_tag LOCUS_04820 220434 219775 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908001.1 protein_id gnl|my_center|LOCUS_04820 220693 220487 gene locus_tag LOCUS_04830 220693 220487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 221105 220782 gene locus_tag LOCUS_04840 221105 220782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 221608 221533 gene locus_tag LOCUS_t00130 221608 221533 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 221745 222821 gene locus_tag LOCUS_04850 221745 222821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 223532 222867 gene locus_tag LOCUS_04860 223532 222867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 223798 224574 gene locus_tag LOCUS_04870 223798 224574 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229505.1 protein_id gnl|my_center|LOCUS_04870 224642 225985 gene locus_tag LOCUS_04880 224642 225985 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902466.1 protein_id gnl|my_center|LOCUS_04880 227120 225912 gene locus_tag LOCUS_04890 227120 225912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 227404 228627 gene locus_tag LOCUS_04900 227404 228627 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031183.1 protein_id gnl|my_center|LOCUS_04900 228678 230870 gene locus_tag LOCUS_04910 228678 230870 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229635.1 protein_id gnl|my_center|LOCUS_04910 231024 234758 gene locus_tag LOCUS_04920 231024 234758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 234755 235036 gene locus_tag LOCUS_04930 234755 235036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 235873 235514 gene locus_tag LOCUS_04940 gene mscL 235873 235514 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804921.1 protein_id gnl|my_center|LOCUS_04940 236945 236178 gene locus_tag LOCUS_04950 236945 236178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 237810 236953 gene locus_tag LOCUS_04960 237810 236953 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 protein_id gnl|my_center|LOCUS_04960 238196 237849 gene locus_tag LOCUS_04970 238196 237849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 238833 238246 gene locus_tag LOCUS_04980 238833 238246 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030525.1 protein_id gnl|my_center|LOCUS_04980 238994 239446 gene locus_tag LOCUS_04990 238994 239446 CDS product DUF2871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831504.1 protein_id gnl|my_center|LOCUS_04990 239443 241110 gene locus_tag LOCUS_05000 239443 241110 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777012.1 protein_id gnl|my_center|LOCUS_05000 242590 241076 gene locus_tag LOCUS_05010 242590 241076 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975632.1 protein_id gnl|my_center|LOCUS_05010 242637 245252 gene locus_tag LOCUS_05020 242637 245252 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_05020 245870 245268 gene locus_tag LOCUS_05030 245870 245268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 245934 246857 gene locus_tag LOCUS_05040 gene galU 245934 246857 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 protein_id gnl|my_center|LOCUS_05040 246854 248119 gene locus_tag LOCUS_05050 246854 248119 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_05050 248291 248788 gene locus_tag LOCUS_05060 gene moaC 248291 248788 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_05060 248785 249279 gene locus_tag LOCUS_05070 248785 249279 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 protein_id gnl|my_center|LOCUS_05070 249311 249913 gene locus_tag LOCUS_05080 249311 249913 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_05080 249949 250968 gene locus_tag LOCUS_05090 249949 250968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 251448 250972 gene locus_tag LOCUS_05100 251448 250972 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029305.1 protein_id gnl|my_center|LOCUS_05100 252625 251441 gene locus_tag LOCUS_05110 252625 251441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 252726 252801 gene locus_tag LOCUS_t00140 252726 252801 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 253035 253775 gene locus_tag LOCUS_05120 253035 253775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05120 254624 254094 gene locus_tag LOCUS_05130 254624 254094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 255328 254711 gene locus_tag LOCUS_05140 255328 254711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 258968 255441 gene locus_tag LOCUS_05150 258968 255441 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730276.1 protein_id gnl|my_center|LOCUS_05150 260573 259017 gene locus_tag LOCUS_05160 260573 259017 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 protein_id gnl|my_center|LOCUS_05160 260623 261468 gene locus_tag LOCUS_05170 gene rsmI 260623 261468 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_05170 261677 262321 gene locus_tag LOCUS_05180 261677 262321 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225081.1 protein_id gnl|my_center|LOCUS_05180 262326 264332 gene locus_tag LOCUS_05190 262326 264332 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977936.1 protein_id gnl|my_center|LOCUS_05190 264329 265072 gene locus_tag LOCUS_05200 264329 265072 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_05200 266230 265292 gene locus_tag LOCUS_05210 266230 265292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727284.1 protein_id gnl|my_center|LOCUS_05210 266455 267327 gene locus_tag LOCUS_05220 gene nadE 266455 267327 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027169.1 protein_id gnl|my_center|LOCUS_05220 268194 267403 gene locus_tag LOCUS_05230 268194 267403 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027753.1 protein_id gnl|my_center|LOCUS_05230 268774 268166 gene locus_tag LOCUS_05240 268774 268166 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896486.1 protein_id gnl|my_center|LOCUS_05240 268837 270633 gene locus_tag LOCUS_05250 gene metG 268837 270633 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775786.1 protein_id gnl|my_center|LOCUS_05250 270639 271493 gene locus_tag LOCUS_05260 270639 271493 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 protein_id gnl|my_center|LOCUS_05260 271695 272963 gene locus_tag LOCUS_05270 271695 272963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 272979 273872 gene locus_tag LOCUS_05280 gene rsmA 272979 273872 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_05280 >Feature sequence03 374 57 gene locus_tag LOCUS_05290 gene wblA 374 57 CDS product transcriptional regulator WblA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029097.1 protein_id gnl|my_center|LOCUS_05290 794 3286 gene locus_tag LOCUS_05300 794 3286 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_05300 3841 3377 gene locus_tag LOCUS_05310 3841 3377 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 protein_id gnl|my_center|LOCUS_05310 3911 4840 gene locus_tag LOCUS_05320 3911 4840 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899637.1 protein_id gnl|my_center|LOCUS_05320 5010 5086 gene locus_tag LOCUS_t00150 5010 5086 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5196 6230 gene locus_tag LOCUS_05330 5196 6230 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405716.1 protein_id gnl|my_center|LOCUS_05330 6331 7560 gene locus_tag LOCUS_05340 6331 7560 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803968.1 protein_id gnl|my_center|LOCUS_05340 7779 8213 gene locus_tag LOCUS_05350 7779 8213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 9434 8235 gene locus_tag LOCUS_05360 9434 8235 CDS product pyrophosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922349.1 protein_id gnl|my_center|LOCUS_05360 10413 9547 gene locus_tag LOCUS_05370 10413 9547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 11722 10640 gene locus_tag LOCUS_05380 11722 10640 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975325.1 protein_id gnl|my_center|LOCUS_05380 12997 11729 gene locus_tag LOCUS_05390 12997 11729 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 protein_id gnl|my_center|LOCUS_05390 13684 13130 gene locus_tag LOCUS_05400 13684 13130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 14276 13677 gene locus_tag LOCUS_05410 gene recR 14276 13677 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_05410 17073 14521 gene locus_tag LOCUS_05420 17073 14521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 17161 17733 gene locus_tag LOCUS_05430 17161 17733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 17730 18185 gene locus_tag LOCUS_05440 17730 18185 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804014.1 protein_id gnl|my_center|LOCUS_05440 18398 19618 gene locus_tag LOCUS_05450 18398 19618 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329124.1 protein_id gnl|my_center|LOCUS_05450 19668 19755 gene locus_tag LOCUS_t00160 19668 19755 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19792 20286 gene locus_tag LOCUS_05460 19792 20286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 20421 22322 gene locus_tag LOCUS_05470 20421 22322 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896800.1 protein_id gnl|my_center|LOCUS_05470 22471 23340 gene locus_tag LOCUS_05480 22471 23340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05480 23512 24435 gene locus_tag LOCUS_05490 23512 24435 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029931.1 protein_id gnl|my_center|LOCUS_05490 24551 24339 gene locus_tag LOCUS_05500 24551 24339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 24550 25788 gene locus_tag LOCUS_05510 24550 25788 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_05510 25877 28156 gene locus_tag LOCUS_05520 25877 28156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 29924 28239 gene locus_tag LOCUS_05530 29924 28239 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730039.1 protein_id gnl|my_center|LOCUS_05530 29947 30243 gene locus_tag LOCUS_05540 29947 30243 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003999914.1 protein_id gnl|my_center|LOCUS_05540 30348 30875 gene locus_tag LOCUS_05550 30348 30875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 31014 32525 gene locus_tag LOCUS_05560 31014 32525 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728196.1 protein_id gnl|my_center|LOCUS_05560 32604 32927 gene locus_tag LOCUS_05570 32604 32927 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089857.1 protein_id gnl|my_center|LOCUS_05570 33002 34006 gene locus_tag LOCUS_05580 gene fgd 33002 34006 CDS product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062430.1 protein_id gnl|my_center|LOCUS_05580 35178 34165 gene locus_tag LOCUS_05590 35178 34165 CDS product DUF3533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031515.1 protein_id gnl|my_center|LOCUS_05590 35272 35829 gene locus_tag LOCUS_05600 35272 35829 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014502.1 protein_id gnl|my_center|LOCUS_05600 36908 35886 gene locus_tag LOCUS_05610 36908 35886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211410235.1 protein_id gnl|my_center|LOCUS_05610 37192 37758 gene locus_tag LOCUS_05620 37192 37758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 37755 38081 gene locus_tag LOCUS_05630 37755 38081 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403775.1 protein_id gnl|my_center|LOCUS_05630 38460 38194 gene locus_tag LOCUS_05640 38460 38194 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056989.1 protein_id gnl|my_center|LOCUS_05640 39649 38558 gene locus_tag LOCUS_05650 39649 38558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 40465 39719 gene locus_tag LOCUS_05660 40465 39719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 40587 41510 gene locus_tag LOCUS_05670 40587 41510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 41638 41549 gene locus_tag LOCUS_t00170 41638 41549 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 41828 42802 gene locus_tag LOCUS_05680 41828 42802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730680.1 protein_id gnl|my_center|LOCUS_05680 43507 43022 gene locus_tag LOCUS_05690 43507 43022 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056534.1 protein_id gnl|my_center|LOCUS_05690 43524 44162 gene locus_tag LOCUS_05700 gene upp 43524 44162 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974921.1 protein_id gnl|my_center|LOCUS_05700 44359 44529 gene locus_tag LOCUS_05710 44359 44529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 44544 45398 gene locus_tag LOCUS_05720 44544 45398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 45483 46979 gene locus_tag LOCUS_05730 45483 46979 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972907.1 protein_id gnl|my_center|LOCUS_05730 47078 48337 gene locus_tag LOCUS_05740 47078 48337 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168581903.1 protein_id gnl|my_center|LOCUS_05740 49395 48484 gene locus_tag LOCUS_05750 49395 48484 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228102.1 protein_id gnl|my_center|LOCUS_05750 50722 49613 gene locus_tag LOCUS_05760 50722 49613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 52551 50917 gene locus_tag LOCUS_05770 52551 50917 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230221.1 protein_id gnl|my_center|LOCUS_05770 53408 52704 gene locus_tag LOCUS_05780 53408 52704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 54487 53528 gene locus_tag LOCUS_05790 54487 53528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 55548 54484 gene locus_tag LOCUS_05800 55548 54484 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119846.1 protein_id gnl|my_center|LOCUS_05800 56483 55557 gene locus_tag LOCUS_05810 56483 55557 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123665.1 protein_id gnl|my_center|LOCUS_05810 56587 57771 gene locus_tag LOCUS_05820 56587 57771 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226129.1 protein_id gnl|my_center|LOCUS_05820 57768 58484 gene locus_tag LOCUS_05830 57768 58484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 58494 60848 gene locus_tag LOCUS_05840 58494 60848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 62491 61016 gene locus_tag LOCUS_05850 gene phoA 62491 61016 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001351506.1 protein_id gnl|my_center|LOCUS_05850 62706 63923 gene locus_tag LOCUS_05860 62706 63923 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004657364.1 protein_id gnl|my_center|LOCUS_05860 65720 63972 gene locus_tag LOCUS_05870 65720 63972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 67165 65780 gene locus_tag LOCUS_05880 67165 65780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 68100 67168 gene locus_tag LOCUS_05890 68100 67168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 69119 68124 gene locus_tag LOCUS_05900 gene ligD 69119 68124 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226451.1 protein_id gnl|my_center|LOCUS_05900 70437 69160 gene locus_tag LOCUS_05910 70437 69160 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229645.1 protein_id gnl|my_center|LOCUS_05910 71793 70456 gene locus_tag LOCUS_05920 71793 70456 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229644.1 protein_id gnl|my_center|LOCUS_05920 71971 72396 gene locus_tag LOCUS_05930 71971 72396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 72393 72716 gene locus_tag LOCUS_05940 72393 72716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 73166 72792 gene locus_tag LOCUS_05950 73166 72792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 73327 74235 gene locus_tag LOCUS_05960 73327 74235 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_05960 74393 74320 gene locus_tag LOCUS_t00180 74393 74320 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 74726 75715 gene locus_tag LOCUS_05970 74726 75715 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817250.1 protein_id gnl|my_center|LOCUS_05970 76009 77865 gene locus_tag LOCUS_05980 76009 77865 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401212.1 protein_id gnl|my_center|LOCUS_05980 78608 77931 gene locus_tag LOCUS_05990 78608 77931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 78771 79520 gene locus_tag LOCUS_06000 78771 79520 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863629.1 protein_id gnl|my_center|LOCUS_06000 79532 81019 gene locus_tag LOCUS_06010 79532 81019 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876236.1 protein_id gnl|my_center|LOCUS_06010 81098 83143 gene locus_tag LOCUS_06020 81098 83143 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113349.1 protein_id gnl|my_center|LOCUS_06020 83181 84434 gene locus_tag LOCUS_06030 83181 84434 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029389.1 protein_id gnl|my_center|LOCUS_06030 85917 84505 gene locus_tag LOCUS_06040 85917 84505 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258343.1 protein_id gnl|my_center|LOCUS_06040 86528 86007 gene locus_tag LOCUS_06050 86528 86007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 87703 86681 gene locus_tag LOCUS_06060 87703 86681 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804077.1 protein_id gnl|my_center|LOCUS_06060 87995 87901 gene locus_tag LOCUS_t00190 87995 87901 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 89496 88045 gene locus_tag LOCUS_06070 89496 88045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 90040 89834 gene locus_tag LOCUS_06080 90040 89834 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_06080 91258 90311 gene locus_tag LOCUS_06090 gene folP 91258 90311 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296421.1 protein_id gnl|my_center|LOCUS_06090 91373 91284 gene locus_tag LOCUS_t00200 91373 91284 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 91536 91871 gene locus_tag LOCUS_06100 91536 91871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 92675 92025 gene locus_tag LOCUS_06110 gene cysE 92675 92025 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929921.1 protein_id gnl|my_center|LOCUS_06110 93613 92678 gene locus_tag LOCUS_06120 gene cysK 93613 92678 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804846.1 protein_id gnl|my_center|LOCUS_06120 93829 94680 gene locus_tag LOCUS_06130 93829 94680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229717.1 protein_id gnl|my_center|LOCUS_06130 94873 95730 gene locus_tag LOCUS_06140 94873 95730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229717.1 protein_id gnl|my_center|LOCUS_06140 95924 99478 gene locus_tag LOCUS_06150 95924 99478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 101182 99704 gene locus_tag LOCUS_06160 101182 99704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 101681 101304 gene locus_tag LOCUS_06170 101681 101304 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392669.1 protein_id gnl|my_center|LOCUS_06170 101971 101681 gene locus_tag LOCUS_06180 101971 101681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 103548 101971 gene locus_tag LOCUS_06190 103548 101971 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_06190 105062 103563 gene locus_tag LOCUS_06200 gene oadA 105062 103563 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105555.1 protein_id gnl|my_center|LOCUS_06200 106287 105316 gene locus_tag LOCUS_06210 106287 105316 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020544063.1 protein_id gnl|my_center|LOCUS_06210 107066 106284 gene locus_tag LOCUS_06220 107066 106284 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229696.1 protein_id gnl|my_center|LOCUS_06220 107710 107063 gene locus_tag LOCUS_06230 107710 107063 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229697.1 protein_id gnl|my_center|LOCUS_06230 108900 107707 gene locus_tag LOCUS_06240 108900 107707 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229698.1 protein_id gnl|my_center|LOCUS_06240 109343 109014 gene locus_tag LOCUS_06250 109343 109014 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_06250 109926 109351 gene locus_tag LOCUS_06260 gene dcd 109926 109351 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 protein_id gnl|my_center|LOCUS_06260 110041 110114 gene locus_tag LOCUS_t00210 110041 110114 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 110630 110316 gene locus_tag LOCUS_06270 110630 110316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 110587 111024 gene locus_tag LOCUS_06280 110587 111024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 111898 111089 gene locus_tag LOCUS_06290 111898 111089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 111779 111997 gene locus_tag LOCUS_06300 111779 111997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 113195 112002 gene locus_tag LOCUS_06310 113195 112002 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229362.1 protein_id gnl|my_center|LOCUS_06310 113296 114348 gene locus_tag LOCUS_06320 113296 114348 CDS product NADPH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950854.1 protein_id gnl|my_center|LOCUS_06320 114403 115626 gene locus_tag LOCUS_06330 114403 115626 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080953.1 protein_id gnl|my_center|LOCUS_06330 116370 115729 gene locus_tag LOCUS_06340 116370 115729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 116882 116508 gene locus_tag LOCUS_06350 116882 116508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 116875 117339 gene locus_tag LOCUS_06360 116875 117339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 117349 118920 gene locus_tag LOCUS_06370 117349 118920 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977903.1 protein_id gnl|my_center|LOCUS_06370 119150 121018 gene locus_tag LOCUS_06380 119150 121018 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230903.1 protein_id gnl|my_center|LOCUS_06380 121549 121313 gene locus_tag LOCUS_06390 121549 121313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 122471 121662 gene locus_tag LOCUS_06400 122471 121662 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975129.1 protein_id gnl|my_center|LOCUS_06400 124474 122468 gene locus_tag LOCUS_06410 124474 122468 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228600.1 protein_id gnl|my_center|LOCUS_06410 124550 125434 gene locus_tag LOCUS_06420 124550 125434 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029242.1 protein_id gnl|my_center|LOCUS_06420 125483 125926 gene locus_tag LOCUS_06430 125483 125926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 126295 125942 gene locus_tag LOCUS_06440 126295 125942 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898051.1 protein_id gnl|my_center|LOCUS_06440 126390 126890 gene locus_tag LOCUS_06450 126390 126890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 128366 126915 gene locus_tag LOCUS_06460 128366 126915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206056.1 protein_id gnl|my_center|LOCUS_06460 128487 130190 gene locus_tag LOCUS_06470 128487 130190 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227841.1 protein_id gnl|my_center|LOCUS_06470 131313 130270 gene locus_tag LOCUS_06480 131313 130270 CDS product beta-eliminating lyase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028948.1 protein_id gnl|my_center|LOCUS_06480 133005 131449 gene locus_tag LOCUS_06490 133005 131449 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029246.1 protein_id gnl|my_center|LOCUS_06490 134004 133021 gene locus_tag LOCUS_06500 134004 133021 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326663.1 protein_id gnl|my_center|LOCUS_06500 135181 134006 gene locus_tag LOCUS_06510 gene pdhA 135181 134006 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 protein_id gnl|my_center|LOCUS_06510 135525 137786 gene locus_tag LOCUS_06520 135525 137786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 138939 137815 gene locus_tag LOCUS_06530 138939 137815 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089460.1 protein_id gnl|my_center|LOCUS_06530 139714 139085 gene locus_tag LOCUS_06540 139714 139085 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528306.1 protein_id gnl|my_center|LOCUS_06540 140836 139751 gene locus_tag LOCUS_06550 gene hisC 140836 139751 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_06550 140984 141631 gene locus_tag LOCUS_06560 140984 141631 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729062.1 protein_id gnl|my_center|LOCUS_06560 142315 141644 gene locus_tag LOCUS_06570 142315 141644 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208775.1 protein_id gnl|my_center|LOCUS_06570 143352 142312 gene locus_tag LOCUS_06580 143352 142312 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208776.1 protein_id gnl|my_center|LOCUS_06580 144212 143349 gene locus_tag LOCUS_06590 144212 143349 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366692.1 protein_id gnl|my_center|LOCUS_06590 145327 144320 gene locus_tag LOCUS_06600 145327 144320 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296757.1 protein_id gnl|my_center|LOCUS_06600 145695 146087 gene locus_tag LOCUS_06610 145695 146087 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_06610 146087 146536 gene locus_tag LOCUS_06620 146087 146536 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414543.1 protein_id gnl|my_center|LOCUS_06620 147818 146574 gene locus_tag LOCUS_06630 gene gguB 147818 146574 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112039.1 protein_id gnl|my_center|LOCUS_06630 149374 147815 gene locus_tag LOCUS_06640 gene gguA 149374 147815 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226249.1 protein_id gnl|my_center|LOCUS_06640 150567 149446 gene locus_tag LOCUS_06650 gene chvE 150567 149446 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226248.1 protein_id gnl|my_center|LOCUS_06650 152110 150677 gene locus_tag LOCUS_06660 gene xylB 152110 150677 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877620.1 protein_id gnl|my_center|LOCUS_06660 153292 152114 gene locus_tag LOCUS_06670 gene xylA 153292 152114 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803826.1 protein_id gnl|my_center|LOCUS_06670 153361 154590 gene locus_tag LOCUS_06680 153361 154590 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228545.1 protein_id gnl|my_center|LOCUS_06680 155788 154613 gene locus_tag LOCUS_06690 155788 154613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 155911 157566 gene locus_tag LOCUS_06700 155911 157566 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113135.1 protein_id gnl|my_center|LOCUS_06700 157754 159280 gene locus_tag LOCUS_06710 157754 159280 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227294.1 protein_id gnl|my_center|LOCUS_06710 159302 160330 gene locus_tag LOCUS_06720 gene cydB 159302 160330 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029331.1 protein_id gnl|my_center|LOCUS_06720 160376 161998 gene locus_tag LOCUS_06730 160376 161998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06730 161995 163884 gene locus_tag LOCUS_06740 161995 163884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06740 163881 164300 gene locus_tag LOCUS_06750 163881 164300 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908695.1 protein_id gnl|my_center|LOCUS_06750 164387 165430 gene locus_tag LOCUS_06760 164387 165430 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186428.1 protein_id gnl|my_center|LOCUS_06760 165515 165751 gene locus_tag LOCUS_06770 165515 165751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 165818 166417 gene locus_tag LOCUS_06780 165818 166417 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 protein_id gnl|my_center|LOCUS_06780 166676 166356 gene locus_tag LOCUS_06790 166676 166356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 167002 166703 gene locus_tag LOCUS_06800 167002 166703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 169131 166999 gene locus_tag LOCUS_06810 gene feoB 169131 166999 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887862.1 protein_id gnl|my_center|LOCUS_06810 169391 169131 gene locus_tag LOCUS_06820 169391 169131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 169421 170023 gene locus_tag LOCUS_06830 169421 170023 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975011.1 protein_id gnl|my_center|LOCUS_06830 170296 171324 gene locus_tag LOCUS_06840 170296 171324 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976055.1 protein_id gnl|my_center|LOCUS_06840 171317 172819 gene locus_tag LOCUS_06850 171317 172819 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014233.1 protein_id gnl|my_center|LOCUS_06850 172809 173807 gene locus_tag LOCUS_06860 172809 173807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06860 173868 174821 gene locus_tag LOCUS_06870 173868 174821 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399393.1 protein_id gnl|my_center|LOCUS_06870 174818 175762 gene locus_tag LOCUS_06880 174818 175762 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014310.1 protein_id gnl|my_center|LOCUS_06880 175759 176151 gene locus_tag LOCUS_06890 gene rbsD 175759 176151 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014236.1 protein_id gnl|my_center|LOCUS_06890 176650 176189 gene locus_tag LOCUS_06900 176650 176189 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897102.1 protein_id gnl|my_center|LOCUS_06900 176769 177551 gene locus_tag LOCUS_06910 176769 177551 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222836.1 protein_id gnl|my_center|LOCUS_06910 177651 179057 gene locus_tag LOCUS_06920 gene purB 177651 179057 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776538.1 protein_id gnl|my_center|LOCUS_06920 181239 179077 gene locus_tag LOCUS_06930 181239 179077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 181943 181254 gene locus_tag LOCUS_06940 gene lolD 181943 181254 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947993.1 protein_id gnl|my_center|LOCUS_06940 182353 182015 gene locus_tag LOCUS_06950 182353 182015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 183119 182586 gene locus_tag LOCUS_06960 183119 182586 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 protein_id gnl|my_center|LOCUS_06960 184362 183172 gene locus_tag LOCUS_06970 184362 183172 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727178.1 protein_id gnl|my_center|LOCUS_06970 184587 184994 gene locus_tag LOCUS_06980 184587 184994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 185055 185336 gene locus_tag LOCUS_06990 185055 185336 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776001.1 protein_id gnl|my_center|LOCUS_06990 185403 185624 gene locus_tag LOCUS_07000 185403 185624 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730261.1 protein_id gnl|my_center|LOCUS_07000 185624 187840 gene locus_tag LOCUS_07010 185624 187840 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028547.1 protein_id gnl|my_center|LOCUS_07010 188879 187968 gene locus_tag LOCUS_07020 188879 187968 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803896.1 protein_id gnl|my_center|LOCUS_07020 189709 188876 gene locus_tag LOCUS_07030 189709 188876 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036908.1 protein_id gnl|my_center|LOCUS_07030 190537 189896 gene locus_tag LOCUS_07040 190537 189896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 191464 190652 gene locus_tag LOCUS_07050 191464 190652 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227823.1 protein_id gnl|my_center|LOCUS_07050 191506 192147 gene locus_tag LOCUS_07060 191506 192147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 192210 193226 gene locus_tag LOCUS_07070 192210 193226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 194460 193393 gene locus_tag LOCUS_07080 gene moaA 194460 193393 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804484.1 protein_id gnl|my_center|LOCUS_07080 194539 195201 gene locus_tag LOCUS_07090 194539 195201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 195946 195152 gene locus_tag LOCUS_07100 195946 195152 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804321.1 protein_id gnl|my_center|LOCUS_07100 197263 195956 gene locus_tag LOCUS_07110 gene serS 197263 195956 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831496.1 protein_id gnl|my_center|LOCUS_07110 197418 198254 gene locus_tag LOCUS_07120 197418 198254 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101946.1 protein_id gnl|my_center|LOCUS_07120 199769 198405 gene locus_tag LOCUS_07130 199769 198405 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242107.1 protein_id gnl|my_center|LOCUS_07130 202058 199818 gene locus_tag LOCUS_07140 202058 199818 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256758.1 protein_id gnl|my_center|LOCUS_07140 202192 203340 gene locus_tag LOCUS_07150 202192 203340 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804319.1 protein_id gnl|my_center|LOCUS_07150 203493 204677 gene locus_tag LOCUS_07160 203493 204677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 206109 204772 gene locus_tag LOCUS_07170 gene efeB 206109 204772 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073925.1 protein_id gnl|my_center|LOCUS_07170 207239 206106 gene locus_tag LOCUS_07180 207239 206106 CDS product peptidase M75 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229934.1 protein_id gnl|my_center|LOCUS_07180 208174 207290 gene locus_tag LOCUS_07190 208174 207290 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229933.1 protein_id gnl|my_center|LOCUS_07190 208335 208751 gene locus_tag LOCUS_07200 208335 208751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 208870 209853 gene locus_tag LOCUS_07210 208870 209853 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094369.1 protein_id gnl|my_center|LOCUS_07210 211658 210033 gene locus_tag LOCUS_07220 211658 210033 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_07220 212731 211655 gene locus_tag LOCUS_07230 gene porB 212731 211655 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020090.1 protein_id gnl|my_center|LOCUS_07230 214003 212744 gene locus_tag LOCUS_07240 gene porA 214003 212744 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020091.1 protein_id gnl|my_center|LOCUS_07240 214388 213987 gene locus_tag LOCUS_07250 214388 213987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 214329 214607 gene locus_tag LOCUS_07260 214329 214607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 214670 216286 gene locus_tag LOCUS_07270 214670 216286 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229798.1 protein_id gnl|my_center|LOCUS_07270 216653 216375 gene locus_tag LOCUS_07280 216653 216375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 217677 216760 gene locus_tag LOCUS_07290 gene pheA 217677 216760 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804316.1 protein_id gnl|my_center|LOCUS_07290 218109 217684 gene locus_tag LOCUS_07300 218109 217684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 218752 218171 gene locus_tag LOCUS_07310 218752 218171 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896727.1 protein_id gnl|my_center|LOCUS_07310 220329 219103 gene locus_tag LOCUS_07320 220329 219103 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840295.1 protein_id gnl|my_center|LOCUS_07320 220525 220677 gene locus_tag LOCUS_07330 220525 220677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 220674 221096 gene locus_tag LOCUS_07340 220674 221096 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051418.1 protein_id gnl|my_center|LOCUS_07340 >Feature sequence04 9473 9228 gene locus_tag LOCUS_07350 9473 9228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 9843 10949 gene locus_tag LOCUS_07360 9843 10949 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878186.1 protein_id gnl|my_center|LOCUS_07360 11067 12752 gene locus_tag LOCUS_07370 11067 12752 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487169.1 protein_id gnl|my_center|LOCUS_07370 12752 13798 gene locus_tag LOCUS_07380 12752 13798 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229774.1 protein_id gnl|my_center|LOCUS_07380 14110 14388 gene locus_tag LOCUS_07390 14110 14388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 15137 14451 gene locus_tag LOCUS_07400 15137 14451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 15526 15134 gene locus_tag LOCUS_07410 15526 15134 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228384.1 protein_id gnl|my_center|LOCUS_07410 16535 15540 gene locus_tag LOCUS_07420 16535 15540 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028393.1 protein_id gnl|my_center|LOCUS_07420 17391 16528 gene locus_tag LOCUS_07430 17391 16528 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028392.1 protein_id gnl|my_center|LOCUS_07430 18335 17382 gene locus_tag LOCUS_07440 18335 17382 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976297.1 protein_id gnl|my_center|LOCUS_07440 18788 18396 gene locus_tag LOCUS_07450 18788 18396 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729640.1 protein_id gnl|my_center|LOCUS_07450 20284 18785 gene locus_tag LOCUS_07460 20284 18785 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877971.1 protein_id gnl|my_center|LOCUS_07460 20862 20284 gene locus_tag LOCUS_07470 20862 20284 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729642.1 protein_id gnl|my_center|LOCUS_07470 21884 20859 gene locus_tag LOCUS_07480 21884 20859 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715268.1 protein_id gnl|my_center|LOCUS_07480 22011 23621 gene locus_tag LOCUS_07490 22011 23621 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027601.1 protein_id gnl|my_center|LOCUS_07490 23618 24289 gene locus_tag LOCUS_07500 23618 24289 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977695.1 protein_id gnl|my_center|LOCUS_07500 24311 24799 gene locus_tag LOCUS_07510 24311 24799 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803676.1 protein_id gnl|my_center|LOCUS_07510 25424 24870 gene locus_tag LOCUS_07520 25424 24870 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_07520 25787 25470 gene locus_tag LOCUS_07530 25787 25470 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808391.1 protein_id gnl|my_center|LOCUS_07530 27071 25809 gene locus_tag LOCUS_07540 27071 25809 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_07540 27272 28252 gene locus_tag LOCUS_07550 27272 28252 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_07550 28256 28678 gene locus_tag LOCUS_07560 28256 28678 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_07560 28781 29425 gene locus_tag LOCUS_07570 28781 29425 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804263.1 protein_id gnl|my_center|LOCUS_07570 29422 30144 gene locus_tag LOCUS_07580 29422 30144 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013931.1 protein_id gnl|my_center|LOCUS_07580 30149 33052 gene locus_tag LOCUS_07590 30149 33052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 33280 34041 gene locus_tag LOCUS_07600 gene fabG 33280 34041 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_07600 34782 34054 gene locus_tag LOCUS_07610 34782 34054 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223103.1 protein_id gnl|my_center|LOCUS_07610 35534 34779 gene locus_tag LOCUS_07620 35534 34779 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223104.1 protein_id gnl|my_center|LOCUS_07620 35683 36735 gene locus_tag LOCUS_07630 35683 36735 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286312.1 protein_id gnl|my_center|LOCUS_07630 36859 38076 gene locus_tag LOCUS_07640 36859 38076 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223107.1 protein_id gnl|my_center|LOCUS_07640 38229 39041 gene locus_tag LOCUS_07650 38229 39041 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223108.1 protein_id gnl|my_center|LOCUS_07650 39058 39876 gene locus_tag LOCUS_07660 39058 39876 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223109.1 protein_id gnl|my_center|LOCUS_07660 40488 39895 gene locus_tag LOCUS_07670 40488 39895 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975113.1 protein_id gnl|my_center|LOCUS_07670 42226 40577 gene locus_tag LOCUS_07680 42226 40577 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528300.1 protein_id gnl|my_center|LOCUS_07680 43511 42300 gene locus_tag LOCUS_07690 43511 42300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 44230 43508 gene locus_tag LOCUS_07700 44230 43508 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027849.1 protein_id gnl|my_center|LOCUS_07700 44254 45837 gene locus_tag LOCUS_07710 44254 45837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 47595 45886 gene locus_tag LOCUS_07720 47595 45886 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730685.1 protein_id gnl|my_center|LOCUS_07720 47747 48145 gene locus_tag LOCUS_07730 47747 48145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 49769 48216 gene locus_tag LOCUS_07740 49769 48216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 49984 51042 gene locus_tag LOCUS_07750 49984 51042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 52281 51217 gene locus_tag LOCUS_07760 52281 51217 CDS product small ribosomal subunit Rsm22 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028248.1 protein_id gnl|my_center|LOCUS_07760 53277 52285 gene locus_tag LOCUS_07770 53277 52285 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230440.1 protein_id gnl|my_center|LOCUS_07770 54582 53341 gene locus_tag LOCUS_07780 54582 53341 CDS product glucose-1-phosphate adenylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350023.1 protein_id gnl|my_center|LOCUS_07780 54773 55063 gene locus_tag LOCUS_07790 54773 55063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 55265 56035 gene locus_tag LOCUS_07800 55265 56035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07800 56032 56526 gene locus_tag LOCUS_07810 56032 56526 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224980.1 protein_id gnl|my_center|LOCUS_07810 56523 57242 gene locus_tag LOCUS_07820 56523 57242 CDS product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224979.1 protein_id gnl|my_center|LOCUS_07820 57889 58983 gene locus_tag LOCUS_07830 57889 58983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 58968 60056 gene locus_tag LOCUS_07840 58968 60056 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119846.1 protein_id gnl|my_center|LOCUS_07840 60368 60063 gene locus_tag LOCUS_07850 60368 60063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 60258 60782 gene locus_tag LOCUS_07860 60258 60782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 61425 60949 gene locus_tag LOCUS_07870 61425 60949 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896798.1 protein_id gnl|my_center|LOCUS_07870 61707 61450 gene locus_tag LOCUS_07880 61707 61450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 62398 62084 gene locus_tag LOCUS_07890 62398 62084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07890 63197 62502 gene locus_tag LOCUS_07900 63197 62502 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113600.1 protein_id gnl|my_center|LOCUS_07900 64558 63194 gene locus_tag LOCUS_07910 64558 63194 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228741.1 protein_id gnl|my_center|LOCUS_07910 65427 64555 gene locus_tag LOCUS_07920 65427 64555 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236296.1 protein_id gnl|my_center|LOCUS_07920 65950 65606 gene locus_tag LOCUS_07930 65950 65606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 66220 66795 gene locus_tag LOCUS_07940 66220 66795 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_07940 66792 67973 gene locus_tag LOCUS_07950 66792 67973 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727019.1 protein_id gnl|my_center|LOCUS_07950 68087 69442 gene locus_tag LOCUS_07960 68087 69442 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 protein_id gnl|my_center|LOCUS_07960 69754 70203 gene locus_tag LOCUS_07970 69754 70203 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015196.1 protein_id gnl|my_center|LOCUS_07970 71265 70282 gene locus_tag LOCUS_07980 71265 70282 CDS product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401263.1 protein_id gnl|my_center|LOCUS_07980 71643 71371 gene locus_tag LOCUS_07990 71643 71371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 71615 72850 gene locus_tag LOCUS_08000 71615 72850 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207959.1 protein_id gnl|my_center|LOCUS_08000 74473 72947 gene locus_tag LOCUS_08010 74473 72947 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229331.1 protein_id gnl|my_center|LOCUS_08010 74567 75070 gene locus_tag LOCUS_08020 74567 75070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 75067 75780 gene locus_tag LOCUS_08030 75067 75780 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114086.1 protein_id gnl|my_center|LOCUS_08030 75826 76095 gene locus_tag LOCUS_08040 75826 76095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 76092 76481 gene locus_tag LOCUS_08050 76092 76481 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403187.1 protein_id gnl|my_center|LOCUS_08050 78702 76564 gene locus_tag LOCUS_08060 78702 76564 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226971.1 protein_id gnl|my_center|LOCUS_08060 78835 79497 gene locus_tag LOCUS_08070 78835 79497 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977108.1 protein_id gnl|my_center|LOCUS_08070 79494 80147 gene locus_tag LOCUS_08080 79494 80147 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731308.1 protein_id gnl|my_center|LOCUS_08080 81281 80256 gene locus_tag LOCUS_08090 81281 80256 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_08090 82005 81292 gene locus_tag LOCUS_08100 82005 81292 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_08100 83377 82013 gene locus_tag LOCUS_08110 83377 82013 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731311.1 protein_id gnl|my_center|LOCUS_08110 83541 86768 gene locus_tag LOCUS_08120 gene lysX 83541 86768 CDS product bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223114.1 protein_id gnl|my_center|LOCUS_08120 87592 86780 gene locus_tag LOCUS_08130 87592 86780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 88470 87589 gene locus_tag LOCUS_08140 88470 87589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 88698 88474 gene locus_tag LOCUS_08150 88698 88474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 89045 88776 gene locus_tag LOCUS_08160 89045 88776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 90405 89926 gene locus_tag LOCUS_08170 90405 89926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 91600 90557 gene locus_tag LOCUS_08180 gene dpaL 91600 90557 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706020.1 protein_id gnl|my_center|LOCUS_08180 91677 92567 gene locus_tag LOCUS_08190 91677 92567 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775749.1 protein_id gnl|my_center|LOCUS_08190 92636 93922 gene locus_tag LOCUS_08200 92636 93922 CDS product DUF4921 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014867.1 protein_id gnl|my_center|LOCUS_08200 95721 93961 gene locus_tag LOCUS_08210 95721 93961 CDS product diadenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150790356.1 protein_id gnl|my_center|LOCUS_08210 95828 96379 gene locus_tag LOCUS_08220 95828 96379 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222261.1 protein_id gnl|my_center|LOCUS_08220 96376 98580 gene locus_tag LOCUS_08230 96376 98580 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222260.1 protein_id gnl|my_center|LOCUS_08230 98614 99030 gene locus_tag LOCUS_08240 98614 99030 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731395.1 protein_id gnl|my_center|LOCUS_08240 100431 99112 gene locus_tag LOCUS_08250 100431 99112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 101015 100428 gene locus_tag LOCUS_08260 101015 100428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 101863 101189 gene locus_tag LOCUS_08270 101863 101189 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014261.1 protein_id gnl|my_center|LOCUS_08270 103767 101860 gene locus_tag LOCUS_08280 103767 101860 CDS product cyclic nucleotide-binding/CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014260.1 protein_id gnl|my_center|LOCUS_08280 105373 103862 gene locus_tag LOCUS_08290 105373 103862 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978319.1 protein_id gnl|my_center|LOCUS_08290 105275 105529 gene locus_tag LOCUS_08300 105275 105529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 105549 107174 gene locus_tag LOCUS_08310 105549 107174 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161799.1 protein_id gnl|my_center|LOCUS_08310 107266 107832 gene locus_tag LOCUS_08320 107266 107832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 109301 108006 gene locus_tag LOCUS_08330 109301 108006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 110586 109390 gene locus_tag LOCUS_08340 gene serA 110586 109390 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054393.1 protein_id gnl|my_center|LOCUS_08340 112337 110664 gene locus_tag LOCUS_08350 112337 110664 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855494.1 protein_id gnl|my_center|LOCUS_08350 113239 112373 gene locus_tag LOCUS_08360 113239 112373 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071548.1 protein_id gnl|my_center|LOCUS_08360 113439 113732 gene locus_tag LOCUS_08370 113439 113732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 113833 114801 gene locus_tag LOCUS_08380 113833 114801 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893402.1 protein_id gnl|my_center|LOCUS_08380 115505 114879 gene locus_tag LOCUS_08390 115505 114879 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532164.1 protein_id gnl|my_center|LOCUS_08390 115604 115888 gene locus_tag LOCUS_08400 115604 115888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 115885 116307 gene locus_tag LOCUS_08410 115885 116307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 116225 116527 gene locus_tag LOCUS_08420 116225 116527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 116503 117816 gene locus_tag LOCUS_08430 116503 117816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 118409 117798 gene locus_tag LOCUS_08440 118409 117798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 120499 118436 gene locus_tag LOCUS_08450 120499 118436 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227921.1 protein_id gnl|my_center|LOCUS_08450 121116 120496 gene locus_tag LOCUS_08460 121116 120496 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227920.