>Feature sequence01 813 52 gene locus_tag LOCUS_00010 813 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2149 788 gene locus_tag LOCUS_00020 gene cca 2149 788 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978948.1 protein_id gnl|my_center|LOCUS_00020 2707 2153 gene locus_tag LOCUS_00030 gene thpR 2707 2153 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879646.1 protein_id gnl|my_center|LOCUS_00030 2864 3385 gene locus_tag LOCUS_00040 2864 3385 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146776.1 protein_id gnl|my_center|LOCUS_00040 3404 3793 gene locus_tag LOCUS_00050 3404 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4743 3832 gene locus_tag LOCUS_00060 gene rnz 4743 3832 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_00060 5751 4750 gene locus_tag LOCUS_00070 5751 4750 CDS product TRM11 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020267.1 protein_id gnl|my_center|LOCUS_00070 6656 5769 gene locus_tag LOCUS_00080 6656 5769 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978942.1 protein_id gnl|my_center|LOCUS_00080 6832 7044 gene locus_tag LOCUS_00090 6832 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 7880 7011 gene locus_tag LOCUS_00100 7880 7011 CDS product nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240366.1 protein_id gnl|my_center|LOCUS_00100 8136 8894 gene locus_tag LOCUS_00110 8136 8894 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879698.1 protein_id gnl|my_center|LOCUS_00110 8944 9252 gene locus_tag LOCUS_00120 8944 9252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 10485 9271 gene locus_tag LOCUS_00130 10485 9271 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250771.1 protein_id gnl|my_center|LOCUS_00130 12810 10642 gene locus_tag LOCUS_00140 12810 10642 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_00140 13322 12822 gene locus_tag LOCUS_00150 13322 12822 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878792.1 protein_id gnl|my_center|LOCUS_00150 13384 13803 gene locus_tag LOCUS_00160 13384 13803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 14092 13739 gene locus_tag LOCUS_00170 14092 13739 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583113.1 protein_id gnl|my_center|LOCUS_00170 14202 14927 gene locus_tag LOCUS_00180 gene alaXM 14202 14927 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846184.1 protein_id gnl|my_center|LOCUS_00180 15000 16910 gene locus_tag LOCUS_00190 15000 16910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 16984 18420 gene locus_tag LOCUS_00200 16984 18420 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868372.1 protein_id gnl|my_center|LOCUS_00200 18427 19761 gene locus_tag LOCUS_00210 18427 19761 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249649.1 protein_id gnl|my_center|LOCUS_00210 19947 21617 gene locus_tag LOCUS_00220 gene thsB 19947 21617 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879727.1 protein_id gnl|my_center|LOCUS_00220 21929 22435 gene locus_tag LOCUS_00230 21929 22435 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878520.1 protein_id gnl|my_center|LOCUS_00230 23013 22441 gene locus_tag LOCUS_00240 23013 22441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 23612 23055 gene locus_tag LOCUS_00250 23612 23055 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742650.1 protein_id gnl|my_center|LOCUS_00250 24565 23924 gene locus_tag LOCUS_00260 24565 23924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 24671 25006 gene locus_tag LOCUS_00270 24671 25006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 25081 26112 gene locus_tag LOCUS_00280 25081 26112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 26291 27172 gene locus_tag LOCUS_00290 26291 27172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 27169 27858 gene locus_tag LOCUS_00300 27169 27858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 28559 28753 gene locus_tag LOCUS_00310 28559 28753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 29403 28951 gene locus_tag LOCUS_00320 29403 28951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 29916 30218 gene locus_tag LOCUS_00330 29916 30218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 30639 32486 gene locus_tag LOCUS_00340 30639 32486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 33498 33767 gene locus_tag LOCUS_00350 33498 33767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 35021 33837 gene locus_tag LOCUS_00360 35021 33837 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135390550.1 protein_id gnl|my_center|LOCUS_00360 35133 35060 gene locus_tag LOCUS_t00010 35133 35060 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 36020 35145 gene locus_tag LOCUS_00370 gene garR 36020 35145 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771929.1 protein_id gnl|my_center|LOCUS_00370 36526 36107 gene locus_tag LOCUS_00380 36526 36107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 36817 37746 gene locus_tag LOCUS_00390 gene ilvE 36817 37746 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 protein_id gnl|my_center|LOCUS_00390 38345 37764 gene locus_tag LOCUS_00400 38345 37764 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053721.1 protein_id gnl|my_center|LOCUS_00400 39300 38386 gene locus_tag LOCUS_00410 39300 38386 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188924.1 protein_id gnl|my_center|LOCUS_00410 39612 40013 gene locus_tag LOCUS_00420 39612 40013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 40118 40606 gene locus_tag LOCUS_00430 40118 40606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 40792 41343 gene locus_tag LOCUS_00440 40792 41343 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250217.1 protein_id gnl|my_center|LOCUS_00440 41405 41788 gene locus_tag LOCUS_00450 41405 41788 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763726.1 protein_id gnl|my_center|LOCUS_00450 42572 41796 gene locus_tag LOCUS_00460 gene suhB 42572 41796 CDS product bifunctional fructose-1,6-bisphosphatase/inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879859.1 protein_id gnl|my_center|LOCUS_00460 43965 42670 gene locus_tag LOCUS_00470 43965 42670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 47316 44128 gene locus_tag LOCUS_00480 gene ileS 47316 44128 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763377.1 protein_id gnl|my_center|LOCUS_00480 47547 48236 gene locus_tag LOCUS_00490 47547 48236 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249618.1 protein_id gnl|my_center|LOCUS_00490 48724 48248 gene locus_tag LOCUS_00500 48724 48248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 48974 48708 gene locus_tag LOCUS_00510 48974 48708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 49865 49017 gene locus_tag LOCUS_00520 gene serK 49865 49017 CDS product L-serine kinase SerK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868633.1 protein_id gnl|my_center|LOCUS_00520 50125 49862 gene locus_tag LOCUS_00530 50125 49862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 50955 50203 gene locus_tag LOCUS_00540 50955 50203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 51017 51238 gene locus_tag LOCUS_00550 51017 51238 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876456.1 protein_id gnl|my_center|LOCUS_00550 52231 53484 gene locus_tag LOCUS_00560 52231 53484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 53579 53914 gene locus_tag LOCUS_00570 53579 53914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 54485 54258 gene locus_tag LOCUS_00580 54485 54258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 54748 54572 gene locus_tag LOCUS_00590 54748 54572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 55096 54815 gene locus_tag LOCUS_00600 55096 54815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 55697 55293 gene locus_tag LOCUS_00610 55697 55293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 55945 55757 gene locus_tag LOCUS_00620 55945 55757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 56501 56983 gene locus_tag LOCUS_00630 56501 56983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 57081 57296 gene locus_tag LOCUS_00640 57081 57296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 57605 57892 gene locus_tag LOCUS_00650 57605 57892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00650 58040 58714 gene locus_tag LOCUS_00660 58040 58714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00660 60388 58961 gene locus_tag LOCUS_00670 60388 58961 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229629.1 protein_id gnl|my_center|LOCUS_00670 60443 60913 gene locus_tag LOCUS_00680 60443 60913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 61516 61328 gene locus_tag LOCUS_00690 61516 61328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 61750 62205 gene locus_tag LOCUS_00700 61750 62205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 62618 62187 gene locus_tag LOCUS_00710 62618 62187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 64425 63010 gene locus_tag LOCUS_00720 64425 63010 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392514.1 protein_id gnl|my_center|LOCUS_00720 64616 65317 gene locus_tag LOCUS_00730 64616 65317 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 protein_id gnl|my_center|LOCUS_00730 66671 65325 gene locus_tag LOCUS_00740 66671 65325 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251051.1 protein_id gnl|my_center|LOCUS_00740 67177 68079 gene locus_tag LOCUS_00750 67177 68079 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762079.1 protein_id gnl|my_center|LOCUS_00750 68076 69305 gene locus_tag LOCUS_00760 gene porA 68076 