COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..450121 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(52..813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(788..2149) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978948.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene cca CDS complement(2153..2707) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879646.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene thpR CDS 2864..3385 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146776.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 3404..3793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(3832..4743) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene rnz CDS complement(4750..5751) product TRM11 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020267.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(5769..6656) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978942.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS 6832..7044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(7011..7880) product nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240366.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 8136..8894 product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879698.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 8944..9252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(9271..10485) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250771.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(10642..12810) product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(12822..13322) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878792.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 13384..13803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(13739..14092) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583113.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 14202..14927 product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846184.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene alaXM CDS 15000..16910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 16984..18420 product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868372.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 18427..19761 product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249649.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 19947..21617 product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879727.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene thsB CDS 21929..22435 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878520.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(22441..23013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(23055..23612) product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742650.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(23924..24565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 24671..25006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 25081..26112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 26291..27172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 27169..27858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 28559..28753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(28951..29403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 29916..30218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 30639..32486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 33498..33767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(33837..35021) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135390550.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 tRNA complement(35060..35133) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(35145..36020) product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771929.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene garR CDS complement(36107..36526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 36817..37746 product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene ilvE CDS complement(37764..38345) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053721.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(38386..39300) product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188924.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 39612..40013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 40118..40606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 40792..41343 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250217.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 41405..41788 product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763726.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(41796..42572) product bifunctional fructose-1,6-bisphosphatase/inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879859.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene suhB CDS complement(42670..43965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(44128..47316) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763377.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene ileS CDS 47547..48236 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249618.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(48248..48724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(48708..48974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(49017..49865) product L-serine kinase SerK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868633.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene serK CDS complement(49862..50125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(50203..50955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 51017..51238 product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876456.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 52231..53484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 53579..53914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(54258..54485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(54572..54748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(54815..55096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(55293..55697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(55757..55945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 56501..56983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 57081..57296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 57605..57892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00650 note possible pseudo, internal stop codon CDS 58040..58714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 note possible pseudo, internal stop codon CDS complement(58961..60388) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229629.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 60443..60913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(61328..61516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 61750..62205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(62187..62618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(63010..64425) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392514.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 64616..65317 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(65325..66671) product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251051.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 67177..68079 product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762079.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 68076..69305 product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877345.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene porA CDS 69402..70373 product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496444.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene porB CDS 70590..72305 product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 72311..72793 product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544970.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene sdhC CDS 72797..73141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 73138..73989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(74069..74569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(74575..75735) product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878064.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(75741..75986) product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256473.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(75998..76447) product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846667.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 76811..77722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 77751..78374 product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081900.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(78321..78485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 78689..79663 product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877358.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene mer CDS 79948..80187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 80204..80782 product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878659.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 80786..81853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 81859..82200 product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876587.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 82200..84839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 84836..86227 product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 86281..86916 product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868878.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 86917..87159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 87165..87497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 87504..89549 product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878656.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(89566..90672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(90741..90974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 91243..92490 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240384.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(92487..93512) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878151.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 93695..94060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 94065..95180 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573426.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene nuoH CDS 95193..95687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 95684..95992 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056517.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene nuoK CDS 95999..97522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 97526..99592 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392500.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene nuoL CDS 99595..101076 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545185.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 101073..102500 product F(420)H(2) dehydrogenase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene fpoN CDS complement(102553..103428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 103885..104097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 104117..104455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 104499..104765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(104781..105392) product DUF996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867948.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(105480..105716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 note possible pseudo, frameshifted CDS complement(107101..107277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01180 tRNA complement(107603..107694) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 107796..108845 product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931705.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(108849..109442) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229253.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 109480..110091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 110116..111213 product di/tri-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244662.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene papB CDS 111293..112447 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978108.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 112790..113923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(113985..114713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(115063..116259) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941744.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(116270..116821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 116921..118405 product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979709.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(118418..119518) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061317.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(119630..120844) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061129.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(121365..121637) product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878567.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene albA tRNA complement(121760..121832) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(121942..122979) product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485760.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 123218..124318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 124365..125297 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876508.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 125411..125896 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763299.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(125868..126134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(126131..127021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 127417..127716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 127835..128152 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867802.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene rpsJ CDS 128270..131113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 131131..131388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(131494..132741) product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978302.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene ahcY CDS 132854..133330 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080908.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 133327..133803 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283178.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene bcp CDS 133881..134048 product 30S ribosomal protein S30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979284.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 134213..135403 product C/D box methylation guide ribonucleoprotein complex aNOP56 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156014546.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 135357..136076 product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846944.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(136350..137348) product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878493.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene radA CDS complement(137382..138677) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249710.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene asnS CDS 138768..139919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(139925..141148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(141132..141773) product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496635.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(141763..142353) product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249247.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(142241..142813) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024515.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(142839..144641) product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879530.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene rqcH CDS 144703..145023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(144937..145308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(145309..145797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 146146..146412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(146432..147319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978174.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(147376..148929) product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867477.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene pyrG CDS complement(149071..150132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 150189..153737 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867481.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene smc CDS 153715..154356 product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870645.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 154353..154901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 154941..155327 product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870178.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 155364..155681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(155808..156977) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547446.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 157162..157398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 157382..158344 product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 158375..158770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 158757..159377 product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870893.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene rrmJ CDS complement(159384..160535) product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876814.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 160745..161293 product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023327.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 161290..161976 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249756.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene rnhB CDS complement(162165..163229) product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020134.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(163311..164009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 164073..164462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(164507..165307) product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250124.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene uppS CDS complement(165294..166376) product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147160.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(166463..167338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979293.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(167453..168373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(168376..168978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 169071..169694 product DUF4443 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868435.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 170119..170613 product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869516.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 170680..171042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 171080..173644 product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142782.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 173699..174535 product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403322.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 174684..175607 product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545688.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(175696..176760) product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846612.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 176957..177220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(177280..178104) product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175220.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene lsrF CDS complement(178174..179199) product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980425.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(179236..179895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(179928..180098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 180268..181746 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460903.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene aspA CDS complement(181786..182217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 182600..183442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(184205..184528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(184622..184996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(185001..185375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 185455..186864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 186866..187519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 187516..188127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 188162..188350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 188358..190019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(189999..190550) product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868259.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(190677..191390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 191524..191817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 191872..192783 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762527.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(192734..193555) product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080966.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 193659..193916 product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011033302.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 193991..194941 product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146505.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(195219..195761) product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978320.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene endA CDS complement(195786..196439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(196598..198385) product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930711.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 198479..199087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 199136..200032 product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene cofD CDS complement(200025..200837) product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259452.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene cofE CDS complement(200868..202475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 202463..203356 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241727.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 203434..204177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 204184..204888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 204988..206142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 206143..206778 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877484.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 206825..207868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 207887..208195 product 30S ribosomal protein S26e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762572.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 208205..208507 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250445.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(208493..209059) product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868695.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene pgsA CDS 209305..209514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 209514..211277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(211270..212151) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869807.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene speB CDS complement(212235..216185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 216550..216900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 216918..217982 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249523.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 218017..219213 product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 219242..219406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 219611..220711 product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249135.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 220718..221113 product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762564.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(221322..222338) product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393433.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene galT CDS 222471..223739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 223863..224972 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228010.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene sucC CDS 224969..225868 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742632.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene sucD CDS complement(225893..227581) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249122.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(227949..229040) product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980538.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(229528..230787) product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene gdhA CDS 230983..231489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 231479..232777 product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878420.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene aspS CDS complement(232954..234192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 234318..234962 product cell division protein CdvB1/B2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979256.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene cdvB1/B2 CDS 235111..235956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 235953..237146 product cell division protein CdvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979234.