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08460 121230 121841 gene locus_tag LOCUS_08470 121230 121841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 122322 121876 gene locus_tag LOCUS_08480 122322 121876 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728168.1 protein_id gnl|my_center|LOCUS_08480 122549 122319 gene locus_tag LOCUS_08490 122549 122319 CDS product PTS glucose/sucrose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975905.1 protein_id gnl|my_center|LOCUS_08490 123649 122546 gene locus_tag LOCUS_08500 123649 122546 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092074.1 protein_id gnl|my_center|LOCUS_08500 123820 124590 gene locus_tag LOCUS_08510 123820 124590 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224595.1 protein_id gnl|my_center|LOCUS_08510 124587 125852 gene locus_tag LOCUS_08520 124587 125852 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224594.1 protein_id gnl|my_center|LOCUS_08520 125857 126975 gene locus_tag LOCUS_08530 gene nagA 125857 126975 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728170.1 protein_id gnl|my_center|LOCUS_08530 128394 127078 gene locus_tag LOCUS_08540 128394 127078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 130196 128439 gene locus_tag LOCUS_08550 130196 128439 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921313.1 protein_id gnl|my_center|LOCUS_08550 130718 131899 gene locus_tag LOCUS_08560 130718 131899 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731330.1 protein_id gnl|my_center|LOCUS_08560 131903 132991 gene locus_tag LOCUS_08570 131903 132991 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731331.1 protein_id gnl|my_center|LOCUS_08570 133807 133154 gene locus_tag LOCUS_08580 133807 133154 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224341.1 protein_id gnl|my_center|LOCUS_08580 133909 134532 gene locus_tag LOCUS_08590 133909 134532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 136060 134870 gene locus_tag LOCUS_08600 136060 134870 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532949.1 protein_id gnl|my_center|LOCUS_08600 137894 136053 gene locus_tag LOCUS_08610 gene malZ 137894 136053 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257409.1 protein_id gnl|my_center|LOCUS_08610 138868 137903 gene locus_tag LOCUS_08620 138868 137903 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804841.1 protein_id gnl|my_center|LOCUS_08620 140475 138868 gene locus_tag LOCUS_08630 140475 138868 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804842.1 protein_id gnl|my_center|LOCUS_08630 141878 140589 gene locus_tag LOCUS_08640 141878 140589 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804843.1 protein_id gnl|my_center|LOCUS_08640 142147 143169 gene locus_tag LOCUS_08650 142147 143169 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031380.1 protein_id gnl|my_center|LOCUS_08650 143213 143659 gene locus_tag LOCUS_08660 gene arfB 143213 143659 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776269.1 protein_id gnl|my_center|LOCUS_08660 143853 144959 gene locus_tag LOCUS_08670 143853 144959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 145293 144967 gene locus_tag LOCUS_08680 145293 144967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 145678 145361 gene locus_tag LOCUS_08690 145678 145361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 145837 146472 gene locus_tag LOCUS_08700 145837 146472 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967149.1 protein_id gnl|my_center|LOCUS_08700 146477 147127 gene locus_tag LOCUS_08710 146477 147127 CDS product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079604.1 protein_id gnl|my_center|LOCUS_08710 147171 147374 gene locus_tag LOCUS_08720 147171 147374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 147371 147733 gene locus_tag LOCUS_08730 147371 147733 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727560.1 protein_id gnl|my_center|LOCUS_08730 151007 147777 gene locus_tag LOCUS_08740 151007 147777 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111768112.1 protein_id gnl|my_center|LOCUS_08740 151157 155035 gene locus_tag LOCUS_08750 gene purL 151157 155035 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039715.1 protein_id gnl|my_center|LOCUS_08750 155122 156150 gene locus_tag LOCUS_08760 155122 156150 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804511.1 protein_id gnl|my_center|LOCUS_08760 156238 156699 gene locus_tag LOCUS_08770 156238 156699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 156877 157050 gene locus_tag LOCUS_08780 156877 157050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 157050 159971 gene locus_tag LOCUS_08790 157050 159971 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031572.1 protein_id gnl|my_center|LOCUS_08790 160769 160098 gene locus_tag LOCUS_08800 160769 160098 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731358.1 protein_id gnl|my_center|LOCUS_08800 160916 161167 gene locus_tag LOCUS_08810 160916 161167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 161164 162093 gene locus_tag LOCUS_08820 161164 162093 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327302.1 protein_id gnl|my_center|LOCUS_08820 162090 162842 gene locus_tag LOCUS_08830 162090 162842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 163641 162865 gene locus_tag LOCUS_08840 gene frnE 163641 162865 CDS product protein disulfide isomerase FrnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 protein_id gnl|my_center|LOCUS_08840 164469 163648 gene locus_tag LOCUS_08850 164469 163648 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731193.1 protein_id gnl|my_center|LOCUS_08850 165944 164466 gene locus_tag LOCUS_08860 165944 164466 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897727.1 protein_id gnl|my_center|LOCUS_08860 166273 166659 gene locus_tag LOCUS_08870 166273 166659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 167113 166700 gene locus_tag LOCUS_08880 167113 166700 CDS product protein-tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222796.1 protein_id gnl|my_center|LOCUS_08880 167974 167162 gene locus_tag LOCUS_08890 167974 167162 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030973.1 protein_id gnl|my_center|LOCUS_08890 168012 168548 gene locus_tag LOCUS_08900 168012 168548 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111272.1 protein_id gnl|my_center|LOCUS_08900 169761 168568 gene locus_tag LOCUS_08910 169761 168568 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046898.1 protein_id gnl|my_center|LOCUS_08910 170468 169983 gene locus_tag LOCUS_08920 170468 169983 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031862.1 protein_id gnl|my_center|LOCUS_08920 170579 171067 gene locus_tag LOCUS_08930 170579 171067 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286612.1 protein_id gnl|my_center|LOCUS_08930 171701 171279 gene locus_tag LOCUS_08940 171701 171279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 171752 172780 gene locus_tag LOCUS_08950 gene tdh 171752 172780 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031190.1 protein_id gnl|my_center|LOCUS_08950 172780 173967 gene locus_tag LOCUS_08960 172780 173967 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972198.1 protein_id gnl|my_center|LOCUS_08960 175219 174158 gene locus_tag LOCUS_08970 175219 174158 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256083.1 protein_id gnl|my_center|LOCUS_08970 175371 175646 gene locus_tag LOCUS_08980 175371 175646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 175945 175667 gene locus_tag LOCUS_08990 175945 175667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 175859 176050 gene locus_tag LOCUS_09000 175859 176050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 176129 177595 gene locus_tag LOCUS_09010 176129 177595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 178281 177829 gene locus_tag LOCUS_09020 178281 177829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 178428 179408 gene locus_tag LOCUS_09030 178428 179408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 179528 179737 gene locus_tag LOCUS_09040 179528 179737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 180570 179638 gene locus_tag LOCUS_09050 180570 179638 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102581.1 protein_id gnl|my_center|LOCUS_09050 180897 180727 gene locus_tag LOCUS_09060 180897 180727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 182362 180902 gene locus_tag LOCUS_09070 182362 180902 CDS product sulfide:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931811.1 protein_id gnl|my_center|LOCUS_09070 182621 183385 gene locus_tag LOCUS_09080 182621 183385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09080 183382 183960 gene locus_tag LOCUS_09090 183382 183960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 183960 185021 gene locus_tag LOCUS_09100 gene amrS 183960 185021 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899934.1 protein_id gnl|my_center|LOCUS_09100 186119 185106 gene locus_tag LOCUS_09110 186119 185106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 187161 186352 gene locus_tag LOCUS_09120 187161 186352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 187781 187290 gene locus_tag LOCUS_09130 187781 187290 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732167.1 protein_id gnl|my_center|LOCUS_09130 188566 187823 gene locus_tag LOCUS_09140 188566 187823 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201007.1 protein_id gnl|my_center|LOCUS_09140 189468 188587 gene locus_tag LOCUS_09150 189468 188587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 189518 189913 gene locus_tag LOCUS_09160 189518 189913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 189938 190414 gene locus_tag LOCUS_09170 189938 190414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 190689 190411 gene locus_tag LOCUS_09180 190689 190411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 192066 190690 gene locus_tag LOCUS_09190 192066 190690 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223123.1 protein_id gnl|my_center|LOCUS_09190 192469 192068 gene locus_tag LOCUS_09200 192469 192068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 192707 193042 gene locus_tag LOCUS_09210 192707 193042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 195146 193119 gene locus_tag LOCUS_09220 195146 193119 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730584.1 protein_id gnl|my_center|LOCUS_09220 196579 195161 gene locus_tag LOCUS_09230 196579 195161 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878358.1 protein_id gnl|my_center|LOCUS_09230 197517 196657 gene locus_tag LOCUS_09240 197517 196657 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206915.1 protein_id gnl|my_center|LOCUS_09240 197536 197712 gene locus_tag LOCUS_09250 197536 197712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 198818 197715 gene locus_tag LOCUS_09260 198818 197715 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015529.1 protein_id gnl|my_center|LOCUS_09260 199582 198815 gene locus_tag LOCUS_09270 199582 198815 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111761.1 protein_id gnl|my_center|LOCUS_09270 199645 200328 gene locus_tag LOCUS_09280 199645 200328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 200414 201046 gene locus_tag LOCUS_09290 200414 201046 CDS product CueP family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014137.1 protein_id gnl|my_center|LOCUS_09290 201137 202252 gene locus_tag LOCUS_09300 gene ald 201137 202252 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 protein_id gnl|my_center|LOCUS_09300 202273 202653 gene locus_tag LOCUS_09310 202273 202653 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112420.1 protein_id gnl|my_center|LOCUS_09310 203043 202666 gene locus_tag LOCUS_09320 203043 202666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 204458 203061 gene locus_tag LOCUS_09330 204458 203061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 >Feature sequence05 540 70 gene locus_tag LOCUS_09340 540 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 587 982 gene locus_tag LOCUS_09350 587 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1761 1090 gene locus_tag LOCUS_09360 1761 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 1895 2677 gene locus_tag LOCUS_09370 1895 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 3359 2835 gene locus_tag LOCUS_09380 3359 2835 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223064.1 protein_id gnl|my_center|LOCUS_09380 3670 3356 gene locus_tag LOCUS_09390 3670 3356 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223065.1 protein_id gnl|my_center|LOCUS_09390 3816 4583 gene locus_tag LOCUS_09400 3816 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 4580 6049 gene locus_tag LOCUS_09410 gene ribA 4580 6049 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404259.1 protein_id gnl|my_center|LOCUS_09410 7155 6046 gene locus_tag LOCUS_09420 7155 6046 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230077.1 protein_id gnl|my_center|LOCUS_09420 7505 7122 gene locus_tag LOCUS_09430 7505 7122 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230078.1 protein_id gnl|my_center|LOCUS_09430 8533 7505 gene locus_tag LOCUS_09440 8533 7505 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485699.1 protein_id gnl|my_center|LOCUS_09440 8901 9935 gene locus_tag LOCUS_09450 8901 9935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 10229 10822 gene locus_tag LOCUS_09460 10229 10822 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405274.1 protein_id gnl|my_center|LOCUS_09460 10823 11410 gene locus_tag LOCUS_09470 10823 11410 CDS product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455144.1 protein_id gnl|my_center|LOCUS_09470 11482 11928 gene locus_tag LOCUS_09480 11482 11928 CDS product DUF5709 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027611.1 protein_id gnl|my_center|LOCUS_09480 13045 12047 gene locus_tag LOCUS_09490 13045 12047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 13171 13590 gene locus_tag LOCUS_09500 13171 13590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 14540 13620 gene locus_tag LOCUS_09510 14540 13620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 15214 14567 gene locus_tag LOCUS_09520 15214 14567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 15695 16510 gene locus_tag LOCUS_09530 15695 16510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 16911 17399 gene locus_tag LOCUS_09540 16911 17399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 17396 18253 gene locus_tag LOCUS_09550 17396 18253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 18410 18922 gene locus_tag LOCUS_09560 18410 18922 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036864.1 protein_id gnl|my_center|LOCUS_09560 19688 18951 gene locus_tag LOCUS_09570 19688 18951 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338706.1 protein_id gnl|my_center|LOCUS_09570 20914 19685 gene locus_tag LOCUS_09580 20914 19685 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224736.1 protein_id gnl|my_center|LOCUS_09580 21657 20920 gene locus_tag LOCUS_09590 21657 20920 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224817.1 protein_id gnl|my_center|LOCUS_09590 22910 21654 gene locus_tag LOCUS_09600 22910 21654 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224816.1 protein_id gnl|my_center|LOCUS_09600 23257 22907 gene locus_tag LOCUS_09610 23257 22907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 23345 23860 gene locus_tag LOCUS_09620 23345 23860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 23893 24627 gene locus_tag LOCUS_09630 23893 24627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 24634 26106 gene locus_tag LOCUS_09640 24634 26106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 26873 26310 gene locus_tag LOCUS_09650 26873 26310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 27014 27667 gene locus_tag LOCUS_09660 27014 27667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 27721 30354 gene locus_tag LOCUS_09670 27721 30354 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179552221.1 protein_id gnl|my_center|LOCUS_09670 30742 31743 gene locus_tag LOCUS_09680 30742 31743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 31893 32702 gene locus_tag LOCUS_09690 31893 32702 CDS product SGNH family lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977101.1 protein_id gnl|my_center|LOCUS_09690 32885 33166 gene locus_tag LOCUS_09700 32885 33166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 33635 33219 gene locus_tag LOCUS_09710 33635 33219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 35024 34017 gene locus_tag LOCUS_09720 35024 34017 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776829.1 protein_id gnl|my_center|LOCUS_09720 35234 35722 gene locus_tag LOCUS_09730 35234 35722 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743071.1 protein_id gnl|my_center|LOCUS_09730 36051 35779 gene locus_tag LOCUS_09740 36051 35779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 37249 36308 gene locus_tag LOCUS_09750 37249 36308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 37482 37246 gene locus_tag LOCUS_09760 37482 37246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09760 37795 38730 gene locus_tag LOCUS_09770 37795 38730 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064705.1 protein_id gnl|my_center|LOCUS_09770 38922 40376 gene locus_tag LOCUS_09780 38922 40376 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946756.1 protein_id gnl|my_center|LOCUS_09780 40836 42443 gene locus_tag LOCUS_09790 40836 42443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 42473 42814 gene locus_tag LOCUS_09800 42473 42814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 42827 43474 gene locus_tag LOCUS_09810 42827 43474 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466787.1 protein_id gnl|my_center|LOCUS_09810 43543 44103 gene locus_tag LOCUS_09820 43543 44103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 44100 44948 gene locus_tag LOCUS_09830 44100 44948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 45195 46112 gene locus_tag LOCUS_09840 45195 46112 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222248.1 protein_id gnl|my_center|LOCUS_09840 46109 47707 gene locus_tag LOCUS_09850 46109 47707 CDS product ABC transporter membrane-spanning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029130.1 protein_id gnl|my_center|LOCUS_09850 47874 48950 gene locus_tag LOCUS_09860 47874 48950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 50676 49144 gene locus_tag LOCUS_09870 50676 49144 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727883.1 protein_id gnl|my_center|LOCUS_09870 51858 50755 gene locus_tag LOCUS_09880 51858 50755 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 protein_id gnl|my_center|LOCUS_09880 51961 52947 gene locus_tag LOCUS_09890 51961 52947 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439110.1 protein_id gnl|my_center|LOCUS_09890 53026 55248 gene locus_tag LOCUS_09900 53026 55248 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728359.1 protein_id gnl|my_center|LOCUS_09900 55839 55345 gene locus_tag LOCUS_09910 55839 55345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 56021 56809 gene locus_tag LOCUS_09920 56021 56809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 57859 56873 gene locus_tag LOCUS_09930 57859 56873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 58014 58853 gene locus_tag LOCUS_09940 58014 58853 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971787.1 protein_id gnl|my_center|LOCUS_09940 59728 58856 gene locus_tag LOCUS_09950 59728 58856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 59832 61100 gene locus_tag LOCUS_09960 59832 61100 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870846.1 protein_id gnl|my_center|LOCUS_09960 61676 61116 gene locus_tag LOCUS_09970 61676 61116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 61742 62356 gene locus_tag LOCUS_09980 61742 62356 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931542.1 protein_id gnl|my_center|LOCUS_09980 62432 63190 gene locus_tag LOCUS_09990 62432 63190 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813870.1 protein_id gnl|my_center|LOCUS_09990 63187 63807 gene locus_tag LOCUS_10000 63187 63807 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391434.1 protein_id gnl|my_center|LOCUS_10000 63907 64566 gene locus_tag LOCUS_10010 63907 64566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 65596 64688 gene locus_tag LOCUS_10020 65596 64688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 65781 66080 gene locus_tag LOCUS_10030 65781 66080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 66172 67221 gene locus_tag LOCUS_10040 gene mgrA 66172 67221 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529545.1 protein_id gnl|my_center|LOCUS_10040 67458 68021 gene locus_tag LOCUS_10050 gene ahpC 67458 68021 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395542.1 protein_id gnl|my_center|LOCUS_10050 68021 69610 gene locus_tag LOCUS_10060 gene ahpF 68021 69610 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315309.1 protein_id gnl|my_center|LOCUS_10060 69806 70195 gene locus_tag LOCUS_10070 69806 70195 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977977.1 protein_id gnl|my_center|LOCUS_10070 70195 71778 gene locus_tag LOCUS_10080 70195 71778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 72993 71782 gene locus_tag LOCUS_10090 72993 71782 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165781113.1 protein_id gnl|my_center|LOCUS_10090 73099 74487 gene locus_tag LOCUS_10100 73099 74487 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030269.1 protein_id gnl|my_center|LOCUS_10100 75546 74662 gene locus_tag LOCUS_10110 75546 74662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 75507 75719 gene locus_tag LOCUS_10120 75507 75719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 76774 75701 gene locus_tag LOCUS_10130 76774 75701 CDS product DUF2855 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084188.1 protein_id gnl|my_center|LOCUS_10130 77696 76833 gene locus_tag LOCUS_10140 77696 76833 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805141.1 protein_id gnl|my_center|LOCUS_10140 78509 77787 gene locus_tag LOCUS_10150 78509 77787 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268146.1 protein_id gnl|my_center|LOCUS_10150 79918 78506 gene locus_tag LOCUS_10160 79918 78506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 80796 79903 gene locus_tag LOCUS_10170 80796 79903 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766234.1 protein_id gnl|my_center|LOCUS_10170 80734 81015 gene locus_tag LOCUS_10180 80734 81015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 81085 81765 gene locus_tag LOCUS_10190 81085 81765 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727699.1 protein_id gnl|my_center|LOCUS_10190 83519 81912 gene locus_tag LOCUS_10200 gene fadD5 83519 81912 CDS product fatty-acid--CoA ligase FadD5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726688.1 protein_id gnl|my_center|LOCUS_10200 84375 83560 gene locus_tag LOCUS_10210 84375 83560 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284345.1 protein_id gnl|my_center|LOCUS_10210 85599 84418 gene locus_tag LOCUS_10220 85599 84418 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227132.1 protein_id gnl|my_center|LOCUS_10220 85606 86424 gene locus_tag LOCUS_10230 85606 86424 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731630.1 protein_id gnl|my_center|LOCUS_10230 86426 88147 gene locus_tag LOCUS_10240 86426 88147 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404960.1 protein_id gnl|my_center|LOCUS_10240 88144 89331 gene locus_tag LOCUS_10250 88144 89331 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898670.1 protein_id gnl|my_center|LOCUS_10250 89328 90926 gene locus_tag LOCUS_10260 89328 90926 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896889.1 protein_id gnl|my_center|LOCUS_10260 90942 92993 gene locus_tag LOCUS_10270 90942 92993 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082909.1 protein_id gnl|my_center|LOCUS_10270 92993 93787 gene locus_tag LOCUS_10280 92993 93787 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404949.1 protein_id gnl|my_center|LOCUS_10280 93810 94412 gene locus_tag LOCUS_10290 93810 94412 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224757.1 protein_id gnl|my_center|LOCUS_10290 94604 95290 gene locus_tag LOCUS_10300 94604 95290 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485328.1 protein_id gnl|my_center|LOCUS_10300 95287 96582 gene locus_tag LOCUS_10310 95287 96582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 96683 97462 gene locus_tag LOCUS_10320 96683 97462 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003584392.1 protein_id gnl|my_center|LOCUS_10320 97459 99804 gene locus_tag LOCUS_10330 97459 99804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 100070 99834 gene locus_tag LOCUS_10340 100070 99834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 100367 100095 gene locus_tag LOCUS_10350 100367 100095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 100576 102675 gene locus_tag LOCUS_10360 100576 102675 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337444.1 protein_id gnl|my_center|LOCUS_10360 103574 102795 gene locus_tag LOCUS_10370 103574 102795 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027975.1 protein_id gnl|my_center|LOCUS_10370 104554 103571 gene locus_tag LOCUS_10380 104554 103571 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226863.1 protein_id gnl|my_center|LOCUS_10380 105537 104551 gene locus_tag LOCUS_10390 105537 104551 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082397.1 protein_id gnl|my_center|LOCUS_10390 106558 105530 gene locus_tag LOCUS_10400 106558 105530 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045020694.1 protein_id gnl|my_center|LOCUS_10400 107554 106646 gene locus_tag LOCUS_10410 107554 106646 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013801.1 protein_id gnl|my_center|LOCUS_10410 109284 107722 gene locus_tag LOCUS_10420 109284 107722 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027069.1 protein_id gnl|my_center|LOCUS_10420 109819 109367 gene locus_tag LOCUS_10430 109819 109367 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225955.1 protein_id gnl|my_center|LOCUS_10430 110132 109902 gene locus_tag LOCUS_10440 110132 109902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 110055 110939 gene locus_tag LOCUS_10450 110055 110939 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878294.1 protein_id gnl|my_center|LOCUS_10450 112486 111071 gene locus_tag LOCUS_10460 112486 111071 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804380.1 protein_id gnl|my_center|LOCUS_10460 112581 113216 gene locus_tag LOCUS_10470 gene bluB 112581 113216 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391283.1 protein_id gnl|my_center|LOCUS_10470 113800 113312 gene locus_tag LOCUS_10480 113800 113312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 114129 113845 gene locus_tag LOCUS_10490 114129 113845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 114336 115595 gene locus_tag LOCUS_10500 114336 115595 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225761.1 protein_id gnl|my_center|LOCUS_10500 115939 115679 gene locus_tag LOCUS_10510 115939 115679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 115967 117085 gene locus_tag LOCUS_10520 115967 117085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 117092 117412 gene locus_tag LOCUS_10530 117092 117412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 117583 118407 gene locus_tag LOCUS_10540 117583 118407 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730403.1 protein_id gnl|my_center|LOCUS_10540 119178 118411 gene locus_tag LOCUS_10550 119178 118411 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226372.1 protein_id gnl|my_center|LOCUS_10550 119937 119248 gene locus_tag LOCUS_10560 119937 119248 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222865.1 protein_id gnl|my_center|LOCUS_10560 120783 120145 gene locus_tag LOCUS_10570 120783 120145 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030265.1 protein_id gnl|my_center|LOCUS_10570 120904 121662 gene locus_tag LOCUS_10580 120904 121662 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226043.1 protein_id gnl|my_center|LOCUS_10580 121883 122428 gene locus_tag LOCUS_10590 121883 122428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 122451 123536 gene locus_tag LOCUS_10600 122451 123536 CDS product DUF2183 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930149.1 protein_id gnl|my_center|LOCUS_10600 123541 124401 gene locus_tag LOCUS_10610 123541 124401 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_10610 124407 125144 gene locus_tag LOCUS_10620 124407 125144 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027371.1 protein_id gnl|my_center|LOCUS_10620 125141 126622 gene locus_tag LOCUS_10630 125141 126622 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727053.1 protein_id gnl|my_center|LOCUS_10630 126615 127322 gene locus_tag LOCUS_10640 126615 127322 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727052.1 protein_id gnl|my_center|LOCUS_10640 127447 128007 gene locus_tag LOCUS_10650 127447 128007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 128004 128657 gene locus_tag LOCUS_10660 128004 128657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 128654 129217 gene locus_tag LOCUS_10670 128654 129217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 130540 129221 gene locus_tag LOCUS_10680 130540 129221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 130925 130662 gene locus_tag LOCUS_10690 130925 130662 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857409.1 protein_id gnl|my_center|LOCUS_10690 133130 130971 gene locus_tag LOCUS_10700 133130 130971 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014766.1 protein_id gnl|my_center|LOCUS_10700 134155 133184 gene locus_tag LOCUS_10710 134155 133184 CDS product hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891418.1 protein_id gnl|my_center|LOCUS_10710 134931 134152 gene locus_tag LOCUS_10720 134931 134152 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891419.1 protein_id gnl|my_center|LOCUS_10720 135099 136811 gene locus_tag LOCUS_10730 135099 136811 CDS product phosphoenolpyruvate-utilizing N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104530.1 protein_id gnl|my_center|LOCUS_10730 137119 138141 gene locus_tag LOCUS_10740 137119 138141 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909511.1 protein_id gnl|my_center|LOCUS_10740 138229 138555 gene locus_tag LOCUS_10750 138229 138555 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222088.1 protein_id gnl|my_center|LOCUS_10750 138676 139026 gene locus_tag LOCUS_10760 138676 139026 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079890.1 protein_id gnl|my_center|LOCUS_10760 139175 140362 gene locus_tag LOCUS_10770 139175 140362 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318704.1 protein_id gnl|my_center|LOCUS_10770 141323 140373 gene locus_tag LOCUS_10780 141323 140373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 141661 141320 gene locus_tag LOCUS_10790 141661 141320 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804080.1 protein_id gnl|my_center|LOCUS_10790 141778 142992 gene locus_tag LOCUS_10800 141778 142992 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_10800 143557 143120 gene locus_tag LOCUS_10810 143557 143120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 143614 143838 gene locus_tag LOCUS_10820 143614 143838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 143978 145717 gene locus_tag LOCUS_10830 143978 145717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 145764 148526 gene locus_tag LOCUS_10840 145764 148526 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546856.1 protein_id gnl|my_center|LOCUS_10840 148523 149773 gene locus_tag LOCUS_10850 148523 149773 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138985883.1 protein_id gnl|my_center|LOCUS_10850 149770 150669 gene locus_tag LOCUS_10860 149770 150669 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385731.1 protein_id gnl|my_center|LOCUS_10860 150707 151321 gene locus_tag LOCUS_10870 150707 151321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 151305 151700 gene locus_tag LOCUS_10880 151305 151700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091317612.1 protein_id gnl|my_center|LOCUS_10880 151681 153180 gene locus_tag LOCUS_10890 151681 153180 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 protein_id gnl|my_center|LOCUS_10890 153334 153555 gene locus_tag LOCUS_10900 153334 153555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 153757 154653 gene locus_tag LOCUS_10910 153757 154653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 154775 154557 gene locus_tag LOCUS_10920 154775 154557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence06 802 185 gene locus_tag LOCUS_10930 802 185 CDS product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896008.1 protein_id gnl|my_center|LOCUS_10930 983 1921 gene locus_tag LOCUS_10940 983 1921 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030286.1 protein_id gnl|my_center|LOCUS_10940 2545 1925 gene locus_tag LOCUS_10950 2545 1925 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014862.1 protein_id gnl|my_center|LOCUS_10950 2875 4764 gene locus_tag LOCUS_10960 2875 4764 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284399.1 protein_id gnl|my_center|LOCUS_10960 4772 5281 gene locus_tag LOCUS_10970 gene ilvN 4772 5281 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_10970 5399 6427 gene locus_tag LOCUS_10980 gene ilvC 5399 6427 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775904.1 protein_id gnl|my_center|LOCUS_10980 6623 7093 gene locus_tag LOCUS_10990 6623 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 7140 8627 gene locus_tag LOCUS_11000 7140 8627 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_11000 9030 8665 gene locus_tag LOCUS_11010 9030 8665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 9492 9244 gene locus_tag LOCUS_11020 9492 9244 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_11020 9889 9620 gene locus_tag LOCUS_11030 9889 9620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 10087 10491 gene locus_tag LOCUS_11040 10087 10491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 14685 10498 gene locus_tag LOCUS_11050 14685 10498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 14891 16120 gene locus_tag LOCUS_11060 14891 16120 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776058.1 protein_id gnl|my_center|LOCUS_11060 16117 16986 gene locus_tag LOCUS_11070 16117 16986 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776057.1 protein_id gnl|my_center|LOCUS_11070 16983 17912 gene locus_tag LOCUS_11080 16983 17912 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776056.1 protein_id gnl|my_center|LOCUS_11080 17980 18183 gene locus_tag LOCUS_11090 17980 18183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 18186 18590 gene locus_tag LOCUS_11100 18186 18590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 18653 19081 gene locus_tag LOCUS_11110 18653 19081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 19078 19569 gene locus_tag LOCUS_11120 19078 19569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 20508 19663 gene locus_tag LOCUS_11130 20508 19663 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030587.1 protein_id gnl|my_center|LOCUS_11130 21751 20591 gene locus_tag LOCUS_11140 21751 20591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 21814 22941 gene locus_tag LOCUS_11150 gene prfB 21814 22941 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776050.1 protein_id gnl|my_center|LOCUS_11150 23947 23048 gene locus_tag LOCUS_11160 23947 23048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 24624 23944 gene locus_tag LOCUS_11170 24624 23944 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974351.1 protein_id gnl|my_center|LOCUS_11170 25919 24621 gene locus_tag LOCUS_11180 25919 24621 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029752.1 protein_id gnl|my_center|LOCUS_11180 26158 27258 gene locus_tag LOCUS_11190 26158 27258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 27307 28212 gene locus_tag LOCUS_11200 gene ftsX 27307 28212 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975844.1 protein_id gnl|my_center|LOCUS_11200 28303 29604 gene locus_tag LOCUS_11210 28303 29604 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776047.1 protein_id gnl|my_center|LOCUS_11210 29751 30224 gene locus_tag LOCUS_11220 gene smpB 29751 30224 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975846.1 protein_id gnl|my_center|LOCUS_11220 30224 32221 gene locus_tag LOCUS_11230 30224 32221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 32536 32363 gene locus_tag LOCUS_11240 32536 32363 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226939.1 protein_id gnl|my_center|LOCUS_11240 36008 32631 gene locus_tag LOCUS_11250 36008 32631 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223655.1 protein_id gnl|my_center|LOCUS_11250 37186 36158 gene locus_tag LOCUS_11260 37186 36158 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976409.1 protein_id gnl|my_center|LOCUS_11260 37291 38046 gene locus_tag LOCUS_11270 37291 38046 CDS product phosphatidylinositol-specific phospholipase C/glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027645.1 protein_id gnl|my_center|LOCUS_11270 38165 38530 gene locus_tag LOCUS_tm00010 38165 38530 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 38613 39398 gene locus_tag LOCUS_11280 38613 39398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 39409 40224 gene locus_tag LOCUS_11290 39409 40224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 40872 40243 gene locus_tag LOCUS_11300 40872 40243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 41492 40869 gene locus_tag LOCUS_11310 41492 40869 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113129.1 protein_id gnl|my_center|LOCUS_11310 42191 41502 gene locus_tag LOCUS_11320 42191 41502 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 protein_id gnl|my_center|LOCUS_11320 43464 42205 gene locus_tag LOCUS_11330 43464 42205 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031803.1 protein_id gnl|my_center|LOCUS_11330 43544 44206 gene locus_tag LOCUS_11340 43544 44206 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222316.1 protein_id gnl|my_center|LOCUS_11340 44273 45712 gene locus_tag LOCUS_11350 44273 45712 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975860.1 protein_id gnl|my_center|LOCUS_11350 45712 46086 gene locus_tag LOCUS_11360 45712 46086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 46331 48673 gene locus_tag LOCUS_11370 46331 48673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 48834 49388 gene locus_tag LOCUS_11380 48834 49388 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_11380 49430 49732 gene locus_tag LOCUS_11390 49430 49732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 49859 51619 gene locus_tag LOCUS_11400 49859 51619 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929967.1 protein_id gnl|my_center|LOCUS_11400 51666 52538 gene locus_tag LOCUS_11410 51666 52538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 52639 54492 gene locus_tag LOCUS_11420 52639 54492 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028097.1 protein_id gnl|my_center|LOCUS_11420 54580 55011 gene locus_tag LOCUS_11430 54580 55011 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230234.1 protein_id gnl|my_center|LOCUS_11430 55090 55344 gene locus_tag LOCUS_11440 55090 55344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 55943 55350 gene locus_tag LOCUS_11450 55943 55350 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975893.1 protein_id gnl|my_center|LOCUS_11450 57280 55967 gene locus_tag LOCUS_11460 57280 55967 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028662.1 protein_id gnl|my_center|LOCUS_11460 57359 57649 gene locus_tag LOCUS_11470 gene clpS 57359 57649 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180153.1 protein_id gnl|my_center|LOCUS_11470 57649 58287 gene locus_tag LOCUS_11480 57649 58287 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229463.1 protein_id gnl|my_center|LOCUS_11480 58704 58294 gene locus_tag LOCUS_11490 58704 58294 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085641.1 protein_id gnl|my_center|LOCUS_11490 59524 58727 gene locus_tag LOCUS_11500 59524 58727 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223929.1 protein_id gnl|my_center|LOCUS_11500 59624 61615 gene locus_tag LOCUS_11510 59624 61615 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_11510 63007 61688 gene locus_tag LOCUS_11520 63007 61688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068715.1 protein_id gnl|my_center|LOCUS_11520 63762 63004 gene locus_tag LOCUS_11530 63762 63004 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776543.1 protein_id gnl|my_center|LOCUS_11530 63866 64795 gene locus_tag LOCUS_11540 63866 64795 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029384.1 protein_id gnl|my_center|LOCUS_11540 66301 64799 gene locus_tag LOCUS_11550 66301 64799 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113030.1 protein_id gnl|my_center|LOCUS_11550 66322 67074 gene locus_tag LOCUS_11560 66322 67074 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_11560 67254 70400 gene locus_tag LOCUS_11570 67254 70400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11570 70596 70901 gene locus_tag LOCUS_11580 gene rplU 70596 70901 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775855.1 protein_id gnl|my_center|LOCUS_11580 70938 71207 gene locus_tag LOCUS_11590 gene rpmA 70938 71207 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_11590 71330 72865 gene locus_tag LOCUS_11600 gene obgE 71330 72865 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976206.1 protein_id gnl|my_center|LOCUS_11600 72852 73973 gene locus_tag LOCUS_11610 gene proB 72852 73973 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 protein_id gnl|my_center|LOCUS_11610 74867 74013 gene locus_tag LOCUS_11620 gene pdxY 74867 74013 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 protein_id gnl|my_center|LOCUS_11620 75885 74914 gene locus_tag LOCUS_11630 75885 74914 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029794.1 protein_id gnl|my_center|LOCUS_11630 76394 76615 gene locus_tag LOCUS_11640 76394 76615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 76618 77274 gene locus_tag LOCUS_11650 gene nadD 76618 77274 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775849.1 protein_id gnl|my_center|LOCUS_11650 77282 77722 gene locus_tag LOCUS_11660 gene rsfS 77282 77722 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067112.1 protein_id gnl|my_center|LOCUS_11660 77719 78381 gene locus_tag LOCUS_11670 77719 78381 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228468.1 protein_id gnl|my_center|LOCUS_11670 78463 78536 gene locus_tag LOCUS_t00220 78463 78536 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 78953 78660 gene locus_tag LOCUS_11680 78953 78660 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921216.1 protein_id gnl|my_center|LOCUS_11680 79417 78950 gene locus_tag LOCUS_11690 79417 78950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921215.1 protein_id gnl|my_center|LOCUS_11690 79524 80306 gene locus_tag LOCUS_11700 79524 80306 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095297.1 protein_id gnl|my_center|LOCUS_11700 80854 80315 gene locus_tag LOCUS_11710 80854 80315 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014033.1 protein_id gnl|my_center|LOCUS_11710 80844 82139 gene locus_tag LOCUS_11720 80844 82139 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113524.1 protein_id gnl|my_center|LOCUS_11720 82274 83491 gene locus_tag LOCUS_11730 82274 83491 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971715.1 protein_id gnl|my_center|LOCUS_11730 83764 86679 gene locus_tag LOCUS_11740 gene leuS 83764 86679 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976232.1 protein_id gnl|my_center|LOCUS_11740 86741 87550 gene locus_tag LOCUS_11750 86741 87550 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976234.1 protein_id gnl|my_center|LOCUS_11750 87863 88780 gene locus_tag LOCUS_11760 87863 88780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 88777 91323 gene locus_tag LOCUS_11770 88777 91323 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028431.1 protein_id gnl|my_center|LOCUS_11770 92264 91365 gene locus_tag LOCUS_11780 92264 91365 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029852.1 protein_id gnl|my_center|LOCUS_11780 92375 93241 gene locus_tag LOCUS_11790 92375 93241 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027127.1 protein_id gnl|my_center|LOCUS_11790 94049 93300 gene locus_tag LOCUS_11800 gene lexA 94049 93300 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030466.1 protein_id gnl|my_center|LOCUS_11800 94292 94684 gene locus_tag LOCUS_11810 94292 94684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 96231 94699 gene locus_tag LOCUS_11820 96231 94699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 96984 97445 gene locus_tag LOCUS_11830 gene nrdR 96984 97445 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804686.1 protein_id gnl|my_center|LOCUS_11830 97607 100507 gene locus_tag LOCUS_11840 97607 100507 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224267.1 protein_id gnl|my_center|LOCUS_11840 100573 101298 gene locus_tag LOCUS_11850 100573 101298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 101391 101918 gene locus_tag LOCUS_11860 101391 101918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 101941 102957 gene locus_tag LOCUS_11870 gene speB 101941 102957 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894987.1 protein_id gnl|my_center|LOCUS_11870 103733 102963 gene locus_tag LOCUS_11880 103733 102963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 103827 104204 gene locus_tag LOCUS_11890 103827 104204 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727266.1 protein_id gnl|my_center|LOCUS_11890 104204 104614 gene locus_tag LOCUS_11900 104204 104614 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090019.1 protein_id gnl|my_center|LOCUS_11900 104611 105192 gene locus_tag LOCUS_11910 104611 105192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 105203 105565 gene locus_tag LOCUS_11920 105203 105565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 105558 105989 gene locus_tag LOCUS_11930 105558 105989 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222283.1 protein_id gnl|my_center|LOCUS_11930 106029 107183 gene locus_tag LOCUS_11940 gene galT 106029 107183 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055169.1 protein_id gnl|my_center|LOCUS_11940 107180 108427 gene locus_tag LOCUS_11950 gene galK 107180 108427 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776399.1 protein_id gnl|my_center|LOCUS_11950 109549 108446 gene locus_tag LOCUS_11960 109549 108446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 109847 111169 gene locus_tag LOCUS_11970 109847 111169 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893059.1 protein_id gnl|my_center|LOCUS_11970 111251 111541 gene locus_tag LOCUS_11980 111251 111541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 111538 112965 gene locus_tag LOCUS_11990 111538 112965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 113069 116971 gene locus_tag LOCUS_12000 gene hrpA 113069 116971 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228749.1 protein_id gnl|my_center|LOCUS_12000 117119 118042 gene locus_tag LOCUS_12010 117119 118042 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229588.1 