69305 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877345.1 protein_id gnl|my_center|LOCUS_00760 69402 70373 gene locus_tag LOCUS_00770 gene porB 69402 70373 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496444.1 protein_id gnl|my_center|LOCUS_00770 70590 72305 gene locus_tag LOCUS_00780 70590 72305 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 protein_id gnl|my_center|LOCUS_00780 72311 72793 gene locus_tag LOCUS_00790 gene sdhC 72311 72793 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544970.1 protein_id gnl|my_center|LOCUS_00790 72797 73141 gene locus_tag LOCUS_00800 72797 73141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 73138 73989 gene locus_tag LOCUS_00810 73138 73989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 74569 74069 gene locus_tag LOCUS_00820 74569 74069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 75735 74575 gene locus_tag LOCUS_00830 75735 74575 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878064.1 protein_id gnl|my_center|LOCUS_00830 75986 75741 gene locus_tag LOCUS_00840 75986 75741 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256473.1 protein_id gnl|my_center|LOCUS_00840 76447 75998 gene locus_tag LOCUS_00850 76447 75998 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846667.1 protein_id gnl|my_center|LOCUS_00850 76811 77722 gene locus_tag LOCUS_00860 76811 77722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 77751 78374 gene locus_tag LOCUS_00870 77751 78374 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081900.1 protein_id gnl|my_center|LOCUS_00870 78485 78321 gene locus_tag LOCUS_00880 78485 78321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 78689 79663 gene locus_tag LOCUS_00890 gene mer 78689 79663 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877358.1 protein_id gnl|my_center|LOCUS_00890 79948 80187 gene locus_tag LOCUS_00900 79948 80187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 80204 80782 gene locus_tag LOCUS_00910 80204 80782 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878659.1 protein_id gnl|my_center|LOCUS_00910 80786 81853 gene locus_tag LOCUS_00920 80786 81853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 81859 82200 gene locus_tag LOCUS_00930 81859 82200 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876587.1 protein_id gnl|my_center|LOCUS_00930 82200 84839 gene locus_tag LOCUS_00940 82200 84839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 84836 86227 gene locus_tag LOCUS_00950 84836 86227 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_00950 86281 86916 gene locus_tag LOCUS_00960 86281 86916 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868878.1 protein_id gnl|my_center|LOCUS_00960 86917 87159 gene locus_tag LOCUS_00970 86917 87159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 87165 87497 gene locus_tag LOCUS_00980 87165 87497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 87504 89549 gene locus_tag LOCUS_00990 87504 89549 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878656.1 protein_id gnl|my_center|LOCUS_00990 90672 89566 gene locus_tag LOCUS_01000 90672 89566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 90974 90741 gene locus_tag LOCUS_01010 90974 90741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 91243 92490 gene locus_tag LOCUS_01020 91243 92490 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240384.1 protein_id gnl|my_center|LOCUS_01020 93512 92487 gene locus_tag LOCUS_01030 93512 92487 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878151.1 protein_id gnl|my_center|LOCUS_01030 93695 94060 gene locus_tag LOCUS_01040 93695 94060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 94065 95180 gene locus_tag LOCUS_01050 gene nuoH 94065 95180 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573426.1 protein_id gnl|my_center|LOCUS_01050 95193 95687 gene locus_tag LOCUS_01060 95193 95687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 95684 95992 gene locus_tag LOCUS_01070 gene nuoK 95684 95992 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056517.1 protein_id gnl|my_center|LOCUS_01070 95999 97522 gene locus_tag LOCUS_01080 95999 97522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 97526 99592 gene locus_tag LOCUS_01090 gene nuoL 97526 99592 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392500.1 protein_id gnl|my_center|LOCUS_01090 99595 101076 gene locus_tag LOCUS_01100 99595 101076 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545185.1 protein_id gnl|my_center|LOCUS_01100 101073 102500 gene locus_tag LOCUS_01110 gene fpoN 101073 102500 CDS product F(420)H(2) dehydrogenase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 protein_id gnl|my_center|LOCUS_01110 103428 102553 gene locus_tag LOCUS_01120 103428 102553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 103885 104097 gene locus_tag LOCUS_01130 103885 104097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 104117 104455 gene locus_tag LOCUS_01140 104117 104455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 104499 104765 gene locus_tag LOCUS_01150 104499 104765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 105392 104781 gene locus_tag LOCUS_01160 105392 104781 CDS product DUF996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867948.1 protein_id gnl|my_center|LOCUS_01160 105716 105480 gene locus_tag LOCUS_01170 105716 105480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01170 107277 107101 gene locus_tag LOCUS_01180 107277 107101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 107694 107603 gene locus_tag LOCUS_t00020 107694 107603 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 107796 108845 gene locus_tag LOCUS_01190 107796 108845 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931705.1 protein_id gnl|my_center|LOCUS_01190 109442 108849 gene locus_tag LOCUS_01200 109442 108849 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229253.1 protein_id gnl|my_center|LOCUS_01200 109480 110091 gene locus_tag LOCUS_01210 109480 110091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 110116 111213 gene locus_tag LOCUS_01220 gene papB 110116 111213 CDS product di/tri-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244662.1 protein_id gnl|my_center|LOCUS_01220 111293 112447 gene locus_tag LOCUS_01230 111293 112447 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978108.1 protein_id gnl|my_center|LOCUS_01230 112790 113923 gene locus_tag LOCUS_01240 112790 113923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 114713 113985 gene locus_tag LOCUS_01250 114713 113985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 116259 115063 gene locus_tag LOCUS_01260 116259 115063 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941744.1 protein_id gnl|my_center|LOCUS_01260 116821 116270 gene locus_tag LOCUS_01270 116821 116270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 116921 118405 gene locus_tag LOCUS_01280 116921 118405 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979709.1 protein_id gnl|my_center|LOCUS_01280 119518 118418 gene locus_tag LOCUS_01290 119518 118418 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061317.1 protein_id gnl|my_center|LOCUS_01290 120844 119630 gene locus_tag LOCUS_01300 120844 119630 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061129.1 protein_id gnl|my_center|LOCUS_01300 121637 121365 gene locus_tag LOCUS_01310 gene albA 121637 121365 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878567.1 protein_id gnl|my_center|LOCUS_01310 121832 121760 gene locus_tag LOCUS_t00030 121832 121760 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 122979 121942 gene locus_tag LOCUS_01320 122979 121942 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485760.1 protein_id gnl|my_center|LOCUS_01320 123218 124318 gene locus_tag LOCUS_01330 123218 124318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 124365 125297 gene locus_tag LOCUS_01340 124365 125297 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876508.1 protein_id gnl|my_center|LOCUS_01340 125411 125896 gene locus_tag LOCUS_01350 125411 125896 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763299.1 protein_id gnl|my_center|LOCUS_01350 126134 125868 gene locus_tag LOCUS_01360 126134 125868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 127021 126131 gene locus_tag LOCUS_01370 127021 126131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 127417 127716 gene locus_tag LOCUS_01380 127417 127716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 127835 128152 gene locus_tag LOCUS_01390 gene rpsJ 127835 128152 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867802.1 protein_id gnl|my_center|LOCUS_01390 128270 131113 gene locus_tag LOCUS_01400 128270 131113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 131131 131388 gene locus_tag LOCUS_01410 131131 131388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 132741 131494 gene locus_tag LOCUS_01420 gene ahcY 132741 131494 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978302.1 protein_id gnl|my_center|LOCUS_01420 132854 133330 gene locus_tag LOCUS_01430 132854 133330 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080908.1 protein_id gnl|my_center|LOCUS_01430 133327 133803 gene locus_tag LOCUS_01440 gene bcp 133327 133803 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283178.1 protein_id gnl|my_center|LOCUS_01440 133881 134048 gene locus_tag LOCUS_01450 133881 134048 CDS product 30S ribosomal protein S30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979284.1 protein_id gnl|my_center|LOCUS_01450 134213 135403 gene locus_tag LOCUS_01460 134213 135403 CDS product C/D box methylation