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene cdvC CDS 237204..237620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(237582..238415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(238424..238963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(238953..240197) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980269.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 240269..240991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(241000..242535) product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978287.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene tgtA CDS 242733..244094 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 244144..245007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 245004..245744 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762388.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 245802..246140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(246141..246545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(246571..247830) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582434.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 247954..248577 product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979808.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 248669..250438 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978120.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 250636..251310 product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878392.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene npdG CDS 251316..251630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 251726..252586 product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(252612..253376) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762424.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(253373..253582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(253579..254025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(254025..255764) product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762425.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(255869..256111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 256251..257036 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020163.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene surE CDS 257184..257750 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(257716..258753) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847017.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 258910..259311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 259420..260349 product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 260413..261378 product thiamine-phosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846193.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 261469..262734 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980417.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 262740..264182 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880664.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene cysS CDS 264241..265356 product DUF1512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979465.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(265405..266361) product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582557.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(266371..266850) product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979561.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(266909..267730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 267945..268838 product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978312.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(268990..269538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(269444..270601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(270780..270992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 271252..271890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 271905..272171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 272269..272937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 272934..273839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 273893..274378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 274400..274912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 275004..275684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 275740..276474 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020802.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 276475..278820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(278705..279928) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868844.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 280026..281291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 281385..282491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 283131..284270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(284405..285139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(285271..286464) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761790.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(286479..288566) product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319808.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(288636..290156) product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978751.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(290153..290377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(290517..291113) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069168135.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(291148..291438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(291553..292740) product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231837.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(293030..294574) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880099.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene guaA CDS 294625..295212 product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902373.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene hpt CDS 295489..296721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 296886..297272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 297457..298488 product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868502.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene tdh CDS 298583..299017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(299023..299559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(299570..300118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 300251..302521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(302559..303164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(304091..304897) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979322.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene pyrH CDS complement(304911..305696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(305726..306331) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980108.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(306349..307134) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846712.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(307131..308168) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980107.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 308412..308987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 309092..310198 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979838.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 310188..310976 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931877.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 311036..311617 product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978534.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 311950..315651 product protease pro-enzyme activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980449.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(315793..316653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 316913..318133 product Acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245999.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 318228..318674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 318777..319445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 319587..321635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 321731..322195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(322214..322564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(322656..322847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 323203..324261 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080774.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 324340..326109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 326445..326903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(326887..327222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 327777..327968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 328013..328201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(328544..328750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(329155..330117) product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762659.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(330114..331184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 331598..332143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(332165..332608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 332704..333033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(333136..333894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(333957..334400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 334716..334976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(335039..335500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 335620..336006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(336018..336572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 336909..337091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 337160..337618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(337592..338446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(338773..342342) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979710.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 342480..343058 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978110.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(343065..343949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 344065..344505 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546746.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(344541..346505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 347053..348492 product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846364.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(348520..349809) product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869166.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 349876..351558 product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393612.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene fdrA CDS 351555..351734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(351720..352205) product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846651.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene cutC CDS complement(352202..353104) product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(353122..355572) product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869170.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(355827..356612) product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869167.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 356830..357618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(357619..358383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(358418..358792) product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978597.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(358798..359961) product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978596.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(359979..360224) product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846902.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 360512..361486 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763084.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 361483..362694 product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763080.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 362733..363680 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980414.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene rbsK CDS 363840..365735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 365722..366450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 366447..367043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(367036..369879) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762372.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 370080..370991 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925117.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 370969..371349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(371368..371778) product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879707.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene mce CDS complement(371779..372168) product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146517.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 372295..373257 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240546.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 373422..374339 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229489.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 374404..376125 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979131.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 376194..377591 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040627.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 377757..378272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(378594..379631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 379755..380696 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583661.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(380720..381706) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978683.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 381936..383363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 383465..384604 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229031.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(384634..387036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(387234..387662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(387672..388184) product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878466.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 388327..389070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 389077..390522 product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979726.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 390519..390776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(390771..391952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 392076..392885 product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249248.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 392882..393316 product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020176.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(393306..393749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(393880..394554) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(394717..395223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(395343..397139) product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(397234..398766) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980566.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(398845..400281) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583195.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene proS CDS complement(400401..400574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(400665..401378) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979662.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 401499..401927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 402044..404494 product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974204.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(404574..404957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(404995..406416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 406515..408305 product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846917.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 408377..410281 product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene glgB CDS complement(410332..410841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 410913..411734 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846813.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 411771..413462 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979769.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(413687..414448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(414505..415743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(415765..416850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(416966..418498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(419310..420626) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978848.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 424090..424347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 424412..424633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 425192..425893 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545742.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(426227..426658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(426658..426936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 427355..427507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 427535..427918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 428008..428643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139679809.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 428640..428873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 tRNA complement(428854..428930) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 429024..429653 product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392225.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(429656..430003) product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979093.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 430093..431775 product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978316.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene glyS CDS complement(431900..433231) product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888344.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 433338..433778 product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398443.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene mntR CDS complement(433749..434561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(434668..435375) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250639.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(435476..436954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(436951..437961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 438093..438509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(438500..438997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(438994..439470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(439739..441679) product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869511.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene gatE CDS complement(441681..443012) product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867819.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene gatD CDS 443209..444393 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142358.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 444529..445383 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980458.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 445380..445721 product DUF1634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980460.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 445982..447292 product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146906.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene rbcL CDS 447376..448872 product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478630.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene pckA CDS 449013..449204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 sequence02 source 1..336978 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1079..2356 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980072.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 tRNA complement(2968..3043) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(3686..5299) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878921.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene pheT CDS complement(5320..6732) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879447.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(6819..7319) product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061166.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 7445..8344 product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250134.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene map CDS complement(8328..8528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(8542..9663) product DUF1512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979465.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 rRNA complement(9748..9855) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 CDS 10042..10287 product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867737.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 10296..13664 product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250034.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 13675..17487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 17491..17823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 17842..18315 product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876680.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 18361..18810 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876681.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 18834..19427 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978220.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 19463..21433 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 21521..22834 product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978219.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene tuf CDS complement(22968..23873) product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742683.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 24440..25000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 26242..27081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 27160..28314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 28314..28955 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228039.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene ftsE tRNA complement(29500..29573) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 29819..30871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(30855..31979) product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879173.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene truD CDS complement(31995..32375) product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251250.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene pth2 CDS complement(32420..33043) product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384435.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 33182..34327 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061129.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 35366..35644 product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021485.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 35700..37868 product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429724.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 37930..38169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 38194..39219 product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250232.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene fen CDS 39224..39883 product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879811.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 40090..40329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 40370..40783 product HTH-type transcriptional regulator LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978132.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene lysM CDS 40884..41153 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979253.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(41260..41586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(41583..42128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(42158..42580) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868849.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 42579..43616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 note possible pseudo, frameshifted CDS 43613..44242 product Kae1-associated kinase Bud32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249630.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 44300..44812 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762369.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 45006..45455 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978348.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 45469..46872 product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064974.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 46874..47125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 47125..48396 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868451.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene serS CDS 48487..49116 product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978426.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(49103..50302) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978424.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 50335..51678 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496570.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 51719..52630 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146653.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(52681..53586) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978840.