protein_id gnl|my_center|LOCUS_12010 118755 118039 gene locus_tag LOCUS_12020 118755 118039 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728971.1 protein_id gnl|my_center|LOCUS_12020 120612 118891 gene locus_tag LOCUS_12030 120612 118891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 121342 120617 gene locus_tag LOCUS_12040 121342 120617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 121453 122220 gene locus_tag LOCUS_12050 121453 122220 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775745.1 protein_id gnl|my_center|LOCUS_12050 122369 122821 gene locus_tag LOCUS_12060 122369 122821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 122938 124089 gene locus_tag LOCUS_12070 122938 124089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 124384 125517 gene locus_tag LOCUS_12080 124384 125517 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229667.1 protein_id gnl|my_center|LOCUS_12080 125621 126016 gene locus_tag LOCUS_12090 125621 126016 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729640.1 protein_id gnl|my_center|LOCUS_12090 126390 127934 gene locus_tag LOCUS_12100 126390 127934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 130518 128197 gene locus_tag LOCUS_12110 130518 128197 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486200.1 protein_id gnl|my_center|LOCUS_12110 131735 130515 gene locus_tag LOCUS_12120 131735 130515 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228053.1 protein_id gnl|my_center|LOCUS_12120 132696 131740 gene locus_tag LOCUS_12130 132696 131740 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_12130 133118 133549 gene locus_tag LOCUS_12140 gene mraZ 133118 133549 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804693.1 protein_id gnl|my_center|LOCUS_12140 133771 134745 gene locus_tag LOCUS_12150 gene rsmH 133771 134745 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976723.1 protein_id gnl|my_center|LOCUS_12150 134742 135404 gene locus_tag LOCUS_12160 134742 135404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 135677 137485 gene locus_tag LOCUS_12170 gene ftsI 135677 137485 CDS product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028132.1 protein_id gnl|my_center|LOCUS_12170 137496 139046 gene locus_tag LOCUS_12180 137496 139046 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028131.1 protein_id gnl|my_center|LOCUS_12180 139043 140470 gene locus_tag LOCUS_12190 139043 140470 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_12190 140467 141564 gene locus_tag LOCUS_12200 gene mraY 140467 141564 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804699.1 protein_id gnl|my_center|LOCUS_12200 141564 143042 gene locus_tag LOCUS_12210 gene murD 141564 143042 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976729.1 protein_id gnl|my_center|LOCUS_12210 143047 144318 gene locus_tag LOCUS_12220 143047 144318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12220 144318 145424 gene locus_tag LOCUS_12230 gene murG 144318 145424 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976731.1 protein_id gnl|my_center|LOCUS_12230 145421 146857 gene locus_tag LOCUS_12240 gene murC 145421 146857 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228036.1 protein_id gnl|my_center|LOCUS_12240 146854 147600 gene locus_tag LOCUS_12250 146854 147600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 147914 149077 gene locus_tag LOCUS_12260 gene ftsZ 147914 149077 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_12260 149217 149945 gene locus_tag LOCUS_12270 gene pgeF 149217 149945 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028130.1 protein_id gnl|my_center|LOCUS_12270 149942 150673 gene locus_tag LOCUS_12280 149942 150673 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224822.1 protein_id gnl|my_center|LOCUS_12280 150750 151247 gene locus_tag LOCUS_12290 gene sepF 150750 151247 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804707.1 protein_id gnl|my_center|LOCUS_12290 151291 151581 gene locus_tag LOCUS_12300 151291 151581 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804708.1 protein_id gnl|my_center|LOCUS_12300 151646 152665 gene locus_tag LOCUS_12310 151646 152665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence07 852 91 gene locus_tag LOCUS_12320 852 91 CDS product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731251.1 protein_id gnl|my_center|LOCUS_12320 2314 893 gene locus_tag LOCUS_12330 2314 893 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897792.1 protein_id gnl|my_center|LOCUS_12330 3165 2311 gene locus_tag LOCUS_12340 3165 2311 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084084.1 protein_id gnl|my_center|LOCUS_12340 3196 4974 gene locus_tag LOCUS_12350 3196 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229290.1 protein_id gnl|my_center|LOCUS_12350 4984 5118 gene locus_tag LOCUS_12360 4984 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 6485 5232 gene locus_tag LOCUS_12370 6485 5232 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086841211.1 protein_id gnl|my_center|LOCUS_12370 6635 7390 gene locus_tag LOCUS_12380 6635 7390 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229286.1 protein_id gnl|my_center|LOCUS_12380 7407 11615 gene locus_tag LOCUS_12390 7407 11615 CDS product alpha-(1->3)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229292.1 protein_id gnl|my_center|LOCUS_12390 12774 11551 gene locus_tag LOCUS_12400 12774 11551 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730275.1 protein_id gnl|my_center|LOCUS_12400 14591 12771 gene locus_tag LOCUS_12410 14591 12771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296325.1 protein_id gnl|my_center|LOCUS_12410 15423 14668 gene locus_tag LOCUS_12420 15423 14668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 15607 16707 gene locus_tag LOCUS_12430 15607 16707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 17581 16775 gene locus_tag LOCUS_12440 17581 16775 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227917.1 protein_id gnl|my_center|LOCUS_12440 17733 19214 gene locus_tag LOCUS_12450 gene rpsA 17733 19214 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976820.1 protein_id gnl|my_center|LOCUS_12450 19342 19809 gene locus_tag LOCUS_12460 19342 19809 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974936.1 protein_id gnl|my_center|LOCUS_12460 19814 21007 gene locus_tag LOCUS_12470 gene coaE 19814 21007 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286284.1 protein_id gnl|my_center|LOCUS_12470 21011 21322 gene locus_tag LOCUS_12480 21011 21322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 21335 23446 gene locus_tag LOCUS_12490 gene uvrB 21335 23446 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028069.1 protein_id gnl|my_center|LOCUS_12490 23781 23422 gene locus_tag LOCUS_12500 23781 23422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 23675 24661 gene locus_tag LOCUS_12510 23675 24661 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897538.1 protein_id gnl|my_center|LOCUS_12510 25651 24752 gene locus_tag LOCUS_12520 25651 24752 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034357836.1 protein_id gnl|my_center|LOCUS_12520 25754 26956 gene locus_tag LOCUS_12530 25754 26956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 26990 28324 gene locus_tag LOCUS_12540 26990 28324 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166233908.1 protein_id gnl|my_center|LOCUS_12540 28464 29021 gene locus_tag LOCUS_12550 28464 29021 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803749.1 protein_id gnl|my_center|LOCUS_12550 29809 29120 gene locus_tag LOCUS_12560 29809 29120 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227876.1 protein_id gnl|my_center|LOCUS_12560 29981 33124 gene locus_tag LOCUS_12570 gene uvrA 29981 33124 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_12570 33121 33705 gene locus_tag LOCUS_12580 33121 33705 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229692.1 protein_id gnl|my_center|LOCUS_12580 34493 33780 gene locus_tag LOCUS_12590 34493 33780 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028095.1 protein_id gnl|my_center|LOCUS_12590 35317 34490 gene locus_tag LOCUS_12600 35317 34490 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976806.1 protein_id gnl|my_center|LOCUS_12600 37011 35314 gene locus_tag LOCUS_12610 37011 35314 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028094.1 protein_id gnl|my_center|LOCUS_12610 37955 37008 gene locus_tag LOCUS_12620 37955 37008 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028093.1 protein_id gnl|my_center|LOCUS_12620 39320 38088 gene locus_tag LOCUS_12630 39320 38088 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976809.1 protein_id gnl|my_center|LOCUS_12630 39495 39896 gene locus_tag LOCUS_12640 39495 39896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12640 39951 42056 gene locus_tag LOCUS_12650 gene uvrC 39951 42056 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028063.1 protein_id gnl|my_center|LOCUS_12650 42053 42964 gene locus_tag LOCUS_12660 gene rapZ 42053 42964 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_12660 42961 43911 gene locus_tag LOCUS_12670 gene yvcK 42961 43911 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028061.1 protein_id gnl|my_center|LOCUS_12670 44011 44991 gene locus_tag LOCUS_12680 gene whiA 44011 44991 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976869.1 protein_id gnl|my_center|LOCUS_12680 45122 46126 gene locus_tag LOCUS_12690 gene gap 45122 46126 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805120.1 protein_id gnl|my_center|LOCUS_12690 46219 47427 gene locus_tag LOCUS_12700 46219 47427 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930207.1 protein_id gnl|my_center|LOCUS_12700 47424 48221 gene locus_tag LOCUS_12710 gene tpiA 47424 48221 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_12710 48298 48543 gene locus_tag LOCUS_12720 48298 48543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 48602 48961 gene locus_tag LOCUS_12730 48602 48961 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976875.1 protein_id gnl|my_center|LOCUS_12730 49784 49056 gene locus_tag LOCUS_12740 gene pgl 49784 49056 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976879.1 protein_id gnl|my_center|LOCUS_12740 50933 49788 gene locus_tag LOCUS_12750 gene opcA 50933 49788 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224673.1 protein_id gnl|my_center|LOCUS_12750 52474 50930 gene locus_tag LOCUS_12760 gene zwf 52474 50930 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224674.1 protein_id gnl|my_center|LOCUS_12760 54105 52471 gene locus_tag LOCUS_12770 54105 52471 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224675.1 protein_id gnl|my_center|LOCUS_12770 55220 54102 gene locus_tag LOCUS_12780 gene tal 55220 54102 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976882.1 protein_id gnl|my_center|LOCUS_12780 57496 55229 gene locus_tag LOCUS_12790 gene tkt 57496 55229 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167022841.1 protein_id gnl|my_center|LOCUS_12790 57709 58665 gene locus_tag LOCUS_12800 57709 58665 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976885.1 protein_id gnl|my_center|LOCUS_12800 59974 58586 gene locus_tag LOCUS_12810 59974 58586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 60009 60629 gene locus_tag LOCUS_12820 60009 60629 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209080.1 protein_id gnl|my_center|LOCUS_12820 61900 60626 gene locus_tag LOCUS_12830 61900 60626 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230284.1 protein_id gnl|my_center|LOCUS_12830 62496 61897 gene locus_tag LOCUS_12840 62496 61897 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230285.1 protein_id gnl|my_center|LOCUS_12840 63502 62567 gene locus_tag LOCUS_12850 63502 62567 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929933.1 protein_id gnl|my_center|LOCUS_12850 64337 63570 gene locus_tag LOCUS_12860 64337 63570 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 protein_id gnl|my_center|LOCUS_12860 65029 64334 gene locus_tag LOCUS_12870 65029 64334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 65136 65864 gene locus_tag LOCUS_12880 65136 65864 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742174.1 protein_id gnl|my_center|LOCUS_12880 65861 67282 gene locus_tag LOCUS_12890 gene sufB 65861 67282 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_12890 67282 68463 gene locus_tag LOCUS_12900 gene sufD 67282 68463 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976895.1 protein_id gnl|my_center|LOCUS_12900 68460 68801 gene locus_tag LOCUS_12910 68460 68801 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_12910 68827 69582 gene locus_tag LOCUS_12920 gene sufC 68827 69582 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805067.1 protein_id gnl|my_center|LOCUS_12920 69582 70877 gene locus_tag LOCUS_12930 69582 70877 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224700.1 protein_id gnl|my_center|LOCUS_12930 70877 71344 gene locus_tag LOCUS_12940 70877 71344 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082271.1 protein_id gnl|my_center|LOCUS_12940 71364 71690 gene locus_tag LOCUS_12950 71364 71690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 71695 72459 gene locus_tag LOCUS_12960 71695 72459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 73313 72402 gene locus_tag LOCUS_12970 73313 72402 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728749.1 protein_id gnl|my_center|LOCUS_12970 73489 75087 gene locus_tag LOCUS_12980 73489 75087 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 protein_id gnl|my_center|LOCUS_12980 76681 75293 gene locus_tag LOCUS_12990 76681 75293 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228765.1 protein_id gnl|my_center|LOCUS_12990 76764 78620 gene locus_tag LOCUS_13000 76764 78620 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_13000 79527 78733 gene locus_tag LOCUS_13010 79527 78733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 79791 79552 gene locus_tag LOCUS_13020 79791 79552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 80156 79791 gene locus_tag LOCUS_13030 80156 79791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 80262 80969 gene locus_tag LOCUS_13040 80262 80969 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805189.1 protein_id gnl|my_center|LOCUS_13040 80995 81750 gene locus_tag LOCUS_13050 gene fabI 80995 81750 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977009.1 protein_id gnl|my_center|LOCUS_13050 82974 81760 gene locus_tag LOCUS_13060 gene serB 82974 81760 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977014.1 protein_id gnl|my_center|LOCUS_13060 84258 83044 gene locus_tag LOCUS_13070 gene glgC 84258 83044 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805186.1 protein_id gnl|my_center|LOCUS_13070 84433 85623 gene locus_tag LOCUS_13080 gene glgA 84433 85623 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805185.1 protein_id gnl|my_center|LOCUS_13080 86424 85645 gene locus_tag LOCUS_13090 86424 85645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 86438 87220 gene locus_tag LOCUS_13100 86438 87220 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284427.1 protein_id gnl|my_center|LOCUS_13100 87342 87809 gene locus_tag LOCUS_13110 87342 87809 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226504.1 protein_id gnl|my_center|LOCUS_13110 87813 89021 gene locus_tag LOCUS_13120 87813 89021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 89131 89901 gene locus_tag LOCUS_13130 89131 89901 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729298.1 protein_id gnl|my_center|LOCUS_13130 89898 90620 gene locus_tag LOCUS_13140 89898 90620 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261750.1 protein_id gnl|my_center|LOCUS_13140 90630 91448 gene locus_tag LOCUS_13150 90630 91448 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812896.1 protein_id gnl|my_center|LOCUS_13150 92108 91428 gene locus_tag LOCUS_13160 92108 91428 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971784.1 protein_id gnl|my_center|LOCUS_13160 92741 92190 gene locus_tag LOCUS_13170 92741 92190 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977028.1 protein_id gnl|my_center|LOCUS_13170 93152 92751 gene locus_tag LOCUS_13180 93152 92751 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027736.1 protein_id gnl|my_center|LOCUS_13180 93916 93149 gene locus_tag LOCUS_13190 93916 93149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977478.1 protein_id gnl|my_center|LOCUS_13190 93999 95024 gene locus_tag LOCUS_13200 93999 95024 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056930.1 protein_id gnl|my_center|LOCUS_13200 95929 95021 gene locus_tag LOCUS_13210 gene mmuM 95929 95021 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030679.1 protein_id gnl|my_center|LOCUS_13210 96086 96171 gene locus_tag LOCUS_t00230 96086 96171 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 96236 96826 gene locus_tag LOCUS_13220 96236 96826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13220 96826 96981 gene locus_tag LOCUS_13230 96826 96981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 97669 97001 gene locus_tag LOCUS_13240 97669 97001 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975488.1 protein_id gnl|my_center|LOCUS_13240 98403 97666 gene locus_tag LOCUS_13250 98403 97666 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028918.1 protein_id gnl|my_center|LOCUS_13250 99140 98400 gene locus_tag LOCUS_13260 99140 98400 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898975.1 protein_id gnl|my_center|LOCUS_13260 99338 100660 gene locus_tag LOCUS_13270 99338 100660 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804006.1 protein_id gnl|my_center|LOCUS_13270 100900 100715 gene locus_tag LOCUS_13280 100900 100715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 100940 101266 gene locus_tag LOCUS_13290 100940 101266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 102205 101285 gene locus_tag LOCUS_13300 102205 101285 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285031.1 protein_id gnl|my_center|LOCUS_13300 102129 103379 gene locus_tag LOCUS_13310 102129 103379 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226472.1 protein_id gnl|my_center|LOCUS_13310 103483 104340 gene locus_tag LOCUS_13320 103483 104340 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972097.1 protein_id gnl|my_center|LOCUS_13320 105376 104357 gene locus_tag LOCUS_13330 gene corA 105376 104357 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223003.1 protein_id gnl|my_center|LOCUS_13330 105400 106098 gene locus_tag LOCUS_13340 105400 106098 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977159.1 protein_id gnl|my_center|LOCUS_13340 106109 106603 gene locus_tag LOCUS_13350 106109 106603 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977160.1 protein_id gnl|my_center|LOCUS_13350 106587 107387 gene locus_tag LOCUS_13360 106587 107387 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226501.1 protein_id gnl|my_center|LOCUS_13360 107494 109143 gene locus_tag LOCUS_13370 107494 109143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 109143 109583 gene locus_tag LOCUS_13380 109143 109583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 109580 111772 gene locus_tag LOCUS_13390 109580 111772 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_13390 111813 113069 gene locus_tag LOCUS_13400 gene mshC 111813 113069 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_13400 114011 113151 gene locus_tag LOCUS_13410 gene parJ 114011 113151 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_13410 117790 114008 gene locus_tag LOCUS_13420 gene metH 117790 114008 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729624.1 protein_id gnl|my_center|LOCUS_13420 117905 118579 gene locus_tag LOCUS_13430 117905 118579 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977169.1 protein_id gnl|my_center|LOCUS_13430 119939 118590 gene locus_tag LOCUS_13440 119939 118590 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728155.1 protein_id gnl|my_center|LOCUS_13440 120016 121503 gene locus_tag LOCUS_13450 120016 121503 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013433.1 protein_id gnl|my_center|LOCUS_13450 121509 122849 gene locus_tag LOCUS_13460 121509 122849 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110217.1 protein_id gnl|my_center|LOCUS_13460 122944 124419 gene locus_tag LOCUS_13470 122944 124419 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030374.1 protein_id gnl|my_center|LOCUS_13470 125345 124422 gene locus_tag LOCUS_13480 125345 124422 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485830.1 protein_id gnl|my_center|LOCUS_13480 125387 126472 gene locus_tag LOCUS_13490 125387 126472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 126484 127572 gene locus_tag LOCUS_13500 126484 127572 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_13500 127612 129267 gene locus_tag LOCUS_13510 gene arc 127612 129267 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_13510 129811 129299 gene locus_tag LOCUS_13520 129811 129299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 130585 130109 gene locus_tag LOCUS_13530 130585 130109 CDS product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401978.1 protein_id gnl|my_center|LOCUS_13530 131571 130582 gene locus_tag LOCUS_13540 131571 130582 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027351.1 protein_id gnl|my_center|LOCUS_13540 132597 131611 gene locus_tag LOCUS_13550 132597 131611 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407276.1 protein_id gnl|my_center|LOCUS_13550 132634 134169 gene locus_tag LOCUS_13560 gene dop 132634 134169 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_13560 134179 134373 gene locus_tag LOCUS_13570 134179 134373 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856167.1 protein_id gnl|my_center|LOCUS_13570 134370 135194 gene locus_tag LOCUS_13580 gene prcB 134370 135194 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_13580 135191 136072 gene locus_tag LOCUS_13590 gene prcA 135191 136072 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_13590 136089 137495 gene locus_tag LOCUS_13600 gene pafA 136089 137495 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729397.1 protein_id gnl|my_center|LOCUS_13600 137581 138534 gene locus_tag LOCUS_13610 137581 138534 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068443.1 protein_id gnl|my_center|LOCUS_13610 138579 138965 gene locus_tag LOCUS_13620 138579 138965 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222011.1 protein_id gnl|my_center|LOCUS_13620 140316 139123 gene locus_tag LOCUS_13630 140316 139123 CDS product DUF3866 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805204.1 protein_id gnl|my_center|LOCUS_13630 140315 142321 gene locus_tag LOCUS_13640 140315 142321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 142462 142761 gene locus_tag LOCUS_13650 142462 142761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 142776 143585 gene locus_tag LOCUS_13660 gene tatC 142776 143585 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977194.1 protein_id gnl|my_center|LOCUS_13660 143634 144524 gene locus_tag LOCUS_13670 143634 144524 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112080.1 protein_id gnl|my_center|LOCUS_13670 144584 147436 gene locus_tag LOCUS_13680 144584 147436 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_13680 147478 148353 gene locus_tag LOCUS_13690 147478 148353 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_13690 149421 148501 gene locus_tag LOCUS_13700 149421 148501 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027889.1 protein_id gnl|my_center|LOCUS_13700 149809 149441 gene locus_tag LOCUS_13710 149809 149441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 149880 150302 gene locus_tag LOCUS_13720 149880 150302 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019983923.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence08 1211 93 gene locus_tag LOCUS_13730 gene ispG 1211 93 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284254.1 protein_id gnl|my_center|LOCUS_13730 1379 2068 gene locus_tag LOCUS_13740 1379 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 2047 2208 gene locus_tag LOCUS_13750 2047 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 2205 3182 gene locus_tag LOCUS_13760 2205 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 3619 3146 gene locus_tag LOCUS_13770 3619 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 4984 3638 gene locus_tag LOCUS_13780 4984 3638 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804643.1 protein_id gnl|my_center|LOCUS_13780 6192 4981 gene locus_tag LOCUS_13790 gene dxr 6192 4981 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973332.1 protein_id gnl|my_center|LOCUS_13790 6688 6206 gene locus_tag LOCUS_13800 6688 6206 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873063.1 protein_id gnl|my_center|LOCUS_13800 6936 8978 gene locus_tag LOCUS_13810 6936 8978 CDS product elongation factor G-like protein EF-G2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400860.1 protein_id gnl|my_center|LOCUS_13810 9224 9847 gene locus_tag LOCUS_13820 9224 9847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 10297 9941 gene locus_tag LOCUS_13830 10297 9941 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228442.1 protein_id gnl|my_center|LOCUS_13830 10806 10294 gene locus_tag LOCUS_13840 10806 10294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 12283 10820 gene locus_tag LOCUS_13850 12283 10820 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229619.1 protein_id gnl|my_center|LOCUS_13850 13230 12346 gene locus_tag LOCUS_13860 13230 12346 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973355.1 protein_id gnl|my_center|LOCUS_13860 14138 13227 gene locus_tag LOCUS_13870 14138 13227 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030376.1 protein_id gnl|my_center|LOCUS_13870 15298 14135 gene locus_tag LOCUS_13880 15298 14135 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973357.1 protein_id gnl|my_center|LOCUS_13880 16530 15298 gene locus_tag LOCUS_13890 16530 15298 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030369.1 protein_id gnl|my_center|LOCUS_13890 16784 17269 gene locus_tag LOCUS_13900 16784 17269 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111753.1 protein_id gnl|my_center|LOCUS_13900 17281 18705 gene locus_tag LOCUS_13910 17281 18705 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893069.1 protein_id gnl|my_center|LOCUS_13910 18702 20075 gene locus_tag LOCUS_13920 18702 20075 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878659.1 protein_id gnl|my_center|LOCUS_13920 20105 20467 gene locus_tag LOCUS_13930 20105 20467 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728561.1 protein_id gnl|my_center|LOCUS_13930 20457 21584 gene locus_tag LOCUS_13940 20457 21584 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284839.1 protein_id gnl|my_center|LOCUS_13940 22475 21591 gene locus_tag LOCUS_13950 gene purU 22475 21591 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974579.1 protein_id gnl|my_center|LOCUS_13950 23695 22472 gene locus_tag LOCUS_13960 gene rlmN 23695 22472 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973380.1 protein_id gnl|my_center|LOCUS_13960 24600 23758 gene locus_tag LOCUS_13970 24600 23758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13970 25197 24640 gene locus_tag LOCUS_13980 gene frr 25197 24640 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 protein_id gnl|my_center|LOCUS_13980 26027 25302 gene locus_tag LOCUS_13990 gene pyrH 26027 25302 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804636.1 protein_id gnl|my_center|LOCUS_13990 26159 28120 gene locus_tag LOCUS_14000 26159 28120 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089548.1 protein_id gnl|my_center|LOCUS_14000 28174 28629 gene locus_tag LOCUS_14010 28174 28629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 30811 28751 gene locus_tag LOCUS_14020 30811 28751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 31497 30808 gene locus_tag LOCUS_14030 31497 30808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 31838 31479 gene locus_tag LOCUS_14040 31838 31479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 32841 32065 gene locus_tag LOCUS_14050 gene istB 32841 32065 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_14050 34472 32838 gene locus_tag LOCUS_14060 gene istA 34472 32838 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189327688.1 protein_id gnl|my_center|LOCUS_14060 34620 35030 gene locus_tag LOCUS_14070 34620 35030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 35174 36025 gene locus_tag LOCUS_14080 35174 36025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 36767 36273 gene locus_tag LOCUS_14090 36767 36273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 38047 36743 gene locus_tag LOCUS_14100 38047 36743 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230284.1 protein_id gnl|my_center|LOCUS_14100 38990 38205 gene locus_tag LOCUS_14110 38990 38205 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027093.1 protein_id gnl|my_center|LOCUS_14110 39058 39867 gene locus_tag LOCUS_14120 39058 39867 CDS product DUF3626 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226733.1 protein_id gnl|my_center|LOCUS_14120 40288 39950 gene locus_tag LOCUS_14130 40288 39950 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224148.1 protein_id gnl|my_center|LOCUS_14130 41296 40460 gene locus_tag LOCUS_14140 gene tsf 41296 40460 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804635.1 protein_id gnl|my_center|LOCUS_14140 42247 41351 gene locus_tag LOCUS_14150 gene rpsB 42247 41351 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106517497.1 protein_id gnl|my_center|LOCUS_14150 43553 42378 gene locus_tag LOCUS_14160 43553 42378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14160 43926 45122 gene locus_tag LOCUS_14170 43926 45122 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_14170 45241 45948 gene locus_tag LOCUS_14180 45241 45948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14180 46982 45930 gene locus_tag LOCUS_14190 46982 45930 CDS product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030168.1 protein_id gnl|my_center|LOCUS_14190 47901 46975 gene locus_tag LOCUS_14200 47901 46975 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088347.1 protein_id gnl|my_center|LOCUS_14200 49115 47967 gene locus_tag LOCUS_14210 gene dprA 49115 47967 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742183.1 protein_id gnl|my_center|LOCUS_14210 50656 49112 gene locus_tag LOCUS_14220 50656 49112 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804630.1 protein_id gnl|my_center|LOCUS_14220 51036 50653 gene locus_tag LOCUS_14230 51036 50653 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872622.1 protein_id gnl|my_center|LOCUS_14230 51509 51192 gene locus_tag LOCUS_14240 51509 51192 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096226.1 protein_id gnl|my_center|LOCUS_14240 52270 51506 gene locus_tag LOCUS_14250 52270 51506 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030471.1 protein_id gnl|my_center|LOCUS_14250 53199 52267 gene locus_tag LOCUS_14260 53199 52267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14260 53912 53196 gene locus_tag LOCUS_14270 gene lepB 53912 53196 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804625.1 protein_id gnl|my_center|LOCUS_14270 54325 53966 gene locus_tag LOCUS_14280 gene rplS 54325 53966 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804624.1 protein_id gnl|my_center|LOCUS_14280 54543 55343 gene locus_tag LOCUS_14290 54543 55343 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227890.1 protein_id gnl|my_center|LOCUS_14290 55411 55803 gene locus_tag LOCUS_14300 55411 55803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 55803 55997 gene locus_tag LOCUS_14310 55803 55997 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 protein_id gnl|my_center|LOCUS_14310 57215 56037 gene locus_tag LOCUS_14320 57215 56037 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224327.1 protein_id gnl|my_center|LOCUS_14320 57665 57324 gene locus_tag LOCUS_14330 57665 57324 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090412.1 protein_id gnl|my_center|LOCUS_14330 57752 58117 gene locus_tag LOCUS_14340 57752 58117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 59360 58128 gene locus_tag LOCUS_14350 59360 58128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 59906 59361 gene locus_tag LOCUS_14360 gene rimM 59906 59361 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804622.1 protein_id gnl|my_center|LOCUS_14360 60248 60012 gene locus_tag LOCUS_14370 60248 60012 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973401.1 protein_id gnl|my_center|LOCUS_14370 60871 60251 gene locus_tag LOCUS_14380 60871 60251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 62153 61065 gene locus_tag LOCUS_14390 62153 61065 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976959.1 protein_id gnl|my_center|LOCUS_14390 62982 62164 gene locus_tag LOCUS_14400 62982 62164 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390517.1 protein_id gnl|my_center|LOCUS_14400 64598 62979 gene locus_tag LOCUS_14410 gene ffh 64598 62979 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389541.1 protein_id gnl|my_center|LOCUS_14410 64672 65622 gene locus_tag LOCUS_14420 64672 65622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225109.1 protein_id gnl|my_center|LOCUS_14420 68061 65647 gene locus_tag LOCUS_14430 68061 65647 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487177.1 protein_id gnl|my_center|LOCUS_14430 68471 68133 gene locus_tag LOCUS_14440 68471 68133 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893792.1 protein_id gnl|my_center|LOCUS_14440 69839 68475 gene locus_tag LOCUS_14450 69839 68475 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087724.1 protein_id gnl|my_center|LOCUS_14450 70704 69949 gene locus_tag LOCUS_14460 70704 69949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 71796 70741 gene locus_tag LOCUS_14470 71796 70741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 73318 71804 gene locus_tag LOCUS_14480 73318 71804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 73696 73403 gene locus_tag LOCUS_14490 73696 73403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 77371 73790 gene locus_tag LOCUS_14500 gene smc 77371 73790 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030315.1 protein_id gnl|my_center|LOCUS_14500 77832 77491 gene locus_tag LOCUS_14510 77832 77491 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976797.1 protein_id gnl|my_center|LOCUS_14510 79337 77931 gene locus_tag LOCUS_14520 79337 77931 CDS product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227742.1 protein_id gnl|my_center|LOCUS_14520 80626 79454 gene locus_tag LOCUS_14530 80626 79454 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230190.1 protein_id gnl|my_center|LOCUS_14530 81291 80623 gene locus_tag LOCUS_14540 81291 80623 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_14540 82321 81311 gene locus_tag LOCUS_14550 82321 81311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 83393 82479 gene locus_tag LOCUS_14560 83393 82479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 83925 83614 gene locus_tag LOCUS_14570 83925 83614 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223794.1 protein_id gnl|my_center|LOCUS_14570 84056 84568 gene locus_tag LOCUS_14580 84056 84568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 85037 85333 gene locus_tag LOCUS_14590 85037 85333 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005643896.1 protein_id gnl|my_center|LOCUS_14590 86264 85386 gene locus_tag LOCUS_14600 gene mutM 86264 85386 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223692.1 protein_id gnl|my_center|LOCUS_14600 87115 86303 gene locus_tag LOCUS_14610 gene rnc 87115 86303 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_14610 87327 87133 gene locus_tag LOCUS_14620 gene rpmF 87327 87133 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811892.1 protein_id gnl|my_center|LOCUS_14620 87916 87329 gene locus_tag LOCUS_14630 87916 87329 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_14630 88547 88050 gene locus_tag LOCUS_14640 88547 88050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 88861 88544 gene locus_tag LOCUS_14650 88861 88544 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804808.1 protein_id gnl|my_center|LOCUS_14650 90935 88923 gene locus_tag LOCUS_14660 90935 88923 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228230.1 protein_id gnl|my_center|LOCUS_14660 91483 91001 gene locus_tag LOCUS_14670 gene coaD 91483 91001 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056942.1 protein_id gnl|my_center|LOCUS_14670 92441 91572 gene locus_tag LOCUS_14680 92441 91572 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762776.1 protein_id gnl|my_center|LOCUS_14680 93024 92464 gene locus_tag LOCUS_14690 gene rsmD 93024 92464 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466716.1 protein_id gnl|my_center|LOCUS_14690 95222 93024 gene locus_tag LOCUS_14700 gene recG 95222 93024 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973428.1 protein_id gnl|my_center|LOCUS_14700 96916 95222 gene locus_tag LOCUS_14710 96916 95222 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030309.1 protein_id gnl|my_center|LOCUS_14710 97120 97314 gene locus_tag LOCUS_14720 gene rpmB 97120 97314 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_14720 98379 97405 gene locus_tag LOCUS_14730 98379 97405 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973432.1 protein_id gnl|my_center|LOCUS_14730 98491 98724 gene locus_tag LOCUS_14740 98491 98724 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973433.1 protein_id gnl|my_center|LOCUS_14740 98754 99191 gene locus_tag LOCUS_14750 98754 99191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 100401 99274 gene locus_tag LOCUS_14760 100401 99274 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973434.1 protein_id gnl|my_center|LOCUS_14760 100507 101613 gene locus_tag LOCUS_14770 100507 101613 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015376.1 protein_id gnl|my_center|LOCUS_14770 103193 101754 gene locus_tag LOCUS_14780 103193 101754 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803904.1 protein_id gnl|my_center|LOCUS_14780 104343 103345 gene locus_tag LOCUS_14790 104343 103345 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 protein_id gnl|my_center|LOCUS_14790 105128 104340 gene locus_tag LOCUS_14800 105128 104340 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 protein_id gnl|my_center|LOCUS_14800 105237 105869 gene locus_tag LOCUS_14810 gene cofC 105237 105869 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973437.1 protein_id gnl|my_center|LOCUS_14810 107185 105851 gene locus_tag LOCUS_14820 gene murA 107185 105851 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775882.1 protein_id gnl|my_center|LOCUS_14820 107830 107249 gene locus_tag LOCUS_14830 107830 107249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14830 108898 108299 gene locus_tag LOCUS_14840 gene leuD 108898 108299 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223620.1 protein_id gnl|my_center|LOCUS_14840 110326 108917 gene locus_tag LOCUS_14850 gene leuC 110326 108917 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223619.1 protein_id gnl|my_center|LOCUS_14850 110460 111209 gene locus_tag LOCUS_14860 110460 111209 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775885.1 protein_id gnl|my_center|LOCUS_14860 111206 111700 gene locus_tag LOCUS_14870 111206 111700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 111839 111766 gene locus_tag LOCUS_t00240 111839 111766 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 112019 111947 gene locus_tag LOCUS_t00250 112019 111947 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 112392 112123 gene locus_tag LOCUS_14880 112392 112123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14880 114464 112833 gene locus_tag LOCUS_14890 gene gltX 114464 112833 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775887.1 protein_id gnl|my_center|LOCUS_14890 115299 114523 gene locus_tag LOCUS_14900 115299 114523 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775888.1 protein_id gnl|my_center|LOCUS_14900 116309 115341 gene locus_tag LOCUS_14910 116309 115341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 116342 117208 gene locus_tag LOCUS_14920 116342 117208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226805.1 protein_id gnl|my_center|LOCUS_14920 117431 117171 gene locus_tag LOCUS_14930 117431 117171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 118540 117428 gene locus_tag LOCUS_14940 118540 117428 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973478.1 protein_id gnl|my_center|LOCUS_14940 118587 122087 gene locus_tag LOCUS_14950 118587 122087 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197702416.1 protein_id gnl|my_center|LOCUS_14950 122354 122998 gene locus_tag LOCUS_14960 122354 122998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 123013 123825 gene locus_tag LOCUS_14970 123013 123825 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228778.1 protein_id gnl|my_center|LOCUS_14970 124118 124696 gene locus_tag LOCUS_14980 124118 124696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803693.1 protein_id gnl|my_center|LOCUS_14980 126366 124777 gene locus_tag LOCUS_14990 gene cimA 126366 124777 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030295.1 protein_id gnl|my_center|LOCUS_14990 127186 126668 gene locus_tag LOCUS_15000 127186 126668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 128408 127314 gene locus_tag LOCUS_15010 128408 127314 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036086.1 protein_id gnl|my_center|LOCUS_15010 129581 128529 gene locus_tag LOCUS_15020 129581 128529 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030290.1 protein_id gnl|my_center|LOCUS_15020 134572 129698 gene locus_tag LOCUS_15030 134572 129698 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_15030 134724 135050 gene locus_tag LOCUS_15040 134724 135050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 135047 135562 gene locus_tag LOCUS_15050 135047 135562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 135571 136065 gene locus_tag LOCUS_15060 135571 136065 CDS product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776068.1 protein_id gnl|my_center|LOCUS_15060 136490 136077 gene locus_tag LOCUS_15070 136490 136077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028709.1 protein_id gnl|my_center|LOCUS_15070 137981 136560 gene locus_tag LOCUS_15080 137981 136560 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229720.1 protein_id gnl|my_center|LOCUS_15080 138381 137986 gene locus_tag LOCUS_15090 138381 137986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 139757 138378 gene locus_tag LOCUS_15100 139757 138378 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776070.1 protein_id gnl|my_center|LOCUS_15100 140419 139754 gene locus_tag LOCUS_15110 140419 139754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 140629 140865 gene locus_tag LOCUS_15120 140629 140865 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776072.1 protein_id gnl|my_center|LOCUS_15120 141445 140903 gene locus_tag LOCUS_15130 141445 140903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 141671 142375 gene locus_tag LOCUS_15140 141671 142375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 142372 142968 gene locus_tag LOCUS_15150 142372 142968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 <145366 143048 gene locus_tag LOCUS_15160 <145366 143048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975807.1:preprotein translocase subunit SecA >Feature sequence09 3070 1553 gene locus_tag LOCUS_15170 3070 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 3681 3067 gene locus_tag LOCUS_15180 3681 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 4083 3793 gene locus_tag LOCUS_15190 4083 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 4406 4098 gene locus_tag LOCUS_15200 4406 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 4692 6050 gene locus_tag LOCUS_15210 gene eccD 4692 6050 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222634.1 protein_id gnl|my_center|LOCUS_15210 6053 7426 gene locus_tag LOCUS_15220 gene eccB 6053 7426 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224123.1 protein_id gnl|my_center|LOCUS_15220 7423 8760 gene locus_tag LOCUS_15230 gene mycP 7423 8760 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030414.1 protein_id gnl|my_center|LOCUS_15230 8805 11465 gene locus_tag LOCUS_15240 gene valS 8805 11465 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054756.1 protein_id gnl|my_center|LOCUS_15240 12320 11601 gene locus_tag LOCUS_15250 12320 11601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 13673 12393 gene locus_tag LOCUS_15260 gene clpX 13673 12393 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412634.1 protein_id gnl|my_center|LOCUS_15260 14634 13954 gene locus_tag LOCUS_15270 14634 13954 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930165.1 protein_id gnl|my_center|LOCUS_15270 15281 14637 gene locus_tag LOCUS_15280 15281 14637 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115412275.1 protein_id gnl|my_center|LOCUS_15280 16336 15443 gene locus_tag LOCUS_15290 16336 15443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 17041 16340 gene locus_tag LOCUS_15300 17041 16340 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729168.1 protein_id gnl|my_center|LOCUS_15300 17958 17134 gene locus_tag LOCUS_15310 17958 17134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 19156 18224 gene locus_tag LOCUS_15320 19156 18224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 20515 19289 gene locus_tag LOCUS_15330 20515 19289 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029671.1 protein_id gnl|my_center|LOCUS_15330 20597 21679 gene locus_tag LOCUS_15340 20597 21679 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033373915.1 protein_id gnl|my_center|LOCUS_15340 23253 21754 gene locus_tag LOCUS_15350 gene tig 23253 21754 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804577.1 protein_id gnl|my_center|LOCUS_15350 23510 23962 gene locus_tag LOCUS_15360 23510 23962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 24101 24030 gene locus_tag LOCUS_t00260 24101 24030 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 24202 24276 gene locus_tag LOCUS_t00270 24202 24276 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 25025 24333 gene locus_tag LOCUS_15370 gene trmB 25025 24333 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230974.1 protein_id gnl|my_center|LOCUS_15370 26625 25150 gene locus_tag LOCUS_15380 26625 25150 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027994.1 protein_id gnl|my_center|LOCUS_15380 27846 26734 gene locus_tag LOCUS_15390 27846 26734 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976175.1 protein_id gnl|my_center|LOCUS_15390 28404 27937 gene locus_tag LOCUS_15400 28404 27937 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666673.1 protein_id gnl|my_center|LOCUS_15400 29053 28439 gene locus_tag LOCUS_15410 29053 28439 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730011.1 protein_id gnl|my_center|LOCUS_15410 29199 31745 gene locus_tag LOCUS_15420 gene pepN 29199 31745 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804773.1 protein_id gnl|my_center|LOCUS_15420 31838 32677 gene locus_tag LOCUS_15430 31838 32677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 32674 33255 gene locus_tag LOCUS_15440 32674 33255 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222096.1 protein_id gnl|my_center|LOCUS_15440 33997 33224 gene locus_tag LOCUS_15450 33997 33224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 33990 34394 gene locus_tag LOCUS_15460 33990 34394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 34399 34809 gene locus_tag LOCUS_15470 34399 34809 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_15470 34888 36582 gene locus_tag LOCUS_15480 34888 36582 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804840.1 protein_id gnl|my_center|LOCUS_15480 36587 37378 gene locus_tag LOCUS_15490 36587 37378 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_15490 38324 37521 gene locus_tag LOCUS_15500 38324 37521 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013899.1 protein_id gnl|my_center|LOCUS_15500 38522 38334 gene locus_tag LOCUS_15510 38522 38334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 38452 39780 gene locus_tag LOCUS_15520 38452 39780 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054423.1 protein_id gnl|my_center|LOCUS_15520 40400 39762 gene locus_tag LOCUS_15530 40400 39762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 40849 40397 gene locus_tag LOCUS_15540 40849 40397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 40963 43050 gene locus_tag LOCUS_15550 40963 43050 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775917.1 