guide ribonucleoprotein complex aNOP56 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156014546.1 protein_id gnl|my_center|LOCUS_01460 135357 136076 gene locus_tag LOCUS_01470 135357 136076 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846944.1 protein_id gnl|my_center|LOCUS_01470 137348 136350 gene locus_tag LOCUS_01480 gene radA 137348 136350 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878493.1 protein_id gnl|my_center|LOCUS_01480 138677 137382 gene locus_tag LOCUS_01490 gene asnS 138677 137382 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249710.1 protein_id gnl|my_center|LOCUS_01490 138768 139919 gene locus_tag LOCUS_01500 138768 139919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 141148 139925 gene locus_tag LOCUS_01510 141148 139925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 141773 141132 gene locus_tag LOCUS_01520 141773 141132 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496635.1 protein_id gnl|my_center|LOCUS_01520 142353 141763 gene locus_tag LOCUS_01530 142353 141763 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249247.1 protein_id gnl|my_center|LOCUS_01530 142813 142241 gene locus_tag LOCUS_01540 142813 142241 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024515.1 protein_id gnl|my_center|LOCUS_01540 144641 142839 gene locus_tag LOCUS_01550 gene rqcH 144641 142839 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879530.1 protein_id gnl|my_center|LOCUS_01550 144703 145023 gene locus_tag LOCUS_01560 144703 145023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 145308 144937 gene locus_tag LOCUS_01570 145308 144937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 145797 145309 gene locus_tag LOCUS_01580 145797 145309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 146146 146412 gene locus_tag LOCUS_01590 146146 146412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 147319 146432 gene locus_tag LOCUS_01600 147319 146432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978174.1 protein_id gnl|my_center|LOCUS_01600 148929 147376 gene locus_tag LOCUS_01610 gene pyrG 148929 147376 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867477.1 protein_id gnl|my_center|LOCUS_01610 150132 149071 gene locus_tag LOCUS_01620 150132 149071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 150189 153737 gene locus_tag LOCUS_01630 gene smc 150189 153737 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867481.1 protein_id gnl|my_center|LOCUS_01630 153715 154356 gene locus_tag LOCUS_01640 153715 154356 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870645.1 protein_id gnl|my_center|LOCUS_01640 154353 154901 gene locus_tag LOCUS_01650 154353 154901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 154941 155327 gene locus_tag LOCUS_01660 154941 155327 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870178.1 protein_id gnl|my_center|LOCUS_01660 155364 155681 gene locus_tag LOCUS_01670 155364 155681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 156977 155808 gene locus_tag LOCUS_01680 156977 155808 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547446.1 protein_id gnl|my_center|LOCUS_01680 157162 157398 gene locus_tag LOCUS_01690 157162 157398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 157382 158344 gene locus_tag LOCUS_01700 157382 158344 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 protein_id gnl|my_center|LOCUS_01700 158375 158770 gene locus_tag LOCUS_01710 158375 158770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 158757 159377 gene locus_tag LOCUS_01720 gene rrmJ 158757 159377 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870893.1 protein_id gnl|my_center|LOCUS_01720 160535 159384 gene locus_tag LOCUS_01730 160535 159384 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876814.1 protein_id gnl|my_center|LOCUS_01730 160745 161293 gene locus_tag LOCUS_01740 160745 161293 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023327.1 protein_id gnl|my_center|LOCUS_01740 161290 161976 gene locus_tag LOCUS_01750 gene rnhB 161290 161976 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249756.1 protein_id gnl|my_center|LOCUS_01750 163229 162165 gene locus_tag LOCUS_01760 163229 162165 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020134.1 protein_id gnl|my_center|LOCUS_01760 164009 163311 gene locus_tag LOCUS_01770 164009 163311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 164073 164462 gene locus_tag LOCUS_01780 164073 164462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 165307 164507 gene locus_tag LOCUS_01790 gene uppS 165307 164507 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250124.1 protein_id gnl|my_center|LOCUS_01790 166376 165294 gene locus_tag LOCUS_01800 166376 165294 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147160.1 protein_id gnl|my_center|LOCUS_01800 167338 166463 gene locus_tag LOCUS_01810 167338 166463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979293.1 protein_id gnl|my_center|LOCUS_01810 168373 167453 gene locus_tag LOCUS_01820 168373 167453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 168978 168376 gene locus_tag LOCUS_01830 168978 168376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 169071 169694 gene locus_tag LOCUS_01840 169071 169694 CDS product DUF4443 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868435.1 protein_id gnl|my_center|LOCUS_01840 170119 170613 gene locus_tag LOCUS_01850 170119 170613 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869516.1 protein_id gnl|my_center|LOCUS_01850 170680 171042 gene locus_tag LOCUS_01860 170680 171042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 171080 173644 gene locus_tag LOCUS_01870 171080 173644 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142782.1 protein_id gnl|my_center|LOCUS_01870 173699 174535 gene locus_tag LOCUS_01880 173699 174535 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403322.1 protein_id gnl|my_center|LOCUS_01880 174684 175607 gene locus_tag LOCUS_01890 174684 175607 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545688.1 protein_id gnl|my_center|LOCUS_01890 176760 175696 gene locus_tag LOCUS_01900 176760 175696 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846612.1 protein_id gnl|my_center|LOCUS_01900 176957 177220 gene locus_tag LOCUS_01910 176957 177220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 178104 177280 gene locus_tag LOCUS_01920 gene lsrF 178104 177280 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175220.1 protein_id gnl|my_center|LOCUS_01920 179199 178174 gene locus_tag LOCUS_01930 179199 178174 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980425.1 protein_id gnl|my_center|LOCUS_01930 179895 179236 gene locus_tag LOCUS_01940 179895 179236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 180098 179928 gene locus_tag LOCUS_01950 180098 179928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 180268 181746 gene locus_tag LOCUS_01960 gene aspA 180268 181746 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460903.1 protein_id gnl|my_center|LOCUS_01960 182217 181786 gene locus_tag LOCUS_01970 182217 181786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 182600 183442 gene locus_tag LOCUS_01980 182600 183442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 184528 184205 gene locus_tag LOCUS_01990 184528 184205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 184996 184622 gene locus_tag LOCUS_02000 184996 184622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 185375 185001 gene locus_tag LOCUS_02010 185375 185001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 185455 186864 gene locus_tag LOCUS_02020 185455 186864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 186866 187519 gene locus_tag LOCUS_02030 186866 187519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 187516 188127 gene locus_tag LOCUS_02040 187516 188127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 188162 188350 gene locus_tag LOCUS_02050 188162 188350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 188358 190019 gene locus_tag LOCUS_02060 188358 190019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 190550 189999 gene locus_tag LOCUS_02070 190550 189999 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868259.1 protein_id gnl|my_center|LOCUS_02070 191390 190677 gene locus_tag LOCUS_02080 191390 190677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 191524 191817 gene locus_tag LOCUS_02090 191524 191817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 191872 192783 gene locus_tag LOCUS_02100 191872 192783 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762527.1 protein_id gnl|my_center|LOCUS_02100 193555 192734 gene locus_tag LOCUS_02110 193555 192734 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080966.1 protein_id gnl|my_center|LOCUS_02110 193659 193916 gene locus_tag LOCUS_02120 193659 193916 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011033302.1 protein_id gnl|my_center|LOCUS_02120 193991 194941 gene locus_tag LOCUS_02130 193991 194941 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146505.1 protein_id gnl|my_center|LOCUS_02130 195761 195219 gene locus_tag LOCUS_02140 gene endA 195761 195219 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978320.1 protein_id gnl|my_center|LOCUS_02140 196439 195786 gene locus_tag LOCUS_02150 196439 195786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 198385 196598 gene locus_tag LOCUS_02160 198385 196598 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930711.1 protein_id gnl|my_center|LOCUS_02160 198479 199087 gene locus_tag LOCUS_02170 198479 199087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 