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 53912..54238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 54321..54932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(54916..55569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(55719..56378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(56391..56993) product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978284.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene psmB CDS complement(57087..58031) product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762505.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene rtcA CDS 58205..58747 product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868691.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 58793..60835 product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980573.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 60884..62071 product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061314.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 62567..63403 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870336.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(63406..63843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 63987..65204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(65270..65755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(65925..66971) product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978305.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 67238..67852 product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876826.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene psmB CDS 67864..69783 product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876827.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(69795..70850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(71023..71316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 71626..72168 product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147114.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(72160..72645) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763381.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 72731..72988 product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846912.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 73231..73884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 73895..74590 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192848.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene rpiA CDS 74623..75642 product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877133.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(75683..76558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(76579..77082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 77231..77701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 77995..78522 product hydrogenase 3 maturation endopeptidase HyCI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546218.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 78519..78863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 78860..79297 product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546559.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 79298..79756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 79749..80987 product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937737.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 80993..81952 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573431.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene nuoH CDS 81958..82353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 82343..82825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 82822..83142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 83139..84863 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene nuoL CDS 84860..86302 product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003041292.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 86353..86670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(86675..87394) product DUF6390 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894094.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(87418..87696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(87807..88973) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879506.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 89169..89441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 89920..92292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(92276..92692) product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889277.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 93113..93694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 93900..95084 product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881185.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 95074..95493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 95496..96431 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147080.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(96445..97074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(97087..97404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 97601..97876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 97990..98562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(98753..99946) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830888.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 100093..100434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 100556..101065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(101545..102135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(102350..102967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 103028..103792 product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805196.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(103779..105344) product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 105629..106060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 tRNA 106151..106227 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(106478..106843) product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545148.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(107017..108180) product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131688.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene gtdA CDS 108388..110736 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259305.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(110779..111939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 112081..112575 product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846892.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene cutC CDS 112598..113413 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727461.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 113477..114241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 114234..115007 product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213853.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene ssuC CDS complement(115063..116085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(116203..117672) product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868839.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene eutA CDS complement(117778..118872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 118977..119531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 119532..120152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 120257..121228 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807628.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 121248..122267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 122331..123143 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943778.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 123167..124081 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240519.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(124106..124330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 124511..125302 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(125307..126476) product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(127322..127744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 129345..129791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 130128..130499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 130610..130912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 130912..131637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 131634..131846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 131843..132814 product UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884438.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 132826..134151 product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250183.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 134401..135279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 135276..136265 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990845.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 136265..138427 product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924817.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 138440..139411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 139408..140304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 140285..142033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 142034..144253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 144250..144624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 144693..145772 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868579.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 145780..146730 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 146693..147886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 147862..149112 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022158.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 149113..150069 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 150078..151400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 151378..152499 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 152496..154106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 154106..158434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 158666..159247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 159350..160450 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250274.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 160477..164364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(164383..167997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 168254..168874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 168892..169983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 170098..170913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 171092..171967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 172266..172769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 172856..174193 product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064256.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 174190..174927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 174931..176331 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868281.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 176375..177061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 177368..177997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(178214..179203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 179442..179915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 180099..180425 product DUF4364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978761.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 180660..181106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(181151..181453) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978640.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 181842..183308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 183424..184572 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868366.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 184566..185894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 186020..187084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 187088..187843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 187840..188094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 188180..189133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 189123..190076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 190091..191485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 191475..192632 product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978258.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 192667..192912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(192926..193633) product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444475.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 193816..195171 product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 195281..195709 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978449.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene moaC CDS 195706..196230 product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762932.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(196210..196563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(196565..197305) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249696.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(197306..198154) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877312.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(198145..198984) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867495.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(199233..200267) product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870502.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(200273..200653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(200650..200907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(200885..201097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(201081..201914) product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867735.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene rrp42 CDS complement(201915..202643) product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867734.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene rrp41 CDS complement(202648..203400) product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876323.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene rrp4 CDS complement(203401..204090) product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762590.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(204226..204867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(204947..205678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(205724..206455) product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877997.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene psmA CDS 206585..207652 product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080652.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene mtnA CDS 207694..208347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(208364..208801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 208947..209273 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902485.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(209257..209844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 210108..211367 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 211501..212583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 212610..213095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(213217..213495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(213555..213830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 213741..215702 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618845.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(215713..217707) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234782358.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(217792..219378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(219759..220523) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763033.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene deoC CDS complement(220645..222096) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(222284..222628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(222747..224192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979730.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(224189..225097) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979801.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(225188..225553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 225934..226236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 226233..226679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 226806..227084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(227248..227667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(227754..228782) product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842311.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 228894..230549 product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879525.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(230649..232124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(232136..233458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(233736..235061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(235139..235699) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469482.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 235803..237611 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(237677..238513) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941492.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 238982..239581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 239660..240001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(240288..240767) product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388912.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene kdpC CDS complement(240773..242872) product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943118.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene kdpB CDS complement(242945..244603) product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638330.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene kdpA CDS complement(244662..244979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(245118..246074) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243771.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 246405..246599 product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979944.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 246865..248553 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229182.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 248554..250110 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015590753.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(250264..250656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(250663..251442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(251442..251939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(251943..253004) product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979941.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(253007..254317) product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846995.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(254320..255084) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880210.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 255226..255603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 255609..256046 product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881076.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 256072..256719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(256786..257190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 257523..257879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(257921..260410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 260633..262093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 262319..262741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 262867..263631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 263635..264102 product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879165.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene aprB CDS 264099..265943 product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879166.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene aprA CDS 265970..267124 product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868287.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene sat CDS complement(267153..267359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 267905..268840 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259143.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(268866..270659) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979987.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(270672..271730) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846673.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(271738..273126) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156015092.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(273291..274328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(274461..275378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(275503..276477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(276826..277068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(277065..279128) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861457.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(279248..279880) product TRASH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249785.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 279956..280123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(280167..280865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 281114..281719 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 281817..282995 product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141490.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 283289..284821 product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978681.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(285073..285423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07390 note possible pseudo, frameshifted CDS complement(285420..286142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 note possible pseudo, internal stop codon, frameshifted CDS complement(286170..286448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07410 note possible pseudo, internal stop codon CDS complement(286718..287122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 287173..288078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 288141..289754 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980566.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 289916..291016 product muconate/chloromuconate family cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206897.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 291083..292213 product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704492.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 292217..293167 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978653.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(293195..294004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013597.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(294234..295598) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455014.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(295709..297337) product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(297437..298597) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925160.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(298594..300078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 300335..301066 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089550.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 301189..302574 product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083638.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(302558..303550) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879161.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene ala CDS 303897..305258 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483346.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(305367..305777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 305983..306882 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055428724.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(306872..308746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(309130..310074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 310188..310919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 310977..313208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 313257..314114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(314336..314863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 315357..315752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 315850..316320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 316324..316809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 316814..317398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 317420..318169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 318232..318474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 318471..320369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 320370..321356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 321470..322393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 322446..323408 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 323405..324652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 324659..325285 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 325372..326544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 326562..327188 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223962128.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 327226..327423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 327470..327802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 327840..328538 product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356970.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene fsa CDS 328829..329368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 329384..330301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 330348..331343 product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 331347..332048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 332144..333094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 333100..333990 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729564.