protein_id gnl|my_center|LOCUS_15550 43061 44014 gene locus_tag LOCUS_15560 gene tesB 43061 44014 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972544.1 protein_id gnl|my_center|LOCUS_15560 45886 44120 gene locus_tag LOCUS_15570 gene treZ 45886 44120 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224465.1 protein_id gnl|my_center|LOCUS_15570 48403 45959 gene locus_tag LOCUS_15580 gene treY 48403 45959 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930196.1 protein_id gnl|my_center|LOCUS_15580 50790 48406 gene locus_tag LOCUS_15590 gene glgX 50790 48406 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804991.1 protein_id gnl|my_center|LOCUS_15590 51041 51796 gene locus_tag LOCUS_15600 gene fabG 51041 51796 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_15600 52012 51797 gene locus_tag LOCUS_15610 52012 51797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 51902 52699 gene locus_tag LOCUS_15620 51902 52699 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224195.1 protein_id gnl|my_center|LOCUS_15620 54166 52769 gene locus_tag LOCUS_15630 54166 52769 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014188.1 protein_id gnl|my_center|LOCUS_15630 55548 54163 gene locus_tag LOCUS_15640 55548 54163 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123927512.1 protein_id gnl|my_center|LOCUS_15640 55810 56592 gene locus_tag LOCUS_15650 55810 56592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 56585 60277 gene locus_tag LOCUS_15660 56585 60277 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775897.1 protein_id gnl|my_center|LOCUS_15660 60309 61970 gene locus_tag LOCUS_15670 gene narH 60309 61970 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775896.1 protein_id gnl|my_center|LOCUS_15670 61967 62689 gene locus_tag LOCUS_15680 61967 62689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 62686 63432 gene locus_tag LOCUS_15690 gene narI 62686 63432 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730339.1 protein_id gnl|my_center|LOCUS_15690 63429 64691 gene locus_tag LOCUS_15700 63429 64691 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113181.1 protein_id gnl|my_center|LOCUS_15700 64633 65370 gene locus_tag LOCUS_15710 64633 65370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15710 65367 65621 gene locus_tag LOCUS_15720 65367 65621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 66039 65590 gene locus_tag LOCUS_15730 66039 65590 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978655.1 protein_id gnl|my_center|LOCUS_15730 66362 66039 gene locus_tag LOCUS_15740 66362 66039 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776328.1 protein_id gnl|my_center|LOCUS_15740 66441 67100 gene locus_tag LOCUS_15750 66441 67100 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929996.1 protein_id gnl|my_center|LOCUS_15750 67102 68196 gene locus_tag LOCUS_15760 67102 68196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257446.1 protein_id gnl|my_center|LOCUS_15760 68193 70838 gene locus_tag LOCUS_15770 68193 70838 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082793861.1 protein_id gnl|my_center|LOCUS_15770 70864 71604 gene locus_tag LOCUS_15780 70864 71604 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529940.1 protein_id gnl|my_center|LOCUS_15780 72831 71686 gene locus_tag LOCUS_15790 72831 71686 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072191.1 protein_id gnl|my_center|LOCUS_15790 72885 73511 gene locus_tag LOCUS_15800 72885 73511 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977126.1 protein_id gnl|my_center|LOCUS_15800 75369 73687 gene locus_tag LOCUS_15810 gene ettA 75369 73687 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804765.1 protein_id gnl|my_center|LOCUS_15810 76038 75457 gene locus_tag LOCUS_15820 76038 75457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 77941 76268 gene locus_tag LOCUS_15830 77941 76268 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776426.1 protein_id gnl|my_center|LOCUS_15830 79650 77938 gene locus_tag LOCUS_15840 79650 77938 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073255020.1 protein_id gnl|my_center|LOCUS_15840 79723 80190 gene locus_tag LOCUS_15850 79723 80190 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831429.1 protein_id gnl|my_center|LOCUS_15850 80195 80785 gene locus_tag LOCUS_15860 gene thpR 80195 80785 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029587.1 protein_id gnl|my_center|LOCUS_15860 80827 80752 gene locus_tag LOCUS_t00280 80827 80752 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 80890 81570 gene locus_tag LOCUS_15870 80890 81570 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230130.1 protein_id gnl|my_center|LOCUS_15870 82813 81590 gene locus_tag LOCUS_15880 82813 81590 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224417.1 protein_id gnl|my_center|LOCUS_15880 82894 83637 gene locus_tag LOCUS_15890 82894 83637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 85152 83812 gene locus_tag LOCUS_15900 85152 83812 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086878.1 protein_id gnl|my_center|LOCUS_15900 89066 85149 gene locus_tag LOCUS_15910 89066 85149 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731067.1 protein_id gnl|my_center|LOCUS_15910 90385 89072 gene locus_tag LOCUS_15920 90385 89072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 90336 91010 gene locus_tag LOCUS_15930 gene orn 90336 91010 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976007.1 protein_id gnl|my_center|LOCUS_15930 91182 91109 gene locus_tag LOCUS_t00290 91182 91109 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 91931 91266 gene locus_tag LOCUS_15940 91931 91266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 92043 92118 gene locus_tag LOCUS_t00300 92043 92118 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 93790 92111 gene locus_tag LOCUS_15950 93790 92111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 94175 93969 gene locus_tag LOCUS_15960 94175 93969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 94757 94179 gene locus_tag LOCUS_15970 94757 94179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 95191 94754 gene locus_tag LOCUS_15980 95191 94754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 97052 95274 gene locus_tag LOCUS_15990 97052 95274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 97597 97049 gene locus_tag LOCUS_16000 97597 97049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 99078 97594 gene locus_tag LOCUS_16010 99078 97594 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031263.1 protein_id gnl|my_center|LOCUS_16010 99971 99075 gene locus_tag LOCUS_16020 99971 99075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 99989 100669 gene locus_tag LOCUS_16030 99989 100669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 102145 100676 gene locus_tag LOCUS_16040 102145 100676 CDS product type VII secretion protein EccE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029051.1 protein_id gnl|my_center|LOCUS_16040 103531 102149 gene locus_tag LOCUS_16050 103531 102149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 103877 103557 gene locus_tag LOCUS_16060 103877 103557 CDS product DUF6112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029048.1 protein_id gnl|my_center|LOCUS_16060 104293 104027 gene locus_tag LOCUS_16070 104293 104027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 105910 104300 gene locus_tag LOCUS_16080 105910 104300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 106640 105924 gene locus_tag LOCUS_16090 106640 105924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235933774.1 protein_id gnl|my_center|LOCUS_16090 107651 106653 gene locus_tag LOCUS_16100 107651 106653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 108541 107648 gene locus_tag LOCUS_16110 108541 107648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 109039 108635 gene locus_tag LOCUS_16120 109039 108635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 109719 109036 gene locus_tag LOCUS_16130 109719 109036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 110648 109716 gene locus_tag LOCUS_16140 110648 109716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 111721 110648 gene locus_tag LOCUS_16150 111721 110648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 112032 112463 gene locus_tag LOCUS_16160 112032 112463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 112984 113994 gene locus_tag LOCUS_16170 112984 113994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 113991 115127 gene locus_tag LOCUS_16180 113991 115127 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047119416.1 protein_id gnl|my_center|LOCUS_16180 115263 115463 gene locus_tag LOCUS_16190 115263 115463 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_16190 115553 119155 gene locus_tag LOCUS_16200 115553 119155 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 protein_id gnl|my_center|LOCUS_16200 119152 121995 gene locus_tag LOCUS_16210 119152 121995 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_16210 121999 123117 gene locus_tag LOCUS_16220 121999 123117 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 protein_id gnl|my_center|LOCUS_16220 123178 126579 gene locus_tag LOCUS_16230 123178 126579 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_16230 126588 127982 gene locus_tag LOCUS_16240 126588 127982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 127979 128620 gene locus_tag LOCUS_16250 127979 128620 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169895.1 protein_id gnl|my_center|LOCUS_16250 128686 129243 gene locus_tag LOCUS_16260 128686 129243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 129240 130394 gene locus_tag LOCUS_16270 129240 130394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 130391 131536 gene locus_tag LOCUS_16280 130391 131536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 131858 131541 gene locus_tag LOCUS_16290 131858 131541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 132252 131848 gene locus_tag LOCUS_16300 132252 131848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 132561 132839 gene locus_tag LOCUS_16310 132561 132839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence10 3276 397 gene locus_tag LOCUS_16320 3276 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 4010 3273 gene locus_tag LOCUS_16330 4010 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 4349 5392 gene locus_tag LOCUS_16340 4349 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 5361 5879 gene locus_tag LOCUS_16350 5361 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 6180 6413 gene locus_tag LOCUS_16360 6180 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 6548 7522 gene locus_tag LOCUS_16370 6548 7522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 7591 8943 gene locus_tag LOCUS_16380 7591 8943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 8940 9155 gene locus_tag LOCUS_16390 8940 9155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 9456 9373 gene locus_tag LOCUS_t00310 9456 9373 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9901 10737 gene locus_tag LOCUS_16400 gene fhaA 9901 10737 CDS product antibiotic biosynthesis regulator FhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975091.1 protein_id gnl|my_center|LOCUS_16400 10734 11228 gene locus_tag LOCUS_16410 gene fhaB 10734 11228 CDS product antibiotic biosynthesis regulator FhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975090.1 protein_id gnl|my_center|LOCUS_16410 11233 12633 gene locus_tag LOCUS_16420 11233 12633 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776670.1 protein_id gnl|my_center|LOCUS_16420 12630 14003 gene locus_tag LOCUS_16430 12630 14003 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029267.1 protein_id gnl|my_center|LOCUS_16430 14000 15457 gene locus_tag LOCUS_16440 14000 15457 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776672.1 protein_id gnl|my_center|LOCUS_16440 15454 17058 gene locus_tag LOCUS_16450 15454 17058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16450 17180 19153 gene locus_tag LOCUS_16460 gene pknB 17180 19153 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776674.1 protein_id gnl|my_center|LOCUS_16460 19374 20030 gene locus_tag LOCUS_16470 19374 20030 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029271.1 protein_id gnl|my_center|LOCUS_16470 20317 20126 gene locus_tag LOCUS_16480 20317 20126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 21026 20322 gene locus_tag LOCUS_16490 21026 20322 CDS product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776677.1 protein_id gnl|my_center|LOCUS_16490 21889 21023 gene locus_tag LOCUS_16500 21889 21023 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485254.1 protein_id gnl|my_center|LOCUS_16500 21974 22237 gene locus_tag LOCUS_16510 21974 22237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 23183 22308 gene locus_tag LOCUS_16520 23183 22308 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 protein_id gnl|my_center|LOCUS_16520 24617 23703 gene locus_tag LOCUS_16530 24617 23703 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803866.1 protein_id gnl|my_center|LOCUS_16530 25226 24738 gene locus_tag LOCUS_16540 25226 24738 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112594.1 protein_id gnl|my_center|LOCUS_16540 25357 26502 gene locus_tag LOCUS_16550 25357 26502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 26677 30210 gene locus_tag LOCUS_16560 26677 30210 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730314.1 protein_id gnl|my_center|LOCUS_16560 30289 31074 gene locus_tag LOCUS_16570 30289 31074 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775994.1 protein_id gnl|my_center|LOCUS_16570 32158 31166 gene locus_tag LOCUS_16580 32158 31166 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776006.1 protein_id gnl|my_center|LOCUS_16580 32646 32155 gene locus_tag LOCUS_16590 32646 32155 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776007.1 protein_id gnl|my_center|LOCUS_16590 33518 32643 gene locus_tag LOCUS_16600 33518 32643 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227681.1 protein_id gnl|my_center|LOCUS_16600 34317 33511 gene locus_tag LOCUS_16610 34317 33511 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036275.1 protein_id gnl|my_center|LOCUS_16610 34983 34408 gene locus_tag LOCUS_16620 34983 34408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16620 35283 35945 gene locus_tag LOCUS_16630 35283 35945 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225121.1 protein_id gnl|my_center|LOCUS_16630 36995 35985 gene locus_tag LOCUS_16640 36995 35985 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462291.1 protein_id gnl|my_center|LOCUS_16640 37140 38825 gene locus_tag LOCUS_16650 37140 38825 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222839.1 protein_id gnl|my_center|LOCUS_16650 38845 39597 gene locus_tag LOCUS_16660 38845 39597 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776957.1 protein_id gnl|my_center|LOCUS_16660 39643 41187 gene locus_tag LOCUS_16670 gene glpK 39643 41187 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776956.1 protein_id gnl|my_center|LOCUS_16670 42334 41315 gene locus_tag LOCUS_16680 42334 41315 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222377.1 protein_id gnl|my_center|LOCUS_16680 42756 42334 gene locus_tag LOCUS_16690 42756 42334 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063604.1 protein_id gnl|my_center|LOCUS_16690 43208 42753 gene locus_tag LOCUS_16700 43208 42753 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477506.1 protein_id gnl|my_center|LOCUS_16700 43903 43280 gene locus_tag LOCUS_16710 43903 43280 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405948.1 protein_id gnl|my_center|LOCUS_16710 44068 44304 gene locus_tag LOCUS_16720 44068 44304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 45172 44312 gene locus_tag LOCUS_16730 45172 44312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 48515 45159 gene locus_tag LOCUS_16740 48515 45159 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_16740 49783 48512 gene locus_tag LOCUS_16750 49783 48512 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968693.1 protein_id gnl|my_center|LOCUS_16750 51306 49780 gene locus_tag LOCUS_16760 51306 49780 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968694.1 protein_id gnl|my_center|LOCUS_16760 52040 51327 gene locus_tag LOCUS_16770 52040 51327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900125.1 protein_id gnl|my_center|LOCUS_16770 52702 52043 gene locus_tag LOCUS_16780 gene mosR 52702 52043 CDS product hypoxia/intracellular survival transcriptional regulator MosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401756.1 protein_id gnl|my_center|LOCUS_16780 53507 52695 gene locus_tag LOCUS_16790 53507 52695 CDS product TIGR04255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404352.1 protein_id gnl|my_center|LOCUS_16790 54389 53574 gene locus_tag LOCUS_16800 54389 53574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 54497 54805 gene locus_tag LOCUS_16810 54497 54805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 54768 56585 gene locus_tag LOCUS_16820 54768 56585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 56482 56408 gene locus_tag LOCUS_t00320 56482 56408 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 56798 56722 gene locus_tag LOCUS_t00330 56798 56722 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 57619 57035 gene locus_tag LOCUS_16830 57619 57035 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225943.1 protein_id gnl|my_center|LOCUS_16830 57846 57616 gene locus_tag LOCUS_16840 57846 57616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16840 58044 57904 gene locus_tag LOCUS_16850 58044 57904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 58663 58241 gene locus_tag LOCUS_16860 58663 58241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 61443 58660 gene locus_tag LOCUS_16870 gene gyrA 61443 58660 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326690.1 protein_id gnl|my_center|LOCUS_16870 63794 61635 gene locus_tag LOCUS_16880 gene gyrB 63794 61635 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803673.1 protein_id gnl|my_center|LOCUS_16880 64262 63900 gene locus_tag LOCUS_16890 64262 63900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 65180 64371 gene locus_tag LOCUS_16900 65180 64371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 65334 66485 gene locus_tag LOCUS_16910 65334 66485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 66482 67039 gene locus_tag LOCUS_16920 66482 67039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 67540 67049 gene locus_tag LOCUS_16930 67540 67049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 68822 67614 gene locus_tag LOCUS_16940 gene recF 68822 67614 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221958.1 protein_id gnl|my_center|LOCUS_16940 70164 68974 gene locus_tag LOCUS_16950 70164 68974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 71448 70255 gene locus_tag LOCUS_16960 gene dnaN 71448 70255 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_16960 73844 72243 gene locus_tag LOCUS_16970 gene dnaA 73844 72243 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221955.1 protein_id gnl|my_center|LOCUS_16970 74291 74428 gene locus_tag LOCUS_16980 gene rpmH 74291 74428 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975051.1 protein_id gnl|my_center|LOCUS_16980 74439 74813 gene locus_tag LOCUS_16990 gene rnpA 74439 74813 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029288.1 protein_id gnl|my_center|LOCUS_16990 74810 75100 gene locus_tag LOCUS_17000 74810 75100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 75134 76171 gene locus_tag LOCUS_17010 gene yidC 75134 76171 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777156.1 protein_id gnl|my_center|LOCUS_17010 76270 76962 gene locus_tag LOCUS_17020 76270 76962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 77146 77901 gene locus_tag LOCUS_17030 gene rsmG 77146 77901 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029291.1 protein_id gnl|my_center|LOCUS_17030 78773 79702 gene locus_tag LOCUS_17040 78773 79702 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029292.1 protein_id gnl|my_center|LOCUS_17040 79699 80826 gene locus_tag LOCUS_17050 79699 80826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17050 81464 81138 gene locus_tag LOCUS_17060 gene trxA 81464 81138 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_17060 82625 81630 gene locus_tag LOCUS_17070 gene trxB 82625 81630 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_17070 83567 82764 gene locus_tag LOCUS_17080 83567 82764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 84243 83629 gene locus_tag LOCUS_17090 gene sigM 84243 83629 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284380.1 protein_id gnl|my_center|LOCUS_17090 86675 84255 gene locus_tag LOCUS_17100 86675 84255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 88924 87125 gene locus_tag LOCUS_17110 gene murJ 88924 87125 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029297.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17110 89504 88986 gene locus_tag LOCUS_17120 89504 88986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17120 89623 91074 gene locus_tag LOCUS_17130 89623 91074 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930081.1 protein_id gnl|my_center|LOCUS_17130 91594 92064 gene locus_tag LOCUS_17140 91594 92064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776161.1 protein_id gnl|my_center|LOCUS_17140 92064 92873 gene locus_tag LOCUS_17150 92064 92873 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776167.1 protein_id gnl|my_center|LOCUS_17150 92870 95029 gene locus_tag LOCUS_17160 92870 95029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 95049 96668 gene locus_tag LOCUS_17170 95049 96668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 96672 97391 gene locus_tag LOCUS_17180 96672 97391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776164.1 protein_id gnl|my_center|LOCUS_17180 97515 99131 gene locus_tag LOCUS_17190 97515 99131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17190 99031 99690 gene locus_tag LOCUS_17200 99031 99690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 99651 103871 gene locus_tag LOCUS_17210 99651 103871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17210 104038 110418 gene locus_tag LOCUS_17220 104038 110418 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193495474.1 protein_id gnl|my_center|LOCUS_17220 110480 111448 gene locus_tag LOCUS_17230 110480 111448 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929980.1 protein_id gnl|my_center|LOCUS_17230 111451 113025 gene locus_tag LOCUS_17240 111451 113025 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776170.1 protein_id gnl|my_center|LOCUS_17240 113022 115724 gene locus_tag LOCUS_17250 113022 115724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 115784 117088 gene locus_tag LOCUS_17260 115784 117088 CDS product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742198.1 protein_id gnl|my_center|LOCUS_17260 117123 117620 gene locus_tag LOCUS_17270 117123 117620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 118777 117785 gene locus_tag LOCUS_17280 118777 117785 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114555269.1 protein_id gnl|my_center|LOCUS_17280 118758 119312 gene locus_tag LOCUS_17290 118758 119312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 120498 119455 gene locus_tag LOCUS_17300 120498 119455 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 protein_id gnl|my_center|LOCUS_17300 120599 121075 gene locus_tag LOCUS_17310 120599 121075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 122254 121160 gene locus_tag LOCUS_17320 122254 121160 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975032.1 protein_id gnl|my_center|LOCUS_17320 122925 122332 gene locus_tag LOCUS_17330 122925 122332 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975031.1 protein_id gnl|my_center|LOCUS_17330 123226 125607 gene locus_tag LOCUS_17340 123226 125607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17340 125611 126933 gene locus_tag LOCUS_17350 125611 126933 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029301.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17350 127074 127361 gene locus_tag LOCUS_17360 gene rpsF 127074 127361 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898321.1 protein_id gnl|my_center|LOCUS_17360 127434 128054 gene locus_tag LOCUS_17370 127434 128054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 128175 128411 gene locus_tag LOCUS_17380 gene rpsR 128175 128411 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777137.1 protein_id gnl|my_center|LOCUS_17380 128438 128884 gene locus_tag LOCUS_17390 gene rplI 128438 128884 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777136.1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence11 218 1144 gene locus_tag LOCUS_17400 218 1144 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045756603.1 protein_id gnl|my_center|LOCUS_17400 1161 2996 gene locus_tag LOCUS_17410 1161 2996 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 protein_id gnl|my_center|LOCUS_17410 3219 3860 gene locus_tag LOCUS_17420 3219 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 4223 3864 gene locus_tag LOCUS_17430 gene arsC 4223 3864 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112580.1 protein_id gnl|my_center|LOCUS_17430 4757 4260 gene locus_tag LOCUS_17440 gene tamR 4757 4260 CDS product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 protein_id gnl|my_center|LOCUS_17440 4922 5734 gene locus_tag LOCUS_17450 4922 5734 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028784.1 protein_id gnl|my_center|LOCUS_17450 5731 6090 gene locus_tag LOCUS_17460 5731 6090 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975682.1 protein_id gnl|my_center|LOCUS_17460 6268 6347 gene locus_tag LOCUS_t00340 6268 6347 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7253 6465 gene locus_tag LOCUS_17470 7253 6465 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027387.1 protein_id gnl|my_center|LOCUS_17470 7423 8889 gene locus_tag LOCUS_17480 gene glmU 7423 8889 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929929.1 protein_id gnl|my_center|LOCUS_17480 8886 9872 gene locus_tag LOCUS_17490 8886 9872 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229964.1 protein_id gnl|my_center|LOCUS_17490 10467 9901 gene locus_tag LOCUS_17500 10467 9901 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892919.1 protein_id gnl|my_center|LOCUS_17500 10560 11582 gene locus_tag LOCUS_17510 10560 11582 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892918.1 protein_id gnl|my_center|LOCUS_17510 12793 11696 gene locus_tag LOCUS_17520 12793 11696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 13219 13908 gene locus_tag LOCUS_17530 13219 13908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 14029 14631 gene locus_tag LOCUS_17540 gene pth 14029 14631 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229969.1 protein_id gnl|my_center|LOCUS_17540 15006 16523 gene locus_tag LOCUS_17550 15006 16523 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803920.1 protein_id gnl|my_center|LOCUS_17550 19085 16539 gene locus_tag LOCUS_17560 19085 16539 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550889.1 protein_id gnl|my_center|LOCUS_17560 20145 19162 gene locus_tag LOCUS_17570 20145 19162 CDS product DUF1839 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196302.1 protein_id gnl|my_center|LOCUS_17570 21053 20157 gene locus_tag LOCUS_17580 21053 20157 CDS product amino acid--[acyl-carrier-protein] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080728814.1 protein_id gnl|my_center|LOCUS_17580 22207 21050 gene locus_tag LOCUS_17590 22207 21050 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972410.1 protein_id gnl|my_center|LOCUS_17590 22449 22207 gene locus_tag LOCUS_17600 22449 22207 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003504852.1 protein_id gnl|my_center|LOCUS_17600 22862 22446 gene locus_tag LOCUS_17610 22862 22446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 23010 26552 gene locus_tag LOCUS_17620 gene mfd 23010 26552 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 protein_id gnl|my_center|LOCUS_17620 26620 27750 gene locus_tag LOCUS_17630 26620 27750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 27747 28697 gene locus_tag LOCUS_17640 27747 28697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 29245 28694 gene locus_tag LOCUS_17650 29245 28694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 29432 31156 gene locus_tag LOCUS_17660 29432 31156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 31232 31981 gene locus_tag LOCUS_17670 31232 31981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 31988 33052 gene locus_tag LOCUS_17680 31988 33052 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468451.1 protein_id gnl|my_center|LOCUS_17680 34686 33103 gene locus_tag LOCUS_17690 34686 33103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 35897 34683 gene locus_tag LOCUS_17700 35897 34683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 37193 35979 gene locus_tag LOCUS_17710 37193 35979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 37355 37849 gene locus_tag LOCUS_17720 37355 37849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 37855 38589 gene locus_tag LOCUS_17730 37855 38589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 38616 39776 gene locus_tag LOCUS_17740 38616 39776 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480088.1 protein_id gnl|my_center|LOCUS_17740 39791 40720 gene locus_tag LOCUS_17750 39791 40720 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888939.1 protein_id gnl|my_center|LOCUS_17750 40857 42230 gene locus_tag LOCUS_17760 gene eno 40857 42230 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975715.1 protein_id gnl|my_center|LOCUS_17760 42239 42904 gene locus_tag LOCUS_17770 42239 42904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 42981 43481 gene locus_tag LOCUS_17780 42981 43481 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028762.1 protein_id gnl|my_center|LOCUS_17780 43478 44428 gene locus_tag LOCUS_17790 43478 44428 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804959.1 protein_id gnl|my_center|LOCUS_17790 45090 44431 gene locus_tag LOCUS_17800 45090 44431 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229440.1 protein_id gnl|my_center|LOCUS_17800 45327 45659 gene locus_tag LOCUS_17810 45327 45659 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223697.1 protein_id gnl|my_center|LOCUS_17810 45656 46750 gene locus_tag LOCUS_17820 45656 46750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 46813 46888 gene locus_tag LOCUS_t00350 46813 46888 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 47050 47889 gene locus_tag LOCUS_17830 47050 47889 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896676.1 protein_id gnl|my_center|LOCUS_17830 47907 48203 gene locus_tag LOCUS_17840 47907 48203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 49142 48114 gene locus_tag LOCUS_17850 49142 48114 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975733.1 protein_id gnl|my_center|LOCUS_17850 49105 49293 gene locus_tag LOCUS_17860 49105 49293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 49342 50718 gene locus_tag LOCUS_17870 49342 50718 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084259.1 protein_id gnl|my_center|LOCUS_17870 51034 52416 gene locus_tag LOCUS_17880 51034 52416 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225068.1 protein_id gnl|my_center|LOCUS_17880 52437 53000 gene locus_tag LOCUS_17890 52437 53000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 54054 53452 gene locus_tag LOCUS_17900 54054 53452 CDS product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053546291.1 protein_id gnl|my_center|LOCUS_17900 54410 54051 gene locus_tag LOCUS_17910 54410 54051 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776291.1 protein_id gnl|my_center|LOCUS_17910 55059 54643 gene locus_tag LOCUS_17920 55059 54643 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112739.1 protein_id gnl|my_center|LOCUS_17920 55478 55056 gene locus_tag LOCUS_17930 55478 55056 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_17930 56127 55504 gene locus_tag LOCUS_17940 56127 55504 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014416.1 protein_id gnl|my_center|LOCUS_17940 57233 56124 gene locus_tag LOCUS_17950 gene arsB 57233 56124 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727470.1 protein_id gnl|my_center|LOCUS_17950 57712 57230 gene locus_tag LOCUS_17960 57712 57230 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222676.1 protein_id gnl|my_center|LOCUS_17960 57782 58144 gene locus_tag LOCUS_17970 57782 58144 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777081.1 protein_id gnl|my_center|LOCUS_17970 60435 58192 gene locus_tag LOCUS_17980 60435 58192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 61793 60645 gene locus_tag LOCUS_17990 61793 60645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 62765 61959 gene locus_tag LOCUS_18000 62765 61959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 63204 65285 gene locus_tag LOCUS_18010 63204 65285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 65395 65793 gene locus_tag LOCUS_18020 65395 65793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 66502 65810 gene locus_tag LOCUS_18030 gene msrA 66502 65810 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918878.1 protein_id gnl|my_center|LOCUS_18030 66565 67593 gene locus_tag LOCUS_18040 66565 67593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 67662 68840 gene locus_tag LOCUS_18050 67662 68840 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_18050 68844 69209 gene locus_tag LOCUS_18060 68844 69209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 69834 69340 gene locus_tag LOCUS_18070 gene greA 69834 69340 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776308.1 protein_id gnl|my_center|LOCUS_18070 70363 70004 gene locus_tag LOCUS_18080 70363 70004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 70532 71467 gene locus_tag LOCUS_18090 gene mca 70532 71467 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444314.1 protein_id gnl|my_center|LOCUS_18090 71464 71793 gene locus_tag LOCUS_18100 71464 71793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 72570 71878 gene locus_tag LOCUS_18110 72570 71878 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_18110 72664 73425 gene locus_tag LOCUS_18120 72664 73425 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_18120 73758 75113 gene locus_tag LOCUS_18130 73758 75113 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973949.1 protein_id gnl|my_center|LOCUS_18130 75280 76068 gene locus_tag LOCUS_18140 75280 76068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 77133 76162 gene locus_tag LOCUS_18150 gene coaA 77133 76162 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776319.1 protein_id gnl|my_center|LOCUS_18150 77220 79067 gene locus_tag LOCUS_18160 gene glmS 77220 79067 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776318.1 protein_id gnl|my_center|LOCUS_18160 79064 79414 gene locus_tag LOCUS_18170 79064 79414 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 protein_id gnl|my_center|LOCUS_18170 79460 80185 gene locus_tag LOCUS_18180 79460 80185 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225220.1 protein_id gnl|my_center|LOCUS_18180 80495 81013 gene locus_tag LOCUS_18190 80495 81013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 81061 82524 gene locus_tag LOCUS_18200 81061 82524 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029833.1 protein_id gnl|my_center|LOCUS_18200 82537 83760 gene locus_tag LOCUS_18210 gene alr 82537 83760 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 protein_id gnl|my_center|LOCUS_18210 83760 85262 gene locus_tag LOCUS_18220 83760 85262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 85259 85750 gene locus_tag LOCUS_18230 85259 85750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 85744 86406 gene locus_tag LOCUS_18240 gene tsaB 85744 86406 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_18240 86403 86861 gene locus_tag LOCUS_18250 gene rimI 86403 86861 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029840.1 protein_id gnl|my_center|LOCUS_18250 86858 87946 gene locus_tag LOCUS_18260 gene tsaD 86858 87946 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 protein_id gnl|my_center|LOCUS_18260 88757 87966 gene locus_tag LOCUS_18270 88757 87966 CDS product DUF3626 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226733.1 protein_id gnl|my_center|LOCUS_18270 89196 88768 gene locus_tag LOCUS_18280 89196 88768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 90293 89286 gene locus_tag LOCUS_18290 90293 89286 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389746.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18290 90322 90627 gene locus_tag LOCUS_18300 90322 90627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 90673 91650 gene locus_tag LOCUS_18310 90673 91650 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975162.1 protein_id gnl|my_center|LOCUS_18310 91650 92483 gene locus_tag LOCUS_18320 gene rbsK 91650 92483 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526901.1 protein_id gnl|my_center|LOCUS_18320 92592 93119 gene locus_tag LOCUS_18330 92592 93119 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777051.1 protein_id gnl|my_center|LOCUS_18330 94424 93195 gene locus_tag LOCUS_18340 94424 93195 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804479.1 protein_id gnl|my_center|LOCUS_18340 94531 94758 gene locus_tag LOCUS_18350 94531 94758 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009934223.1 protein_id gnl|my_center|LOCUS_18350 94823 95278 gene locus_tag LOCUS_18360 94823 95278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 95340 96185 gene locus_tag LOCUS_18370 95340 96185 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261950.1 protein_id gnl|my_center|LOCUS_18370 96200 96688 gene locus_tag LOCUS_18380 96200 96688 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728514.1 protein_id gnl|my_center|LOCUS_18380 96878 97171 gene locus_tag LOCUS_18390 gene groES 96878 97171 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559922.1 protein_id gnl|my_center|LOCUS_18390 97316 98935 gene locus_tag LOCUS_18400 gene groL 97316 98935 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 protein_id gnl|my_center|LOCUS_18400 99375 99605 gene locus_tag LOCUS_18410 99375 99605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 99602 100381 gene locus_tag LOCUS_18420 99602 100381 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229941.1 protein_id gnl|my_center|LOCUS_18420 100378 101586 gene locus_tag LOCUS_18430 100378 101586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 101583 102143 gene locus_tag LOCUS_18440 101583 102143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 102406 102179 gene locus_tag LOCUS_18450 102406 102179 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728864.1 protein_id gnl|my_center|LOCUS_18450 103620 102442 gene locus_tag LOCUS_18460 103620 102442 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510567.1 protein_id gnl|my_center|LOCUS_18460 103753 105276 gene locus_tag LOCUS_18470 103753 105276 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776830.1 protein_id gnl|my_center|LOCUS_18470 105344 106387 gene locus_tag LOCUS_18480 gene adhP 105344 106387 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015397.1 protein_id gnl|my_center|LOCUS_18480 106389 106790 gene locus_tag LOCUS_18490 106389 106790 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776831.1 protein_id gnl|my_center|LOCUS_18490 107234 106938 gene locus_tag LOCUS_18500 107234 106938 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222678.1 protein_id gnl|my_center|LOCUS_18500 107498 109015 gene locus_tag LOCUS_18510 gene guaB 107498 109015 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804497.1 protein_id gnl|my_center|LOCUS_18510 110818 109175 gene locus_tag LOCUS_18520 110818 109175 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403977.1 protein_id gnl|my_center|LOCUS_18520 110983 112110 gene locus_tag LOCUS_18530 110983 112110 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804502.1 protein_id gnl|my_center|LOCUS_18530 113080 112205 gene locus_tag LOCUS_18540 113080 112205 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727781.1 protein_id gnl|my_center|LOCUS_18540 113226 114650 gene locus_tag LOCUS_18550 113226 114650 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096830.1 protein_id gnl|my_center|LOCUS_18550 114736 116343 gene locus_tag LOCUS_18560 114736 116343 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029859.1 protein_id gnl|my_center|LOCUS_18560 116340 118139 gene locus_tag LOCUS_18570 116340 118139 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222688.1 protein_id gnl|my_center|LOCUS_18570 118232 119761 gene locus_tag LOCUS_18580 118232 119761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 119858 120619 gene locus_tag LOCUS_18590 119858 120619 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943910.1 protein_id gnl|my_center|LOCUS_18590 120616 120960 gene locus_tag LOCUS_18600 120616 120960 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857996.1 protein_id gnl|my_center|LOCUS_18600 120957 122546 gene locus_tag LOCUS_18610 gene guaA 120957 122546 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974187.1 protein_id gnl|my_center|LOCUS_18610 124192 122900 gene locus_tag LOCUS_18620 124192 122900 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110870.1 protein_id gnl|my_center|LOCUS_18620 >Feature sequence12 653 57 gene locus_tag LOCUS_18630 653 57 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 protein_id gnl|my_center|LOCUS_18630 1017 676 gene locus_tag LOCUS_18640 1017 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 1278 2399 gene locus_tag LOCUS_18650 1278 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 2543 2893 gene locus_tag LOCUS_18660 2543 2893 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730014.1 protein_id gnl|my_center|LOCUS_18660 3701 2859 gene locus_tag LOCUS_18670 3701 2859 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085604.1 protein_id gnl|my_center|LOCUS_18670 4280 3783 gene locus_tag LOCUS_18680 4280 3783 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226865.1 protein_id gnl|my_center|LOCUS_18680 5017 4280 gene locus_tag LOCUS_18690 5017 4280 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727829.1 protein_id gnl|my_center|LOCUS_18690 5503 5117 gene locus_tag LOCUS_18700 5503 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 6053 5520 gene locus_tag LOCUS_18710 6053 5520 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091620766.1 protein_id gnl|my_center|LOCUS_18710 7434 6256 gene locus_tag LOCUS_18720 7434 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 8851 7577 gene locus_tag LOCUS_18730 8851 7577 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416640.1 protein_id gnl|my_center|LOCUS_18730 10089 9004 gene locus_tag LOCUS_18740 gene ychF 10089 9004 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730394.1 protein_id gnl|my_center|LOCUS_18740 10172 10867 gene locus_tag LOCUS_18750 10172 10867 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_18750 10864 11979 gene locus_tag LOCUS_18760 10864 11979 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256020.1 protein_id gnl|my_center|LOCUS_18760 12758 11976 gene locus_tag LOCUS_18770 12758 11976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 12935 14158 gene locus_tag LOCUS_18780 12935 14158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 15229 14195 gene locus_tag LOCUS_18790 15229 14195 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973920.1 protein_id gnl|my_center|LOCUS_18790 15334 16596 gene locus_tag LOCUS_18800 gene xseA 15334 16596 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776296.1 protein_id gnl|my_center|LOCUS_18800 16607 16870 gene locus_tag LOCUS_18810 16607 16870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 17459 16878 gene locus_tag LOCUS_18820 17459 16878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 17615 18643 gene locus_tag LOCUS_18830 gene glpX 17615 18643 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973930.1 protein_id gnl|my_center|LOCUS_18830 18640 19557 gene locus_tag LOCUS_18840 18640 19557 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776299.1 protein_id gnl|my_center|LOCUS_18840 19571 21277 gene locus_tag LOCUS_18850 19571 21277 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_18850 21308 21829 gene locus_tag LOCUS_18860 21308 21829 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002922537.1 protein_id gnl|my_center|LOCUS_18860 21852 23207 gene locus_tag LOCUS_18870 21852 23207 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031744.1 protein_id gnl|my_center|LOCUS_18870 24644 23295 gene locus_tag LOCUS_18880 gene glmM 24644 23295 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974237.1 protein_id gnl|my_center|LOCUS_18880 24844 25278 gene locus_tag LOCUS_18890 24844 25278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 25857 25354 gene locus_tag LOCUS_18900 gene rpsI 25857 25354 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974238.1 protein_id gnl|my_center|LOCUS_18900 26336 25893 gene locus_tag LOCUS_18910 gene rplM 26336 25893 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776324.1 protein_id gnl|my_center|LOCUS_18910 26586 27215 gene locus_tag LOCUS_18920 26586 27215 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230395.1 protein_id gnl|my_center|LOCUS_18920 27212 28495 gene locus_tag LOCUS_18930 27212 28495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 28492 29007 gene locus_tag LOCUS_18940 28492 29007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 32204 29136 gene locus_tag LOCUS_18950 32204 29136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 32955 32302 gene locus_tag LOCUS_18960 32955 32302 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731541.1 protein_id gnl|my_center|LOCUS_18960 33725 32979 gene locus_tag LOCUS_18970 33725 32979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18970 34676 33735 gene locus_tag LOCUS_18980 34676 33735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18980 35499 34732 gene locus_tag LOCUS_18990 35499 34732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 36087 36623 gene locus_tag LOCUS_19000 gene soxR 36087 36623 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224136.1 protein_id gnl|my_center|LOCUS_19000 37489 36629 gene locus_tag LOCUS_19010 gene truA 37489 36629 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776325.1 protein_id gnl|my_center|LOCUS_19010 37528 37905 gene locus_tag LOCUS_19020 37528 37905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 38094 37918 gene locus_tag LOCUS_19030 38094 37918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 38996 38109 gene locus_tag LOCUS_19040 38996 38109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19040 39054 39671 gene locus_tag LOCUS_19050 39054 39671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 40498 39668 gene locus_tag LOCUS_19060 40498 39668 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877268.1 protein_id gnl|my_center|LOCUS_19060 41018 40491 gene locus_tag LOCUS_19070 41018 40491 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226727.1 protein_id gnl|my_center|LOCUS_19070 41920 41111 gene locus_tag LOCUS_19080 41920 41111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 43027 41978 gene locus_tag LOCUS_19090 43027 41978 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966937.1 protein_id gnl|my_center|LOCUS_19090 43790 43182 gene locus_tag LOCUS_19100 gene rpsD 43790 43182 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418354.1 protein_id gnl|my_center|LOCUS_19100 44221 43817 gene locus_tag LOCUS_19110 gene rpsK 44221 43817 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_19110 44664 44287 gene locus_tag LOCUS_19120 gene rpsM 44664 44287 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974244.1 protein_id gnl|my_center|LOCUS_19120 45331 45110 gene locus_tag LOCUS_19130 gene infA 45331 45110 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558881.1 protein_id gnl|my_center|LOCUS_19130 45779 45534 gene locus_tag LOCUS_19140 45779 45534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 45951 46427 gene locus_tag LOCUS_19150 45951 46427 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088503.1 protein_id gnl|my_center|LOCUS_19150 47288 46440 gene locus_tag LOCUS_19160 gene map 47288 46440 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222621.1 protein_id gnl|my_center|LOCUS_19160 47851 47288 gene locus_tag LOCUS_19170 47851 47288 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776356.1 protein_id gnl|my_center|LOCUS_19170 49167 47851 gene locus_tag