199136 200032 gene locus_tag LOCUS_02180 gene cofD 199136 200032 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_02180 200837 200025 gene locus_tag LOCUS_02190 gene cofE 200837 200025 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259452.1 protein_id gnl|my_center|LOCUS_02190 202475 200868 gene locus_tag LOCUS_02200 202475 200868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 202463 203356 gene locus_tag LOCUS_02210 202463 203356 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241727.1 protein_id gnl|my_center|LOCUS_02210 203434 204177 gene locus_tag LOCUS_02220 203434 204177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 204184 204888 gene locus_tag LOCUS_02230 204184 204888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 204988 206142 gene locus_tag LOCUS_02240 204988 206142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 206143 206778 gene locus_tag LOCUS_02250 206143 206778 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877484.1 protein_id gnl|my_center|LOCUS_02250 206825 207868 gene locus_tag LOCUS_02260 206825 207868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 207887 208195 gene locus_tag LOCUS_02270 207887 208195 CDS product 30S ribosomal protein S26e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762572.1 protein_id gnl|my_center|LOCUS_02270 208205 208507 gene locus_tag LOCUS_02280 208205 208507 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250445.1 protein_id gnl|my_center|LOCUS_02280 209059 208493 gene locus_tag LOCUS_02290 gene pgsA 209059 208493 CDS product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868695.1 protein_id gnl|my_center|LOCUS_02290 209305 209514 gene locus_tag LOCUS_02300 209305 209514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 209514 211277 gene locus_tag LOCUS_02310 209514 211277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 212151 211270 gene locus_tag LOCUS_02320 gene speB 212151 211270 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869807.1 protein_id gnl|my_center|LOCUS_02320 216185 212235 gene locus_tag LOCUS_02330 216185 212235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 216550 216900 gene locus_tag LOCUS_02340 216550 216900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 216918 217982 gene locus_tag LOCUS_02350 216918 217982 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249523.1 protein_id gnl|my_center|LOCUS_02350 218017 219213 gene locus_tag LOCUS_02360 218017 219213 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_02360 219242 219406 gene locus_tag LOCUS_02370 219242 219406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 219611 220711 gene locus_tag LOCUS_02380 219611 220711 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249135.1 protein_id gnl|my_center|LOCUS_02380 220718 221113 gene locus_tag LOCUS_02390 220718 221113 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762564.1 protein_id gnl|my_center|LOCUS_02390 222338 221322 gene locus_tag LOCUS_02400 gene galT 222338 221322 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393433.1 protein_id gnl|my_center|LOCUS_02400 222471 223739 gene locus_tag LOCUS_02410 222471 223739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 223863 224972 gene locus_tag LOCUS_02420 gene sucC 223863 224972 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228010.1 protein_id gnl|my_center|LOCUS_02420 224969 225868 gene locus_tag LOCUS_02430 gene sucD 224969 225868 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742632.1 protein_id gnl|my_center|LOCUS_02430 227581 225893 gene locus_tag LOCUS_02440 227581 225893 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249122.1 protein_id gnl|my_center|LOCUS_02440 229040 227949 gene locus_tag LOCUS_02450 229040 227949 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980538.1 protein_id gnl|my_center|LOCUS_02450 230787 229528 gene locus_tag LOCUS_02460 gene gdhA 230787 229528 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_02460 230983 231489 gene locus_tag LOCUS_02470 230983 231489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 231479 232777 gene locus_tag LOCUS_02480 gene aspS 231479 232777 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878420.1 protein_id gnl|my_center|LOCUS_02480 234192 232954 gene locus_tag LOCUS_02490 234192 232954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 234318 234962 gene locus_tag LOCUS_02500 gene cdvB1/B2 234318 234962 CDS product cell division protein CdvB1/B2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979256.1 protein_id gnl|my_center|LOCUS_02500 235111 235956 gene locus_tag LOCUS_02510 235111 235956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 235953 237146 gene locus_tag LOCUS_02520 gene cdvC 235953 237146 CDS product cell division protein CdvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979234.1 protein_id gnl|my_center|LOCUS_02520 237204 237620 gene locus_tag LOCUS_02530 237204 237620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 238415 237582 gene locus_tag LOCUS_02540 238415 237582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 238963 238424 gene locus_tag LOCUS_02550 238963 238424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 240197 238953 gene locus_tag LOCUS_02560 240197 238953 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980269.1 protein_id gnl|my_center|LOCUS_02560 240269 240991 gene locus_tag LOCUS_02570 240269 240991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 242535 241000 gene locus_tag LOCUS_02580 gene tgtA 242535 241000 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978287.1 protein_id gnl|my_center|LOCUS_02580 242733 244094 gene locus_tag LOCUS_02590 242733 244094 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_02590 244144 245007 gene locus_tag LOCUS_02600 244144 245007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 245004 245744 gene locus_tag LOCUS_02610 245004 245744 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762388.1 protein_id gnl|my_center|LOCUS_02610 245802 246140 gene locus_tag LOCUS_02620 245802 246140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 246545 246141 gene locus_tag LOCUS_02630 246545 246141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 247830 246571 gene locus_tag LOCUS_02640 247830 246571 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582434.1 protein_id gnl|my_center|LOCUS_02640 247954 248577 gene locus_tag LOCUS_02650 247954 248577 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979808.1 protein_id gnl|my_center|LOCUS_02650 248669 250438 gene locus_tag LOCUS_02660 248669 250438 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978120.1 protein_id gnl|my_center|LOCUS_02660 250636 251310 gene locus_tag LOCUS_02670 gene npdG 250636 251310 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878392.1 protein_id gnl|my_center|LOCUS_02670 251316 251630 gene locus_tag LOCUS_02680 251316 251630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 251726 252586 gene locus_tag LOCUS_02690 251726 252586 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_02690 253376 252612 gene locus_tag LOCUS_02700 253376 252612 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762424.1 protein_id gnl|my_center|LOCUS_02700 253582 253373 gene locus_tag LOCUS_02710 253582 253373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 254025 253579 gene locus_tag LOCUS_02720 254025 253579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 255764 254025 gene locus_tag LOCUS_02730 255764 254025 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762425.1 protein_id gnl|my_center|LOCUS_02730 256111 255869 gene locus_tag LOCUS_02740 256111 255869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 256251 257036 gene locus_tag LOCUS_02750 gene surE 256251 257036 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020163.1 protein_id gnl|my_center|LOCUS_02750 257184 257750 gene locus_tag LOCUS_02760 257184 257750 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_02760 258753 257716 gene locus_tag LOCUS_02770 258753 257716 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847017.1 protein_id gnl|my_center|LOCUS_02770 258910 259311 gene locus_tag LOCUS_02780 258910 259311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 259420 260349 gene locus_tag LOCUS_02790 259420 260349 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 protein_id gnl|my_center|LOCUS_02790 260413 261378 gene locus_tag LOCUS_02800 260413 261378 CDS product thiamine-phosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846193.1 protein_id gnl|my_center|LOCUS_02800 261469 262734 gene locus_tag LOCUS_02810 261469 262734 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980417.1 protein_id gnl|my_center|LOCUS_02810 262740 264182 gene locus_tag LOCUS_02820 gene cysS 262740 264182 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880664.1 protein_id gnl|my_center|LOCUS_02820 264241 265356 gene locus_tag LOCUS_02830 264241 265356 CDS product DUF1512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979465.1 protein_id gnl|my_center|LOCUS_02830 266361 265405 gene locus_tag LOCUS_02840 266361 265405 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582557.1 protein_id gnl|my_center|LOCUS_02840 266850 266371 gene locus_tag LOCUS_02850 266850 266371 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979561.1 protein_id gnl|my_center|LOCUS_02850 267730 266909 gene locus_tag LOCUS_02860 267730 266909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 267945 268838 gene locus_tag LOCUS_02870 267945 268838 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978312.1 protein_id gnl|my_center|LOCUS_02870 269538 268990 gene