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 333987..334907 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548187.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene galE CDS 335136..335639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 335646..336560 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878124.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 sequence03 source 1..222589 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(566..2704) product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839420.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 3127..3888 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251231.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 3885..5447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 5526..8378 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020807.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 8587..9573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 9702..9986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(9993..10304) product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846979.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 10443..11837 product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868897.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene gcvPA CDS 11839..13380 product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868896.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene gcvPB CDS 13500..14432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(14453..14782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 14995..15348 product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877371.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 15356..15664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 15726..16037 product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869944.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene eif1A CDS 16034..16822 product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060945.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 16819..17382 product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249751.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 17513..19057 product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979316.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 19026..21614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 21685..21879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 21881..22855 product L-myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846748.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 23598..25145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(25239..25862) product NAD(P)H-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082483.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 26066..27742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(27766..28233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 28482..30065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 30202..30663 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867606.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 30803..32293 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979431.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene glnA CDS 32349..33926 product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243454.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene pruA CDS complement(33959..35260) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763576.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(35330..36301) product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229044.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(36291..38219) product 2-oxoacid:ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980386.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(38249..38629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 38736..39650 product NAD-dependent malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762366.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene mdh CDS complement(39676..40155) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763400.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(40171..41535) product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763417.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 41632..42807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 42804..43901 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048184.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 43885..45579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(45836..46444) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763732.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 46575..47135 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761840.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 47299..48927 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391946.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 48939..49745 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391947.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(50260..50733) product AAA-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980406.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(50801..52204) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256756.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 52335..54152 product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878912.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 54258..55361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 55414..55914 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978207.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene rimI CDS 55916..57556 product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320246.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 57794..58591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(58588..58812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(58920..59534) product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979489.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene pdxT CDS complement(59531..60499) product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979488.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene pdxS CDS complement(60599..61579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 61728..62189 product azlBCD operon transcriptional regulator AzlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399001.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene azlB CDS complement(62216..63166) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868005.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene arcC CDS 63401..64090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 64137..65765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(65824..66075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(66106..66444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(66441..66629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(66716..67222) product GTP-dependent dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868805.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(67223..67411) product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023600.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(67404..68006) product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869896.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene rpoE CDS complement(68126..68518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(68508..69752) product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496772.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(69803..70222) product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763318.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 70322..71128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(71089..71271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(71314..73200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(74664..75065) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene ndk CDS complement(75062..75256) product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978232.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(75564..75779) product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978233.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(75796..76194) product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240293.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene rpl7ae CDS complement(76312..78078) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867608.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(78088..79077) product short chain isoprenyl diphosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875690.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene idsA CDS complement(79085..80146) product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875688.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene fni CDS complement(80143..80901) product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762949.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(80889..81764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(81825..82502) product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875685.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene amrB CDS complement(82663..83328) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762850.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene rpsB CDS complement(83411..83641) product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867658.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(83739..84896) product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980299.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(84880..85398) product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846746.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(85388..85909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(85906..86511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 86912..88732 product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143530.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(88846..89556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(89777..90193) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061175.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(90190..90669) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250452.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene rplM CDS complement(90629..90970) product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762450.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(90997..91644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(91651..92064) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867653.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(92064..92561) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867652.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(92568..93014) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980145.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(93288..94238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 94393..96150 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867349.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene glmS CDS complement(96161..97330) product aconitase X catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250200.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(97342..98187) product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250430.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene udp CDS complement(98688..99695) product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869643.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(99692..100267) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978376.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(100285..100791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(100969..101550) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146533.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(101537..102976) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978380.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene secY CDS complement(102983..103414) product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869978.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(103470..103934) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867442.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(103942..104574) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978383.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(104592..105206) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763591.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(105216..105659) product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763590.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(105656..106048) product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867446.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(106055..106618) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867447.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(106608..107000) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867448.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(107016..107180) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250478.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(107186..107722) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762516.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(107732..108466) product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875657.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(108466..108855) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867452.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene rplX CDS complement(108848..109282) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867453.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(109315..109644) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846880.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(109641..109880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(109877..110086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(110073..110729) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875650.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(110730..111194) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875649.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene rplV CDS complement(111297..112067) product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867465.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 112227..112595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(112603..112986) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867460.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene rpsS CDS complement(113016..113765) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867461.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(113781..114047) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867462.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(114057..114845) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875645.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene rpl4p CDS complement(114845..115828) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879418.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene rpl3p CDS 116165..117706 product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249656.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene gapN CDS 117905..118426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 118480..118677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 118740..119699 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978799.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 119712..119906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(119907..120608) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966429.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 tRNA 121192..121283 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 121515..122837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(122859..123668) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 123769..124329 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081583.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene apt CDS complement(124372..125139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 125271..126464 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878825.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 126490..127920 product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878367.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 127863..129230 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878369.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 129374..129925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 130029..130607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 130886..131254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 131556..132944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 132957..133595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 133544..134482 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241141.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(134753..136036) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980484.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 136179..136661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 136757..137005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(137035..137418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(137801..138034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 138186..139058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 139062..139742 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256391.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(139825..141012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(141083..142030) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979837.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(142041..143054) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979838.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(143051..143626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 143805..144536 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(144507..145673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(145730..146320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(146325..147938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 148043..149641 product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812078.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene spoVB CDS 149733..150320 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229800.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(150464..150850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978746.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 151026..151337 product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249128.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 151565..152941 product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186205.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 153144..153647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(153674..154774) product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761873.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(154928..156505) product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877864.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(156502..157872) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022374.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 158069..158842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 159347..159538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(159566..160672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(160669..160950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 160834..161352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 161401..162240 product G1 family endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228226.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(162758..163717) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 163719..165752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(165804..166382) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980595.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 166716..167759 product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528955.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(167865..168800) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970215.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(168797..169825) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878388.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(169827..171410) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948025.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(172049..172891) product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870112.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(173169..174377) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978005.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(174340..174849) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978007.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 174960..176114 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064882.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 176202..177581 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240446.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 177630..178505 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 178538..179509 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807650.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 179506..180258 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921642.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 180255..180986 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 181009..182238 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877874.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 182560..183777 product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861718.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 183774..184508 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434222.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 184535..185158 product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391283.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene bluB CDS 185165..186136 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064134.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 186137..186967 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545272.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(186968..187852) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(187990..188967) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257499.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(189050..190786) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970501.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 190940..192022 product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244980.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene ykfB CDS 192298..193596 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023306.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(193643..196420) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879008.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 196464..197609 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742140.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(197827..198192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(198189..198971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(198973..199260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(199253..199615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(199852..201306) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203961.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 201764..202975 product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762231.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(203023..203931) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762228.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(203936..205051) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249610.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(205026..206558) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249609.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 206663..208003 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(208334..208945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 209372..210232 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583989.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene pheA CDS complement(210385..210717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(210814..211053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 211254..212411 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979804.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(212742..214037) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257052.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene purB CDS complement(214027..215241) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880823.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(215244..216557) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881325.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene guaB CDS 216990..217286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 217299..217526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 217647..218129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 218136..218600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 218605..219363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(219701..219949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 220805..222076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 sequence04 source 1..148108 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(688..978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(986..1291) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(1374..1955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(2249..2665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(2675..3430) product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878746.