LOCUS_19180 gene secY 49167 47851 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_19180 49834 49352 gene locus_tag LOCUS_19190 gene rplO 49834 49352 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974249.1 protein_id gnl|my_center|LOCUS_19190 50022 49837 gene locus_tag LOCUS_19200 gene rpmD 50022 49837 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776359.1 protein_id gnl|my_center|LOCUS_19200 50681 50019 gene locus_tag LOCUS_19210 gene rpsE 50681 50019 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974251.1 protein_id gnl|my_center|LOCUS_19210 51081 50713 gene locus_tag LOCUS_19220 gene rplR 51081 50713 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776361.1 protein_id gnl|my_center|LOCUS_19220 51627 51091 gene locus_tag LOCUS_19230 gene rplF 51627 51091 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222612.1 protein_id gnl|my_center|LOCUS_19230 52041 51643 gene locus_tag LOCUS_19240 gene rpsH 52041 51643 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974254.1 protein_id gnl|my_center|LOCUS_19240 52322 52137 gene locus_tag LOCUS_19250 52322 52137 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010550318.1 protein_id gnl|my_center|LOCUS_19250 52894 52325 gene locus_tag LOCUS_19260 gene rplE 52894 52325 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892854.1 protein_id gnl|my_center|LOCUS_19260 53235 52894 gene locus_tag LOCUS_19270 gene rplX 53235 52894 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776365.1 protein_id gnl|my_center|LOCUS_19270 53607 53239 gene locus_tag LOCUS_19280 gene rplN 53607 53239 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974257.1 protein_id gnl|my_center|LOCUS_19280 54050 53757 gene locus_tag LOCUS_19290 gene rpsQ 54050 53757 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_19290 54289 54056 gene locus_tag LOCUS_19300 gene rpmC 54289 54056 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974259.1 protein_id gnl|my_center|LOCUS_19300 54708 54289 gene locus_tag LOCUS_19310 gene rplP 54708 54289 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776370.1 protein_id gnl|my_center|LOCUS_19310 55532 54708 gene locus_tag LOCUS_19320 gene rpsC 55532 54708 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776371.1 protein_id gnl|my_center|LOCUS_19320 55933 55532 gene locus_tag LOCUS_19330 gene rplV 55933 55532 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814510.1 protein_id gnl|my_center|LOCUS_19330 56214 55933 gene locus_tag LOCUS_19340 gene rpsS 56214 55933 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776373.1 protein_id gnl|my_center|LOCUS_19340 57067 56231 gene locus_tag LOCUS_19350 gene rplB 57067 56231 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776374.1 protein_id gnl|my_center|LOCUS_19350 57398 57096 gene locus_tag LOCUS_19360 gene rplW 57398 57096 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776375.1 protein_id gnl|my_center|LOCUS_19360 58012 57395 gene locus_tag LOCUS_19370 gene rplD 58012 57395 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222605.1 protein_id gnl|my_center|LOCUS_19370 58668 58018 gene locus_tag LOCUS_19380 gene rplC 58668 58018 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974267.1 protein_id gnl|my_center|LOCUS_19380 58988 58680 gene locus_tag LOCUS_19390 gene rpsJ 58988 58680 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776378.1 protein_id gnl|my_center|LOCUS_19390 58944 59252 gene locus_tag LOCUS_19400 58944 59252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 61057 59549 gene locus_tag LOCUS_19410 61057 59549 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188420.1 protein_id gnl|my_center|LOCUS_19410 61250 62302 gene locus_tag LOCUS_19420 61250 62302 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259465.1 protein_id gnl|my_center|LOCUS_19420 62299 62661 gene locus_tag LOCUS_19430 62299 62661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 63926 62733 gene locus_tag LOCUS_19440 gene tuf 63926 62733 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029795.1 protein_id gnl|my_center|LOCUS_19440 66151 64037 gene locus_tag LOCUS_19450 gene fusA 66151 64037 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055595.1 protein_id gnl|my_center|LOCUS_19450 66756 66286 gene locus_tag LOCUS_19460 gene rpsG 66756 66286 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776385.1 protein_id gnl|my_center|LOCUS_19460 67130 66756 gene locus_tag LOCUS_19470 gene rpsL 67130 66756 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102113.1 protein_id gnl|my_center|LOCUS_19470 68237 67500 gene locus_tag LOCUS_19480 68237 67500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 68619 68242 gene locus_tag LOCUS_19490 68619 68242 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222358.1 protein_id gnl|my_center|LOCUS_19490 72604 68720 gene locus_tag LOCUS_19500 72604 68720 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_19500 76200 72715 gene locus_tag LOCUS_19510 gene rpoB 76200 72715 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029792.1 protein_id gnl|my_center|LOCUS_19510 77143 76754 gene locus_tag LOCUS_19520 gene rplL 77143 76754 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403353.1 protein_id gnl|my_center|LOCUS_19520 77870 77232 gene locus_tag LOCUS_19530 gene rplJ 77870 77232 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974311.1 protein_id gnl|my_center|LOCUS_19530 78957 78232 gene locus_tag LOCUS_19540 gene rplA 78957 78232 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974314.1 protein_id gnl|my_center|LOCUS_19540 79528 79097 gene locus_tag LOCUS_19550 gene rplK 79528 79097 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892734.1 protein_id gnl|my_center|LOCUS_19550 80508 79627 gene locus_tag LOCUS_19560 80508 79627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 80839 80576 gene locus_tag LOCUS_19570 80839 80576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 80982 80909 gene locus_tag LOCUS_t00360 80982 80909 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 81133 82845 gene locus_tag LOCUS_19580 gene malS 81133 82845 CDS product oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062822354.1 protein_id gnl|my_center|LOCUS_19580 84167 83079 gene locus_tag LOCUS_19590 84167 83079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 84268 85563 gene locus_tag LOCUS_19600 84268 85563 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_19600 85598 86110 gene locus_tag LOCUS_19610 85598 86110 CDS product DUF5709 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027611.1 protein_id gnl|my_center|LOCUS_19610 86202 87233 gene locus_tag LOCUS_19620 86202 87233 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776398.1 protein_id gnl|my_center|LOCUS_19620 88051 87230 gene locus_tag LOCUS_19630 88051 87230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19630 88437 87955 gene locus_tag LOCUS_19640 88437 87955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19640 89545 88472 gene locus_tag LOCUS_19650 89545 88472 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270166.1 protein_id gnl|my_center|LOCUS_19650 89970 89545 gene locus_tag LOCUS_19660 89970 89545 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_19660 90419 89973 gene locus_tag LOCUS_19670 90419 89973 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776156.1 protein_id gnl|my_center|LOCUS_19670 90724 90554 gene locus_tag LOCUS_19680 gene rpmG 90724 90554 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776157.1 protein_id gnl|my_center|LOCUS_19680 90932 90858 gene locus_tag LOCUS_t00370 90932 90858 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 91051 90978 gene locus_tag LOCUS_t00380 91051 90978 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 91563 91129 gene locus_tag LOCUS_19690 gene aroQ 91563 91129 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976858.1 protein_id gnl|my_center|LOCUS_19690 91913 91584 gene locus_tag LOCUS_19700 91913 91584 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222286.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19700 93218 92238 gene locus_tag LOCUS_19710 93218 92238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 94077 93223 gene locus_tag LOCUS_19720 94077 93223 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 protein_id gnl|my_center|LOCUS_19720 96605 94074 gene locus_tag LOCUS_19730 96605 94074 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223764.1 protein_id gnl|my_center|LOCUS_19730 97090 96602 gene locus_tag LOCUS_19740 97090 96602 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223763.1 protein_id gnl|my_center|LOCUS_19740 98368 97244 gene locus_tag LOCUS_19750 98368 97244 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727161.1 protein_id gnl|my_center|LOCUS_19750 99449 98361 gene locus_tag LOCUS_19760 99449 98361 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223761.1 protein_id gnl|my_center|LOCUS_19760 100344 99454 gene locus_tag LOCUS_19770 100344 99454 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223759.1 protein_id gnl|my_center|LOCUS_19770 101115 100504 gene locus_tag LOCUS_19780 101115 100504 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223758.1 protein_id gnl|my_center|LOCUS_19780 102725 101142 gene locus_tag LOCUS_19790 102725 101142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 105546 102865 gene locus_tag LOCUS_19800 105546 102865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 106283 105543 gene locus_tag LOCUS_19810 106283 105543 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775964.1 protein_id gnl|my_center|LOCUS_19810 107603 106413 gene locus_tag LOCUS_19820 107603 106413 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977076.1 protein_id gnl|my_center|LOCUS_19820 108748 107600 gene locus_tag LOCUS_19830 108748 107600 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113287.1 protein_id gnl|my_center|LOCUS_19830 110265 108745 gene locus_tag LOCUS_19840 110265 108745 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227765.1 protein_id gnl|my_center|LOCUS_19840 111590 110262 gene locus_tag LOCUS_19850 gene gabT 111590 110262 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892002.1 protein_id gnl|my_center|LOCUS_19850 111816 113405 gene locus_tag LOCUS_19860 111816 113405 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731463.1 protein_id gnl|my_center|LOCUS_19860 >Feature sequence13 939 52 gene locus_tag LOCUS_19870 939 52 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854943.1 protein_id gnl|my_center|LOCUS_19870 974 1714 gene locus_tag LOCUS_19880 974 1714 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729389.1 protein_id gnl|my_center|LOCUS_19880 1975 3030 gene locus_tag LOCUS_19890 1975 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 3045 3500 gene locus_tag LOCUS_19900 3045 3500 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870300.1 protein_id gnl|my_center|LOCUS_19900 3624 4286 gene locus_tag LOCUS_19910 3624 4286 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058094.1 protein_id gnl|my_center|LOCUS_19910 5679 4348 gene locus_tag LOCUS_19920 5679 4348 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147002.1 protein_id gnl|my_center|LOCUS_19920 5783 6718 gene locus_tag LOCUS_19930 5783 6718 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148616319.1 protein_id gnl|my_center|LOCUS_19930 7061 6732 gene locus_tag LOCUS_19940 7061 6732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 7045 7344 gene locus_tag LOCUS_19950 7045 7344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 8992 7571 gene locus_tag LOCUS_19960 gene fumC 8992 7571 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889251.1 protein_id gnl|my_center|LOCUS_19960 9077 10402 gene locus_tag LOCUS_19970 9077 10402 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869305.1 protein_id gnl|my_center|LOCUS_19970 10672 10409 gene locus_tag LOCUS_19980 10672 10409 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013354.1 protein_id gnl|my_center|LOCUS_19980 10842 12968 gene locus_tag LOCUS_19990 gene malQ 10842 12968 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729252.1 protein_id gnl|my_center|LOCUS_19990 14441 13086 gene locus_tag LOCUS_20000 14441 13086 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726950.1 protein_id gnl|my_center|LOCUS_20000 16054 14438 gene locus_tag LOCUS_20010 16054 14438 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726949.1 protein_id gnl|my_center|LOCUS_20010 16868 16047 gene locus_tag LOCUS_20020 16868 16047 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090116.1 protein_id gnl|my_center|LOCUS_20020 17008 17937 gene locus_tag LOCUS_20030 17008 17937 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 protein_id gnl|my_center|LOCUS_20030 19143 17944 gene locus_tag LOCUS_20040 19143 17944 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230613.1 protein_id gnl|my_center|LOCUS_20040 20219 19140 gene locus_tag LOCUS_20050 20219 19140 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230614.1 protein_id gnl|my_center|LOCUS_20050 21266 20226 gene locus_tag LOCUS_20060 21266 20226 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230615.1 protein_id gnl|my_center|LOCUS_20060 22283 21270 gene locus_tag LOCUS_20070 22283 21270 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230616.1 protein_id gnl|my_center|LOCUS_20070 24102 22426 gene locus_tag LOCUS_20080 24102 22426 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230617.1 protein_id gnl|my_center|LOCUS_20080 24282 24734 gene locus_tag LOCUS_20090 24282 24734 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973876.1 protein_id gnl|my_center|LOCUS_20090 24800 26704 gene locus_tag LOCUS_20100 gene typA 24800 26704 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_20100 26858 27742 gene locus_tag LOCUS_20110 gene mshB 26858 27742 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229758.1 protein_id gnl|my_center|LOCUS_20110 27846 29621 gene locus_tag LOCUS_20120 27846 29621 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015435.1 protein_id gnl|my_center|LOCUS_20120 30403 29672 gene locus_tag LOCUS_20130 30403 29672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 30502 30828 gene locus_tag LOCUS_20140 30502 30828 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973842.1 protein_id gnl|my_center|LOCUS_20140 30825 31982 gene locus_tag LOCUS_20150 gene dapC 30825 31982 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222936.1 protein_id gnl|my_center|LOCUS_20150 32159 33451 gene locus_tag LOCUS_20160 32159 33451 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230153.1 protein_id gnl|my_center|LOCUS_20160 33605 34012 gene locus_tag LOCUS_20170 33605 34012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 34920 34015 gene locus_tag LOCUS_20180 34920 34015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804736.1 protein_id gnl|my_center|LOCUS_20180 35968 35036 gene locus_tag LOCUS_20190 gene dapD 35968 35036 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898768.1 protein_id gnl|my_center|LOCUS_20190 36031 37125 gene locus_tag LOCUS_20200 gene dapE 36031 37125 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_20200 37138 38004 gene locus_tag LOCUS_20210 37138 38004 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973837.1 protein_id gnl|my_center|LOCUS_20210 38076 38489 gene locus_tag LOCUS_20220 38076 38489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 38486 38983 gene locus_tag LOCUS_20230 38486 38983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 38980 40254 gene locus_tag LOCUS_20240 38980 40254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 40251 41555 gene locus_tag LOCUS_20250 40251 41555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 41804 41974 gene locus_tag LOCUS_20260 41804 41974 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966491.1 protein_id gnl|my_center|LOCUS_20260 42220 43785 gene locus_tag LOCUS_20270 42220 43785 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775677.1 protein_id gnl|my_center|LOCUS_20270 43785 44153 gene locus_tag LOCUS_20280 43785 44153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 44825 44193 gene locus_tag LOCUS_20290 44825 44193 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804743.1 protein_id gnl|my_center|LOCUS_20290 45029 45661 gene locus_tag LOCUS_20300 gene sigE 45029 45661 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973830.1 protein_id gnl|my_center|LOCUS_20300 45661 46284 gene locus_tag LOCUS_20310 45661 46284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 46281 47759 gene locus_tag LOCUS_20320 46281 47759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20320 47806 48192 gene locus_tag LOCUS_20330 47806 48192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 49434 48295 gene locus_tag LOCUS_20340 49434 48295 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_20340 50031 49483 gene locus_tag LOCUS_20350 50031 49483 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804746.1 protein_id gnl|my_center|LOCUS_20350 51301 50024 gene locus_tag LOCUS_20360 51301 50024 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_20360 51402 52106 gene locus_tag LOCUS_20370 51402 52106 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031779.1 protein_id gnl|my_center|LOCUS_20370 52241 53332 gene locus_tag LOCUS_20380 52241 53332 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222030.1 protein_id gnl|my_center|LOCUS_20380 53329 54231 gene locus_tag LOCUS_20390 53329 54231 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222029.1 protein_id gnl|my_center|LOCUS_20390 54460 55155 gene locus_tag LOCUS_20400 54460 55155 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776667.1 protein_id gnl|my_center|LOCUS_20400 56621 55776 gene locus_tag LOCUS_20410 56621 55776 CDS product RIO kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223947.1 protein_id gnl|my_center|LOCUS_20410 56852 57727 gene locus_tag LOCUS_20420 56852 57727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 57872 59065 gene locus_tag LOCUS_20430 57872 59065 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030944.1 protein_id gnl|my_center|LOCUS_20430 59625 59143 gene locus_tag LOCUS_20440 59625 59143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 59714 60352 gene locus_tag LOCUS_20450 59714 60352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 61833 60343 gene locus_tag LOCUS_20460 61833 60343 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930178.1 protein_id gnl|my_center|LOCUS_20460 61890 62174 gene locus_tag LOCUS_20470 61890 62174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 63963 62266 gene locus_tag LOCUS_20480 63963 62266 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_20480 65495 63963 gene locus_tag LOCUS_20490 gene glpK 65495 63963 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027172.1 protein_id gnl|my_center|LOCUS_20490 66458 65571 gene locus_tag LOCUS_20500 66458 65571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228743.1 protein_id gnl|my_center|LOCUS_20500 66580 67473 gene locus_tag LOCUS_20510 66580 67473 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804749.1 protein_id gnl|my_center|LOCUS_20510 67553 68335 gene locus_tag LOCUS_20520 67553 68335 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098387.1 protein_id gnl|my_center|LOCUS_20520 68377 69426 gene locus_tag LOCUS_20530 68377 69426 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222380.1 protein_id gnl|my_center|LOCUS_20530 69691 69443 gene locus_tag LOCUS_20540 69691 69443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 69782 70675 gene locus_tag LOCUS_20550 69782 70675 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222703.1 protein_id gnl|my_center|LOCUS_20550 72370 70751 gene locus_tag LOCUS_20560 72370 70751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 72521 73210 gene locus_tag LOCUS_20570 72521 73210 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973811.1 protein_id gnl|my_center|LOCUS_20570 74437 73214 gene locus_tag LOCUS_20580 gene moeZ 74437 73214 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973798.1 protein_id gnl|my_center|LOCUS_20580 74494 75144 gene locus_tag LOCUS_20590 74494 75144 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 protein_id gnl|my_center|LOCUS_20590 75221 75445 gene locus_tag LOCUS_20600 75221 75445 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804752.1 protein_id gnl|my_center|LOCUS_20600 75626 75889 gene locus_tag LOCUS_20610 75626 75889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 76061 77209 gene locus_tag LOCUS_20620 76061 77209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 77311 80607 gene locus_tag LOCUS_20630 77311 80607 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223038.1 protein_id gnl|my_center|LOCUS_20630 80604 84005 gene locus_tag LOCUS_20640 80604 84005 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804755.1 protein_id gnl|my_center|LOCUS_20640 85374 83992 gene locus_tag LOCUS_20650 85374 83992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 85408 86391 gene locus_tag LOCUS_20660 gene nudC 85408 86391 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327228.1 protein_id gnl|my_center|LOCUS_20660 86504 88651 gene locus_tag LOCUS_20670 86504 88651 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668762.1 protein_id gnl|my_center|LOCUS_20670 88793 89056 gene locus_tag LOCUS_20680 88793 89056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 89305 89601 gene locus_tag LOCUS_20690 89305 89601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 89726 89863 gene locus_tag LOCUS_20700 89726 89863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 89965 90933 gene locus_tag LOCUS_20710 89965 90933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 90930 92261 gene locus_tag LOCUS_20720 90930 92261 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030108.1 protein_id gnl|my_center|LOCUS_20720 92924 92343 gene locus_tag LOCUS_20730 92924 92343 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896556.1 protein_id gnl|my_center|LOCUS_20730 93199 93038 gene locus_tag LOCUS_20740 93199 93038 CDS product DUF5679 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551122.1 protein_id gnl|my_center|LOCUS_20740 94006 93377 gene locus_tag LOCUS_20750 94006 93377 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973778.1 protein_id gnl|my_center|LOCUS_20750 95532 94003 gene locus_tag LOCUS_20760 95532 94003 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 protein_id gnl|my_center|LOCUS_20760 95683 96129 gene locus_tag LOCUS_20770 95683 96129 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973775.1 protein_id gnl|my_center|LOCUS_20770 96126 97220 gene locus_tag LOCUS_20780 96126 97220 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804763.1 protein_id gnl|my_center|LOCUS_20780 97783 97250 gene locus_tag LOCUS_20790 97783 97250 CDS product PPA1309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167526720.1 protein_id gnl|my_center|LOCUS_20790 97918 101133 gene locus_tag LOCUS_20800 97918 101133 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973771.1 protein_id gnl|my_center|LOCUS_20800 101221 101295 gene locus_tag LOCUS_t00390 101221 101295 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 101388 102665 gene locus_tag LOCUS_20810 101388 102665 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_20810 102662 104014 gene locus_tag LOCUS_20820 102662 104014 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030488.1 protein_id gnl|my_center|LOCUS_20820 104082 104684 gene locus_tag LOCUS_20830 104082 104684 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296502.1 protein_id gnl|my_center|LOCUS_20830 105463 104657 gene locus_tag LOCUS_20840 105463 104657 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775973.1 protein_id gnl|my_center|LOCUS_20840 105899 105687 gene locus_tag LOCUS_20850 105899 105687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 105781 107421 gene locus_tag LOCUS_20860 105781 107421 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973860.1 protein_id gnl|my_center|LOCUS_20860 107743 108681 gene locus_tag LOCUS_20870 107743 108681 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229923.1 protein_id gnl|my_center|LOCUS_20870 108674 109603 gene locus_tag LOCUS_20880 108674 109603 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284211.1 protein_id gnl|my_center|LOCUS_20880 109621 110673 gene locus_tag LOCUS_20890 109621 110673 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030066.1 protein_id gnl|my_center|LOCUS_20890 110666 111892 gene locus_tag LOCUS_20900 110666 111892 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229920.1 protein_id gnl|my_center|LOCUS_20900 112386 112042 gene locus_tag LOCUS_20910 112386 112042 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930294.1 protein_id gnl|my_center|LOCUS_20910 >Feature sequence14 557 1027 gene locus_tag LOCUS_20920 557 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 1020 1943 gene locus_tag LOCUS_20930 1020 1943 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976742.1 protein_id gnl|my_center|LOCUS_20930 2082 5675 gene locus_tag LOCUS_20940 gene dnaE 2082 5675 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804720.1 protein_id gnl|my_center|LOCUS_20940 5827 7569 gene locus_tag LOCUS_20950 5827 7569 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029468.1 protein_id gnl|my_center|LOCUS_20950 7739 9844 gene locus_tag LOCUS_20960 7739 9844 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803998.1 protein_id gnl|my_center|LOCUS_20960 10345 10746 gene locus_tag LOCUS_20970 10345 10746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 10743 10979 gene locus_tag LOCUS_20980 10743 10979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 12149 11154 gene locus_tag LOCUS_20990 12149 11154 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891444.1 protein_id gnl|my_center|LOCUS_20990 12217 14700 gene locus_tag LOCUS_21000 12217 14700 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969822.1 protein_id gnl|my_center|LOCUS_21000 16246 14690 gene locus_tag LOCUS_21010 16246 14690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 16190 16375 gene locus_tag LOCUS_21020 16190 16375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 17244 16438 gene locus_tag LOCUS_21030 17244 16438 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227300.1 protein_id gnl|my_center|LOCUS_21030 17508 19130 gene locus_tag LOCUS_21040 17508 19130 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188488774.1 protein_id gnl|my_center|LOCUS_21040 20674 19250 gene locus_tag LOCUS_21050 gene glnA 20674 19250 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775685.1 protein_id gnl|my_center|LOCUS_21050 20930 21346 gene locus_tag LOCUS_21060 20930 21346 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976618.1 protein_id gnl|my_center|LOCUS_21060 22145 21414 gene locus_tag LOCUS_21070 22145 21414 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976619.1 protein_id gnl|my_center|LOCUS_21070 23176 22151 gene locus_tag LOCUS_21080 gene lipA 23176 22151 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466774.1 protein_id gnl|my_center|LOCUS_21080 23980 23309 gene locus_tag LOCUS_21090 gene lipB 23980 23309 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775681.1 protein_id gnl|my_center|LOCUS_21090 24039 25073 gene locus_tag LOCUS_21100 24039 25073 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975953.1 protein_id gnl|my_center|LOCUS_21100 25253 25131 gene locus_tag LOCUS_21110 25253 25131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 26034 25300 gene locus_tag LOCUS_21120 26034 25300 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031666.1 protein_id gnl|my_center|LOCUS_21120 26344 26045 gene locus_tag LOCUS_21130 26344 26045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 26228 27895 gene locus_tag LOCUS_21140 26228 27895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21140 28478 27879 gene locus_tag LOCUS_21150 28478 27879 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179664825.1 protein_id gnl|my_center|LOCUS_21150 30047 28536 gene locus_tag LOCUS_21160 30047 28536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 31059 30157 gene locus_tag LOCUS_21170 31059 30157 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729703.1 protein_id gnl|my_center|LOCUS_21170 33036 31093 gene locus_tag LOCUS_21180 gene sucB 33036 31093 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775679.1 protein_id gnl|my_center|LOCUS_21180 34473 33097 gene locus_tag LOCUS_21190 gene lpdA 34473 33097 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224051.1 protein_id gnl|my_center|LOCUS_21190 34578 34985 gene locus_tag LOCUS_21200 34578 34985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 35078 35263 gene locus_tag LOCUS_21210 35078 35263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 36840 35344 gene locus_tag LOCUS_21220 36840 35344 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224057.1 protein_id gnl|my_center|LOCUS_21220 36938 38026 gene locus_tag LOCUS_21230 gene gcvT 36938 38026 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085318.1 protein_id gnl|my_center|LOCUS_21230 38052 38264 gene locus_tag LOCUS_21240 38052 38264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 38899 38309 gene locus_tag LOCUS_21250 38899 38309 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805010.1 protein_id gnl|my_center|LOCUS_21250 38952 40316 gene locus_tag LOCUS_21260 38952 40316 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878135.1 protein_id gnl|my_center|LOCUS_21260 40814 40317 gene locus_tag LOCUS_21270 40814 40317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 40962 42113 gene locus_tag LOCUS_21280 40962 42113 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027926.1 protein_id gnl|my_center|LOCUS_21280 42758 42180 gene locus_tag LOCUS_21290 42758 42180 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777073.1 protein_id gnl|my_center|LOCUS_21290 44076 42766 gene locus_tag LOCUS_21300 44076 42766 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086842507.1 protein_id gnl|my_center|LOCUS_21300 44211 45050 gene locus_tag LOCUS_21310 44211 45050 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223279.1 protein_id gnl|my_center|LOCUS_21310 45043 45747 gene locus_tag LOCUS_21320 45043 45747 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223280.1 protein_id gnl|my_center|LOCUS_21320 45763 46641 gene locus_tag LOCUS_21330 45763 46641 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223281.1 protein_id gnl|my_center|LOCUS_21330 46643 47752 gene locus_tag LOCUS_21340 46643 47752 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223282.1 protein_id gnl|my_center|LOCUS_21340 47891 49186 gene locus_tag LOCUS_21350 47891 49186 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223283.1 protein_id gnl|my_center|LOCUS_21350 49282 50781 gene locus_tag LOCUS_21360 49282 50781 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972177.1 protein_id gnl|my_center|LOCUS_21360 51341 50874 gene locus_tag LOCUS_21370 51341 50874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 52382 51501 gene locus_tag LOCUS_21380 52382 51501 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728763.1 protein_id gnl|my_center|LOCUS_21380 52509 53540 gene locus_tag LOCUS_21390 gene hrcA 52509 53540 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_21390 53619 54749 gene locus_tag LOCUS_21400 gene dnaJ 53619 54749 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_21400 54756 55499 gene locus_tag LOCUS_21410 54756 55499 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775758.1 protein_id gnl|my_center|LOCUS_21410 55536 55877 gene locus_tag LOCUS_21420 55536 55877 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976256.1 protein_id gnl|my_center|LOCUS_21420 55906 57072 gene locus_tag LOCUS_21430 55906 57072 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_21430 57069 57533 gene locus_tag LOCUS_21440 gene ybeY 57069 57533 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775754.1 protein_id gnl|my_center|LOCUS_21440 57582 58889 gene locus_tag LOCUS_21450 57582 58889 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 protein_id gnl|my_center|LOCUS_21450 58873 59796 gene locus_tag LOCUS_21460 gene era 58873 59796 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326176.1 protein_id gnl|my_center|LOCUS_21460 59990 61918 gene locus_tag LOCUS_21470 59990 61918 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727978.1 protein_id gnl|my_center|LOCUS_21470 63402 62062 gene locus_tag LOCUS_21480 63402 62062 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897865.1 protein_id gnl|my_center|LOCUS_21480 64392 63496 gene locus_tag LOCUS_21490 64392 63496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228743.1 protein_id gnl|my_center|LOCUS_21490 64313 64546 gene locus_tag LOCUS_21500 64313 64546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 64647 65639 gene locus_tag LOCUS_21510 64647 65639 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230597.1 protein_id gnl|my_center|LOCUS_21510 65786 67528 gene locus_tag LOCUS_21520 gene leuA 65786 67528 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930223.1 protein_id gnl|my_center|LOCUS_21520 67685 68518 gene locus_tag LOCUS_21530 gene pcaH 67685 68518 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728462.1 protein_id gnl|my_center|LOCUS_21530 68518 69108 gene locus_tag LOCUS_21540 gene pcaG 68518 69108 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728463.1 protein_id gnl|my_center|LOCUS_21540 69101 70369 gene locus_tag LOCUS_21550 gene pcaB 69101 70369 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031114.1 protein_id gnl|my_center|LOCUS_21550 70362 71147 gene locus_tag LOCUS_21560 70362 71147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21560 71144 71581 gene locus_tag LOCUS_21570 gene pcaC 71144 71581 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462297.1 protein_id gnl|my_center|LOCUS_21570 71587 72771 gene locus_tag LOCUS_21580 71587 72771 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223752.1 protein_id gnl|my_center|LOCUS_21580 72768 73457 gene locus_tag LOCUS_21590 72768 73457 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929696.1 protein_id gnl|my_center|LOCUS_21590 73454 74110 gene locus_tag LOCUS_21600 73454 74110 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819086.1 protein_id gnl|my_center|LOCUS_21600 74107 74940 gene locus_tag LOCUS_21610 74107 74940 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 protein_id gnl|my_center|LOCUS_21610 74946 76136 gene locus_tag LOCUS_21620 74946 76136 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089160.1 protein_id gnl|my_center|LOCUS_21620 77013 76192 gene locus_tag LOCUS_21630 77013 76192 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326902.1 protein_id gnl|my_center|LOCUS_21630 77648 77019 gene locus_tag LOCUS_21640 77648 77019 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971839.1 protein_id gnl|my_center|LOCUS_21640 77811 78647 gene locus_tag LOCUS_21650 gene recO 77811 78647 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863758.1 protein_id gnl|my_center|LOCUS_21650 78644 79420 gene locus_tag LOCUS_21660 78644 79420 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775743.1 protein_id gnl|my_center|LOCUS_21660 80345 79500 gene locus_tag LOCUS_21670 gene ppk2 80345 79500 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978711.1 protein_id gnl|my_center|LOCUS_21670 80422 80838 gene locus_tag LOCUS_21680 80422 80838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 81249 80854 gene locus_tag LOCUS_21690 81249 80854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 81221 82627 gene locus_tag LOCUS_21700 81221 82627 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729870.1 protein_id gnl|my_center|LOCUS_21700 82752 83933 gene locus_tag LOCUS_21710 82752 83933 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975538.1 protein_id gnl|my_center|LOCUS_21710 84024 84581 gene locus_tag LOCUS_21720 84024 84581 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975539.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21720 85607 84741 gene locus_tag LOCUS_21730 85607 84741 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030499.1 protein_id gnl|my_center|LOCUS_21730 85672 86379 gene locus_tag LOCUS_21740 85672 86379 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804932.1 protein_id gnl|my_center|LOCUS_21740 86460 87668 gene locus_tag LOCUS_21750 gene dusB 86460 87668 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010147544.1 protein_id gnl|my_center|LOCUS_21750 87750 88976 gene locus_tag LOCUS_21760 87750 88976 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775728.1 protein_id gnl|my_center|LOCUS_21760 89083 91017 gene locus_tag LOCUS_21770 gene dnaG 89083 91017 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775727.1 protein_id gnl|my_center|LOCUS_21770 91017 91547 gene locus_tag LOCUS_21780 91017 91547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 91624 91697 gene locus_tag LOCUS_t00400 91624 91697 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 92807 91764 gene locus_tag LOCUS_21790 92807 91764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 93674 92892 gene locus_tag LOCUS_21800 93674 92892 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363315.1 protein_id gnl|my_center|LOCUS_21800 94686 93715 gene locus_tag LOCUS_21810 94686 93715 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804404.1 protein_id gnl|my_center|LOCUS_21810 94825 96321 gene locus_tag LOCUS_21820 94825 96321 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119102.1 protein_id gnl|my_center|LOCUS_21820 97820 96441 gene locus_tag LOCUS_21830 97820 96441 CDS product MHS family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406233.1 protein_id gnl|my_center|LOCUS_21830 98865 98014 gene locus_tag LOCUS_21840 98865 98014 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730686.1 protein_id gnl|my_center|LOCUS_21840 99083 99553 gene locus_tag LOCUS_21850 99083 99553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 99647 99723 gene locus_tag LOCUS_t00410 99647 99723 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 <100650 99777 gene locus_tag LOCUS_21860 <100650 99777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973953.1:LLM class flavin-dependent oxidoreductase >Feature sequence15 273 97 gene locus_tag LOCUS_21870 273 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 3007 332 gene locus_tag LOCUS_21880 gene polA 3007 332 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_21880 3055 3468 gene locus_tag LOCUS_21890 3055 3468 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976812.1 protein_id gnl|my_center|LOCUS_21890 4180 3599 gene locus_tag LOCUS_21900 4180 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 4315 5088 gene locus_tag LOCUS_21910 4315 5088 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462325.1 protein_id gnl|my_center|LOCUS_21910 5738 5145 gene locus_tag LOCUS_21920 5738 5145 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976804.1 protein_id gnl|my_center|LOCUS_21920 5892 5807 gene locus_tag LOCUS_t00420 5892 5807 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7443 5989 gene locus_tag LOCUS_21930 gene pyk 7443 5989 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028096.1 protein_id gnl|my_center|LOCUS_21930 9432 7972 gene locus_tag LOCUS_21940 9432 7972 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976791.1 protein_id gnl|my_center|LOCUS_21940 13969 9425 gene locus_tag LOCUS_21950 gene gltB 13969 9425 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028104.1 protein_id gnl|my_center|LOCUS_21950 14988 14107 gene locus_tag LOCUS_21960 gene lgt 14988 14107 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971316.1 protein_id gnl|my_center|LOCUS_21960 15858 15076 gene locus_tag LOCUS_21970 15858 15076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 16438 15929 gene locus_tag LOCUS_21980 16438 15929 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223188.1 protein_id gnl|my_center|LOCUS_21980 17268 16435 gene locus_tag LOCUS_21990 gene trpA 17268 16435 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407999.1 protein_id gnl|my_center|LOCUS_21990 18566 17265 gene locus_tag LOCUS_22000 gene trpB 18566 17265 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930205.1 protein_id gnl|my_center|LOCUS_22000 19357 18563 gene locus_tag LOCUS_22010 gene trpC 19357 18563 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 protein_id gnl|my_center|LOCUS_22010 19810 19502 gene locus_tag LOCUS_22020 19810 19502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 20503 19883 gene locus_tag LOCUS_22030 20503 19883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 22062 20500 gene locus_tag LOCUS_22040 22062 20500 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976773.1 protein_id gnl|my_center|LOCUS_22040 22441 22055 gene locus_tag LOCUS_22050 gene hisI 22441 22055 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052762.1 protein_id gnl|my_center|LOCUS_22050 22451 23137 gene locus_tag LOCUS_22060 22451 23137 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 protein_id gnl|my_center|LOCUS_22060 23955 23149 gene locus_tag LOCUS_22070 gene hisF 23955 23149 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976768.1 protein_id gnl|my_center|LOCUS_22070 23954 24541 gene locus_tag LOCUS_22080 23954 24541 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898102.1 protein_id gnl|my_center|LOCUS_22080 24541 25743 gene locus_tag LOCUS_22090 24541 25743 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853634.1 protein_id gnl|my_center|LOCUS_22090 26398 25901 gene locus_tag LOCUS_22100 26398 25901 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977388.1 protein_id gnl|my_center|LOCUS_22100 27262 26420 gene locus_tag LOCUS_22110 gene hisG 27262 26420 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 protein_id gnl|my_center|LOCUS_22110 27571 27308 gene locus_tag LOCUS_22120 27571 27308 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929945.1 protein_id gnl|my_center|LOCUS_22120 27997 28473 gene locus_tag LOCUS_22130 27997 28473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 28868 28563 gene locus_tag LOCUS_22140 28868 28563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 29530 28874 gene locus_tag LOCUS_22150 gene rpe 29530 28874 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977361.1 protein_id gnl|my_center|LOCUS_22150 30893 29541 gene locus_tag LOCUS_22160 30893 29541 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805210.1 protein_id gnl|my_center|LOCUS_22160 32089 31154 gene locus_tag LOCUS_22170 gene fmt 32089 31154 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 protein_id gnl|my_center|LOCUS_22170 32640 32092 gene locus_tag LOCUS_22180 gene def 32640 32092 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224209.1 protein_id gnl|my_center|LOCUS_22180 33519 32686 gene locus_tag LOCUS_22190 33519 32686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 33839 33552 gene locus_tag LOCUS_22200 33839 33552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 34564 33788 gene locus_tag LOCUS_22210 34564 33788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 35936 34557 gene locus_tag LOCUS_22220 35936 34557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 38031 36028 gene locus_tag LOCUS_22230 38031 36028 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027807.1 protein_id gnl|my_center|LOCUS_22230 39349 38129 gene locus_tag LOCUS_22240 gene metK 39349 38129 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_22240 40690 39431 gene locus_tag LOCUS_22250 gene coaBC 40690 39431 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_22250 40980 40717 gene locus_tag LOCUS_22260 gene rpoZ 40980 40717 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977348.1 protein_id gnl|my_center|LOCUS_22260 41579 41019 gene locus_tag LOCUS_22270 gene gmk 41579 41019 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805082.1 protein_id gnl|my_center|LOCUS_22270 41890 41576 gene locus_tag LOCUS_22280 41890 41576 CDS product integration host factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977346.1 protein_id gnl|my_center|LOCUS_22280 42351 42007 gene locus_tag LOCUS_22290 42351 42007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 43217 42348 gene locus_tag LOCUS_22300 gene pyrF 43217 42348 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485777.1 protein_id gnl|my_center|LOCUS_22300 44253 43219 gene locus_tag LOCUS_22310 44253 43219 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_22310 45146 44253 gene locus_tag LOCUS_22320 45146 44253 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_22320 48466 45143 gene locus_tag LOCUS_22330 gene carB 48466 45143 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977343.1 protein_id gnl|my_center|LOCUS_22330 49631 48468 gene locus_tag LOCUS_22340 gene carA 49631 48468 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027810.1 protein_id gnl|my_center|LOCUS_22340 50185 49628 gene locus_tag LOCUS_22350 50185 49628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 51471 50182 gene locus_tag LOCUS_22360 51471 50182 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 protein_id gnl|my_center|LOCUS_22360 52430 51468 gene locus_tag LOCUS_22370 52430 51468 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805075.1 protein_id gnl|my_center|LOCUS_22370 53008 52427 gene locus_tag LOCUS_22380 gene pyrR 53008 52427 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805074.1 protein_id gnl|my_center|LOCUS_22380 53526 53116 gene locus_tag LOCUS_22390 gene nusB 53526 53116 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224611.1 protein_id gnl|my_center|LOCUS_22390 54090 53530 gene locus_tag LOCUS_22400 gene efp 54090 53530 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224610.1 protein_id gnl|my_center|LOCUS_22400 54245 55804 gene locus_tag LOCUS_22410 54245 55804 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_22410 56162 57226 gene locus_tag LOCUS_22420 gene tsuA 56162 57226 CDS product thiosulfate utilization transporter TsuA/YeeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492348.1 protein_id gnl|my_center|LOCUS_22420 57274 57498 gene locus_tag LOCUS_22430 gene tsuB 57274 57498 CDS product thiosulfate utilization sulfurtransferase TsuB/YeeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985273.1 protein_id gnl|my_center|LOCUS_22430 58663 57584 gene locus_tag LOCUS_22440 gene aroB 58663 57584 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027813.1 protein_id gnl|my_center|LOCUS_22440 59172 58660 gene locus_tag LOCUS_22450 59172 58660 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027814.1 protein_id gnl|my_center|LOCUS_22450 60389 59166 gene locus_tag LOCUS_22460 gene aroC 60389 59166 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_22460 63193 60500 gene locus_tag LOCUS_22470 gene ppdK 63193 60500 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_22470 64144 63314 gene locus_tag LOCUS_22480 64144 63314 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027816.1 protein_id gnl|my_center|LOCUS_22480 65298 64135 gene locus_tag LOCUS_22490 gene mltG 65298 64135 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775669.1 protein_id gnl|my_center|LOCUS_22490 65807 65295 gene locus_tag LOCUS_22500 gene ruvX 65807 65295 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042825781.1 protein_id gnl|my_center|LOCUS_22500 68503 65810 gene locus_tag LOCUS_22510 gene alaS 68503 65810 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977325.1 protein_id gnl|my_center|LOCUS_22510 70094 68721 gene locus_tag LOCUS_22520 70094 68721 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977320.1 protein_id gnl|my_center|LOCUS_22520 70849 70091 gene locus_tag LOCUS_22530 70849 70091 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223128.1 protein_id gnl|my_center|LOCUS_22530 70926 73157 gene locus_tag LOCUS_22540 70926 73157 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031089.1 protein_id gnl|my_center|LOCUS_22540 73132 73932 gene locus_tag LOCUS_22550 73132 73932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 75404 74028 gene locus_tag LOCUS_22560 75404 74028 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727104.1 protein_id gnl|my_center|LOCUS_22560 76295 75591 gene locus_tag LOCUS_22570 76295 75591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 76935 76300 gene locus_tag LOCUS_22580 76935 76300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 78776 76941 gene locus_tag LOCUS_22590 gene aspS 78776 76941 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894384.1 protein_id gnl|my_center|LOCUS_22590 79474 78881 gene locus_tag LOCUS_22600 79474 78881 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975821.1 protein_id gnl|my_center|LOCUS_22600 79534 80931 gene locus_tag LOCUS_22610 79534 80931 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226840.1 protein_id gnl|my_center|LOCUS_22610 80935 82383 gene locus_tag LOCUS_22620 80935 82383 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226839.1 protein_id gnl|my_center|LOCUS_22620 82808 82371 gene locus_tag LOCUS_22630 82808 82371 