locus_tag LOCUS_02880 269538 268990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 270601 269444 gene locus_tag LOCUS_02890 270601 269444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 270992 270780 gene locus_tag LOCUS_02900 270992 270780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 271252 271890 gene locus_tag LOCUS_02910 271252 271890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 271905 272171 gene locus_tag LOCUS_02920 271905 272171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 272269 272937 gene locus_tag LOCUS_02930 272269 272937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 272934 273839 gene locus_tag LOCUS_02940 272934 273839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 273893 274378 gene locus_tag LOCUS_02950 273893 274378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 274400 274912 gene locus_tag LOCUS_02960 274400 274912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 275004 275684 gene locus_tag LOCUS_02970 275004 275684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 275740 276474 gene locus_tag LOCUS_02980 275740 276474 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020802.1 protein_id gnl|my_center|LOCUS_02980 276475 278820 gene locus_tag LOCUS_02990 276475 278820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 279928 278705 gene locus_tag LOCUS_03000 279928 278705 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868844.1 protein_id gnl|my_center|LOCUS_03000 280026 281291 gene locus_tag LOCUS_03010 280026 281291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 281385 282491 gene locus_tag LOCUS_03020 281385 282491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 283131 284270 gene locus_tag LOCUS_03030 283131 284270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 285139 284405 gene locus_tag LOCUS_03040 285139 284405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 286464 285271 gene locus_tag LOCUS_03050 286464 285271 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761790.1 protein_id gnl|my_center|LOCUS_03050 288566 286479 gene locus_tag LOCUS_03060 288566 286479 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319808.1 protein_id gnl|my_center|LOCUS_03060 290156 288636 gene locus_tag LOCUS_03070 290156 288636 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978751.1 protein_id gnl|my_center|LOCUS_03070 290377 290153 gene locus_tag LOCUS_03080 290377 290153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 291113 290517 gene locus_tag LOCUS_03090 291113 290517 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069168135.1 protein_id gnl|my_center|LOCUS_03090 291438 291148 gene locus_tag LOCUS_03100 291438 291148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 292740 291553 gene locus_tag LOCUS_03110 292740 291553 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231837.1 protein_id gnl|my_center|LOCUS_03110 294574 293030 gene locus_tag LOCUS_03120 gene guaA 294574 293030 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880099.1 protein_id gnl|my_center|LOCUS_03120 294625 295212 gene locus_tag LOCUS_03130 gene hpt 294625 295212 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902373.1 protein_id gnl|my_center|LOCUS_03130 295489 296721 gene locus_tag LOCUS_03140 295489 296721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 296886 297272 gene locus_tag LOCUS_03150 296886 297272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 297457 298488 gene locus_tag LOCUS_03160 gene tdh 297457 298488 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868502.1 protein_id gnl|my_center|LOCUS_03160 298583 299017 gene locus_tag LOCUS_03170 298583 299017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 299559 299023 gene locus_tag LOCUS_03180 299559 299023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 300118 299570 gene locus_tag LOCUS_03190 300118 299570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 300251 302521 gene locus_tag LOCUS_03200 300251 302521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 303164 302559 gene locus_tag LOCUS_03210 303164 302559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 304897 304091 gene locus_tag LOCUS_03220 gene pyrH 304897 304091 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979322.1 protein_id gnl|my_center|LOCUS_03220 305696 304911 gene locus_tag LOCUS_03230 305696 304911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 306331 305726 gene locus_tag LOCUS_03240 306331 305726 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980108.1 protein_id gnl|my_center|LOCUS_03240 307134 306349 gene locus_tag LOCUS_03250 307134 306349 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846712.1 protein_id gnl|my_center|LOCUS_03250 308168 307131 gene locus_tag LOCUS_03260 308168 307131 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980107.1 protein_id gnl|my_center|LOCUS_03260 308412 308987 gene locus_tag LOCUS_03270 308412 308987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 309092 310198 gene locus_tag LOCUS_03280 309092 310198 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979838.1 protein_id gnl|my_center|LOCUS_03280 310188 310976 gene locus_tag LOCUS_03290 310188 310976 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931877.1 protein_id gnl|my_center|LOCUS_03290 311036 311617 gene locus_tag LOCUS_03300 311036 311617 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978534.1 protein_id gnl|my_center|LOCUS_03300 311950 315651 gene locus_tag LOCUS_03310 311950 315651 CDS product protease pro-enzyme activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980449.1 protein_id gnl|my_center|LOCUS_03310 316653 315793 gene locus_tag LOCUS_03320 316653 315793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 316913 318133 gene locus_tag LOCUS_03330 316913 318133 CDS product Acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245999.1 protein_id gnl|my_center|LOCUS_03330 318228 318674 gene locus_tag LOCUS_03340 318228 318674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 318777 319445 gene locus_tag LOCUS_03350 318777 319445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 319587 321635 gene locus_tag LOCUS_03360 319587 321635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 321731 322195 gene locus_tag LOCUS_03370 321731 322195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 322564 322214 gene locus_tag LOCUS_03380 322564 322214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 322847 322656 gene locus_tag LOCUS_03390 322847 322656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 323203 324261 gene locus_tag LOCUS_03400 323203 324261 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080774.1 protein_id gnl|my_center|LOCUS_03400 324340 326109 gene locus_tag LOCUS_03410 324340 326109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 326445 326903 gene locus_tag LOCUS_03420 326445 326903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 327222 326887 gene locus_tag LOCUS_03430 327222 326887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 327777 327968 gene locus_tag LOCUS_03440 327777 327968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 328013 328201 gene locus_tag LOCUS_03450 328013 328201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 328750 328544 gene locus_tag LOCUS_03460 328750 328544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 330117 329155 gene locus_tag LOCUS_03470 330117 329155 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762659.1 protein_id gnl|my_center|LOCUS_03470 331184 330114 gene locus_tag LOCUS_03480 331184 330114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 331598 332143 gene locus_tag LOCUS_03490 331598 332143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 332608 332165 gene locus_tag LOCUS_03500 332608 332165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 332704 333033 gene locus_tag LOCUS_03510 332704 333033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 333894 333136 gene locus_tag LOCUS_03520 333894 333136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 334400 333957 gene locus_tag LOCUS_03530 334400 333957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 334716 334976 gene locus_tag LOCUS_03540 334716 334976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 335500 335039 gene locus_tag LOCUS_03550 335500 335039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 335620 336006 gene locus_tag LOCUS_03560 335620 336006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 336572 336018 gene locus_tag LOCUS_03570 336572 336018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 336909 337091 gene locus_tag LOCUS_03580 336909 337091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 337160 337618 gene locus_tag LOCUS_03590 337160 337618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 338446 337592 gene locus_tag LOCUS_03600 338446 337592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 342342 338773 gene locus_tag LOCUS_03610 342342 338773 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979710.1 protein_id gnl|my_center|LOCUS_03610 342480 343058 gene locus_tag LOCUS_03620 342480 343058 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978110.1 protein_id gnl|my_center|LOCUS_03620 343949 343065 gene locus_tag LOCUS_03630 343949 343065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 344065 344505 gene locus_tag LOCUS_03640 344065 344505 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546746.1 protein_id gnl|my_center|LOCUS_03640 346505 344541 gene locus_tag LOCUS_03650 346505 344541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 347053 348492 gene locus_tag LOCUS_03660 347053 348492 