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(3699..4151) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878779.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene trxA CDS complement(4311..5030) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583126.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(5050..5337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(5513..6463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847040.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 6619..6798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 6868..7572 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892625.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(7622..7834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(7837..8403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(8791..9837) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730143.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(9876..10625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 10790..12085 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103412.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 12728..14086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 14194..14646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 14739..15242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(15349..17196) product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403165.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(17193..18611) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978976.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(18611..19315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(19524..21299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(21415..21864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 22006..23157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(23263..23661) product DUF2203 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881169.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 23886..25676 product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584026.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 25669..26529 product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256841.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 26539..26829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(26836..27171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(27294..27785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 28270..28770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(28855..29712) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971159.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 30673..31299 product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978815.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(31336..31839) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228850.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(31841..33883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(33884..35134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(35156..35677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 35709..36323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 36780..38237 product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762961.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 38283..38861 product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496827.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene endA CDS 38869..39714 product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274369.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 39716..40921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 40927..41631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(41606..42796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(42868..45039) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868004.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 45158..45733 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880118.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(45770..46039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(46142..48601) product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065536.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(48829..54069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(54077..54625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 55197..55778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(56078..56830) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763691.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(56827..57747) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053639.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(58017..58823) product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763052.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 58976..59185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(59327..59605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(59927..61927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 62668..62973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 63303..64655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 64661..65488 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173997.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 65485..66300 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315797.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 66297..67283 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867312.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 68886..69743 product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020646525.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 69806..71023 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979972.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 71242..72213 product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978451.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 72210..73466 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868795.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene hisS CDS complement(73478..74689) product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228352.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(74722..75528) product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528003.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene paaG CDS complement(75533..76312) product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256011.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(76335..77174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 77315..78334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(78342..79778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 79816..81507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 81987..83156 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 83343..84908 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246447.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 85871..86206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(86474..87733) product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022104.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(87730..89832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(90266..90421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 90469..90756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 90936..94958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 96065..96403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 96809..98749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(98863..99090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(99095..99526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(100329..100964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(101081..101746) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980308.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(101891..102919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225204.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(102916..103131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 103198..103650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 103788..104429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 104581..105345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(105440..106309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(106372..107604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(107677..108903) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250397.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(108900..109844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(110023..110466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 111135..111512 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173512.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(111582..112481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(112600..113739) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082450.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 113991..116459 product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 116456..116833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(116895..117812) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763004.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 118000..118956 product bifunctional 2-dehydro-3-deoxygluconokinase/2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980563.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene kdgK CDS 118953..119840 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289156.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(119894..120169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(120132..120698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(120900..121175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(121320..122156) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042382595.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 122511..123602 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228259.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene menC CDS complement(123599..123976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 124208..125620 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(125597..126022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 126271..127473 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246392.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(127487..128338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(128597..128992) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940795.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(129035..129421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 129667..131478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 131693..132487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 132675..132959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 133336..134154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 134389..135561 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879390.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 135661..136620 product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980430.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene htpX CDS 136750..138426 product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879727.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene thsB CDS 138570..138962 product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879687.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 138910..139509 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256875.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(139586..140812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 140901..141635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 141705..143225 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257475.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(144052..144753) product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729288.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene pqqC CDS complement(144750..146546) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229128.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(146550..147551) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681411.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 sequence05 source 1..147869 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 246..374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 tRNA complement(858..935) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 1106..1729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 1739..3112 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868348.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene glmM CDS complement(3119..3295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(3382..4356) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066048.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene thiL CDS complement(4353..5657) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877965.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene glmM tRNA complement(5754..5829) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 6006..6093 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 6313..6666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 6638..7066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(7166..7411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(7518..8201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(8437..10125) product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene polX CDS complement(10190..11767) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156014205.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(11764..12507) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979123.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene fabG CDS complement(12552..12932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(12929..14035) product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979124.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(14234..15676) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589538.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 15804..16379 product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979589.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 16436..17986 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903114.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 17996..19519 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020720.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 19506..19994 product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789540.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(20003..21016) product acryloyl-coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978456.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(21075..23933) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879908.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene leuS CDS complement(23988..26717) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762670.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene alaS CDS 26942..27325 product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876242.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 27388..27789 product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979712.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(27794..29371) product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289376.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 29917..30378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 30375..31055 product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763579.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(31056..32054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(32089..32946) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249796.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 33024..33770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 33777..34772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(34756..36159) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065480.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene glmM CDS complement(36187..36735) product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(36967..38697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(39124..40089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(40778..41899) product [LysW]-lysine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888052.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(41903..43096) product acetylornithine/succinylornithine family transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877594.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(43089..43898) product [LysW]-aminoadipate/[LysW]-glutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978133.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(43908..44963) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762032.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene argC CDS complement(44965..45822) product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene lysX CDS complement(45833..46006) product alpha-aminoadipate/glutamate carrier protein LysW/ArgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978131.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene lysW/argW CDS complement(46006..47472) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875908.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene argH CDS complement(47469..48671) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167827706.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 48740..49459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 49677..50945 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980446.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 51000..52562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 52796..54067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 54094..54660 product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020756.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 54778..55539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(55720..56454) product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867607.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 56552..58108 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980566.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 58121..59116 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035552.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 59237..59602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 60649..62616 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066875.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(62622..63377) product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268058.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 63890..64120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 64183..64860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 64853..65191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(65478..66020) product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847016.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene yjjX CDS complement(66119..67147) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846488.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(67144..68763) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979152.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(68760..69551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 69984..70511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(70535..71902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 71976..73226 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258527.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 73324..74223 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846488.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(74393..75586) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846343.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(75583..76212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 76337..76846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(76848..78332) product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846351.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 78402..79118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 79137..79496 product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 79731..80699 product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272642.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene ilvA CDS 80728..81102 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(81092..82255) product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877916.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(82252..83553) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene lysA CDS complement(83546..84718) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876437.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(84715..85521) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene dapB CDS complement(85514..86587) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081879.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene dapA CDS complement(86651..87229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 87402..87797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(87739..88233) product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(88209..89948) product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 90027..91034 product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867373.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene meaB CDS complement(91031..92284) product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966033.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(93025..93303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(93552..94031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(94220..94447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(95143..96057) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980282.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 tRNA 96183..96273 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 96604..97602 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878432.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(97627..98589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(98989..99381) product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762335.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(99443..99844) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944306.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 99903..101114 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763168.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 101134..101910 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762508.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 101907..102863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 103008..104618 product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181877.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 104628..105809 product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763169.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 105806..106324 product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978019.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(106329..107513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(107513..107866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 108060..109919 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240475.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 109922..110362 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080780.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene cdd CDS 110379..111179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(111189..112328) product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(112356..113066) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485759.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(113066..114238) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382128.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(114430..114858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 tRNA complement(115007..115091) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(115214..115459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(115611..116420) product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867617.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 116639..116917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(116907..117962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(117972..119153) product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879392.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene dnaG CDS complement(119247..119606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(119870..120649) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene fabG CDS complement(120684..121253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(121317..122378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 122902..124071 product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068577384.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 124167..124514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 124511..125923 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene moeB CDS 126065..126955 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979100.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 127261..129840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 129837..130028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(130095..130295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 130431..132554 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979927.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 132556..133383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846787.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 133478..134017 product DUF1404 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978076.