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027912.1 protein_id gnl|my_center|LOCUS_22630 83524 82805 gene locus_tag LOCUS_22640 83524 82805 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804265.1 protein_id gnl|my_center|LOCUS_22640 84238 83576 gene locus_tag LOCUS_22650 84238 83576 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977050.1 protein_id gnl|my_center|LOCUS_22650 85961 84252 gene locus_tag LOCUS_22660 85961 84252 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091806.1 protein_id gnl|my_center|LOCUS_22660 87084 85978 gene locus_tag LOCUS_22670 87084 85978 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804980.1 protein_id gnl|my_center|LOCUS_22670 88796 87084 gene locus_tag LOCUS_22680 88796 87084 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804979.1 protein_id gnl|my_center|LOCUS_22680 89623 88814 gene locus_tag LOCUS_22690 89623 88814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804978.1 protein_id gnl|my_center|LOCUS_22690 90600 89653 gene locus_tag LOCUS_22700 90600 89653 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227815.1 protein_id gnl|my_center|LOCUS_22700 91781 90597 gene locus_tag LOCUS_22710 gene steA 91781 90597 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804976.1 protein_id gnl|my_center|LOCUS_22710 93623 91875 gene locus_tag LOCUS_22720 gene recN 93623 91875 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_22720 94615 93683 gene locus_tag LOCUS_22730 94615 93683 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_22730 95448 94630 gene locus_tag LOCUS_22740 95448 94630 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079310.1 protein_id gnl|my_center|LOCUS_22740 95711 95445 gene locus_tag LOCUS_22750 95711 95445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 >Feature sequence16 447 1811 gene locus_tag LOCUS_22760 447 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 1824 2237 gene locus_tag LOCUS_22770 1824 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 2227 2436 gene locus_tag LOCUS_22780 2227 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 2438 3517 gene locus_tag LOCUS_22790 2438 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 3514 3915 gene locus_tag LOCUS_22800 3514 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 4139 4065 gene locus_tag LOCUS_t00430 4139 4065 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5753 4197 gene locus_tag LOCUS_22810 5753 4197 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975395.1 protein_id gnl|my_center|LOCUS_22810 6965 5820 gene locus_tag LOCUS_22820 6965 5820 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975394.1 protein_id gnl|my_center|LOCUS_22820 7579 6962 gene locus_tag LOCUS_22830 7579 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 8269 7601 gene locus_tag LOCUS_22840 8269 7601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 10190 8295 gene locus_tag LOCUS_22850 10190 8295 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804249.1 protein_id gnl|my_center|LOCUS_22850 10366 11295 gene locus_tag LOCUS_22860 10366 11295 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230336.1 protein_id gnl|my_center|LOCUS_22860 11947 11381 gene locus_tag LOCUS_22870 11947 11381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 12198 12848 gene locus_tag LOCUS_22880 12198 12848 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035335.1 protein_id gnl|my_center|LOCUS_22880 13982 12957 gene locus_tag LOCUS_22890 13982 12957 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813861.1 protein_id gnl|my_center|LOCUS_22890 14848 13979 gene locus_tag LOCUS_22900 14848 13979 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391054.1 protein_id gnl|my_center|LOCUS_22900 16183 14936 gene locus_tag LOCUS_22910 16183 14936 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931548.1 protein_id gnl|my_center|LOCUS_22910 16968 16258 gene locus_tag LOCUS_22920 16968 16258 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067079.1 protein_id gnl|my_center|LOCUS_22920 17728 16961 gene locus_tag LOCUS_22930 17728 16961 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243003.1 protein_id gnl|my_center|LOCUS_22930 17891 19042 gene locus_tag LOCUS_22940 17891 19042 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027320.1 protein_id gnl|my_center|LOCUS_22940 19830 19039 gene locus_tag LOCUS_22950 19830 19039 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728215.1 protein_id gnl|my_center|LOCUS_22950 20012 21865 gene locus_tag LOCUS_22960 20012 21865 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730559.1 protein_id gnl|my_center|LOCUS_22960 22571 21870 gene locus_tag LOCUS_22970 22571 21870 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027526.1 protein_id gnl|my_center|LOCUS_22970 22791 23432 gene locus_tag LOCUS_22980 22791 23432 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728695.1 protein_id gnl|my_center|LOCUS_22980 23432 24733 gene locus_tag LOCUS_22990 23432 24733 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110021.1 protein_id gnl|my_center|LOCUS_22990 24730 25509 gene locus_tag LOCUS_23000 24730 25509 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975878.1 protein_id gnl|my_center|LOCUS_23000 25513 26535 gene locus_tag LOCUS_23010 25513 26535 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728692.1 protein_id gnl|my_center|LOCUS_23010 26569 27606 gene locus_tag LOCUS_23020 26569 27606 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532988.1 protein_id gnl|my_center|LOCUS_23020 27603 28874 gene locus_tag LOCUS_23030 27603 28874 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338142.1 protein_id gnl|my_center|LOCUS_23030 28880 30223 gene locus_tag LOCUS_23040 28880 30223 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230185.1 protein_id gnl|my_center|LOCUS_23040 31895 30303 gene locus_tag LOCUS_23050 31895 30303 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224962.1 protein_id gnl|my_center|LOCUS_23050 34737 31939 gene locus_tag LOCUS_23060 gene topA 34737 31939 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776591.1 protein_id gnl|my_center|LOCUS_23060 34956 35756 gene locus_tag LOCUS_23070 34956 35756 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231012.1 protein_id gnl|my_center|LOCUS_23070 36180 35836 gene locus_tag LOCUS_23080 36180 35836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975673.1 protein_id gnl|my_center|LOCUS_23080 37944 36199 gene locus_tag LOCUS_23090 37944 36199 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804055.1 protein_id gnl|my_center|LOCUS_23090 38980 38063 gene locus_tag LOCUS_23100 38980 38063 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776004.1 protein_id gnl|my_center|LOCUS_23100 40155 39067 gene locus_tag LOCUS_23110 40155 39067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 40231 40755 gene locus_tag LOCUS_23120 40231 40755 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395734.1 protein_id gnl|my_center|LOCUS_23120 43055 40836 gene locus_tag LOCUS_23130 43055 40836 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942111.1 protein_id gnl|my_center|LOCUS_23130 43536 43204 gene locus_tag LOCUS_23140 43536 43204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 45552 43549 gene locus_tag LOCUS_23150 45552 43549 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 protein_id gnl|my_center|LOCUS_23150 47282 45549 gene locus_tag LOCUS_23160 47282 45549 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227095.1 protein_id gnl|my_center|LOCUS_23160 47924 47283 gene locus_tag LOCUS_23170 47924 47283 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230926.1 protein_id gnl|my_center|LOCUS_23170 49404 48091 gene locus_tag LOCUS_23180 49404 48091 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006590721.1 protein_id gnl|my_center|LOCUS_23180 50843 49401 gene locus_tag LOCUS_23190 gene aspA 50843 49401 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368668.1 protein_id gnl|my_center|LOCUS_23190 52595 51093 gene locus_tag LOCUS_23200 52595 51093 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776589.1 protein_id gnl|my_center|LOCUS_23200 53311 52595 gene locus_tag LOCUS_23210 53311 52595 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804383.1 protein_id gnl|my_center|LOCUS_23210 55757 53421 gene locus_tag LOCUS_23220 55757 53421 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449634.1 protein_id gnl|my_center|LOCUS_23220 56203 55868 gene locus_tag LOCUS_23230 gene bldG 56203 55868 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_23230 56430 57074 gene locus_tag LOCUS_23240 56430 57074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 57123 59474 gene locus_tag LOCUS_23250 57123 59474 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485160.1 protein_id gnl|my_center|LOCUS_23250 59525 59917 gene locus_tag LOCUS_23260 59525 59917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 60093 60851 gene locus_tag LOCUS_23270 60093 60851 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730500.1 protein_id gnl|my_center|LOCUS_23270 61227 60862 gene locus_tag LOCUS_23280 61227 60862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 61592 61245 gene locus_tag LOCUS_23290 61592 61245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 61813 61619 gene locus_tag LOCUS_23300 61813 61619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 62524 61970 gene locus_tag LOCUS_23310 62524 61970 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393763.1 protein_id gnl|my_center|LOCUS_23310 62525 63325 gene locus_tag LOCUS_23320 62525 63325 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099690.1 protein_id gnl|my_center|LOCUS_23320 64058 63369 gene locus_tag LOCUS_23330 64058 63369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 64798 64055 gene locus_tag LOCUS_23340 64798 64055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 65930 64764 gene locus_tag LOCUS_23350 65930 64764 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776567.1 protein_id gnl|my_center|LOCUS_23350 66715 65927 gene locus_tag LOCUS_23360 66715 65927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 68001 67153 gene locus_tag LOCUS_23370 68001 67153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 68026 69228 gene locus_tag LOCUS_23380 68026 69228 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667486.1 protein_id gnl|my_center|LOCUS_23380 69239 70060 gene locus_tag LOCUS_23390 69239 70060 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977611.1 protein_id gnl|my_center|LOCUS_23390 70057 70482 gene locus_tag LOCUS_23400 70057 70482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104514.1 protein_id gnl|my_center|LOCUS_23400 70496 72037 gene locus_tag LOCUS_23410 70496 72037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 72219 72563 gene locus_tag LOCUS_23420 72219 72563 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049745379.1 protein_id gnl|my_center|LOCUS_23420 72567 74231 gene locus_tag LOCUS_23430 72567 74231 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223483.1 protein_id gnl|my_center|LOCUS_23430 74443 76380 gene locus_tag LOCUS_23440 gene acs 74443 76380 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_23440 77353 76502 gene locus_tag LOCUS_23450 77353 76502 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_23450 77564 78907 gene locus_tag LOCUS_23460 gene nhaA 77564 78907 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081951.1 protein_id gnl|my_center|LOCUS_23460 79050 79559 gene locus_tag LOCUS_23470 79050 79559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 79663 80583 gene locus_tag LOCUS_23480 79663 80583 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029089.1 protein_id gnl|my_center|LOCUS_23480 81832 80621 gene locus_tag LOCUS_23490 81832 80621 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230547.1 protein_id gnl|my_center|LOCUS_23490 82476 81829 gene locus_tag LOCUS_23500 82476 81829 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_23500 83333 82494 gene locus_tag LOCUS_23510 83333 82494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 83395 84072 gene locus_tag LOCUS_23520 83395 84072 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_23520 84994 84182 gene locus_tag LOCUS_23530 84994 84182 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_23530 85848 84991 gene locus_tag LOCUS_23540 85848 84991 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230560.1 protein_id gnl|my_center|LOCUS_23540 85909 86562 gene locus_tag LOCUS_23550 85909 86562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 87010 86540 gene locus_tag LOCUS_23560 87010 86540 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 protein_id gnl|my_center|LOCUS_23560 87167 87012 gene locus_tag LOCUS_23570 87167 87012 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975360.1 protein_id gnl|my_center|LOCUS_23570 87236 88267 gene locus_tag LOCUS_23580 87236 88267 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029095.1 protein_id gnl|my_center|LOCUS_23580 88264 89433 gene locus_tag LOCUS_23590 88264 89433 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029096.1 protein_id gnl|my_center|LOCUS_23590 >Feature sequence17 <1 687 gene locus_tag LOCUS_23600 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002286297.1:NlpC/P60 family protein 1435 785 gene locus_tag LOCUS_23610 1435 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 1544 2956 gene locus_tag LOCUS_23620 1544 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 3014 4135 gene locus_tag LOCUS_23630 3014 4135 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_23630 4144 5124 gene locus_tag LOCUS_23640 gene tilS 4144 5124 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975427.1 protein_id gnl|my_center|LOCUS_23640 5176 5730 gene locus_tag LOCUS_23650 gene hpt 5176 5730 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_23650 6080 5877 gene locus_tag LOCUS_23660 6080 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 6529 6308 gene locus_tag LOCUS_23670 6529 6308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 7258 9432 gene locus_tag LOCUS_23680 gene ftsH 7258 9432 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 protein_id gnl|my_center|LOCUS_23680 9407 10030 gene locus_tag LOCUS_23690 gene folE 9407 10030 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_23690 10027 10863 gene locus_tag LOCUS_23700 gene folP 10027 10863 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975435.1 protein_id gnl|my_center|LOCUS_23700 10869 11750 gene locus_tag LOCUS_23710 gene folK 10869 11750 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804897.1 protein_id gnl|my_center|LOCUS_23710 11744 12205 gene locus_tag LOCUS_23720 11744 12205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 12961 12206 gene locus_tag LOCUS_23730 12961 12206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 14129 12963 gene locus_tag LOCUS_23740 14129 12963 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975441.1 protein_id gnl|my_center|LOCUS_23740 14205 15395 gene locus_tag LOCUS_23750 14205 15395 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222093.1 protein_id gnl|my_center|LOCUS_23750 15795 15421 gene locus_tag LOCUS_23760 15795 15421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 15996 15844 gene locus_tag LOCUS_23770 15996 15844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 15964 16794 gene locus_tag LOCUS_23780 15964 16794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23780 16791 17711 gene locus_tag LOCUS_23790 gene panC 16791 17711 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975450.1 protein_id gnl|my_center|LOCUS_23790 17780 18202 gene locus_tag LOCUS_23800 17780 18202 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230457.1 protein_id gnl|my_center|LOCUS_23800 18195 19934 gene locus_tag LOCUS_23810 18195 19934 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028946.1 protein_id gnl|my_center|LOCUS_23810 19931 20833 gene locus_tag LOCUS_23820 gene nadC 19931 20833 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975452.1 protein_id gnl|my_center|LOCUS_23820 21581 20865 gene locus_tag LOCUS_23830 21581 20865 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091945.1 protein_id gnl|my_center|LOCUS_23830 21673 22578 gene locus_tag LOCUS_23840 21673 22578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 22613 24109 gene locus_tag LOCUS_23850 gene lysS 22613 24109 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230454.1 protein_id gnl|my_center|LOCUS_23850 24113 24310 gene locus_tag LOCUS_23860 24113 24310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 24427 24753 gene locus_tag LOCUS_23870 24427 24753 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230453.1 protein_id gnl|my_center|LOCUS_23870 24840 25418 gene locus_tag LOCUS_23880 24840 25418 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230450.1 protein_id gnl|my_center|LOCUS_23880 25415 26689 gene locus_tag LOCUS_23890 25415 26689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 27718 26747 gene locus_tag LOCUS_23900 gene speB 27718 26747 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727391.1 protein_id gnl|my_center|LOCUS_23900 28671 27793 gene locus_tag LOCUS_23910 28671 27793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 29593 28664 gene locus_tag LOCUS_23920 29593 28664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 29592 30539 gene locus_tag LOCUS_23930 29592 30539 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227088.1 protein_id gnl|my_center|LOCUS_23930 30639 31649 gene locus_tag LOCUS_23940 30639 31649 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015422.1 protein_id gnl|my_center|LOCUS_23940 31652 31882 gene locus_tag LOCUS_23950 31652 31882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 32413 31907 gene locus_tag LOCUS_23960 32413 31907 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391368.1 protein_id gnl|my_center|LOCUS_23960 32379 33296 gene locus_tag LOCUS_23970 32379 33296 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730006.1 protein_id gnl|my_center|LOCUS_23970 33678 34349 gene locus_tag LOCUS_23980 33678 34349 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855259.1 protein_id gnl|my_center|LOCUS_23980 34674 37148 gene locus_tag LOCUS_23990 34674 37148 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_23990 37554 38615 gene locus_tag LOCUS_24000 gene ribD 37554 38615 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407308.1 protein_id gnl|my_center|LOCUS_24000 38617 39219 gene locus_tag LOCUS_24010 38617 39219 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_24010 39216 40466 gene locus_tag LOCUS_24020 gene ribB 39216 40466 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803671.1 protein_id gnl|my_center|LOCUS_24020 40463 40930 gene locus_tag LOCUS_24030 gene ribH 40463 40930 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977385.1 protein_id gnl|my_center|LOCUS_24030 40940 41482 gene locus_tag LOCUS_24040 40940 41482 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804919.1 protein_id gnl|my_center|LOCUS_24040 41479 42165 gene locus_tag LOCUS_24050 41479 42165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 43084 42185 gene locus_tag LOCUS_24060 43084 42185 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975480.1 protein_id gnl|my_center|LOCUS_24060 44163 43087 gene locus_tag LOCUS_24070 gene disA 44163 43087 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_24070 45626 44241 gene locus_tag LOCUS_24080 gene radA 45626 44241 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028928.1 protein_id gnl|my_center|LOCUS_24080 45799 47406 gene locus_tag LOCUS_24090 45799 47406 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085191.1 protein_id gnl|my_center|LOCUS_24090 47416 48036 gene locus_tag LOCUS_24100 47416 48036 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531972.1 protein_id gnl|my_center|LOCUS_24100 48247 48591 gene locus_tag LOCUS_24110 48247 48591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 48543 49880 gene locus_tag LOCUS_24120 48543 49880 CDS product DUF222 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110436.1 protein_id gnl|my_center|LOCUS_24120 50555 49962 gene locus_tag LOCUS_24130 50555 49962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 51347 50652 gene locus_tag LOCUS_24140 51347 50652 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223868.1 protein_id gnl|my_center|LOCUS_24140 52146 51349 gene locus_tag LOCUS_24150 52146 51349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975485.1 protein_id gnl|my_center|LOCUS_24150 52263 53195 gene locus_tag LOCUS_24160 52263 53195 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028926.1 protein_id gnl|my_center|LOCUS_24160 53271 54146 gene locus_tag LOCUS_24170 53271 54146 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975487.1 protein_id gnl|my_center|LOCUS_24170 54143 54757 gene locus_tag LOCUS_24180 54143 54757 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975488.1 protein_id gnl|my_center|LOCUS_24180 56623 54797 gene locus_tag LOCUS_24190 56623 54797 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977687.1 protein_id gnl|my_center|LOCUS_24190 56725 57255 gene locus_tag LOCUS_24200 56725 57255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 57252 58043 gene locus_tag LOCUS_24210 gene proC 57252 58043 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975496.1 protein_id gnl|my_center|LOCUS_24210 58036 58548 gene locus_tag LOCUS_24220 58036 58548 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620342.1 protein_id gnl|my_center|LOCUS_24220 58624 59256 gene locus_tag LOCUS_24230 58624 59256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 59937 59269 gene locus_tag LOCUS_24240 59937 59269 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_24240 60062 61246 gene locus_tag LOCUS_24250 60062 61246 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326515.1 protein_id gnl|my_center|LOCUS_24250 61546 61746 gene locus_tag LOCUS_24260 61546 61746 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004984898.1 protein_id gnl|my_center|LOCUS_24260 62204 63277 gene locus_tag LOCUS_24270 62204 63277 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_24270 63274 64560 gene locus_tag LOCUS_24280 63274 64560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 64594 64854 gene locus_tag LOCUS_24290 64594 64854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 64926 65732 gene locus_tag LOCUS_24300 64926 65732 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141850309.1 protein_id gnl|my_center|LOCUS_24300 65729 67036 gene locus_tag LOCUS_24310 65729 67036 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061882.1 protein_id gnl|my_center|LOCUS_24310 67033 68019 gene locus_tag LOCUS_24320 gene hemC 67033 68019 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727310.1 protein_id gnl|my_center|LOCUS_24320 68073 69692 gene locus_tag LOCUS_24330 68073 69692 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975519.1 protein_id gnl|my_center|LOCUS_24330 69709 70692 gene locus_tag LOCUS_24340 gene hemB 69709 70692 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776657.1 protein_id gnl|my_center|LOCUS_24340 72035 70689 gene locus_tag LOCUS_24350 72035 70689 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031093.1 protein_id gnl|my_center|LOCUS_24350 72883 72056 gene locus_tag LOCUS_24360 72883 72056 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819430.1 protein_id gnl|my_center|LOCUS_24360 73010 74131 gene locus_tag LOCUS_24370 73010 74131 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485041.1 protein_id gnl|my_center|LOCUS_24370 74179 75564 gene locus_tag LOCUS_24380 74179 75564 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803742.1 protein_id gnl|my_center|LOCUS_24380 75566 76477 gene locus_tag LOCUS_24390 75566 76477 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803743.1 protein_id gnl|my_center|LOCUS_24390 76474 77295 gene locus_tag LOCUS_24400 76474 77295 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803744.1 protein_id gnl|my_center|LOCUS_24400 77974 77444 gene locus_tag LOCUS_24410 77974 77444 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776424.1 protein_id gnl|my_center|LOCUS_24410 78106 78594 gene locus_tag LOCUS_24420 78106 78594 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973592.1 protein_id gnl|my_center|LOCUS_24420 78658 79986 gene locus_tag LOCUS_24430 gene hemL 78658 79986 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029675.1 protein_id gnl|my_center|LOCUS_24430 80017 80664 gene locus_tag LOCUS_24440 80017 80664 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222430.1 protein_id gnl|my_center|LOCUS_24440 80661 81245 gene locus_tag LOCUS_24450 80661 81245 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776421.1 protein_id gnl|my_center|LOCUS_24450 81259 82008 gene locus_tag LOCUS_24460 81259 82008 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222432.1 protein_id gnl|my_center|LOCUS_24460 82121 83605 gene locus_tag LOCUS_24470 82121 83605 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029679.1 protein_id gnl|my_center|LOCUS_24470 83602 84603 gene locus_tag LOCUS_24480 gene ccsB 83602 84603 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776418.1 protein_id gnl|my_center|LOCUS_24480 84603 84896 gene locus_tag LOCUS_24490 84603 84896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 85787 84915 gene locus_tag LOCUS_24500 85787 84915 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466560.1 protein_id gnl|my_center|LOCUS_24500 86067 85804 gene locus_tag LOCUS_24510 86067 85804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 87308 86145 gene locus_tag LOCUS_24520 gene menE 87308 86145 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098433.1 protein_id gnl|my_center|LOCUS_24520 88132 87302 gene locus_tag LOCUS_24530 88132 87302 CDS product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779966.1 protein_id gnl|my_center|LOCUS_24530 88653 88195 gene locus_tag LOCUS_24540 88653 88195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 >Feature sequence18 2093 741 gene locus_tag LOCUS_24550 2093 741 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728094.1 protein_id gnl|my_center|LOCUS_24550 2245 3399 gene locus_tag LOCUS_24560 2245 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 4578 3385 gene locus_tag LOCUS_24570 4578 3385 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921155.1 protein_id gnl|my_center|LOCUS_24570 5249 4575 gene locus_tag LOCUS_24580 5249 4575 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_24580 5978 5340 gene locus_tag LOCUS_24590 gene raiA 5978 5340 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776077.1 protein_id gnl|my_center|LOCUS_24590 7005 6202 gene locus_tag LOCUS_24600 7005 6202 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054881065.1 protein_id gnl|my_center|LOCUS_24600 8905 7112 gene locus_tag LOCUS_24610 8905 7112 CDS product LpqB family beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776079.1 protein_id gnl|my_center|LOCUS_24610 10575 8902 gene locus_tag LOCUS_24620 gene mtrB 10575 8902 CDS product two-component system sensor histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028715.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24620 11254 10577 gene locus_tag LOCUS_24630 gene mtrA 11254 10577 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 protein_id gnl|my_center|LOCUS_24630 12846 11398 gene locus_tag LOCUS_24640 gene ahcY 12846 11398 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_24640 13942 12998 gene locus_tag LOCUS_24650 13942 12998 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891984.1 protein_id gnl|my_center|LOCUS_24650 15477 14053 gene locus_tag LOCUS_24660 gene mtr 15477 14053 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728470.1 protein_id gnl|my_center|LOCUS_24660 15500 15880 gene locus_tag LOCUS_24670 15500 15880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 17081 15909 gene locus_tag LOCUS_24680 17081 15909 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975785.1 protein_id gnl|my_center|LOCUS_24680 17302 17081 gene locus_tag LOCUS_24690 17302 17081 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975784.1 protein_id gnl|my_center|LOCUS_24690 18746 17295 gene locus_tag LOCUS_24700 18746 17295 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_24700 19142 18762 gene locus_tag LOCUS_24710 19142 18762 CDS product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975781.1 protein_id gnl|my_center|LOCUS_24710 19287 19628 gene locus_tag LOCUS_24720 19287 19628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 21119 19635 gene locus_tag LOCUS_24730 21119 19635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 24385 21116 gene locus_tag LOCUS_24740 24385 21116 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028725.1 protein_id gnl|my_center|LOCUS_24740 24673 24410 gene locus_tag LOCUS_24750 24673 24410 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091761302.1 protein_id gnl|my_center|LOCUS_24750 24929 25903 gene locus_tag LOCUS_24760 gene cofD 24929 25903 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975775.1 protein_id gnl|my_center|LOCUS_24760 25900 27090 gene locus_tag LOCUS_24770 gene cofE 25900 27090 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776096.1 protein_id gnl|my_center|LOCUS_24770 29188 27164 gene locus_tag LOCUS_24780 29188 27164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 29794 29474 gene locus_tag LOCUS_24790 29794 29474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 30234 29791 gene locus_tag LOCUS_24800 30234 29791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 31188 30262 gene locus_tag LOCUS_24810 31188 30262 CDS product DNA-3-methyladenine glycosylase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139979125.1 protein_id gnl|my_center|LOCUS_24810 32041 31226 gene locus_tag LOCUS_24820 32041 31226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 33036 32038 gene locus_tag LOCUS_24830 33036 32038 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222165.1 protein_id gnl|my_center|LOCUS_24830 34910 33033 gene locus_tag LOCUS_24840 34910 33033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 36000 34918 gene locus_tag LOCUS_24850 36000 34918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 38095 36014 gene locus_tag LOCUS_24860 38095 36014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 38165 38875 gene locus_tag LOCUS_24870 38165 38875 CDS product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975771.1 protein_id gnl|my_center|LOCUS_24870 40503 38869 gene locus_tag LOCUS_24880 40503 38869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 40796 41575 gene locus_tag LOCUS_24890 40796 41575 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031119.1 protein_id gnl|my_center|LOCUS_24890 41577 42221 gene locus_tag LOCUS_24900 41577 42221 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031118.1 protein_id gnl|my_center|LOCUS_24900 45249 42301 gene locus_tag LOCUS_24910 45249 42301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 45131 45649 gene locus_tag LOCUS_24920 45131 45649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 45652 47097 gene locus_tag LOCUS_24930 45652 47097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 47157 49064 gene locus_tag LOCUS_24940 47157 49064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 49327 49055 gene locus_tag LOCUS_24950 49327 49055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 50262 49510 gene locus_tag LOCUS_24960 50262 49510 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090507.1 protein_id gnl|my_center|LOCUS_24960 51466 50255 gene locus_tag LOCUS_24970 51466 50255 CDS product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966155.1 protein_id gnl|my_center|LOCUS_24970 51687 51469 gene locus_tag LOCUS_24980 51687 51469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 51770 52429 gene locus_tag LOCUS_24990 51770 52429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 52441 53499 gene locus_tag LOCUS_25000 gene pseI 52441 53499 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920708.1 protein_id gnl|my_center|LOCUS_25000 53552 55810 gene locus_tag LOCUS_25010 53552 55810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 56801 55863 gene locus_tag LOCUS_25020 56801 55863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 57934 56807 gene locus_tag LOCUS_25030 gene pseC 57934 56807 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 protein_id gnl|my_center|LOCUS_25030 58929 57940 gene locus_tag LOCUS_25040 gene pseB 58929 57940 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867763.1 protein_id gnl|my_center|LOCUS_25040 59124 60173 gene locus_tag LOCUS_25050 59124 60173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 60184 61686 gene locus_tag LOCUS_25060 60184 61686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 62441 61695 gene locus_tag LOCUS_25070 62441 61695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 63232 62441 gene locus_tag LOCUS_25080 63232 62441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 64215 63229 gene locus_tag LOCUS_25090 64215 63229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 64379 65608 gene locus_tag LOCUS_25100 64379 65608 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224737.1 protein_id gnl|my_center|LOCUS_25100 66782 65616 gene locus_tag LOCUS_25110 66782 65616 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975760.1 protein_id gnl|my_center|LOCUS_25110 67922 66861 gene locus_tag LOCUS_25120 67922 66861 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223508.1 protein_id gnl|my_center|LOCUS_25120 67993 69171 gene locus_tag LOCUS_25130 67993 69171 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_25130 69222 69677 gene locus_tag LOCUS_25140 69222 69677 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027708.1 protein_id gnl|my_center|LOCUS_25140 70203 69685 gene locus_tag LOCUS_25150 gene purE 70203 69685 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975752.1 protein_id gnl|my_center|LOCUS_25150 71411 70200 gene locus_tag LOCUS_25160 71411 70200 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975751.1 protein_id gnl|my_center|LOCUS_25160 71452 71934 gene locus_tag LOCUS_25170 71452 71934 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286038.1 protein_id gnl|my_center|LOCUS_25170 72996 71950 gene locus_tag LOCUS_25180 72996 71950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 73680 73000 gene locus_tag LOCUS_25190 73680 73000 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975748.1 protein_id gnl|my_center|LOCUS_25190 74913 73729 gene locus_tag LOCUS_25200 74913 73729 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223470.1 protein_id gnl|my_center|LOCUS_25200 75730 74972 gene locus_tag LOCUS_25210 75730 74972 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029953.1 protein_id gnl|my_center|LOCUS_25210 >Feature sequence19 992 435 gene locus_tag LOCUS_25220 992 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 4732 995 gene locus_tag LOCUS_25230 4732 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 5978 4887 gene locus_tag LOCUS_25240 5978 4887 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229083.1 protein_id gnl|my_center|LOCUS_25240 6643 5975 gene locus_tag LOCUS_25250 6643 5975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 7596 6781 gene locus_tag LOCUS_25260 7596 6781 CDS product abortive infection family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056616.1 protein_id gnl|my_center|LOCUS_25260 9257 7593 gene locus_tag LOCUS_25270 9257 7593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 10663 9257 gene locus_tag LOCUS_25280 10663 9257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 11745 10660 gene locus_tag LOCUS_25290 11745 10660 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112777.1 protein_id gnl|my_center|LOCUS_25290 14018 11742 gene locus_tag LOCUS_25300 14018 11742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 14755 14015 gene locus_tag LOCUS_25310 14755 14015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 16732 14984 gene locus_tag LOCUS_25320 gene dnaB 16732 14984 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909028.1 protein_id gnl|my_center|LOCUS_25320 16999 17340 gene locus_tag LOCUS_25330 16999 17340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 18835 17375 gene locus_tag LOCUS_25340 18835 17375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 19926 18949 gene locus_tag LOCUS_25350 19926 18949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 20303 19923 gene locus_tag LOCUS_25360 20303 19923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 21111 20476 gene locus_tag LOCUS_25370 21111 20476 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283908.1 protein_id gnl|my_center|LOCUS_25370 21127 21834 gene locus_tag LOCUS_25380 21127 21834 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227842.1 protein_id gnl|my_center|LOCUS_25380 22144 22428 gene locus_tag LOCUS_25390 22144 22428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 22452 23843 gene locus_tag LOCUS_25400 22452 23843 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_25400 24669 23860 gene locus_tag LOCUS_25410 gene thiD 24669 23860 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822268.1 protein_id gnl|my_center|LOCUS_25410 24846 26591 gene locus_tag LOCUS_25420 gene thiC 24846 26591 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014273.1 protein_id gnl|my_center|LOCUS_25420 27102 27917 gene locus_tag LOCUS_25430 27102 27917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25430 27910 28773 gene locus_tag LOCUS_25440 gene thiM 27910 28773 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776708.1 protein_id gnl|my_center|LOCUS_25440 28770 29453 gene locus_tag LOCUS_25450 28770 29453 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776709.1 protein_id gnl|my_center|LOCUS_25450 31046 29520 gene locus_tag LOCUS_25460 31046 29520 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_25460 31156 32091 gene locus_tag LOCUS_25470 31156 32091 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121449.1 protein_id gnl|my_center|LOCUS_25470 32191 34785 gene locus_tag LOCUS_25480 32191 34785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 34785 35393 gene locus_tag LOCUS_25490 34785 35393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 35540 40171 gene locus_tag LOCUS_25500 35540 40171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 41179 40463 gene locus_tag LOCUS_25510 41179 40463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 42169 41336 gene locus_tag LOCUS_25520 42169 41336 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030774.1 protein_id gnl|my_center|LOCUS_25520 43245 42166 gene locus_tag LOCUS_25530 43245 42166 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270370.1 protein_id gnl|my_center|LOCUS_25530 44231 43245 gene locus_tag LOCUS_25540 44231 43245 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031350.1 protein_id gnl|my_center|LOCUS_25540 46334 44412 gene locus_tag LOCUS_25550 gene iolD 46334 44412 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_25550 47429 46359 gene locus_tag LOCUS_25560 gene iolB 47429 46359 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729993.1 protein_id gnl|my_center|LOCUS_25560 48538 47426 gene locus_tag LOCUS_25570 gene iolC 48538 47426 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729991.1 protein_id gnl|my_center|LOCUS_25570 49452 48535 gene locus_tag LOCUS_25580 49452 48535 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729986.1 protein_id gnl|my_center|LOCUS_25580 50456 49449 gene locus_tag LOCUS_25590 50456 49449 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487216.1 protein_id gnl|my_center|LOCUS_25590 50692 51447 gene locus_tag LOCUS_25600 50692 51447 CDS product myo-inositol degradation transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030772.1 protein_id gnl|my_center|LOCUS_25600 51544 52182 gene locus_tag LOCUS_25610 51544 52182 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730225.1 protein_id gnl|my_center|LOCUS_25610 52190 52858 gene locus_tag LOCUS_25620 52190 52858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 53108 52953 gene locus_tag LOCUS_25630 53108 52953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 53161 53757 gene locus_tag LOCUS_25640 53161 53757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 54980 53775 gene locus_tag LOCUS_25650 54980 53775 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047037982.1 protein_id gnl|my_center|LOCUS_25650 55165 55797 gene locus_tag LOCUS_25660 55165 55797 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156014321.1 protein_id gnl|my_center|LOCUS_25660 55794 57482 gene locus_tag LOCUS_25670 55794 57482 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030294.1 protein_id gnl|my_center|LOCUS_25670 57491 59149 gene locus_tag LOCUS_25680 57491 59149 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230124.1 protein_id gnl|my_center|LOCUS_25680 59174 60520 gene locus_tag LOCUS_25690 59174 60520 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729035.1 protein_id gnl|my_center|LOCUS_25690 60517 62136 gene locus_tag LOCUS_25700 60517 62136 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819848.1 protein_id gnl|my_center|LOCUS_25700 63525 62305 gene locus_tag LOCUS_25710 63525 62305 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054879778.1 protein_id gnl|my_center|LOCUS_25710 63784 64905 gene locus_tag LOCUS_25720 63784 64905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 64892 65227 gene locus_tag LOCUS_25730 64892 65227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 66850 66416 gene locus_tag LOCUS_25740 66850 66416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 66773 67732 gene locus_tag LOCUS_25750 66773 67732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 67998 74810 gene locus_tag LOCUS_25760 67998 74810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 74829 75542 gene locus_tag LOCUS_25770 74829 75542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 >Feature sequence20 1250 288 gene locus_tag LOCUS_25780 gene meaB 1250 288 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_25780 2456 1251 gene locus_tag LOCUS_25790 2456 1251 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084654.1 protein_id gnl|my_center|LOCUS_25790 3099 2665 gene locus_tag LOCUS_25800 gene mce 3099 2665 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223476.1 protein_id gnl|my_center|LOCUS_25800 3387 4721 gene locus_tag LOCUS_25810 gene ccrA 3387 4721 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283587.1 protein_id gnl|my_center|LOCUS_25810 4873 6144 gene locus_tag LOCUS_25820 4873 6144 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225393.1 protein_id gnl|my_center|LOCUS_25820 6146 6415 gene locus_tag LOCUS_25830 6146 6415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229480.1 protein_id gnl|my_center|LOCUS_25830 6913 6422 gene locus_tag LOCUS_25840 6913 6422 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226925.1 protein_id gnl|my_center|LOCUS_25840 8106 6970 gene locus_tag LOCUS_25850 8106 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 10005 8272 gene locus_tag LOCUS_25860 10005 8272 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229492.1 protein_id gnl|my_center|LOCUS_25860 10153 10848 gene locus_tag LOCUS_25870 gene nucS 10153 10848 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775934.1 protein_id gnl|my_center|LOCUS_25870 11529 10909 gene locus_tag LOCUS_25880 11529 10909 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971514.1 protein_id gnl|my_center|LOCUS_25880 11616 13154 gene locus_tag LOCUS_25890 11616 13154 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775824.1 protein_id gnl|my_center|LOCUS_25890 13258 13815 gene locus_tag LOCUS_25900 13258 13815 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119882.1 protein_id gnl|my_center|LOCUS_25900 16067 13965 gene locus_tag LOCUS_25910 16067 13965 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030947.1 protein_id gnl|my_center|LOCUS_25910 16478 16170 gene locus_tag LOCUS_25920 16478 16170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 16365 16613 gene locus_tag LOCUS_25930 16365 16613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 17889 16660 gene locus_tag LOCUS_25940 gene lhgO 17889 16660 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727635.1 protein_id gnl|my_center|LOCUS_25940 17951 18637 gene locus_tag LOCUS_25950 17951 18637 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973616.1 protein_id gnl|my_center|LOCUS_25950 19120 18683 gene locus_tag LOCUS_25960 19120 18683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 19400 19137 gene locus_tag LOCUS_25970 19400 19137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 19287 19589 gene locus_tag LOCUS_25980 19287 19589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 21063 19603 gene locus_tag LOCUS_25990 gene atpD 21063 19603 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004120484.1 protein_id gnl|my_center|LOCUS_25990 21989 21075 gene locus_tag LOCUS_26000 21989 21075 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973625.1 protein_id gnl|my_center|LOCUS_26000 23775 22114 gene locus_tag LOCUS_26010 gene atpA 23775 22114 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775940.1 protein_id gnl|my_center|LOCUS_26010 24678 23860 gene locus_tag LOCUS_26020 24678 23860 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_26020 25280 24678 gene locus_tag LOCUS_26030 25280 24678 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229526.1 protein_id gnl|my_center|LOCUS_26030 25536 25333 gene locus_tag LOCUS_26040 25536 25333 CDS product F-type H+-transporting ATPase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225896.1 protein_id gnl|my_center|LOCUS_26040 26470 25646 gene locus_tag LOCUS_26050 gene atpB 26470 25646 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229528.1 protein_id gnl|my_center|LOCUS_26050 26771 26529 gene locus_tag LOCUS_26060 26771 26529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 27148 26768 gene locus_tag LOCUS_26070 27148 26768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 28935 27577 gene locus_tag LOCUS_26080 28935 27577 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090595110.1 protein_id gnl|my_center|LOCUS_26080 30249 28972 gene locus_tag LOCUS_26090 30249 28972 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081014.1 protein_id gnl|my_center|LOCUS_26090 31171 30413 gene locus_tag LOCUS_26100 31171 30413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 32173 31289 gene locus_tag LOCUS_26110 gene prmC 32173 31289 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973636.1 protein_id gnl|my_center|LOCUS_26110 33255 32173 gene locus_tag LOCUS_26120 gene prfA 33255 32173 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973637.1 protein_id gnl|my_center|LOCUS_26120 33633 33415 gene locus_tag LOCUS_26130 gene rpmE 33633 33415 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775950.1 protein_id gnl|my_center|LOCUS_26130 33802 35373 gene locus_tag LOCUS_26140 33802 35373 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742166.1 protein_id gnl|my_center|LOCUS_26140 37466 35478 gene locus_tag LOCUS_26150 37466 35478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 38779 37832 gene locus_tag LOCUS_26160 gene thrB 38779 37832 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_26160 39882 38779 gene locus_tag LOCUS_26170 gene thrC 39882 38779 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_26170 41214 39886 gene locus_tag LOCUS_26180 41214 39886 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_26180 42777 41341 gene locus_tag LOCUS_26190 gene lysA 42777 41341 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775960.1 protein_id gnl|my_center|LOCUS_26190 44492 42846 gene locus_tag LOCUS_26200 gene argS 44492 42846 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730214.1 protein_id gnl|my_center|LOCUS_26200 44587 44660 gene locus_tag LOCUS_t00440 44587 44660 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 45731 45060 gene locus_tag LOCUS_26210 45731 45060 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971514.1 protein_id gnl|my_center|LOCUS_26210 46820 45789 gene locus_tag LOCUS_26220 46820 45789 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183373870.1 protein_id gnl|my_center|LOCUS_26220 48199 46817 gene locus_tag LOCUS_26230 48199 46817 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226803.1 protein_id gnl|my_center|LOCUS_26230 48365 49591 gene locus_tag LOCUS_26240 48365 49591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 49588 50388 gene locus_tag LOCUS_26250 49588 50388 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229684.1 protein_id gnl|my_center|LOCUS_26250 50584 51591 gene locus_tag LOCUS_26260 50584 51591 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804560.1 protein_id gnl|my_center|LOCUS_26260 51810 55754 gene locus_tag LOCUS_26270 51810 55754 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 protein_id gnl|my_center|LOCUS_26270 55947 56144 gene locus_tag LOCUS_26280 55947 