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846364.1 protein_id gnl|my_center|LOCUS_03660 349809 348520 gene locus_tag LOCUS_03670 349809 348520 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869166.1 protein_id gnl|my_center|LOCUS_03670 349876 351558 gene locus_tag LOCUS_03680 gene fdrA 349876 351558 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393612.1 protein_id gnl|my_center|LOCUS_03680 351555 351734 gene locus_tag LOCUS_03690 351555 351734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 352205 351720 gene locus_tag LOCUS_03700 gene cutC 352205 351720 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846651.1 protein_id gnl|my_center|LOCUS_03700 353104 352202 gene locus_tag LOCUS_03710 353104 352202 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 protein_id gnl|my_center|LOCUS_03710 355572 353122 gene locus_tag LOCUS_03720 355572 353122 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869170.1 protein_id gnl|my_center|LOCUS_03720 356612 355827 gene locus_tag LOCUS_03730 356612 355827 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869167.1 protein_id gnl|my_center|LOCUS_03730 356830 357618 gene locus_tag LOCUS_03740 356830 357618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 358383 357619 gene locus_tag LOCUS_03750 358383 357619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 358792 358418 gene locus_tag LOCUS_03760 358792 358418 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978597.1 protein_id gnl|my_center|LOCUS_03760 359961 358798 gene locus_tag LOCUS_03770 359961 358798 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978596.1 protein_id gnl|my_center|LOCUS_03770 360224 359979 gene locus_tag LOCUS_03780 360224 359979 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846902.1 protein_id gnl|my_center|LOCUS_03780 360512 361486 gene locus_tag LOCUS_03790 360512 361486 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763084.1 protein_id gnl|my_center|LOCUS_03790 361483 362694 gene locus_tag LOCUS_03800 361483 362694 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763080.1 protein_id gnl|my_center|LOCUS_03800 362733 363680 gene locus_tag LOCUS_03810 gene rbsK 362733 363680 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980414.1 protein_id gnl|my_center|LOCUS_03810 363840 365735 gene locus_tag LOCUS_03820 363840 365735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 365722 366450 gene locus_tag LOCUS_03830 365722 366450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 366447 367043 gene locus_tag LOCUS_03840 366447 367043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 369879 367036 gene locus_tag LOCUS_03850 369879 367036 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762372.1 protein_id gnl|my_center|LOCUS_03850 370080 370991 gene locus_tag LOCUS_03860 370080 370991 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925117.1 protein_id gnl|my_center|LOCUS_03860 370969 371349 gene locus_tag LOCUS_03870 370969 371349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 371778 371368 gene locus_tag LOCUS_03880 gene mce 371778 371368 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879707.1 protein_id gnl|my_center|LOCUS_03880 372168 371779 gene locus_tag LOCUS_03890 372168 371779 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146517.1 protein_id gnl|my_center|LOCUS_03890 372295 373257 gene locus_tag LOCUS_03900 372295 373257 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240546.1 protein_id gnl|my_center|LOCUS_03900 373422 374339 gene locus_tag LOCUS_03910 373422 374339 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229489.1 protein_id gnl|my_center|LOCUS_03910 374404 376125 gene locus_tag LOCUS_03920 374404 376125 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979131.1 protein_id gnl|my_center|LOCUS_03920 376194 377591 gene locus_tag LOCUS_03930 376194 377591 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040627.1 protein_id gnl|my_center|LOCUS_03930 377757 378272 gene locus_tag LOCUS_03940 377757 378272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 379631 378594 gene locus_tag LOCUS_03950 379631 378594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 379755 380696 gene locus_tag LOCUS_03960 379755 380696 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583661.1 protein_id gnl|my_center|LOCUS_03960 381706 380720 gene locus_tag LOCUS_03970 381706 380720 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978683.1 protein_id gnl|my_center|LOCUS_03970 381936 383363 gene locus_tag LOCUS_03980 381936 383363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 383465 384604 gene locus_tag LOCUS_03990 383465 384604 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229031.1 protein_id gnl|my_center|LOCUS_03990 387036 384634 gene locus_tag LOCUS_04000 387036 384634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 387662 387234 gene locus_tag LOCUS_04010 387662 387234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 388184 387672 gene locus_tag LOCUS_04020 388184 387672 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878466.1 protein_id gnl|my_center|LOCUS_04020 388327 389070 gene locus_tag LOCUS_04030 388327 389070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 389077 390522 gene locus_tag LOCUS_04040 389077 390522 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979726.1 protein_id gnl|my_center|LOCUS_04040 390519 390776 gene locus_tag LOCUS_04050 390519 390776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 391952 390771 gene locus_tag LOCUS_04060 391952 390771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 392076 392885 gene locus_tag LOCUS_04070 392076 392885 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249248.1 protein_id gnl|my_center|LOCUS_04070 392882 393316 gene locus_tag LOCUS_04080 392882 393316 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020176.1 protein_id gnl|my_center|LOCUS_04080 393749 393306 gene locus_tag LOCUS_04090 393749 393306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 394554 393880 gene locus_tag LOCUS_04100 394554 393880 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_04100 395223 394717 gene locus_tag LOCUS_04110 395223 394717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 397139 395343 gene locus_tag LOCUS_04120 397139 395343 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_04120 398766 397234 gene locus_tag LOCUS_04130 398766 397234 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980566.1 protein_id gnl|my_center|LOCUS_04130 400281 398845 gene locus_tag LOCUS_04140 gene proS 400281 398845 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583195.1 protein_id gnl|my_center|LOCUS_04140 400574 400401 gene locus_tag LOCUS_04150 400574 400401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 401378 400665 gene locus_tag LOCUS_04160 401378 400665 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979662.1 protein_id gnl|my_center|LOCUS_04160 401499 401927 gene locus_tag LOCUS_04170 401499 401927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 402044 404494 gene locus_tag LOCUS_04180 402044 404494 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974204.1 protein_id gnl|my_center|LOCUS_04180 404957 404574 gene locus_tag LOCUS_04190 404957 404574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 406416 404995 gene locus_tag LOCUS_04200 406416 404995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 406515 408305 gene locus_tag LOCUS_04210 406515 408305 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846917.1 protein_id gnl|my_center|LOCUS_04210 408377 410281 gene locus_tag LOCUS_04220 gene glgB 408377 410281 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_04220 410841 410332 gene locus_tag LOCUS_04230 410841 410332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 410913 411734 gene locus_tag LOCUS_04240 410913 411734 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846813.1 protein_id gnl|my_center|LOCUS_04240 411771 413462 gene locus_tag LOCUS_04250 411771 413462 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979769.1 protein_id gnl|my_center|LOCUS_04250 414448 413687 gene locus_tag LOCUS_04260 414448 413687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 415743 414505 gene locus_tag LOCUS_04270 415743 414505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 416850 415765 gene locus_tag LOCUS_04280 416850 415765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 418498 416966 gene locus_tag LOCUS_04290 418498 416966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 420626 419310 gene locus_tag LOCUS_04300 420626 419310 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978848.1 protein_id gnl|my_center|LOCUS_04300 424090 424347 gene locus_tag LOCUS_04310 424090 424347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 424412 424633 gene locus_tag LOCUS_04320 424412 424633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 425192 425893 gene locus_tag LOCUS_04330 425192 425893 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545742.1 protein_id gnl|my_center|LOCUS_04330 426658 426227 gene locus_tag LOCUS_04340 426658 426227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 426936 426658 gene locus_tag LOCUS_04350 426936 426658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 427355 427507 gene locus_tag LOCUS_04360 427355 427507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 427535 427918 gene locus_tag LOCUS_04370 427535 427918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 428008 428643 gene locus_tag LOCUS_04380 428008 428643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139679809.1 protein_id gnl|my_center|LOCUS_04380 428640 