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(134260..134679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 135077..135451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 135633..136094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(136295..137119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 137241..137453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 repeat_region 137964..138364 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccttcaacgaagccataaccttttggttatggagac CDS 138623..141151 product type I-U CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930412.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene cas3u CDS 141138..141953 product type I-U CRISPR-associated protein Cas8c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940730.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene cas8c CDS 141987..143093 product type I-U CRISPR-associated RAMP protein Csb1/Cas7u inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940731.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene cas7u CDS 143094..144527 product type I-U CRISPR-associated protein Csb2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940732.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene csb2 CDS 144548..146197 product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene cas1 CDS 146202..146492 product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387937.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene cas2 CDS complement(146578..146952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(146858..147301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(147298..147510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 sequence06 source 1..92612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..578 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876071.1:TIGR00289 family protein locus_tag LOCUS_12970 CDS 571..1896 product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867603.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 2713..3042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 3176..3379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 3385..3726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 3848..4417 product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867500.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 4408..5160 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990848.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene rsmA CDS 5157..5699 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867555.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 5816..6508 product TrmJ/YjtD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877451.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(6513..7694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 8013..8429 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846759.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 8422..9441 product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876932.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene dph2 CDS 10224..10517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 10517..10858 product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870659.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(11211..11876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(12529..13533) product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080192.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(13795..14172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(14420..14776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 tRNA 15053..15126 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 15528..15866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(15932..16447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(16444..16881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 17087..17509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(17515..18720) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090011.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(18772..20154) product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475806.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(20534..20941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 note possible pseudo, internal stop codon CDS 21587..22024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 22793..23350 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986565.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(23352..24125) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061277.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(24122..24901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(24898..25842) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250095.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 26012..27427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 27530..28678 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 28675..28980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 29091..30359 product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 30425..31249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 31308..31529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 31848..32753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(32871..33572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 33948..34385 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868810.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 34488..35780 product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(35826..36254) product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942008.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 36420..36737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(36807..37679) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870010.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(37685..38341) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878987.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(38338..38838) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867125.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(38915..39376) product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869871.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(39377..39556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 39814..40731 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584136.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene argF CDS complement(40709..41617) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867626.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene ftsY CDS complement(41622..42062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(42075..42755) product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496375.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(42798..43322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(43502..43786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 44778..45305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 note possible pseudo, internal stop codon, frameshifted tRNA 45449..45526 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 45938..46153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 46408..46587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(47586..48062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(48434..49012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(49822..51030) product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014128488.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(51100..51414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 51567..52136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(52509..52853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(52908..53483) product DNA protection during starvation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144276.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene dps CDS complement(53779..54147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(54265..54720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 54961..55719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 56562..57446 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064254.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 57674..59734 product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868544.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene topA CDS complement(59729..60268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 60414..60629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(60758..63118) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762768.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(63175..64428) product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876511.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene prf1 CDS 64475..65155 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979322.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene pyrH CDS complement(65379..66011) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 66012..67430 product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877017.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(67440..68648) product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250852.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(68929..69111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 69111..69536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(69549..70064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(70140..70586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 70746..70898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 70906..71640 product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868227.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 71666..74992 product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879218.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene polC CDS complement(74978..75973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13800 note possible pseudo, frameshifted CDS complement(76096..76341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(76831..77163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 77309..78529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 78648..80009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(80006..82144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(83003..83854) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060997.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(84307..84687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 85201..85470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 85534..85968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 86021..87223 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970459.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(87463..88497) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980491.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(89526..89993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 90071..90376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 91310..91498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 sequence07 source 1..84801 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(35..517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 1378..4296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(5047..5382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(5725..6708) product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980518.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(6698..8644) product 2-oxoacid:ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980386.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(8792..9223) product zinc-containing ferredoxin Zfx1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978102.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene zfx1 CDS complement(9230..9673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(9816..10826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979645.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 10898..11506 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976893.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(11608..12789) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899055.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(13132..14487) product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860267.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(14484..15059) product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031813.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(15043..15891) product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958565.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(16046..16321) product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256599.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 16795..17433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 17437..17757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 17826..18971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257446.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(19186..19617) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838707.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 20440..21336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(21537..22523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(22659..23123) product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967591.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(23194..23853) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096121.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(23938..24564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 24704..25282 product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021972.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(25266..25784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(25781..27037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(27092..28105) product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063658.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(28159..28875) product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969195.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene narI CDS complement(28862..29407) product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814217.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene narJ CDS complement(29404..30990) product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692685.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene narH CDS complement(30980..34525) product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729064.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(34774..35421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 35666..36118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 36258..37475 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978775.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 37632..38153 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583273.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(38185..39762) product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416707.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene hutU CDS 39920..41173 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887529.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene hutI CDS complement(41175..42650) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243255.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene hutH CDS 42719..43684 product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243908.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene hutG CDS complement(43715..44554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 44924..46843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(46994..49519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(49681..50013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(50035..50520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 50577..50987 product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876368.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 50989..52152 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870637.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene hflX CDS complement(52141..52713) product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053622.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 52751..53299 product transcription factor E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250974.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene tfe CDS complement(53282..53863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(53860..54144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 54316..54900 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene msrA CDS complement(54897..55943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(56002..56940) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 57243..57968 product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023615.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 58196..59056 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940835.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene dapA CDS complement(59138..60385) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065179.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene eno CDS complement(60652..61065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(61049..61297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 62140..63324 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980657.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 63430..64854 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584142.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene pyk CDS complement(64890..66200) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938066.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 66370..67434 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141167.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 67668..68486 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020163.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene surE CDS 68617..69501 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763484.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 69564..70379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(70388..71542) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392413.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene metK CDS 71754..71954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(71972..73261) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528603.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 73962..75539 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808651.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene ggt CDS 75617..76117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(76157..76663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 76818..77366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 77378..78871 product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023687.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene gltA CDS 79037..79276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 79233..79637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 note possible pseudo, frameshifted CDS 80044..80967 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256181.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 80964..81710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(81852..82043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 82244..82507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 82729..83781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 sequence08 source 1..69980 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 633..3488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(3571..3924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 4017..4946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 4975..5556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 5929..6963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 6953..7924 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978966.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 7984..9075 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene wecB CDS 9215..10543 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762251.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 10540..11169 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403266.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(11619..12776) product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878467.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(12783..13898) product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081868529.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(14266..15165) product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209658.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(15174..15698) product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868109.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene pxpB CDS complement(15892..16683) product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731005.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(16744..17508) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867271.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(17596..18810) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061074.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 19242..19691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 19747..20751 product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014745580.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 20893..21900 product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013682815.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 22037..22675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 22713..23201 product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(23194..23868) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545344.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(23914..24228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(24304..24753) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546540.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(24817..26004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(26042..27304) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061271.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene pgk CDS 27424..27858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 27877..28161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 28166..28393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(28415..28591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(29121..29459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 29719..33081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(33270..33560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(33557..34669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 34940..36676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 36681..37682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 37687..38220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 38217..39512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 39509..41488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 41489..44296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 44343..45053 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877951.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 45050..46948 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250186.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 47012..48013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 48010..48774 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532061.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene gph CDS complement(48752..49447) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868855.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene tpiA CDS complement(49434..50564) product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846263.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene fbp CDS 50901..51431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 51483..52313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 52341..53291 product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892274.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(53315..53926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 54148..54735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(54841..55563) product DUF981 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979588.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 56105..56686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 56891..57430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 tRNA complement(57545..57636) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(57708..57887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 58408..59550 product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980340.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(59535..60293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(60284..60715) product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761848.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(60730..61863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 62205..62594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(62622..62960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 63194..63487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 63514..64191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 64166..64450 product archaellum operon transcriptional activator EarA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878956.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 64644..65945 product UDP-sulfoquinovose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846779.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene agl3 CDS 66025..67077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 67170..68273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 sequence09 source 1..59715 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 1..79 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(115..522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(852..1637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(1898..3322) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979769.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(3565..4500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847040.