56144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 56181 56357 gene locus_tag LOCUS_26290 56181 56357 CDS product DUF6104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030139.1 protein_id gnl|my_center|LOCUS_26290 56412 57092 gene locus_tag LOCUS_26300 56412 57092 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775967.1 protein_id gnl|my_center|LOCUS_26300 57152 58171 gene locus_tag LOCUS_26310 gene galE 57152 58171 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_26310 59324 58251 gene locus_tag LOCUS_26320 59324 58251 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973708.1 protein_id gnl|my_center|LOCUS_26320 59286 60317 gene locus_tag LOCUS_26330 gene pseG 59286 60317 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920694.1 protein_id gnl|my_center|LOCUS_26330 61506 60343 gene locus_tag LOCUS_26340 61506 60343 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973709.1 protein_id gnl|my_center|LOCUS_26340 61715 62104 gene locus_tag LOCUS_26350 61715 62104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 62174 62566 gene locus_tag LOCUS_26360 gene sodN 62174 62566 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_26360 62731 63651 gene locus_tag LOCUS_26370 62731 63651 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230916.1 protein_id gnl|my_center|LOCUS_26370 63680 64513 gene locus_tag LOCUS_26380 63680 64513 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896853.1 protein_id gnl|my_center|LOCUS_26380 64699 65628 gene locus_tag LOCUS_26390 64699 65628 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025221252.1 protein_id gnl|my_center|LOCUS_26390 65634 66599 gene locus_tag LOCUS_26400 65634 66599 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053710.1 protein_id gnl|my_center|LOCUS_26400 66596 67405 gene locus_tag LOCUS_26410 66596 67405 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973712.1 protein_id gnl|my_center|LOCUS_26410 68819 67545 gene locus_tag LOCUS_26420 68819 67545 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495247.1 protein_id gnl|my_center|LOCUS_26420 70249 68849 gene locus_tag LOCUS_26430 70249 68849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 71036 70749 gene locus_tag LOCUS_26440 71036 70749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 71764 71033 gene locus_tag LOCUS_26450 gene sigR 71764 71033 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_26450 72061 73389 gene locus_tag LOCUS_26460 gene cmr 72061 73389 CDS product multidrug efflux MFS transporter Cmr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015368.1 protein_id gnl|my_center|LOCUS_26460 74076 73435 gene locus_tag LOCUS_26470 74076 73435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973757.1 protein_id gnl|my_center|LOCUS_26470 74460 74335 gene locus_tag LOCUS_26480 74460 74335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 >Feature sequence21 223 17 gene locus_tag LOCUS_26490 223 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 135 410 gene locus_tag LOCUS_26500 135 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 631 1146 gene locus_tag LOCUS_26510 631 1146 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223984.1 protein_id gnl|my_center|LOCUS_26510 2737 1289 gene locus_tag LOCUS_26520 2737 1289 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729738.1 protein_id gnl|my_center|LOCUS_26520 3982 2738 gene locus_tag LOCUS_26530 3982 2738 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775710.1 protein_id gnl|my_center|LOCUS_26530 4337 4089 gene locus_tag LOCUS_26540 4337 4089 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775709.1 protein_id gnl|my_center|LOCUS_26540 5459 4434 gene locus_tag LOCUS_26550 5459 4434 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976418.1 protein_id gnl|my_center|LOCUS_26550 6639 5461 gene locus_tag LOCUS_26560 6639 5461 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028322.1 protein_id gnl|my_center|LOCUS_26560 7957 6785 gene locus_tag LOCUS_26570 gene fasR 7957 6785 CDS product fatty acid biosynthesis transcriptional regulator FasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028321.1 protein_id gnl|my_center|LOCUS_26570 9453 8026 gene locus_tag LOCUS_26580 gene argG 9453 8026 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226260.1 protein_id gnl|my_center|LOCUS_26580 9587 10753 gene locus_tag LOCUS_26590 9587 10753 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027852.1 protein_id gnl|my_center|LOCUS_26590 11605 10997 gene locus_tag LOCUS_26600 11605 10997 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228375.1 protein_id gnl|my_center|LOCUS_26600 12735 11602 gene locus_tag LOCUS_26610 12735 11602 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030073.1 protein_id gnl|my_center|LOCUS_26610 15653 12885 gene locus_tag LOCUS_26620 gene aceE 15653 12885 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223999.1 protein_id gnl|my_center|LOCUS_26620 15842 16393 gene locus_tag LOCUS_26630 15842 16393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 16390 17994 gene locus_tag LOCUS_26640 16390 17994 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804900.1 protein_id gnl|my_center|LOCUS_26640 18071 18496 gene locus_tag LOCUS_26650 18071 18496 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202437260.1 protein_id gnl|my_center|LOCUS_26650 18570 19061 gene locus_tag LOCUS_26660 18570 19061 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224001.1 protein_id gnl|my_center|LOCUS_26660 19177 19250 gene locus_tag LOCUS_t00450 19177 19250 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 19251 20093 gene locus_tag LOCUS_26670 19251 20093 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223077.1 protein_id gnl|my_center|LOCUS_26670 20090 20830 gene locus_tag LOCUS_26680 20090 20830 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028262.1 protein_id gnl|my_center|LOCUS_26680 20838 22022 gene locus_tag LOCUS_26690 20838 22022 CDS product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223079.1 protein_id gnl|my_center|LOCUS_26690 22270 22019 gene locus_tag LOCUS_26700 22270 22019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 22989 22243 gene locus_tag LOCUS_26710 gene yaaA 22989 22243 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976516.1 protein_id gnl|my_center|LOCUS_26710 23048 24511 gene locus_tag LOCUS_26720 23048 24511 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223097.1 protein_id gnl|my_center|LOCUS_26720 26576 25293 gene locus_tag LOCUS_26730 26576 25293 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410039.1 protein_id gnl|my_center|LOCUS_26730 26625 27281 gene locus_tag LOCUS_26740 26625 27281 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897237.1 protein_id gnl|my_center|LOCUS_26740 28143 27361 gene locus_tag LOCUS_26750 28143 27361 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775698.1 protein_id gnl|my_center|LOCUS_26750 29056 28193 gene locus_tag LOCUS_26760 gene map 29056 28193 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_26760 29105 29302 gene locus_tag LOCUS_26770 29105 29302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 29306 30001 gene locus_tag LOCUS_26780 29306 30001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 30354 30007 gene locus_tag LOCUS_26790 30354 30007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 31781 30402 gene locus_tag LOCUS_26800 31781 30402 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530465.1 protein_id gnl|my_center|LOCUS_26800 31924 32256 gene locus_tag LOCUS_26810 31924 32256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26810 32222 33334 gene locus_tag LOCUS_26820 32222 33334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26820 34205 33339 gene locus_tag LOCUS_26830 gene panB 34205 33339 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223113.1 protein_id gnl|my_center|LOCUS_26830 34433 36709 gene locus_tag LOCUS_26840 34433 36709 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028663.1 protein_id gnl|my_center|LOCUS_26840 36837 38174 gene locus_tag LOCUS_26850 gene glnA 36837 38174 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_26850 38194 41190 gene locus_tag LOCUS_26860 38194 41190 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 protein_id gnl|my_center|LOCUS_26860 41192 41788 gene locus_tag LOCUS_26870 41192 41788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 41815 43149 gene locus_tag LOCUS_26880 gene hisD 41815 43149 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028117.1 protein_id gnl|my_center|LOCUS_26880 43149 44264 gene locus_tag LOCUS_26890 43149 44264 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224128.1 protein_id gnl|my_center|LOCUS_26890 44261 44869 gene locus_tag LOCUS_26900 gene hisB 44261 44869 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052519.1 protein_id gnl|my_center|LOCUS_26900 44923 45555 gene locus_tag LOCUS_26910 44923 45555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 45545 46189 gene locus_tag LOCUS_26920 gene hisH 45545 46189 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776205.1 protein_id gnl|my_center|LOCUS_26920 46250 46984 gene locus_tag LOCUS_26930 gene priA 46250 46984 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776203.1 protein_id gnl|my_center|LOCUS_26930 46984 47760 gene locus_tag LOCUS_26940 46984 47760 CDS product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776202.1 protein_id gnl|my_center|LOCUS_26940 47892 49151 gene locus_tag LOCUS_26950 47892 49151 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230592.1 protein_id gnl|my_center|LOCUS_26950 49435 50049 gene locus_tag LOCUS_26960 gene infC 49435 50049 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027874.1 protein_id gnl|my_center|LOCUS_26960 50123 50317 gene locus_tag LOCUS_26970 gene rpmI 50123 50317 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977225.1 protein_id gnl|my_center|LOCUS_26970 50397 50777 gene locus_tag LOCUS_26980 gene rplT 50397 50777 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559056.1 protein_id gnl|my_center|LOCUS_26980 50822 51613 gene locus_tag LOCUS_26990 50822 51613 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_26990 51624 52733 gene locus_tag LOCUS_27000 51624 52733 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027872.1 protein_id gnl|my_center|LOCUS_27000 52821 53915 gene locus_tag LOCUS_27010 gene pheS 52821 53915 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977229.1 protein_id gnl|my_center|LOCUS_27010 53915 56473 gene locus_tag LOCUS_27020 gene pheT 53915 56473 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776192.1 protein_id gnl|my_center|LOCUS_27020 56479 57243 gene locus_tag LOCUS_27030 56479 57243 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729564.1 protein_id gnl|my_center|LOCUS_27030 57299 58348 gene locus_tag LOCUS_27040 gene argC 57299 58348 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977244.1 protein_id gnl|my_center|LOCUS_27040 58345 59496 gene locus_tag LOCUS_27050 gene argJ 58345 59496 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027859.1 protein_id gnl|my_center|LOCUS_27050 59493 60437 gene locus_tag LOCUS_27060 gene argB 59493 60437 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068277.1 protein_id gnl|my_center|LOCUS_27060 60434 61660 gene locus_tag LOCUS_27070 60434 61660 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227835.1 protein_id gnl|my_center|LOCUS_27070 61657 62598 gene locus_tag LOCUS_27080 gene argF 61657 62598 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813521.1 protein_id gnl|my_center|LOCUS_27080 62595 63092 gene locus_tag LOCUS_27090 62595 63092 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977248.1 protein_id gnl|my_center|LOCUS_27090 63195 64631 gene locus_tag LOCUS_27100 gene argH 63195 64631 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027854.1 protein_id gnl|my_center|LOCUS_27100 64673 65284 gene locus_tag LOCUS_27110 64673 65284 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 protein_id gnl|my_center|LOCUS_27110 65361 66620 gene locus_tag LOCUS_27120 gene tyrS 65361 66620 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 protein_id gnl|my_center|LOCUS_27120 >Feature sequence22 186 989 gene locus_tag LOCUS_27130 186 989 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742086.1 protein_id gnl|my_center|LOCUS_27130 1513 1028 gene locus_tag LOCUS_27140 1513 1028 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230805.1 protein_id gnl|my_center|LOCUS_27140 1743 2663 gene locus_tag LOCUS_27150 1743 2663 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777056.1 protein_id gnl|my_center|LOCUS_27150 3232 2786 gene locus_tag LOCUS_27160 3232 2786 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467870.1 protein_id gnl|my_center|LOCUS_27160 4303 3239 gene locus_tag LOCUS_27170 4303 3239 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390361.1 protein_id gnl|my_center|LOCUS_27170 5089 4460 gene locus_tag LOCUS_27180 gene grpE 5089 4460 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975269.1 protein_id gnl|my_center|LOCUS_27180 6981 5086 gene locus_tag LOCUS_27190 gene dnaK 6981 5086 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804830.1 protein_id gnl|my_center|LOCUS_27190 7280 7086 gene locus_tag LOCUS_27200 7280 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 8133 7381 gene locus_tag LOCUS_27210 8133 7381 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813831.1 protein_id gnl|my_center|LOCUS_27210 9182 8130 gene locus_tag LOCUS_27220 9182 8130 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229982.1 protein_id gnl|my_center|LOCUS_27220 9246 10208 gene locus_tag LOCUS_27230 9246 10208 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043788179.1 protein_id gnl|my_center|LOCUS_27230 10232 10828 gene locus_tag LOCUS_27240 10232 10828 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531936.1 protein_id gnl|my_center|LOCUS_27240 11862 10885 gene locus_tag LOCUS_27250 11862 10885 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284397.1 protein_id gnl|my_center|LOCUS_27250 11937 13187 gene locus_tag LOCUS_27260 11937 13187 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226021.1 protein_id gnl|my_center|LOCUS_27260 13311 14585 gene locus_tag LOCUS_27270 13311 14585 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258492.1 protein_id gnl|my_center|LOCUS_27270 14658 15662 gene locus_tag LOCUS_27280 14658 15662 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978217.1 protein_id gnl|my_center|LOCUS_27280 15733 17490 gene locus_tag LOCUS_27290 15733 17490 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082857.1 protein_id gnl|my_center|LOCUS_27290 18028 18405 gene locus_tag LOCUS_27300 18028 18405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 18449 19840 gene locus_tag LOCUS_27310 18449 19840 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104578.1 protein_id gnl|my_center|LOCUS_27310 20002 21267 gene locus_tag LOCUS_27320 20002 21267 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071171.1 protein_id gnl|my_center|LOCUS_27320 21264 21737 gene locus_tag LOCUS_27330 21264 21737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 21734 22807 gene locus_tag LOCUS_27340 21734 22807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27340 22722 23228 gene locus_tag LOCUS_27350 22722 23228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27350 24105 23272 gene locus_tag LOCUS_27360 24105 23272 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267408.1 protein_id gnl|my_center|LOCUS_27360 24273 24632 gene locus_tag LOCUS_27370 24273 24632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 24746 26152 gene locus_tag LOCUS_27380 24746 26152 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084878.1 protein_id gnl|my_center|LOCUS_27380 26240 27625 gene locus_tag LOCUS_27390 26240 27625 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945939.1 protein_id gnl|my_center|LOCUS_27390 27705 28265 gene locus_tag LOCUS_27400 27705 28265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 28302 30866 gene locus_tag LOCUS_27410 gene hrpB 28302 30866 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129699620.1 protein_id gnl|my_center|LOCUS_27410 31953 30910 gene locus_tag LOCUS_27420 31953 30910 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027421.1 protein_id gnl|my_center|LOCUS_27420 32321 34768 gene locus_tag LOCUS_27430 32321 34768 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462788.1 protein_id gnl|my_center|LOCUS_27430 34835 36232 gene locus_tag LOCUS_27440 34835 36232 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895076.1 protein_id gnl|my_center|LOCUS_27440 36599 38143 gene locus_tag LOCUS_27450 36599 38143 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259273.1 protein_id gnl|my_center|LOCUS_27450 38151 38549 gene locus_tag LOCUS_27460 38151 38549 CDS product OadG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259272.1 protein_id gnl|my_center|LOCUS_27460 38556 39170 gene locus_tag LOCUS_27470 38556 39170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 39167 40294 gene locus_tag LOCUS_27480 39167 40294 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259270.1 protein_id gnl|my_center|LOCUS_27480 41147 40419 gene locus_tag LOCUS_27490 41147 40419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 41238 43355 gene locus_tag LOCUS_27500 41238 43355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 43467 44090 gene locus_tag LOCUS_27510 43467 44090 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065304.1 protein_id gnl|my_center|LOCUS_27510 44659 44264 gene locus_tag LOCUS_27520 44659 44264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 44758 45486 gene locus_tag LOCUS_27530 44758 45486 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223128.1 protein_id gnl|my_center|LOCUS_27530 45483 46733 gene locus_tag LOCUS_27540 45483 46733 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095819.1 protein_id gnl|my_center|LOCUS_27540 48401 46740 gene locus_tag LOCUS_27550 48401 46740 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104297.1 protein_id gnl|my_center|LOCUS_27550 48485 50425 gene locus_tag LOCUS_27560 48485 50425 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887578.1 protein_id gnl|my_center|LOCUS_27560 50464 50664 gene locus_tag LOCUS_27570 50464 50664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 51865 50666 gene locus_tag LOCUS_27580 51865 50666 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223726.1 protein_id gnl|my_center|LOCUS_27580 52126 51938 gene locus_tag LOCUS_27590 52126 51938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 52065 53159 gene locus_tag LOCUS_27600 52065 53159 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896959.1 protein_id gnl|my_center|LOCUS_27600 55433 53301 gene locus_tag LOCUS_27610 55433 53301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 56049 55588 gene locus_tag LOCUS_27620 56049 55588 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776962.1 protein_id gnl|my_center|LOCUS_27620 56210 57556 gene locus_tag LOCUS_27630 gene gdhA 56210 57556 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896839.1 protein_id gnl|my_center|LOCUS_27630 58048 57632 gene locus_tag LOCUS_27640 58048 57632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 59624 58368 gene locus_tag LOCUS_27650 59624 58368 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014146.1 protein_id gnl|my_center|LOCUS_27650 61688 59658 gene locus_tag LOCUS_27660 gene cerN 61688 59658 CDS product ceramidase CerN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114226.1 protein_id gnl|my_center|LOCUS_27660 61808 63529 gene locus_tag LOCUS_27670 61808 63529 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925143.1 protein_id gnl|my_center|LOCUS_27670 64388 63624 gene locus_tag LOCUS_27680 64388 63624 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081153.1 protein_id gnl|my_center|LOCUS_27680 65084 64569 gene locus_tag LOCUS_27690 65084 64569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 <66485 65284 gene locus_tag LOCUS_27700 <66485 65284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140422.1:SdrD B-like domain-containing protein >Feature sequence23 616 86 gene locus_tag LOCUS_27710 616 86 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084002.1 protein_id gnl|my_center|LOCUS_27710 735 1613 gene locus_tag LOCUS_27720 735 1613 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461623.1 protein_id gnl|my_center|LOCUS_27720 1610 2698 gene locus_tag LOCUS_27730 gene arsB 1610 2698 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727470.1 protein_id gnl|my_center|LOCUS_27730 2695 3102 gene locus_tag LOCUS_27740 2695 3102 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_27740 3192 4007 gene locus_tag LOCUS_27750 3192 4007 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873433.1 protein_id gnl|my_center|LOCUS_27750 4028 4882 gene locus_tag LOCUS_27760 4028 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 4985 6763 gene locus_tag LOCUS_27770 4985 6763 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804649.1 protein_id gnl|my_center|LOCUS_27770 6760 7539 gene locus_tag LOCUS_27780 6760 7539 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887985.1 protein_id gnl|my_center|LOCUS_27780 7539 8318 gene locus_tag LOCUS_27790 7539 8318 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805161.1 protein_id gnl|my_center|LOCUS_27790 8318 9046 gene locus_tag LOCUS_27800 8318 9046 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975552.1 protein_id gnl|my_center|LOCUS_27800 9991 9083 gene locus_tag LOCUS_27810 9991 9083 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555716.1 protein_id gnl|my_center|LOCUS_27810 10663 10064 gene locus_tag LOCUS_27820 10663 10064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 10556 10795 gene locus_tag LOCUS_27830 10556 10795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 11289 10765 gene locus_tag LOCUS_27840 11289 10765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27840 11730 11296 gene locus_tag LOCUS_27850 11730 11296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27850 12484 11717 gene locus_tag LOCUS_27860 12484 11717 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972825.1 protein_id gnl|my_center|LOCUS_27860 13542 12481 gene locus_tag LOCUS_27870 13542 12481 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223440.1 protein_id gnl|my_center|LOCUS_27870 14950 13646 gene locus_tag LOCUS_27880 14950 13646 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228435.1 protein_id gnl|my_center|LOCUS_27880 15900 14950 gene locus_tag LOCUS_27890 gene cysD 15900 14950 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228434.1 protein_id gnl|my_center|LOCUS_27890 16505 15897 gene locus_tag LOCUS_27900 gene cysC 16505 15897 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164276380.1 protein_id gnl|my_center|LOCUS_27900 17224 16502 gene locus_tag LOCUS_27910 17224 16502 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972820.1 protein_id gnl|my_center|LOCUS_27910 19130 17412 gene locus_tag LOCUS_27920 19130 17412 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228431.1 protein_id gnl|my_center|LOCUS_27920 20492 19533 gene locus_tag LOCUS_27930 20492 19533 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093951710.1 protein_id gnl|my_center|LOCUS_27930 21037 20495 gene locus_tag LOCUS_27940 21037 20495 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228809.1 protein_id gnl|my_center|LOCUS_27940 21828 21034 gene locus_tag LOCUS_27950 21828 21034 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228811.1 protein_id gnl|my_center|LOCUS_27950 22862 21825 gene locus_tag LOCUS_27960 gene cobT 22862 21825 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228810.1 protein_id gnl|my_center|LOCUS_27960 23902 22859 gene locus_tag LOCUS_27970 23902 22859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 26400 23899 gene locus_tag LOCUS_27980 26400 23899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 27008 26394 gene locus_tag LOCUS_27990 gene cobO 27008 26394 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228816.1 protein_id gnl|my_center|LOCUS_27990 29125 27008 gene locus_tag LOCUS_28000 29125 27008 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976970.1 protein_id gnl|my_center|LOCUS_28000 29346 30599 gene locus_tag LOCUS_28010 29346 30599 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269017.1 protein_id gnl|my_center|LOCUS_28010 30596 31360 gene locus_tag LOCUS_28020 gene cobM 30596 31360 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228819.1 protein_id gnl|my_center|LOCUS_28020 31538 32224 gene locus_tag LOCUS_28030 31538 32224 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030567.1 protein_id gnl|my_center|LOCUS_28030 32217 32519 gene locus_tag LOCUS_28040 32217 32519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 32522 33292 gene locus_tag LOCUS_28050 gene cbiQ 32522 33292 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030565.1 protein_id gnl|my_center|LOCUS_28050 33289 34137 gene locus_tag LOCUS_28060 33289 34137 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030564.1 protein_id gnl|my_center|LOCUS_28060 35710 34154 gene locus_tag LOCUS_28070 35710 34154 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228824.1 protein_id gnl|my_center|LOCUS_28070 36411 35707 gene locus_tag LOCUS_28080 36411 35707 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 protein_id gnl|my_center|LOCUS_28080 37487 36408 gene locus_tag LOCUS_28090 gene cobG 37487 36408 CDS product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729385.1 protein_id gnl|my_center|LOCUS_28090 37686 41354 gene locus_tag LOCUS_28100 gene cobN 37686 41354 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228832.1 protein_id gnl|my_center|LOCUS_28100 42140 41364 gene locus_tag LOCUS_28110 gene cobF 42140 41364 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109722.1 protein_id gnl|my_center|LOCUS_28110 43687 42137 gene locus_tag LOCUS_28120 43687 42137 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228807.1 protein_id gnl|my_center|LOCUS_28120 43707 44273 gene locus_tag LOCUS_28130 43707 44273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 44348 45817 gene locus_tag LOCUS_28140 44348 45817 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225544.1 protein_id gnl|my_center|LOCUS_28140 45847 46293 gene locus_tag LOCUS_28150 45847 46293 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225543.1 protein_id gnl|my_center|LOCUS_28150 46353 47156 gene locus_tag LOCUS_28160 46353 47156 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225542.1 protein_id gnl|my_center|LOCUS_28160 48239 47196 gene locus_tag LOCUS_28170 48239 47196 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973597.1 protein_id gnl|my_center|LOCUS_28170 49423 48236 gene locus_tag LOCUS_28180 49423 48236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 50208 49420 gene locus_tag LOCUS_28190 50208 49420 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397831.1 protein_id gnl|my_center|LOCUS_28190 51238 50318 gene locus_tag LOCUS_28200 51238 50318 CDS product streptomycin 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729101.1 protein_id gnl|my_center|LOCUS_28200 52581 51235 gene locus_tag LOCUS_28210 52581 51235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 52758 53330 gene locus_tag LOCUS_28220 gene rimP 52758 53330 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973323.1 protein_id gnl|my_center|LOCUS_28220 53332 54378 gene locus_tag LOCUS_28230 gene nusA 53332 54378 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030401.1 protein_id gnl|my_center|LOCUS_28230 54683 54375 gene locus_tag LOCUS_28240 54683 54375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 54816 57785 gene locus_tag LOCUS_28250 54816 57785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 >Feature sequence24 1865 57 gene locus_tag LOCUS_28260 gene recD 1865 57 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900979.1 protein_id gnl|my_center|LOCUS_28260 5359 1862 gene locus_tag LOCUS_28270 gene recB 5359 1862 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727605.1 protein_id gnl|my_center|LOCUS_28270 8769 5359 gene locus_tag LOCUS_28280 gene recC 8769 5359 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900193.1 protein_id gnl|my_center|LOCUS_28280 8782 11034 gene locus_tag LOCUS_28290 8782 11034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804311.1 protein_id gnl|my_center|LOCUS_28290 11534 12313 gene locus_tag LOCUS_28300 11534 12313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28300 12401 13921 gene locus_tag LOCUS_28310 12401 13921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 14901 14062 gene locus_tag LOCUS_28320 14901 14062 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_28320 15955 14996 gene locus_tag LOCUS_28330 15955 14996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 16848 15952 gene locus_tag LOCUS_28340 16848 15952 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230607.1 protein_id gnl|my_center|LOCUS_28340 16935 17897 gene locus_tag LOCUS_28350 16935 17897 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230608.1 protein_id gnl|my_center|LOCUS_28350 18180 17917 gene locus_tag LOCUS_28360 18180 17917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 19704 18268 gene locus_tag LOCUS_28370 19704 18268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 20646 19792 gene locus_tag LOCUS_28380 20646 19792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 21549 20656 gene locus_tag LOCUS_28390 21549 20656 CDS product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974969.1 protein_id gnl|my_center|LOCUS_28390 22105 21584 gene locus_tag LOCUS_28400 22105 21584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 22315 22791 gene locus_tag LOCUS_28410 22315 22791 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226079.1 protein_id gnl|my_center|LOCUS_28410 22788 23375 gene locus_tag LOCUS_28420 22788 23375 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226078.1 protein_id gnl|my_center|LOCUS_28420 23452 24726 gene locus_tag LOCUS_28430 23452 24726 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 protein_id gnl|my_center|LOCUS_28430 24723 25436 gene locus_tag LOCUS_28440 24723 25436 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975444.1 protein_id gnl|my_center|LOCUS_28440 25523 26293 gene locus_tag LOCUS_28450 25523 26293 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_28450 26295 28763 gene locus_tag LOCUS_28460 26295 28763 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975721.1 protein_id gnl|my_center|LOCUS_28460 29166 30371 gene locus_tag LOCUS_28470 29166 30371 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030223.1 protein_id gnl|my_center|LOCUS_28470 30403 31017 gene locus_tag LOCUS_28480 30403 31017 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031718.1 protein_id gnl|my_center|LOCUS_28480 31014 31442 gene locus_tag LOCUS_28490 31014 31442 CDS product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805109.1 protein_id gnl|my_center|LOCUS_28490 31529 32479 gene locus_tag LOCUS_28500 31529 32479 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865109.1 protein_id gnl|my_center|LOCUS_28500 32476 33543 gene locus_tag LOCUS_28510 32476 33543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 34726 33644 gene locus_tag LOCUS_28520 34726 33644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 34707 34871 gene locus_tag LOCUS_28530 34707 34871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 36189 34912 gene locus_tag LOCUS_28540 36189 34912 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484988.1 protein_id gnl|my_center|LOCUS_28540 37525 36191 gene locus_tag LOCUS_28550 37525 36191 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028498.1 protein_id gnl|my_center|LOCUS_28550 39870 37522 gene locus_tag LOCUS_28560 39870 37522 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014868643.1 protein_id gnl|my_center|LOCUS_28560 41015 39867 gene locus_tag LOCUS_28570 41015 39867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 42334 41012 gene locus_tag LOCUS_28580 42334 41012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 44133 42331 gene locus_tag LOCUS_28590 44133 42331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 44807 44142 gene locus_tag LOCUS_28600 44807 44142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 46043 44811 gene locus_tag LOCUS_28610 46043 44811 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479620.1 protein_id gnl|my_center|LOCUS_28610 46911 46198 gene locus_tag LOCUS_28620 46911 46198 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789656.1 protein_id gnl|my_center|LOCUS_28620 47820 47179 gene locus_tag LOCUS_28630 47820 47179 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413654.1 protein_id gnl|my_center|LOCUS_28630 47858 48226 gene locus_tag LOCUS_28640 47858 48226 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777081.1 protein_id gnl|my_center|LOCUS_28640 48282 49034 gene locus_tag LOCUS_28650 48282 49034 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984103.1 protein_id gnl|my_center|LOCUS_28650 49442 49161 gene locus_tag LOCUS_28660 49442 49161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 50816 49644 gene locus_tag LOCUS_28670 50816 49644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 51846 50809 gene locus_tag LOCUS_28680 51846 50809 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804319.1 protein_id gnl|my_center|LOCUS_28680 >Feature sequence25 220 891 gene locus_tag LOCUS_28690 220 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 1817 930 gene locus_tag LOCUS_28700 1817 930 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_28700 6657 1828 gene locus_tag LOCUS_28710 6657 1828 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109508967.1 protein_id gnl|my_center|LOCUS_28710 6763 6984 gene locus_tag LOCUS_28720 6763 6984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 7368 7042 gene locus_tag LOCUS_28730 7368 7042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 7501 7896 gene locus_tag LOCUS_28740 7501 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 8329 7937 gene locus_tag LOCUS_28750 8329 7937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 8470 8946 gene locus_tag LOCUS_28760 8470 8946 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028935.1 protein_id gnl|my_center|LOCUS_28760 8985 9398 gene locus_tag LOCUS_28770 8985 9398 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222358.1 protein_id gnl|my_center|LOCUS_28770 10464 9433 gene locus_tag LOCUS_28780 10464 9433 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726948.1 protein_id gnl|my_center|LOCUS_28780 10516 10767 gene locus_tag LOCUS_28790 10516 10767 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224216.1 protein_id gnl|my_center|LOCUS_28790 10845 11774 gene locus_tag LOCUS_28800 10845 11774 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228484.1 protein_id gnl|my_center|LOCUS_28800 11774 12628 gene locus_tag LOCUS_28810 11774 12628 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228483.1 protein_id gnl|my_center|LOCUS_28810 12637 13461 gene locus_tag LOCUS_28820 12637 13461 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228482.1 protein_id gnl|my_center|LOCUS_28820 13757 14857 gene locus_tag LOCUS_28830 gene recA 13757 14857 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894107.1 protein_id gnl|my_center|LOCUS_28830 14857 15609 gene locus_tag LOCUS_28840 14857 15609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 15712 15879 gene locus_tag LOCUS_28850 15712 15879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861489.1 protein_id gnl|my_center|LOCUS_28850 16399 15965 gene locus_tag LOCUS_28860 16399 15965 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466994.1 protein_id gnl|my_center|LOCUS_28860 16886 16491 gene locus_tag LOCUS_28870 16886 16491 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015550.1 protein_id gnl|my_center|LOCUS_28870 16966 18477 gene locus_tag LOCUS_28880 gene miaB 16966 18477 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030453.1 protein_id gnl|my_center|LOCUS_28880 19243 18689 gene locus_tag LOCUS_28890 19243 18689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 19715 19407 gene locus_tag LOCUS_28900 19715 19407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 19816 20415 gene locus_tag LOCUS_28910 19816 20415 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230292.1 protein_id gnl|my_center|LOCUS_28910 20435 21346 gene locus_tag LOCUS_28920 gene miaA 20435 21346 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224257.1 protein_id gnl|my_center|LOCUS_28920 21435 22292 gene locus_tag LOCUS_28930 gene dapF 21435 22292 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804680.1 protein_id gnl|my_center|LOCUS_28930 22304 22918 gene locus_tag LOCUS_28940 22304 22918 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389654.1 protein_id gnl|my_center|LOCUS_28940 23034 24500 gene locus_tag LOCUS_28950 gene hflX 23034 24500 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_28950 24572 25669 gene locus_tag LOCUS_28960 24572 25669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 25761 26330 gene locus_tag LOCUS_28970 25761 26330 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013557.1 protein_id gnl|my_center|LOCUS_28970 29195 26583 gene locus_tag LOCUS_28980 29195 26583 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 protein_id gnl|my_center|LOCUS_28980 30238 29210 gene locus_tag LOCUS_28990 30238 29210 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229398.1 protein_id gnl|my_center|LOCUS_28990 30753 30235 gene locus_tag LOCUS_29000 30753 30235 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229399.1 protein_id gnl|my_center|LOCUS_29000 30961 33654 gene locus_tag LOCUS_29010 30961 33654 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_29010 33669 34535 gene locus_tag LOCUS_29020 33669 34535 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288522.1 protein_id gnl|my_center|LOCUS_29020 34701 35777 gene locus_tag LOCUS_29030 34701 35777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 35963 37078 gene locus_tag LOCUS_29040 35963 37078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 37140 39452 gene locus_tag LOCUS_29050 37140 39452 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229470.1 protein_id gnl|my_center|LOCUS_29050 39608 40588 gene locus_tag LOCUS_29060 gene holA 39608 40588 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485035.1 protein_id gnl|my_center|LOCUS_29060 40677 41045 gene locus_tag LOCUS_29070 40677 41045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 41615 41124 gene locus_tag LOCUS_29080 41615 41124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29080 41920 43764 gene locus_tag LOCUS_29090 gene lepA 41920 43764 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083190386.1 protein_id gnl|my_center|LOCUS_29090 43851 44312 gene locus_tag LOCUS_29100 43851 44312 CDS product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229705.1 protein_id gnl|my_center|LOCUS_29100 45156 44365 gene locus_tag LOCUS_29110 45156 44365 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726668.1 protein_id gnl|my_center|LOCUS_29110 45216 46442 gene locus_tag LOCUS_29120 gene hemW 45216 46442 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326185.1 protein_id gnl|my_center|LOCUS_29120 46473 47468 gene locus_tag LOCUS_29130 46473 47468 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480227.1 protein_id gnl|my_center|LOCUS_29130 47582 48580 gene locus_tag LOCUS_29140 47582 48580 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878423.1 protein_id gnl|my_center|LOCUS_29140 48577 49830 gene locus_tag LOCUS_29150 48577 49830 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064064.1 protein_id gnl|my_center|LOCUS_29150 51544 50033 gene locus_tag LOCUS_29160 51544 50033 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104247.1 protein_id gnl|my_center|LOCUS_29160 >Feature sequence26 282 1448 gene locus_tag LOCUS_29170 282 1448 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046898.1 protein_id gnl|my_center|LOCUS_29170 2847 1510 gene locus_tag LOCUS_29180 2847 1510 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225213.1 protein_id gnl|my_center|LOCUS_29180 2982 3689 gene locus_tag LOCUS_29190 2982 3689 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007447704.1 protein_id gnl|my_center|LOCUS_29190 6322 3641 gene locus_tag LOCUS_29200 6322 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 7776 6319 gene locus_tag LOCUS_29210 7776 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 7993 9282 gene locus_tag LOCUS_29220 7993 9282 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068484.1 protein_id gnl|my_center|LOCUS_29220 9279 10100 gene locus_tag LOCUS_29230 9279 10100 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051560.1 protein_id gnl|my_center|LOCUS_29230 11240 10149 gene locus_tag LOCUS_29240 11240 10149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 12058 11237 gene locus_tag LOCUS_29250 12058 11237 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467152.1 protein_id gnl|my_center|LOCUS_29250 12094 13236 gene locus_tag LOCUS_29260 12094 13236 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250274.1 protein_id gnl|my_center|LOCUS_29260 13233 13970 gene locus_tag LOCUS_29270 13233 13970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 14994 13918 gene locus_tag LOCUS_29280 14994 13918 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027730.1 protein_id gnl|my_center|LOCUS_29280 15009 15350 gene locus_tag LOCUS_29290 15009 15350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 16349 15366 gene locus_tag LOCUS_29300 16349 15366 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187502.1 protein_id gnl|my_center|LOCUS_29300 17412 16417 gene locus_tag LOCUS_29310 17412 16417 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085629.1 protein_id gnl|my_center|LOCUS_29310 18257 17436 gene locus_tag LOCUS_29320 18257 17436 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730268.1 protein_id gnl|my_center|LOCUS_29320 18835 18254 gene locus_tag LOCUS_29330 18835 18254 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479987.1 protein_id gnl|my_center|LOCUS_29330 18929 21403 gene locus_tag LOCUS_29340 gene pcrA 18929 21403 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_29340 22373 21456 gene locus_tag LOCUS_29350 22373 21456 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029872.1 protein_id gnl|my_center|LOCUS_29350 22400 22807 gene locus_tag LOCUS_29360 22400 22807 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_29360 23384 22842 gene locus_tag LOCUS_29370 23384 22842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 23583 24767 gene locus_tag LOCUS_29380 gene sucC 23583 24767 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804537.1 protein_id gnl|my_center|LOCUS_29380 24792 25685 gene locus_tag LOCUS_29390 gene sucD 24792 25685 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804538.1 protein_id gnl|my_center|LOCUS_29390 26029 27294 gene locus_tag LOCUS_29400 26029 27294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 27317 27916 gene locus_tag LOCUS_29410 gene purN 27317 27916 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974158.1 protein_id gnl|my_center|LOCUS_29410 28026 29660 gene locus_tag LOCUS_29420 gene purH 28026 29660 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029883.1 protein_id gnl|my_center|LOCUS_29420 29724 30617 gene locus_tag LOCUS_29430 29724 30617 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974148.1 protein_id gnl|my_center|LOCUS_29430 30698 31795 gene locus_tag LOCUS_29440 30698 31795 CDS product ionic transporter y4hA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226367.1 protein_id gnl|my_center|LOCUS_29440 32871 31879 gene locus_tag LOCUS_29450 32871 31879 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908123.1 protein_id gnl|my_center|LOCUS_29450 33097 33897 gene locus_tag LOCUS_29460 33097 33897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 33999 34472 gene locus_tag LOCUS_29470 33999 34472 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977815.1 protein_id gnl|my_center|LOCUS_29470 34776 34441 gene locus_tag LOCUS_29480 34776 34441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 34821 35351 gene locus_tag LOCUS_29490 34821 35351 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250228.1 protein_id gnl|my_center|LOCUS_29490 35348 36463 gene locus_tag LOCUS_29500 gene sfnG 35348 36463 CDS product dimethyl sulfone monooxygenase SfnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092820.1 protein_id gnl|my_center|LOCUS_29500 37438 36548 gene locus_tag LOCUS_29510 gene aqpZ 37438 36548 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731298.1 protein_id gnl|my_center|LOCUS_29510 37613 38635 gene locus_tag LOCUS_29520 gene trpS 37613 38635 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417440.1 protein_id gnl|my_center|LOCUS_29520 38648 39169 gene locus_tag LOCUS_29530 38648 39169 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029900.1 protein_id gnl|my_center|LOCUS_29530 40720 39287 gene locus_tag LOCUS_29540 40720 39287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 41991 40819 gene locus_tag LOCUS_29550 41991 40819 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742121.1 protein_id gnl|my_center|LOCUS_29550 42116 43201 gene locus_tag LOCUS_29560 42116 43201 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776146.1 protein_id gnl|my_center|LOCUS_29560 43557 43282 gene locus_tag LOCUS_29570 43557 43282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 43736 45328 gene locus_tag LOCUS_29580 43736 45328 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974103.1 protein_id gnl|my_center|LOCUS_29580 45426 46622 gene locus_tag LOCUS_29590 45426 46622 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776145.1 protein_id gnl|my_center|LOCUS_29590 46763 47824 gene locus_tag LOCUS_29600 46763 47824 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222768.