428873 gene locus_tag LOCUS_04390 428640 428873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 428930 428854 gene locus_tag LOCUS_t00040 428930 428854 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 429024 429653 gene locus_tag LOCUS_04400 429024 429653 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392225.1 protein_id gnl|my_center|LOCUS_04400 430003 429656 gene locus_tag LOCUS_04410 430003 429656 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979093.1 protein_id gnl|my_center|LOCUS_04410 430093 431775 gene locus_tag LOCUS_04420 gene glyS 430093 431775 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978316.1 protein_id gnl|my_center|LOCUS_04420 433231 431900 gene locus_tag LOCUS_04430 433231 431900 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888344.1 protein_id gnl|my_center|LOCUS_04430 433338 433778 gene locus_tag LOCUS_04440 gene mntR 433338 433778 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398443.1 protein_id gnl|my_center|LOCUS_04440 434561 433749 gene locus_tag LOCUS_04450 434561 433749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 435375 434668 gene locus_tag LOCUS_04460 435375 434668 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250639.1 protein_id gnl|my_center|LOCUS_04460 436954 435476 gene locus_tag LOCUS_04470 436954 435476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 437961 436951 gene locus_tag LOCUS_04480 437961 436951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 438093 438509 gene locus_tag LOCUS_04490 438093 438509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 438997 438500 gene locus_tag LOCUS_04500 438997 438500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 439470 438994 gene locus_tag LOCUS_04510 439470 438994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 441679 439739 gene locus_tag LOCUS_04520 gene gatE 441679 439739 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869511.1 protein_id gnl|my_center|LOCUS_04520 443012 441681 gene locus_tag LOCUS_04530 gene gatD 443012 441681 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867819.1 protein_id gnl|my_center|LOCUS_04530 443209 444393 gene locus_tag LOCUS_04540 443209 444393 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142358.1 protein_id gnl|my_center|LOCUS_04540 444529 445383 gene locus_tag LOCUS_04550 444529 445383 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980458.1 protein_id gnl|my_center|LOCUS_04550 445380 445721 gene locus_tag LOCUS_04560 445380 445721 CDS product DUF1634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980460.1 protein_id gnl|my_center|LOCUS_04560 445982 447292 gene locus_tag LOCUS_04570 gene rbcL 445982 447292 CDS product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146906.1 protein_id gnl|my_center|LOCUS_04570 447376 448872 gene locus_tag LOCUS_04580 gene pckA 447376 448872 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478630.1 protein_id gnl|my_center|LOCUS_04580 449013 449204 gene locus_tag LOCUS_04590 449013 449204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 >Feature sequence02 1079 2356 gene locus_tag LOCUS_04600 1079 2356 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980072.1 protein_id gnl|my_center|LOCUS_04600 3043 2968 gene locus_tag LOCUS_t00050 3043 2968 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5299 3686 gene locus_tag LOCUS_04610 gene pheT 5299 3686 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878921.1 protein_id gnl|my_center|LOCUS_04610 6732 5320 gene locus_tag LOCUS_04620 6732 5320 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879447.1 protein_id gnl|my_center|LOCUS_04620 7319 6819 gene locus_tag LOCUS_04630 7319 6819 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061166.1 protein_id gnl|my_center|LOCUS_04630 7445 8344 gene locus_tag LOCUS_04640 gene map 7445 8344 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250134.1 protein_id gnl|my_center|LOCUS_04640 8528 8328 gene locus_tag LOCUS_04650 8528 8328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 9663 8542 gene locus_tag LOCUS_04660 9663 8542 CDS product DUF1512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979465.1 protein_id gnl|my_center|LOCUS_04660 9855 9748 gene locus_tag LOCUS_r00010 9855 9748 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 10042 10287 gene locus_tag LOCUS_04670 10042 10287 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867737.1 protein_id gnl|my_center|LOCUS_04670 10296 13664 gene locus_tag LOCUS_04680 10296 13664 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250034.1 protein_id gnl|my_center|LOCUS_04680 13675 17487 gene locus_tag LOCUS_04690 13675 17487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 17491 17823 gene locus_tag LOCUS_04700 17491 17823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 17842 18315 gene locus_tag LOCUS_04710 17842 18315 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876680.1 protein_id gnl|my_center|LOCUS_04710 18361 18810 gene locus_tag LOCUS_04720 18361 18810 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876681.1 protein_id gnl|my_center|LOCUS_04720 18834 19427 gene locus_tag LOCUS_04730 18834 19427 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978220.1 protein_id gnl|my_center|LOCUS_04730 19463 21433 gene locus_tag LOCUS_04740 19463 21433 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_04740 21521 22834 gene locus_tag LOCUS_04750 gene tuf 21521 22834 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978219.1 protein_id gnl|my_center|LOCUS_04750 23873 22968 gene locus_tag LOCUS_04760 23873 22968 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742683.1 protein_id gnl|my_center|LOCUS_04760 24440 25000 gene locus_tag LOCUS_04770 24440 25000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 26242 27081 gene locus_tag LOCUS_04780 26242 27081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 27160 28314 gene locus_tag LOCUS_04790 27160 28314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 28314 28955 gene locus_tag LOCUS_04800 gene ftsE 28314 28955 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228039.1 protein_id gnl|my_center|LOCUS_04800 29573 29500 gene locus_tag LOCUS_t00060 29573 29500 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 29819 30871 gene locus_tag LOCUS_04810 29819 30871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 31979 30855 gene locus_tag LOCUS_04820 gene truD 31979 30855 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879173.1 protein_id gnl|my_center|LOCUS_04820 32375 31995 gene locus_tag LOCUS_04830 gene pth2 32375 31995 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251250.1 protein_id gnl|my_center|LOCUS_04830 33043 32420 gene locus_tag LOCUS_04840 33043 32420 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384435.1 protein_id gnl|my_center|LOCUS_04840 33182 34327 gene locus_tag LOCUS_04850 33182 34327 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061129.1 protein_id gnl|my_center|LOCUS_04850 35366 35644 gene locus_tag LOCUS_04860 35366 35644 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021485.1 protein_id gnl|my_center|LOCUS_04860 35700 37868 gene locus_tag LOCUS_04870 35700 37868 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429724.1 protein_id gnl|my_center|LOCUS_04870 37930 38169 gene locus_tag LOCUS_04880 37930 38169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 38194 39219 gene locus_tag LOCUS_04890 gene fen 38194 39219 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250232.1 protein_id gnl|my_center|LOCUS_04890 39224 39883 gene locus_tag LOCUS_04900 39224 39883 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879811.1 protein_id gnl|my_center|LOCUS_04900 40090 40329 gene locus_tag LOCUS_04910 40090 40329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 40370 40783 gene locus_tag LOCUS_04920 gene lysM 40370 40783 CDS product HTH-type transcriptional regulator LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978132.1 protein_id gnl|my_center|LOCUS_04920 40884 41153 gene locus_tag LOCUS_04930 40884 41153 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979253.1 protein_id gnl|my_center|LOCUS_04930 41586 41260 gene locus_tag LOCUS_04940 41586 41260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 42128 41583 gene locus_tag LOCUS_04950 42128 41583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 42580 42158 gene locus_tag LOCUS_04960 42580 42158 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868849.1 protein_id gnl|my_center|LOCUS_04960 42579 43616 gene locus_tag LOCUS_04970 42579 43616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04970 43613 44242 gene locus_tag LOCUS_04980 43613 44242 CDS product Kae1-associated kinase Bud32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249630.1 protein_id gnl|my_center|LOCUS_04980 44300 44812 gene locus_tag LOCUS_04990 44300 44812 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762369.1 protein_id gnl|my_center|LOCUS_04990 45006 45455 gene locus_tag LOCUS_05000 45006 45455 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978348.1 protein_id gnl|my_center|LOCUS_05000 45469 46872 gene locus_tag LOCUS_05010 45469 46872 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064974.1 protein_id gnl|my_center|LOCUS_05010 46874 47125 gene locus_tag LOCUS_05020 46874 47125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 47125 48396 gene locus_tag LOCUS_05030 gene serS 47125 48396 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868451.1 protein_id gnl|my_center|LOCUS_05030 48487 49116 gene locus_tag LOCUS_05040 48487 49116 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978426.1 protein_id