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(4487..4873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(5106..6920) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979769.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(7075..7224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 7330..7593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 7590..8651 product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223900.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(8856..9224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 9308..9430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 9615..10523 product EF-Tu/IF-2/RF-3 family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869822.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(10503..11726) product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405266.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(11998..12264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 12406..13275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 13330..14394 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876434.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene asd CDS 14558..15376 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259324.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(15377..16036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 16101..17192 product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979564.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene amrS CDS complement(17222..17506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 17781..18908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 18901..20214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 20332..20598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 20595..22280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(22407..22877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS 23049..24929 product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(24932..25345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 25465..25776 product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074197.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 25791..28547 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228149.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene acnA CDS complement(28697..29122) product zinc-containing ferredoxin Zfx1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978102.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene zfx1 CDS 29873..31942 product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 32092..32529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(32753..33043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(33056..33412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(33427..33840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(33958..34320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(34344..35105) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357819.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(35164..35310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(35393..35971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(35989..37647) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879805.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(37807..38655) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545000.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene tatC CDS complement(38707..38943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(39069..39626) product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250601.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(39695..40252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 41313..41447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 41454..41654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 41763..42671 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808204.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 42668..43516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(44108..45889) product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000371.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(46640..48607) product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525144.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 49562..51400 product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895174.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 51400..52527 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080048.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(52557..53471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(53566..55449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(55565..56074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(56076..56609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(56597..57118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(57600..58829) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878822.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(58966..59448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 sequence10 source 1..59369 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(991..2289) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061037.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene glyA CDS 2536..3603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 3648..5048 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807812.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(5095..6297) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142523.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(6350..7006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(7031..7477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(7658..8584) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene pyrB CDS complement(8644..9528) product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540892.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(9756..12098) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257971.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(12205..13593) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455014.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(13714..15495) product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392001.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene ade CDS 15512..15712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 15764..16195 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761914.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(16199..17584) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978631.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(17649..17996) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392444.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene trxA CDS 18189..18512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 18726..19346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 19648..20424 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228949.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene sufC CDS 20490..21893 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259322.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene sufB CDS 21917..23146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 23215..24450 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 24447..24878 product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(25028..25309) product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978435.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 25431..25772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(25788..27302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 27377..28246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 28275..29582 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867468.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(29596..29988) product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868733.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(29993..31381) product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870644.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 31561..33342 product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868460.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 33524..34048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(34032..34391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(34401..35147) product proliferating cell nuclear antigen (pcna) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762193.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene pcn CDS 35248..36393 product DNA primase small subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978939.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene priS CDS 36483..37151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 37148..37429 product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978937.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 37503..37703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 37700..38479 product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867969.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(38645..40864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(40910..41317) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146698.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene gcvH CDS complement(41304..42428) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082884.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene gcvT CDS 42482..43255 product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023428.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene cofE CDS complement(43227..43910) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880570.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 44048..44875 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880570.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 44916..46565 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762101.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene metG CDS complement(46562..46993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 47087..48085 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene trxB CDS complement(48054..49172) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066563.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene dinB CDS complement(49874..50071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(50242..50505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 51304..51684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 51692..52837 product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393695.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene arsB CDS 52838..53263 product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 53591..54424 product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989337.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(54421..55629) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003041753.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 56087..57172 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868111.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 57330..57581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 57560..57880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 57979..59040 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867726.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 sequence11 source 1..56119 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1221..1532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 1639..2748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(2831..3130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 3539..4651 product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994047.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene pepQ CDS 4697..5431 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978977.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 5501..6343 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868130.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 6471..7871 product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene gndA CDS 7878..8987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(8995..11337) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257971.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(11392..12618) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978898.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(12730..12936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(12933..13598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 13767..14603 product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(14630..16585) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762026.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene acs CDS 16758..17663 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546124.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene moaA CDS 17670..17930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 18053..18481 product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232367.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 18560..19765 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(19861..20688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846484.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 20782..22185 product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979132.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene hydA CDS complement(22204..23541) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979128.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(23597..25087) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257638.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(25130..25738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(25731..27014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(27019..27963) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(27965..28453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(28450..29211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(29478..30338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(31578..31739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(31833..32126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 32507..34603 product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023776.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 34654..35202 product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878776.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 35277..36929 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338336.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 37022..38179 product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762413.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 38187..38495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(38479..39171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 39227..39946 product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169713.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 40001..40663 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763370.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene upp CDS complement(40779..42083) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978901.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(42101..43816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(43819..44523) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 44580..44789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(44906..45337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(45318..45581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(45896..47131) product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256214.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(47244..47903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(47952..48287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 48368..49645 product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763075.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 49794..51605 product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146933.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 51621..52478 product tRNA (guanine(37)-N1)-methyltransferase Trm5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867861.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene trm5b CDS complement(52473..53051) product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762930.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(53067..53585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(53697..53975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(53982..54200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 tRNA 54334..54410 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 54555..54698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(55133..55336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(55493..55762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 sequence12 source 1..46872 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(924..1556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 2141..2869 product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080184.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(2890..4338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(4735..5307) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111108.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 5495..6967 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256756.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 7084..7413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(7598..8575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(8809..9678) product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970212.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(9715..11100) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978087.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(11280..11690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(11790..12227) product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 12475..13467 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091562.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 13464..14246 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene fabG CDS 14264..15445 product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816570.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 15493..16500 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 16590..17936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 18009..18980 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene cysK CDS 18993..20270 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061193.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene thrC CDS complement(20304..21032) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 21153..21527 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene gloA CDS 21583..22605 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475604.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 22898..24160 product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082184.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 24247..25230 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(25252..25764) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454093.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 26007..27380 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979148.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(27515..28279) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(28433..28648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 28530..30029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 30245..31675 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021657.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 31863..32729 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 32831..33358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 33355..35001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 35002..36456 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980691.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(36524..37384) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460669.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(37565..37900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(38432..38974) product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060842.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 39036..39269 product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 39364..40644 product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876597.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 41569..41997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(42357..44381) product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839420.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(44585..45802) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941161.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(46232..46633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17580 tRNA 46788..46865 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 sequence13 source 1..45376 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 490..651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(785..1909) product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223454.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 tRNA complement(3157..3228) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(3244..4905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(4905..6854) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084207611.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(6903..7982) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876908.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene dnaJ CDS complement(8012..9883) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene dnaK CDS complement(9880..10452) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392121.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene grpE CDS 10587..11381 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251231.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 11473..13050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(13057..13860) product extradiol dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868422.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 13965..14261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 14459..15613 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542268.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 15621..16769 product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870473.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 16865..17719 product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 17927..19195 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876437.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 19196..19990 product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876218.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 19977..20969 product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870761.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 21027..21677 product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867573.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 21674..22510 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892481.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 22507..23385 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021396.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 23382..24677 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876404.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene aroA CDS 24674..25780 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene aroC CDS 25904..27178 product (5-formylfuran-3-yl)methyl phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870189.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene mfnC CDS 27175..28017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(28010..28813) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750470.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene trpA CDS complement(28810..29979) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867583.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene trpB CDS complement(29986..30624) product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903201.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(30627..31409) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene trpC CDS complement(31390..32445) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869732.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene trpD CDS complement(32448..33035) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880323.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(33032..34429) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877263.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene trpE CDS 34506..35870 product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146581.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 36212..36661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(36632..37411) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 37546..38142 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781269.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 38361..38864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(38999..39994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 40711..41415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(41638..42117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 42205..42585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 42824..43120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 43349..43612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(43616..44419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 sequence14 source 1..44772 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(122..628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 691..816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(870..1589) product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383856.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 1722..2576 product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867662.