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29600 >Feature sequence27 <1 711 gene locus_tag LOCUS_29610 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140422.1:SdrD B-like domain-containing protein 2394 799 gene locus_tag LOCUS_29620 2394 799 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226376481.1 protein_id gnl|my_center|LOCUS_29620 3732 2443 gene locus_tag LOCUS_29630 3732 2443 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_29630 4603 3830 gene locus_tag LOCUS_29640 4603 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 5219 4905 gene locus_tag LOCUS_29650 5219 4905 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975291.1 protein_id gnl|my_center|LOCUS_29650 6343 5312 gene locus_tag LOCUS_29660 gene fbaA 6343 5312 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029142.1 protein_id gnl|my_center|LOCUS_29660 7251 6442 gene locus_tag LOCUS_29670 7251 6442 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122195341.1 protein_id gnl|my_center|LOCUS_29670 8515 7259 gene locus_tag LOCUS_29680 8515 7259 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223908.1 protein_id gnl|my_center|LOCUS_29680 8874 8512 gene locus_tag LOCUS_29690 8874 8512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 8917 9084 gene locus_tag LOCUS_29700 8917 9084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 10627 9065 gene locus_tag LOCUS_29710 10627 9065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 10614 10853 gene locus_tag LOCUS_29720 10614 10853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 11544 10879 gene locus_tag LOCUS_29730 11544 10879 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776560.1 protein_id gnl|my_center|LOCUS_29730 12137 11541 gene locus_tag LOCUS_29740 12137 11541 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231827.1 protein_id gnl|my_center|LOCUS_29740 12200 12763 gene locus_tag LOCUS_29750 12200 12763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245720.1 protein_id gnl|my_center|LOCUS_29750 13649 12915 gene locus_tag LOCUS_29760 13649 12915 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937416.1 protein_id gnl|my_center|LOCUS_29760 14512 13649 gene locus_tag LOCUS_29770 14512 13649 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112052.1 protein_id gnl|my_center|LOCUS_29770 15391 14516 gene locus_tag LOCUS_29780 15391 14516 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116998.1 protein_id gnl|my_center|LOCUS_29780 15557 16255 gene locus_tag LOCUS_29790 15557 16255 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230830.1 protein_id gnl|my_center|LOCUS_29790 18268 16337 gene locus_tag LOCUS_29800 18268 16337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 21140 18432 gene locus_tag LOCUS_29810 21140 18432 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030729.1 protein_id gnl|my_center|LOCUS_29810 22101 21343 gene locus_tag LOCUS_29820 22101 21343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 22733 22179 gene locus_tag LOCUS_29830 gene pyrE 22733 22179 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029143.1 protein_id gnl|my_center|LOCUS_29830 23233 22826 gene locus_tag LOCUS_29840 23233 22826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 23178 23348 gene locus_tag LOCUS_29850 23178 23348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 23498 24289 gene locus_tag LOCUS_29860 23498 24289 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727225.1 protein_id gnl|my_center|LOCUS_29860 24293 25237 gene locus_tag LOCUS_29870 24293 25237 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223020.1 protein_id gnl|my_center|LOCUS_29870 26321 25266 gene locus_tag LOCUS_29880 26321 25266 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649461.1 protein_id gnl|my_center|LOCUS_29880 27366 26500 gene locus_tag LOCUS_29890 27366 26500 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227669.1 protein_id gnl|my_center|LOCUS_29890 29221 27548 gene locus_tag LOCUS_29900 29221 27548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 29891 29202 gene locus_tag LOCUS_29910 29891 29202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 30000 30401 gene locus_tag LOCUS_29920 30000 30401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 33010 30446 gene locus_tag LOCUS_29930 gene clpB 33010 30446 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975278.1 protein_id gnl|my_center|LOCUS_29930 33229 34461 gene locus_tag LOCUS_29940 33229 34461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 35020 34412 gene locus_tag LOCUS_29950 35020 34412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 35058 36143 gene locus_tag LOCUS_29960 35058 36143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 36306 36554 gene locus_tag LOCUS_29970 36306 36554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 36551 36790 gene locus_tag LOCUS_29980 36551 36790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 38201 37074 gene locus_tag LOCUS_29990 38201 37074 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015116.1 protein_id gnl|my_center|LOCUS_29990 38355 39869 gene locus_tag LOCUS_30000 38355 39869 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742107.1 protein_id gnl|my_center|LOCUS_30000 40450 40013 gene locus_tag LOCUS_30010 40450 40013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 40627 41865 gene locus_tag LOCUS_30020 40627 41865 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821341.1 protein_id gnl|my_center|LOCUS_30020 42522 41968 gene locus_tag LOCUS_30030 42522 41968 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050546857.1 protein_id gnl|my_center|LOCUS_30030 >Feature sequence28 975 316 gene locus_tag LOCUS_30040 975 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30040 1523 972 gene locus_tag LOCUS_30050 1523 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30050 1555 3423 gene locus_tag LOCUS_30060 1555 3423 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_30060 3420 4520 gene locus_tag LOCUS_30070 3420 4520 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_30070 5479 4553 gene locus_tag LOCUS_30080 gene rarD 5479 4553 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30080 5777 6550 gene locus_tag LOCUS_30090 5777 6550 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973246.1 protein_id gnl|my_center|LOCUS_30090 6615 7436 gene locus_tag LOCUS_30100 6615 7436 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030447.1 protein_id gnl|my_center|LOCUS_30100 7520 8200 gene locus_tag LOCUS_30110 7520 8200 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894110.1 protein_id gnl|my_center|LOCUS_30110 8431 9096 gene locus_tag LOCUS_30120 8431 9096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 10433 9135 gene locus_tag LOCUS_30130 10433 9135 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222034.1 protein_id gnl|my_center|LOCUS_30130 11572 10430 gene locus_tag LOCUS_30140 11572 10430 CDS product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027880.1 protein_id gnl|my_center|LOCUS_30140 12738 11740 gene locus_tag LOCUS_30150 12738 11740 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_30150 14297 12735 gene locus_tag LOCUS_30160 gene nuoN 14297 12735 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974371.1 protein_id gnl|my_center|LOCUS_30160 15826 14297 gene locus_tag LOCUS_30170 15826 14297 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974372.1 protein_id gnl|my_center|LOCUS_30170 17763 15823 gene locus_tag LOCUS_30180 gene nuoL 17763 15823 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893421.1 protein_id gnl|my_center|LOCUS_30180 18074 17775 gene locus_tag LOCUS_30190 gene nuoK 18074 17775 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893422.1 protein_id gnl|my_center|LOCUS_30190 18871 18071 gene locus_tag LOCUS_30200 18871 18071 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029738.1 protein_id gnl|my_center|LOCUS_30200 19557 18868 gene locus_tag LOCUS_30210 gene nuoI 19557 18868 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327003.1 protein_id gnl|my_center|LOCUS_30210 20965 19550 gene locus_tag LOCUS_30220 gene nuoH 20965 19550 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029736.1 protein_id gnl|my_center|LOCUS_30220 23433 20962 gene locus_tag LOCUS_30230 23433 20962 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728121.1 protein_id gnl|my_center|LOCUS_30230 24740 23430 gene locus_tag LOCUS_30240 gene nuoF 24740 23430 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416439.1 protein_id gnl|my_center|LOCUS_30240 25636 24743 gene locus_tag LOCUS_30250 gene nuoE 25636 24743 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974380.1 protein_id gnl|my_center|LOCUS_30250 27024 25636 gene locus_tag LOCUS_30260 27024 25636 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 protein_id gnl|my_center|LOCUS_30260 27761 27024 gene locus_tag LOCUS_30270 27761 27024 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029733.1 protein_id gnl|my_center|LOCUS_30270 28312 27758 gene locus_tag LOCUS_30280 28312 27758 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416420.1 protein_id gnl|my_center|LOCUS_30280 28711 28346 gene locus_tag LOCUS_30290 28711 28346 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_30290 30137 28818 gene locus_tag LOCUS_30300 30137 28818 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_30300 30986 30294 gene locus_tag LOCUS_30310 30986 30294 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 protein_id gnl|my_center|LOCUS_30310 31136 32374 gene locus_tag LOCUS_30320 31136 32374 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929999.1 protein_id gnl|my_center|LOCUS_30320 32433 33695 gene locus_tag LOCUS_30330 32433 33695 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106275831.1 protein_id gnl|my_center|LOCUS_30330 35540 33714 gene locus_tag LOCUS_30340 gene menD 35540 33714 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466562.1 protein_id gnl|my_center|LOCUS_30340 37103 35640 gene locus_tag LOCUS_30350 37103 35640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 37399 37100 gene locus_tag LOCUS_30360 37399 37100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 38474 37491 gene locus_tag LOCUS_30370 38474 37491 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727412.1 protein_id gnl|my_center|LOCUS_30370 38901 38497 gene locus_tag LOCUS_30380 38901 38497 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029511.1 protein_id gnl|my_center|LOCUS_30380 39008 39961 gene locus_tag LOCUS_30390 39008 39961 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094646.1 protein_id gnl|my_center|LOCUS_30390 40546 40962 gene locus_tag LOCUS_30400 40546 40962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 40996 41382 gene locus_tag LOCUS_30410 40996 41382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 >Feature sequence29 270 1319 gene locus_tag LOCUS_30420 270 1319 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027928.1 protein_id gnl|my_center|LOCUS_30420 1665 1276 gene locus_tag LOCUS_30430 1665 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 1711 2160 gene locus_tag LOCUS_30440 1711 2160 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891554.1 protein_id gnl|my_center|LOCUS_30440 2171 2578 gene locus_tag LOCUS_30450 2171 2578 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078910.1 protein_id gnl|my_center|LOCUS_30450 3188 2643 gene locus_tag LOCUS_30460 3188 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 3288 4790 gene locus_tag LOCUS_30470 3288 4790 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728345.1 protein_id gnl|my_center|LOCUS_30470 5715 4795 gene locus_tag LOCUS_30480 5715 4795 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803681.1 protein_id gnl|my_center|LOCUS_30480 6827 5892 gene locus_tag LOCUS_30490 6827 5892 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777086.1 protein_id gnl|my_center|LOCUS_30490 6874 8571 gene locus_tag LOCUS_30500 6874 8571 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101313.1 protein_id gnl|my_center|LOCUS_30500 8860 8597 gene locus_tag LOCUS_30510 8860 8597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 9413 8919 gene locus_tag LOCUS_30520 9413 8919 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388480.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30520 10144 9410 gene locus_tag LOCUS_30530 10144 9410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 11170 10232 gene locus_tag LOCUS_30540 11170 10232 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726632.1 protein_id gnl|my_center|LOCUS_30540 12597 11167 gene locus_tag LOCUS_30550 12597 11167 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776711.1 protein_id gnl|my_center|LOCUS_30550 12910 12599 gene locus_tag LOCUS_30560 12910 12599 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888479.1 protein_id gnl|my_center|LOCUS_30560 13897 12941 gene locus_tag LOCUS_30570 13897 12941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 14646 13894 gene locus_tag LOCUS_30580 14646 13894 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112978.1 protein_id gnl|my_center|LOCUS_30580 14689 15543 gene locus_tag LOCUS_30590 14689 15543 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225578.1 protein_id gnl|my_center|LOCUS_30590 15559 16302 gene locus_tag LOCUS_30600 15559 16302 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225350.1 protein_id gnl|my_center|LOCUS_30600 16663 16307 gene locus_tag LOCUS_30610 16663 16307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 17322 16948 gene locus_tag LOCUS_30620 17322 16948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 17747 17319 gene locus_tag LOCUS_30630 gene crcB 17747 17319 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975197.1 protein_id gnl|my_center|LOCUS_30630 22763 17805 gene locus_tag LOCUS_30640 22763 17805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 23122 22850 gene locus_tag LOCUS_30650 23122 22850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 23940 23290 gene locus_tag LOCUS_30660 23940 23290 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228133.1 protein_id gnl|my_center|LOCUS_30660 25328 23937 gene locus_tag LOCUS_30670 25328 23937 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030770.1 protein_id gnl|my_center|LOCUS_30670 25518 26303 gene locus_tag LOCUS_30680 25518 26303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 26951 26334 gene locus_tag LOCUS_30690 26951 26334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 27014 27730 gene locus_tag LOCUS_30700 27014 27730 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225211.1 protein_id gnl|my_center|LOCUS_30700 27764 28336 gene locus_tag LOCUS_30710 27764 28336 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092983.1 protein_id gnl|my_center|LOCUS_30710 28971 29768 gene locus_tag LOCUS_30720 28971 29768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 29916 31106 gene locus_tag LOCUS_30730 29916 31106 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729341.1 protein_id gnl|my_center|LOCUS_30730 31150 31971 gene locus_tag LOCUS_30740 31150 31971 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_30740 32697 31987 gene locus_tag LOCUS_30750 32697 31987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 32855 33193 gene locus_tag LOCUS_30760 32855 33193 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101499.1 protein_id gnl|my_center|LOCUS_30760 33873 33211 gene locus_tag LOCUS_30770 33873 33211 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081641.1 protein_id gnl|my_center|LOCUS_30770 34682 33939 gene locus_tag LOCUS_30780 34682 33939 CDS product chromosome condensation regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000385090.1 protein_id gnl|my_center|LOCUS_30780 35277 34804 gene locus_tag LOCUS_30790 35277 34804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228771.1 protein_id gnl|my_center|LOCUS_30790 35351 35836 gene locus_tag LOCUS_30800 35351 35836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 36035 36685 gene locus_tag LOCUS_30810 36035 36685 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285566.1 protein_id gnl|my_center|LOCUS_30810 36790 37323 gene locus_tag LOCUS_30820 36790 37323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 38291 37317 gene locus_tag LOCUS_30830 38291 37317 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031422.1 protein_id gnl|my_center|LOCUS_30830 38553 38326 gene locus_tag LOCUS_30840 38553 38326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 39106 39930 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggctcatccccgctcgcgcggggcggac 40185 39985 gene locus_tag LOCUS_30850 40185 39985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 >Feature sequence30 <1 1363 gene locus_tag LOCUS_30860 <1 1363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974086.1:ABC transporter ATP-binding protein 1360 2475 gene locus_tag LOCUS_30870 1360 2475 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222770.1 protein_id gnl|my_center|LOCUS_30870 2472 3743 gene locus_tag LOCUS_30880 2472 3743 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029928.1 protein_id gnl|my_center|LOCUS_30880 3746 4156 gene locus_tag LOCUS_30890 3746 4156 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908747.1 protein_id gnl|my_center|LOCUS_30890 4198 5484 gene locus_tag LOCUS_30900 4198 5484 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872150.1 protein_id gnl|my_center|LOCUS_30900 6346 5546 gene locus_tag LOCUS_30910 gene deoC 6346 5546 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256596.1 protein_id gnl|my_center|LOCUS_30910 6429 6791 gene locus_tag LOCUS_30920 6429 6791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 6788 7930 gene locus_tag LOCUS_30930 6788 7930 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_30930 8733 7906 gene locus_tag LOCUS_30940 8733 7906 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419780.1 protein_id gnl|my_center|LOCUS_30940 8762 9757 gene locus_tag LOCUS_30950 8762 9757 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975791.1 protein_id gnl|my_center|LOCUS_30950 9787 10095 gene locus_tag LOCUS_30960 9787 10095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 10109 10777 gene locus_tag LOCUS_30970 10109 10777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896615.1 protein_id gnl|my_center|LOCUS_30970 12097 10805 gene locus_tag LOCUS_30980 12097 10805 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223048.1 protein_id gnl|my_center|LOCUS_30980 13156 12119 gene locus_tag LOCUS_30990 13156 12119 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897409.1 protein_id gnl|my_center|LOCUS_30990 14382 13153 gene locus_tag LOCUS_31000 14382 13153 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484831.1 protein_id gnl|my_center|LOCUS_31000 15089 14379 gene locus_tag LOCUS_31010 15089 14379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 16186 15086 gene locus_tag LOCUS_31020 16186 15086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 16856 16227 gene locus_tag LOCUS_31030 16856 16227 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189397579.1 protein_id gnl|my_center|LOCUS_31030 18519 16849 gene locus_tag LOCUS_31040 18519 16849 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_31040 19375 18542 gene locus_tag LOCUS_31050 19375 18542 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776134.1 protein_id gnl|my_center|LOCUS_31050 19458 20870 gene locus_tag LOCUS_31060 19458 20870 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872192.1 protein_id gnl|my_center|LOCUS_31060 20962 21759 gene locus_tag LOCUS_31070 20962 21759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 22070 21768 gene locus_tag LOCUS_31080 22070 21768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 24137 22350 gene locus_tag LOCUS_31090 24137 22350 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029950.1 protein_id gnl|my_center|LOCUS_31090 24270 25718 gene locus_tag LOCUS_31100 24270 25718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 26733 25690 gene locus_tag LOCUS_31110 26733 25690 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229955.1 protein_id gnl|my_center|LOCUS_31110 26717 27130 gene locus_tag LOCUS_31120 26717 27130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 27103 28044 gene locus_tag LOCUS_31130 27103 28044 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804248.1 protein_id gnl|my_center|LOCUS_31130 28551 28111 gene locus_tag LOCUS_31140 28551 28111 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005373242.1 protein_id gnl|my_center|LOCUS_31140 28639 29820 gene locus_tag LOCUS_31150 28639 29820 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229659.1 protein_id gnl|my_center|LOCUS_31150 29848 31446 gene locus_tag LOCUS_31160 29848 31446 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231527.1 protein_id gnl|my_center|LOCUS_31160 31827 31483 gene locus_tag LOCUS_31170 31827 31483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 31817 32035 gene locus_tag LOCUS_31180 31817 32035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 32948 32235 gene locus_tag LOCUS_31190 32948 32235 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776131.1 protein_id gnl|my_center|LOCUS_31190 34847 32970 gene locus_tag LOCUS_31200 34847 32970 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093951984.1 protein_id gnl|my_center|LOCUS_31200 35006 35575 gene locus_tag LOCUS_31210 35006 35575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 37368 35653 gene locus_tag LOCUS_31220 37368 35653 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728748.1 protein_id gnl|my_center|LOCUS_31220 37403 38065 gene locus_tag LOCUS_31230 37403 38065 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894928.1 protein_id gnl|my_center|LOCUS_31230 38062 39228 gene locus_tag LOCUS_31240 38062 39228 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228953.1 protein_id gnl|my_center|LOCUS_31240 39601 39350 gene locus_tag LOCUS_31250 39601 39350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 >Feature sequence31 252 1028 gene locus_tag LOCUS_31260 252 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 1611 2018 gene locus_tag LOCUS_31270 1611 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 2309 2635 gene locus_tag LOCUS_31280 2309 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 2798 3205 gene locus_tag LOCUS_31290 2798 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 5208 3481 gene locus_tag LOCUS_31300 5208 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 5607 5224 gene locus_tag LOCUS_31310 5607 5224 CDS product DUF6394 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880147.1 protein_id gnl|my_center|LOCUS_31310 5937 5731 gene locus_tag LOCUS_31320 5937 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 6593 5970 gene locus_tag LOCUS_31330 6593 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 6708 6944 gene locus_tag LOCUS_31340 6708 6944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 7850 6948 gene locus_tag LOCUS_31350 7850 6948 CDS product ArgP/LysG family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014240.1 protein_id gnl|my_center|LOCUS_31350 7921 8514 gene locus_tag LOCUS_31360 7921 8514 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095323.1 protein_id gnl|my_center|LOCUS_31360 8760 8566 gene locus_tag LOCUS_31370 8760 8566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 9818 8763 gene locus_tag LOCUS_31380 9818 8763 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256709.1 protein_id gnl|my_center|LOCUS_31380 10603 9818 gene locus_tag LOCUS_31390 10603 9818 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256708.1 protein_id gnl|my_center|LOCUS_31390 11708 11163 gene locus_tag LOCUS_31400 11708 11163 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015486.1 protein_id gnl|my_center|LOCUS_31400 11870 12022 gene locus_tag LOCUS_31410 11870 12022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 12913 12026 gene locus_tag LOCUS_31420 12913 12026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 13344 13042 gene locus_tag LOCUS_31430 13344 13042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 13500 13895 gene locus_tag LOCUS_31440 13500 13895 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021844.1 protein_id gnl|my_center|LOCUS_31440 14952 13906 gene locus_tag LOCUS_31450 14952 13906 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728115.1 protein_id gnl|my_center|LOCUS_31450 15093 16784 gene locus_tag LOCUS_31460 15093 16784 CDS product 3-ketosteroid-delta-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728641.1 protein_id gnl|my_center|LOCUS_31460 16925 18982 gene locus_tag LOCUS_31470 16925 18982 CDS product serine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259150.1 protein_id gnl|my_center|LOCUS_31470 18986 19819 gene locus_tag LOCUS_31480 18986 19819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 19905 20555 gene locus_tag LOCUS_31490 19905 20555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 20754 22589 gene locus_tag LOCUS_31500 20754 22589 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_31500 22715 23068 gene locus_tag LOCUS_31510 22715 23068 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387149.1 protein_id gnl|my_center|LOCUS_31510 23615 23043 gene locus_tag LOCUS_31520 23615 23043 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038534996.1 protein_id gnl|my_center|LOCUS_31520 23740 24741 gene locus_tag LOCUS_31530 23740 24741 CDS product DUF5692 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948196.1 protein_id gnl|my_center|LOCUS_31530 25248 24817 gene locus_tag LOCUS_31540 25248 24817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080796943.1 protein_id gnl|my_center|LOCUS_31540 25817 25350 gene locus_tag LOCUS_31550 25817 25350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 25921 26841 gene locus_tag LOCUS_31560 25921 26841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 28209 26896 gene locus_tag LOCUS_31570 28209 26896 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804192.1 protein_id gnl|my_center|LOCUS_31570 28946 28365 gene locus_tag LOCUS_31580 28946 28365 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973388.1 protein_id gnl|my_center|LOCUS_31580 29030 30640 gene locus_tag LOCUS_31590 29030 30640 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777012.1 protein_id gnl|my_center|LOCUS_31590 30903 31295 gene locus_tag LOCUS_31600 30903 31295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 31397 31633 gene locus_tag LOCUS_31610 31397 31633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 31630 32043 gene locus_tag LOCUS_31620 31630 32043 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141677.1 protein_id gnl|my_center|LOCUS_31620 32383 33531 gene locus_tag LOCUS_31630 32383 33531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 >Feature sequence32 896 135 gene locus_tag LOCUS_31640 896 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31640 1366 1103 gene locus_tag LOCUS_31650 1366 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 1627 2214 gene locus_tag LOCUS_31660 1627 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 2510 2328 gene locus_tag LOCUS_31670 2510 2328 CDS product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728261.1 protein_id gnl|my_center|LOCUS_31670 4801 2534 gene locus_tag LOCUS_31680 4801 2534 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728262.1 protein_id gnl|my_center|LOCUS_31680 4969 6366 gene locus_tag LOCUS_31690 gene lpdA 4969 6366 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892330.1 protein_id gnl|my_center|LOCUS_31690 7814 6492 gene locus_tag LOCUS_31700 7814 6492 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110423.1 protein_id gnl|my_center|LOCUS_31700 8016 8924 gene locus_tag LOCUS_31710 8016 8924 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114171.1 protein_id gnl|my_center|LOCUS_31710 9177 9446 gene locus_tag LOCUS_31720 gene rpsO 9177 9446 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973291.1 protein_id gnl|my_center|LOCUS_31720 9621 12071 gene locus_tag LOCUS_31730 9621 12071 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973290.1 protein_id gnl|my_center|LOCUS_31730 12217 12882 gene locus_tag LOCUS_31740 12217 12882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 12895 13218 gene locus_tag LOCUS_31750 12895 13218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 13228 13944 gene locus_tag LOCUS_31760 13228 13944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 14126 15793 gene locus_tag LOCUS_31770 14126 15793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 15836 16585 gene locus_tag LOCUS_31780 gene dapB 15836 16585 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804662.1 protein_id gnl|my_center|LOCUS_31780 16901 16587 gene locus_tag LOCUS_31790 16901 16587 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804664.1 protein_id gnl|my_center|LOCUS_31790 17737 16898 gene locus_tag LOCUS_31800 17737 16898 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804665.1 protein_id gnl|my_center|LOCUS_31800 18338 17724 gene locus_tag LOCUS_31810 18338 17724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 19107 18379 gene locus_tag LOCUS_31820 19107 18379 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404702.1 protein_id gnl|my_center|LOCUS_31820 19636 19169 gene locus_tag LOCUS_31830 gene folA 19636 19169 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073447.1 protein_id gnl|my_center|LOCUS_31830 20485 19694 gene locus_tag LOCUS_31840 20485 19694 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969714.1 protein_id gnl|my_center|LOCUS_31840 20790 21626 gene locus_tag LOCUS_31850 gene dapA 20790 21626 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030431.1 protein_id gnl|my_center|LOCUS_31850 21623 23311 gene locus_tag LOCUS_31860 21623 23311 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_31860 23844 23353 gene locus_tag LOCUS_31870 23844 23353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 24646 24047 gene locus_tag LOCUS_31880 24646 24047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 24772 27513 gene locus_tag LOCUS_31890 24772 27513 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113701643.1 protein_id gnl|my_center|LOCUS_31890 27515 28177 gene locus_tag LOCUS_31900 27515 28177 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207910.1 protein_id gnl|my_center|LOCUS_31900 28177 28830 gene locus_tag LOCUS_31910 28177 28830 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976332.1 protein_id gnl|my_center|LOCUS_31910 29218 28973 gene locus_tag LOCUS_31920 29218 28973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 30525 29341 gene locus_tag LOCUS_31930 30525 29341 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_31930 30506 32032 gene locus_tag LOCUS_31940 gene rimO 30506 32032 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973272.1 protein_id gnl|my_center|LOCUS_31940 32029 32688 gene locus_tag LOCUS_31950 gene pgsA 32029 32688 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973271.1 protein_id gnl|my_center|LOCUS_31950 32685 33155 gene locus_tag LOCUS_31960 32685 33155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 33208 33576 gene locus_tag LOCUS_31970 33208 33576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 >Feature sequence33 204 114 gene locus_tag LOCUS_t00460 204 114 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 255 1199 gene locus_tag LOCUS_31980 gene htpX 255 1199 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974338.1 protein_id gnl|my_center|LOCUS_31980 1323 3839 gene locus_tag LOCUS_31990 gene pepN 1323 3839 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283751.1 protein_id gnl|my_center|LOCUS_31990 3854 4693 gene locus_tag LOCUS_32000 3854 4693 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906792.1 protein_id gnl|my_center|LOCUS_32000 4869 5756 gene locus_tag LOCUS_32010 4869 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 6783 5944 gene locus_tag LOCUS_32020 6783 5944 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726679.1 protein_id gnl|my_center|LOCUS_32020 7232 6780 gene locus_tag LOCUS_32030 gene htdZ 7232 6780 CDS product 3-hydroxyacyl-thioester dehydratase HtdZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400912.1 protein_id gnl|my_center|LOCUS_32030 7352 7960 gene locus_tag LOCUS_32040 7352 7960 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015424.1 protein_id gnl|my_center|LOCUS_32040 8085 9728 gene locus_tag LOCUS_32050 8085 9728 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230133.1 protein_id gnl|my_center|LOCUS_32050 10289 9795 gene locus_tag LOCUS_32060 10289 9795 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974333.1 protein_id gnl|my_center|LOCUS_32060 10349 10430 gene locus_tag LOCUS_t00470 10349 10430 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 10710 10516 gene locus_tag LOCUS_32070 10710 10516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 10930 12120 gene locus_tag LOCUS_32080 10930 12120 CDS product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257345.1 protein_id gnl|my_center|LOCUS_32080 12120 13118 gene locus_tag LOCUS_32090 12120 13118 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225688.1 protein_id gnl|my_center|LOCUS_32090 13265 13747 gene locus_tag LOCUS_32100 13265 13747 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259155.1 protein_id gnl|my_center|LOCUS_32100 14455 13757 gene locus_tag LOCUS_32110 14455 13757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 14630 16069 gene locus_tag LOCUS_32120 14630 16069 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729243.1 protein_id gnl|my_center|LOCUS_32120 16119 16463 gene locus_tag LOCUS_32130 16119 16463 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234816983.1 protein_id gnl|my_center|LOCUS_32130 16548 17357 gene locus_tag LOCUS_32140 16548 17357 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111593.1 protein_id gnl|my_center|LOCUS_32140 17354 17995 gene locus_tag LOCUS_32150 17354 17995 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172637.1 protein_id gnl|my_center|LOCUS_32150 17992 18828 gene locus_tag LOCUS_32160 17992 18828 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225677.1 protein_id gnl|my_center|LOCUS_32160 18846 20078 gene locus_tag LOCUS_32170 18846 20078 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_32170 19085 19001 gene locus_tag LOCUS_t00480 19085 19001 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 20075 20827 gene locus_tag LOCUS_32180 20075 20827 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414081.1 protein_id gnl|my_center|LOCUS_32180 20829 21905 gene locus_tag LOCUS_32190 20829 21905 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027920.1 protein_id gnl|my_center|LOCUS_32190 21915 22595 gene locus_tag LOCUS_32200 21915 22595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 22722 23906 gene locus_tag LOCUS_32210 22722 23906 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027647.1 protein_id gnl|my_center|LOCUS_32210 23903 25006 gene locus_tag LOCUS_32220 23903 25006 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225001.1 protein_id gnl|my_center|LOCUS_32220 25075 26274 gene locus_tag LOCUS_32230 25075 26274 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480052.1 protein_id gnl|my_center|LOCUS_32230 26278 27783 gene locus_tag LOCUS_32240 26278 27783 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 protein_id gnl|my_center|LOCUS_32240 27789 31031 gene locus_tag LOCUS_32250 27789 31031 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112417.1 protein_id gnl|my_center|LOCUS_32250 >Feature sequence34 69 2285 gene locus_tag LOCUS_32260 69 2285 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316996.1 protein_id gnl|my_center|LOCUS_32260 2310 3326 gene locus_tag LOCUS_32270 2310 3326 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224055.1 protein_id gnl|my_center|LOCUS_32270 6000 3421 gene locus_tag LOCUS_32280 6000 3421 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486976.1 protein_id gnl|my_center|LOCUS_32280 6201 8354 gene locus_tag LOCUS_32290 6201 8354 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031595.1 protein_id gnl|my_center|LOCUS_32290 8356 10074 gene locus_tag LOCUS_32300 gene treS 8356 10074 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224468.1 protein_id gnl|my_center|LOCUS_32300 10067 14077 gene locus_tag LOCUS_32310 10067 14077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 14191 15855 gene locus_tag LOCUS_32320 gene pgm 14191 15855 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728182.1 protein_id gnl|my_center|LOCUS_32320 18692 16143 gene locus_tag LOCUS_32330 18692 16143 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389382.1 protein_id gnl|my_center|LOCUS_32330 19827 18826 gene locus_tag LOCUS_32340 19827 18826 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929959.1 protein_id gnl|my_center|LOCUS_32340 20894 19887 gene locus_tag LOCUS_32350 20894 19887 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973580.1 protein_id gnl|my_center|LOCUS_32350 21948 20929 gene locus_tag LOCUS_32360 21948 20929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 22940 21945 gene locus_tag LOCUS_32370 22940 21945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 23491 23057 gene locus_tag LOCUS_32380 23491 23057 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973586.1 protein_id gnl|my_center|LOCUS_32380 24262 23618 gene locus_tag LOCUS_32390 24262 23618 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038986.1 protein_id gnl|my_center|LOCUS_32390 25098 24259 gene locus_tag LOCUS_32400 25098 24259 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_32400 28286 25095 gene locus_tag LOCUS_32410 28286 25095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 28652 28332 gene locus_tag LOCUS_32420 28652 28332 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726762.1 protein_id gnl|my_center|LOCUS_32420 >Feature sequence35 2132 594 gene locus_tag LOCUS_32430 2132 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 2349 6320 gene locus_tag LOCUS_32440 2349 6320 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030426.1 protein_id gnl|my_center|LOCUS_32440 6358 7119 gene locus_tag LOCUS_32450 6358 7119 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977745.1 protein_id gnl|my_center|LOCUS_32450 7216 8196 gene locus_tag LOCUS_32460 7216 8196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 8193 8942 gene locus_tag LOCUS_32470 8193 8942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 8939 9400 gene locus_tag LOCUS_32480 8939 9400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 9670 10896 gene locus_tag LOCUS_32490 9670 10896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 11794 10907 gene locus_tag LOCUS_32500 11794 10907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 12501 11791 gene locus_tag LOCUS_32510 12501 11791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 13125 12589 gene locus_tag LOCUS_32520 13125 12589 CDS product NUDIX hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870383.1 protein_id gnl|my_center|LOCUS_32520 13790 13248 gene locus_tag LOCUS_32530 13790 13248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 14724 13801 gene locus_tag LOCUS_32540 14724 13801 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230734.1 protein_id gnl|my_center|LOCUS_32540 16511 14721 gene locus_tag LOCUS_32550 16511 14721 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230735.1 protein_id gnl|my_center|LOCUS_32550 17743 16508 gene locus_tag LOCUS_32560 17743 16508 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161790914.1 protein_id gnl|my_center|LOCUS_32560 18553 17747 gene locus_tag LOCUS_32570 18553 17747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 19183 22572 gene locus_tag LOCUS_32580 gene ileS 19183 22572 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224829.1 protein_id gnl|my_center|LOCUS_32580 22698 24095 gene locus_tag LOCUS_32590 22698 24095 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804613.1 protein_id gnl|my_center|LOCUS_32590 24092 24352 gene locus_tag LOCUS_32600 24092 24352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 24349 24741 gene locus_tag LOCUS_32610 24349 24741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 24751 25179 gene locus_tag LOCUS_32620 gene ndk 24751 25179 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804615.1 protein_id gnl|my_center|LOCUS_32620 >Feature sequence36 2241 118 gene locus_tag LOCUS_32630 gene glgX 2241 118 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486968.1 protein_id gnl|my_center|LOCUS_32630 2324 2818 gene locus_tag LOCUS_32640 2324 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 2815 3594 gene locus_tag LOCUS_32650 2815 3594 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_32650 3814 4596 gene locus_tag LOCUS_32660 3814 4596 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027565.1 protein_id gnl|my_center|LOCUS_32660 4626 5579 gene locus_tag LOCUS_32670 4626 5579 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_32670 5766 6806 gene locus_tag LOCUS_32680 5766 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 6957 7343 gene locus_tag LOCUS_32690 6957 7343 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975942.1 protein_id gnl|my_center|LOCUS_32690 7340 8032 gene locus_tag LOCUS_32700 7340 8032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 8042 9226 gene locus_tag LOCUS_32710 8042 9226 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728292.1 protein_id gnl|my_center|LOCUS_32710 9226 10392 gene locus_tag LOCUS_32720 gene mnmA 9226 10392 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973510.1 protein_id gnl|my_center|LOCUS_32720 10389 11393 gene locus_tag LOCUS_32730 10389 11393 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030277.1 protein_id gnl|my_center|LOCUS_32730 12918 11416 gene locus_tag LOCUS_32740 12918 11416 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 protein_id gnl|my_center|LOCUS_32740 13081 15327 gene locus_tag LOCUS_32750 gene ligA 13081 15327 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415263.1 protein_id gnl|my_center|LOCUS_32750 15781 15338 gene locus_tag LOCUS_32760 15781 15338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 16317 15778 gene locus_tag LOCUS_32770 16317 15778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 16450 16812 gene locus_tag LOCUS_32780 16450 16812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 17843 16848 gene locus_tag LOCUS_32790 17843 16848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 18130 17840 gene locus_tag LOCUS_32800 18130 17840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 18262 18558 gene locus_tag LOCUS_32810 gene gatC 18262 18558 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973500.1 protein_id gnl|my_center|LOCUS_32810 18669 20183 gene locus_tag LOCUS_32820 gene gatA 18669 20183 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775913.1 protein_id gnl|my_center|LOCUS_32820 20186 21733 gene locus_tag LOCUS_32830 gene gatB 20186 21733 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030281.1 protein_id gnl|my_center|LOCUS_32830 >Feature sequence37 532 1533 gene locus_tag LOCUS_32840 532 1533 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093348.1 protein_id gnl|my_center|LOCUS_32840 1935 1600 gene locus_tag LOCUS_32850 1935 1600 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975911.1 protein_id gnl|my_center|LOCUS_32850 2189 1941 gene locus_tag LOCUS_32860 2189 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 2777 2307 gene locus_tag LOCUS_32870 gene bcp 2777 2307 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093079.1 protein_id gnl|my_center|LOCUS_32870 2903 3592 gene locus_tag LOCUS_32880 2903 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32880 3673 4038 gene locus_tag LOCUS_32890 3673 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32890 4039 4803 gene locus_tag LOCUS_32900 gene cbiQ 4039 4803 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975656.1 protein_id gnl|my_center|LOCUS_32900 4800 5549 gene locus_tag LOCUS_32910 4800 5549 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_32910 5631 5549 gene locus_tag LOCUS_t00490 5631 5549 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6299 5664 gene locus_tag LOCUS_32920 gene rdgB 6299 5664 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_32920 7048 6296 gene locus_tag LOCUS_32930 gene rph 7048 6296 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776022.1 protein_id gnl|my_center|LOCUS_32930 7955 7185 gene locus_tag LOCUS_32940 7955 7185 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776023.1 protein_id gnl|my_center|LOCUS_32940 8767 7952 gene locus_tag LOCUS_32950 gene murI 8767 7952 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567685.1 protein_id gnl|my_center|LOCUS_32950 10755 8905 gene locus_tag LOCUS_32960 10755 8905 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485037.1 protein_id gnl|my_center|LOCUS_32960 12814 10946 gene locus_tag LOCUS_32970 12814 10946 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156206934.1 protein_id gnl|my_center|LOCUS_32970 13506 12916 gene locus_tag LOCUS_32980 13506 12916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 14650 13601 gene locus_tag LOCUS_32990 gene rodA 14650 13601 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_32990 15708 14737 gene locus_tag LOCUS_33000 15708 14737 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_33000 16621 15710 gene locus_tag LOCUS_33010 gene truB 16621 15710 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030403.1 protein_id gnl|my_center|LOCUS_33010 17135 16608 gene locus_tag LOCUS_33020 gene rbfA 17135 16608 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804655.1 protein_id gnl|my_center|LOCUS_33020 17487 17203 gene locus_tag LOCUS_33030 17487 17203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 17392 17943 gene locus_tag LOCUS_33040 17392 17943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 18083 18709 gene locus_tag LOCUS_33050 18083 18709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 18709 19941 gene locus_tag LOCUS_33060 18709 19941 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777064.1 protein_id gnl|my_center|LOCUS_33060 >Feature sequence38 1201 29 gene locus_tag LOCUS_33070 1201 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 1740 1198 gene locus_tag LOCUS_33080 1740 1198 CDS product DUF4365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977294.1 protein_id gnl|my_center|LOCUS_33080 2697 1750 gene locus_tag LOCUS_33090 2697 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 3560 3946 gene locus_tag LOCUS_33100 3560 3946 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728710.1 protein_id gnl|my_center|LOCUS_33100 4775 3978 gene locus_tag LOCUS_33110 4775 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 4989 5876 gene locus_tag LOCUS_33120 4989 5876 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230727.1 protein_id gnl|my_center|LOCUS_33120 5964 6365 gene locus_tag LOCUS_33130 5964 6365 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728091.1 protein_id gnl|my_center|LOCUS_33130 6497 7156 gene locus_tag LOCUS_33140 gene modA 6497 7156 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728090.1 protein_id gnl|my_center|LOCUS_33140 7213 7983 gene locus_tag LOCUS_33150 7213 7983 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728089.1 protein_id gnl|my_center|LOCUS_33150 7980 9032 gene locus_tag LOCUS_33160 7980 9032 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728088.1 protein_id gnl|my_center|LOCUS_33160 9082 9831 gene locus_tag LOCUS_33170 9082 9831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 11204 9978 gene locus_tag LOCUS_33180 11204 9978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 12082 11201 gene locus_tag LOCUS_33190 12082 11201 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230149.1 protein_id gnl|my_center|LOCUS_33190 12911 12183 gene locus_tag LOCUS_33200 12911 12183 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 protein_id gnl|my_center|LOCUS_33200 14238 12901 gene locus_tag LOCUS_33210 14238 12901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 15176 14361 gene locus_tag LOCUS_33220 15176 14361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 16099 15173 gene locus_tag LOCUS_33230 16099 15173 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728951.1 protein_id gnl|my_center|LOCUS_33230 16065 16538 gene locus_tag LOCUS_33240 16065 16538 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027835.1 protein_id gnl|my_center|LOCUS_33240 16548 16829 gene locus_tag LOCUS_33250 16548 16829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 >Feature sequence39 <1 2803 gene locus_tag LOCUS_33260 <1 2803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674070.1:CRISPR-associated helicase/endonuclease Cas3 2796 4418 gene locus_tag LOCUS_33270 2796 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 4411 5046 gene locus_tag LOCUS_33280 4411 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 5049 6179 gene locus_tag LOCUS_33290 gene cas7e 5049 6179 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674072.1 protein_id gnl|my_center|LOCUS_33290 6176 6889 gene locus_tag LOCUS_33300 gene cas5e 6176 6889 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674073.1 protein_id gnl|my_center|LOCUS_33300 6886 7569 gene locus_tag LOCUS_33310 gene cas6e 6886 7569 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674074.1 protein_id gnl|my_center|LOCUS_33310 7566 8525 gene locus_tag LOCUS_33320 gene cas1e 7566 8525 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674075.1 protein_id gnl|my_center|LOCUS_33320 8519 8875 gene locus_tag LOCUS_33330 8519 8875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 8914 10588 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtccgccccgcgcgagcggggatgagcc >Feature sequence40 210 2015 gene locus_tag LOCUS_33340 gene ilvD 210 2015 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854128.1 protein_id gnl|my_center|LOCUS_33340 3069 2029 gene locus_tag LOCUS_33350 gene rsgA 3069 2029 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775972.1 protein_id gnl|my_center|LOCUS_33350 4328 3066 gene locus_tag LOCUS_33360 gene aroA 4328 3066 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973760.1 protein_id gnl|my_center|LOCUS_33360 4884 4357 gene locus_tag LOCUS_33370 4884 4357 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230942.1 protein_id gnl|my_center|LOCUS_33370 4997 5893 gene locus_tag LOCUS_33380 4997 5893 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030116.1 protein_id gnl|my_center|LOCUS_33380 >Feature sequence41 200 1234 gene locus_tag LOCUS_33390 200 1234 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_33390 1244 2128 gene locus_tag LOCUS_33400 gene mreC 1244 2128 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976189.1 protein_id gnl|my_center|LOCUS_33400 2125 2613 gene locus_tag LOCUS_33410 2125 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 2610 4673 gene locus_tag LOCUS_33420 gene mrdA 2610 4673 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_33420 4794 6146 gene locus_tag LOCUS_33430 4794 6146 CDS product ISL3-like element ISMsm4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730510.1 protein_id gnl|my_center|LOCUS_33430 >Feature sequence42 220 630 gene locus_tag LOCUS_33440 220 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 727 3162 gene locus_tag LOCUS_33450 727 3162 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804342.1 protein_id gnl|my_center|LOCUS_33450 4165 3311 gene locus_tag LOCUS_33460 4165 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 4822 4526 gene locus_tag LOCUS_33470 4822 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 4761 5057 gene locus_tag LOCUS_33480 4761 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 >Feature sequence43 1719 727 gene locus_tag LOCUS_33490 1719 727 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804972.1 protein_id gnl|my_center|LOCUS_33490 2467 1721 gene locus_tag LOCUS_33500 2467 1721 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977032.1 protein_id gnl|my_center|LOCUS_33500 3222 3114 gene locus_tag LOCUS_r00010 3222 3114 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8