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(2581..3867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 4008..4985 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392167.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 4995..5981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 6029..6421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(6443..7537) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762008.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(7580..8443) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812339.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(8483..10150) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726981.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 10239..11291 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879898.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(11925..12590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(12587..13270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(13328..14611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18160 note possible pseudo, frameshifted CDS complement(14860..15123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(15296..16864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(16871..17860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 18215..19339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(20108..20275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 20664..21197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 21194..21712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(22790..23173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 23604..24086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 24138..24305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 25558..26310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 26310..27521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(27640..28122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(28194..28433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(28625..29113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(29699..30601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(30630..31697) product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877833.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(31727..32296) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene rfbC CDS complement(32301..33191) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980041.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(33198..34208) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877832.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene rfbB CDS complement(34315..34599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(35040..35417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(35532..36470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(37403..38353) product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592106.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(38988..39530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(39579..40820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(40856..42106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(43374..43694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(44004..44387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 sequence15 source 1..39142 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 158..352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(349..2787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 3007..3801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(3804..5864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(5920..6291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(6288..6455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(6509..6862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 7425..8453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 8924..11533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 12277..12465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 12472..13020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 13286..13567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 13564..14046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 14099..16267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 16301..16585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 16609..17037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 17046..17702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 17845..18339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 18413..18886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 18917..19141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 19444..20634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 20889..21749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 21896..22258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(23648..23926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 25250..26521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 26550..28901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(31339..31626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 31699..32433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 32829..34619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 34619..35185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 35664..36263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(36821..37117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(37259..38008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 sequence16 source 1..38287 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 164..394 product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 488..3163 product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene ppdK CDS 3264..4124 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846973.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene cyoE CDS 4369..5019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 5022..7469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS 7475..7750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 7765..8544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 8649..9134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(9153..10190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(10580..11686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(12382..13041) product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763249.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(13041..13892) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene pstB CDS complement(13909..14832) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404794.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene pstA CDS complement(14840..15820) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404792.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene pstC CDS complement(15838..17031) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900236.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene pstS CDS 17204..17986 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928572.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 18175..19443 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933494.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(20336..20578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(20712..21731) product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966531.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 23288..24778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(25210..25494) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847047.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(25494..25646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(25994..26617) product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762040.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 27038..27490 product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258443.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(27613..28290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 28993..30738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 30941..31396 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227162.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 31777..32010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 31973..33103 product cytochrome b558/566 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979723.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene cbsA CDS 33103..33843 product Rieske iron-sulfur protein SoxL2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979725.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene soxL2 CDS 33864..35513 product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979726.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 35577..36317 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901833.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 36314..37363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(37318..38043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19120 sequence17 source 1..36088 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 694..1767 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868095.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 2722..3384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980166.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(3582..4049) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(4116..4373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 4472..4930 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978712.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(4989..5351) product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228341.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(5918..6823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 7298..8122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 8119..8631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(8609..9733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(9748..10422) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174104.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene lipB CDS complement(10424..11842) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903648.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene lpdA CDS complement(11847..13070) product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863430.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene pdhC CDS complement(13127..13858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 14102..14587 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(14600..14896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 15673..16098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 16453..16857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 16992..17936 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582519.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 17938..19029 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705177.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(19122..19934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(19943..20899) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256181.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(20931..22325) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903377.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(22445..23479) product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020910.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(23592..25742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(25739..26800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(26811..27764) product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762467.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene radA CDS 28029..28697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 28836..29576 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene fabG CDS 29612..30154 product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870785.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 30151..30801 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene queC CDS 30783..31547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 31671..32645 product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830232.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene dppB CDS 32661..33584 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868768.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 33581..34576 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 34578..35576 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(35584..35934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19490 sequence18 source 1..28226 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 281..613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 597..914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 1006..1299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 1296..1697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 1828..2085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 2078..2476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 2469..2774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 2780..3073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 3096..3575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 3565..4188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(5257..5517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(5534..5932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS complement(5988..6761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(7272..7907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 7960..8700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(8817..9188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 10206..12119 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171602985.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(12580..12762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 12907..13122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 13127..13966 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064366.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 14605..16509 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234782358.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(16688..16882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(18219..19232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(19239..20363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(20505..21653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 21724..22650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 22741..23049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 23266..24405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 25331..26374 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 sequence19 source 1..25880 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(397..780) product methionine-R-sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853613.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(1281..1760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(1811..2320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(2459..4189) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249122.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(4211..5446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(6112..6300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 7002..7352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 7346..8617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 8618..8791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 9130..10146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 10153..10707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(10960..11133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(11169..11666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 12567..12746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 12901..13263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19930 note possible pseudo, frameshifted CDS 13202..13495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(14193..14744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(14832..15410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 15624..15956 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879633.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene trxA CDS 15959..16456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 16453..16974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(16981..17481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(18247..19668) product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228473.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene merA CDS complement(19921..20079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(21775..22341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 22621..22761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(23568..24197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 24864..25409 product copper chaperone Copz family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256100.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 sequence20 source 1..24260 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 473..2053 product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051765.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(2388..3485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(4320..5624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(5621..6181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(6259..6411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 6627..8183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 8180..8782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(9118..9528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(9592..10155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(11069..11959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 12391..12744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 13075..13353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(13536..14750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(14755..15480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(15491..16153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 17249..17611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(17530..18375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(18456..19496) product IS481-like element ISA0963-2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877817.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 19796..20113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(20141..20527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(21961..22563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(22942..23184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(23329..23544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20290 sequence21 source 1..24057 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 392..1216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 1203..1733 product type II toxin-antitoxin system toxin endoribonuclease Nob1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877892.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene nob1 CDS complement(1789..2694) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727378.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 gene hemH CDS complement(2691..3728) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972892.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 gene hemE CDS complement(3725..5008) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398699.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene hemL CDS complement(5018..5737) product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869292.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(5737..6729) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881381.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene hemB CDS complement(6719..7204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(7480..8403) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene hemC CDS complement(8390..8977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(9781..11712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(11954..13369) product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846936.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene merA CDS complement(13984..15129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(16170..16946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 16972..17229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(17262..18377) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147062.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 18712..19467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(19939..20223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 20516..21487 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905888.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 21484..21717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(21804..22064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 22343..22726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS complement(22742..22897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 23203..23907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 sequence22 source 1..18655 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 139..294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 458..1132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 1501..3330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(3693..3887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(4010..4201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 4368..4886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 5001..5282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(5427..6998) product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089418476.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(6999..7739) product PaeR7I family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176598.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(7752..7982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(9211..9582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 10033..12267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(12507..13238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(13245..14519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(14509..15669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 15768..16208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 16448..16678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 16653..17081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS complement(18035..18292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20720 sequence23 source 1..16894 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1107..1322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS 1421..2110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(2652..3119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(3338..3904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(3929..4438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 5174..5584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(5581..5844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(6294..6812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS 6962..7195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(7559..8929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(8970..10088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(10134..10769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(12967..13665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 14063..14377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(14934..15092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 15187..15516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(15518..16819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20890 sequence24 source 1..8551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(147..590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(612..1139) product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846892.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene cutC CDS complement(1142..2014) product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 2129..3010 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072012.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(3007..4470) product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877720.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(4579..5157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS 5309..6604 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192776.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(6591..7961) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939112.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 misc_feature complement(7979..>8551) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879276.1:thiamine pyrophosphate-binding protein locus_tag LOCUS_20980 sequence25 source 1..5614 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(540..860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(1081..1371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(1358..1966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 2355..3065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(3086..3796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 misc_feature complement(4832..>5614) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003899284.1:phospholipase C locus_tag LOCUS_21040 sequence26 source 1..3945 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(343..2097) product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729435.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene poxB CDS complement(2186..3784) product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 sequence27 source 1..3942 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1178..2173) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879275.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(2200..3150) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978653.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 misc_feature complement(3162..>3942) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979018.1:APC family permease locus_tag LOCUS_21090