gnl|my_center|LOCUS_05040 50302 49103 gene locus_tag LOCUS_05050 50302 49103 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978424.1 protein_id gnl|my_center|LOCUS_05050 50335 51678 gene locus_tag LOCUS_05060 50335 51678 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496570.1 protein_id gnl|my_center|LOCUS_05060 51719 52630 gene locus_tag LOCUS_05070 51719 52630 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146653.1 protein_id gnl|my_center|LOCUS_05070 53586 52681 gene locus_tag LOCUS_05080 53586 52681 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978840.1 protein_id gnl|my_center|LOCUS_05080 53912 54238 gene locus_tag LOCUS_05090 53912 54238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 54321 54932 gene locus_tag LOCUS_05100 54321 54932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 55569 54916 gene locus_tag LOCUS_05110 55569 54916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 56378 55719 gene locus_tag LOCUS_05120 56378 55719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 56993 56391 gene locus_tag LOCUS_05130 gene psmB 56993 56391 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978284.1 protein_id gnl|my_center|LOCUS_05130 58031 57087 gene locus_tag LOCUS_05140 gene rtcA 58031 57087 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762505.1 protein_id gnl|my_center|LOCUS_05140 58205 58747 gene locus_tag LOCUS_05150 58205 58747 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868691.1 protein_id gnl|my_center|LOCUS_05150 58793 60835 gene locus_tag LOCUS_05160 58793 60835 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980573.1 protein_id gnl|my_center|LOCUS_05160 60884 62071 gene locus_tag LOCUS_05170 60884 62071 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061314.1 protein_id gnl|my_center|LOCUS_05170 62567 63403 gene locus_tag LOCUS_05180 62567 63403 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870336.1 protein_id gnl|my_center|LOCUS_05180 63843 63406 gene locus_tag LOCUS_05190 63843 63406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 63987 65204 gene locus_tag LOCUS_05200 63987 65204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 65755 65270 gene locus_tag LOCUS_05210 65755 65270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 66971 65925 gene locus_tag LOCUS_05220 66971 65925 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978305.1 protein_id gnl|my_center|LOCUS_05220 67238 67852 gene locus_tag LOCUS_05230 gene psmB 67238 67852 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876826.1 protein_id gnl|my_center|LOCUS_05230 67864 69783 gene locus_tag LOCUS_05240 67864 69783 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876827.1 protein_id gnl|my_center|LOCUS_05240 70850 69795 gene locus_tag LOCUS_05250 70850 69795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 71316 71023 gene locus_tag LOCUS_05260 71316 71023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 71626 72168 gene locus_tag LOCUS_05270 71626 72168 CDS product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147114.1 protein_id gnl|my_center|LOCUS_05270 72645 72160 gene locus_tag LOCUS_05280 72645 72160 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763381.1 protein_id gnl|my_center|LOCUS_05280 72731 72988 gene locus_tag LOCUS_05290 72731 72988 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846912.1 protein_id gnl|my_center|LOCUS_05290 73231 73884 gene locus_tag LOCUS_05300 73231 73884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 73895 74590 gene locus_tag LOCUS_05310 gene rpiA 73895 74590 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192848.1 protein_id gnl|my_center|LOCUS_05310 74623 75642 gene locus_tag LOCUS_05320 74623 75642 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877133.1 protein_id gnl|my_center|LOCUS_05320 76558 75683 gene locus_tag LOCUS_05330 76558 75683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 77082 76579 gene locus_tag LOCUS_05340 77082 76579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 77231 77701 gene locus_tag LOCUS_05350 77231 77701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 77995 78522 gene locus_tag LOCUS_05360 77995 78522 CDS product hydrogenase 3 maturation endopeptidase HyCI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546218.1 protein_id gnl|my_center|LOCUS_05360 78519 78863 gene locus_tag LOCUS_05370 78519 78863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 78860 79297 gene locus_tag LOCUS_05380 78860 79297 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546559.1 protein_id gnl|my_center|LOCUS_05380 79298 79756 gene locus_tag LOCUS_05390 79298 79756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 79749 80987 gene locus_tag LOCUS_05400 79749 80987 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937737.1 protein_id gnl|my_center|LOCUS_05400 80993 81952 gene locus_tag LOCUS_05410 gene nuoH 80993 81952 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573431.1 protein_id gnl|my_center|LOCUS_05410 81958 82353 gene locus_tag LOCUS_05420 81958 82353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 82343 82825 gene locus_tag LOCUS_05430 82343 82825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 82822 83142 gene locus_tag LOCUS_05440 82822 83142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 83139 84863 gene locus_tag LOCUS_05450 gene nuoL 83139 84863 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_05450 84860 86302 gene locus_tag LOCUS_05460 84860 86302 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003041292.1 protein_id gnl|my_center|LOCUS_05460 86353 86670 gene locus_tag LOCUS_05470 86353 86670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 87394 86675 gene locus_tag LOCUS_05480 87394 86675 CDS product DUF6390 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894094.1 protein_id gnl|my_center|LOCUS_05480 87696 87418 gene locus_tag LOCUS_05490 87696 87418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 88973 87807 gene locus_tag LOCUS_05500 88973 87807 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879506.1 protein_id gnl|my_center|LOCUS_05500 89169 89441 gene locus_tag LOCUS_05510 89169 89441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 89920 92292 gene locus_tag LOCUS_05520 89920 92292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 92692 92276 gene locus_tag LOCUS_05530 92692 92276 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889277.1 protein_id gnl|my_center|LOCUS_05530 93113 93694 gene locus_tag LOCUS_05540 93113 93694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 93900 95084 gene locus_tag LOCUS_05550 93900 95084 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881185.1 protein_id gnl|my_center|LOCUS_05550 95074 95493 gene locus_tag LOCUS_05560 95074 95493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 95496 96431 gene locus_tag LOCUS_05570 95496 96431 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147080.1 protein_id gnl|my_center|LOCUS_05570 97074 96445 gene locus_tag LOCUS_05580 97074 96445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 97404 97087 gene locus_tag LOCUS_05590 97404 97087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 97601 97876 gene locus_tag LOCUS_05600 97601 97876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 97990 98562 gene locus_tag LOCUS_05610 97990 98562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 99946 98753 gene locus_tag LOCUS_05620 99946 98753 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830888.1 protein_id gnl|my_center|LOCUS_05620 100093 100434 gene locus_tag LOCUS_05630 100093 100434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 100556 101065 gene locus_tag LOCUS_05640 100556 101065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 102135 101545 gene locus_tag LOCUS_05650 102135 101545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 102967 102350 gene locus_tag LOCUS_05660 102967 102350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 103028 103792 gene locus_tag LOCUS_05670 103028 103792 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805196.1 protein_id gnl|my_center|LOCUS_05670 105344 103779 gene locus_tag LOCUS_05680 105344 103779 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 protein_id gnl|my_center|LOCUS_05680 105629 106060 gene locus_tag LOCUS_05690 105629 106060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 106151 106227 gene locus_tag LOCUS_t00070 106151 106227 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 106843 106478 gene locus_tag LOCUS_05700 106843 106478 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545148.1 protein_id gnl|my_center|LOCUS_05700 108180 107017 gene locus_tag LOCUS_05710 gene gtdA 108180 107017 CDS product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131688.1 protein_id gnl|my_center|LOCUS_05710 108388 110736 gene locus_tag LOCUS_05720 108388 110736 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259305.1 protein_id gnl|my_center|LOCUS_05720 111939 110779 gene locus_tag LOCUS_05730 111939 110779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 112081 112575 gene locus_tag LOCUS_05740 gene cutC 112081 112575 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846892.1 protein_id gnl|my_center|LOCUS_05740 112598 113413 gene locus_tag LOCUS_05750 112598 113413 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727461.1 protein_id gnl|my_center|LOCUS_05750 113477 114241 gene locus_tag LOCUS_05760 113477 114241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 114234 115007 gene locus_tag LOCUS_05770 gene ssuC 114234 115007 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213853.1 protein_id gnl|my_center|LOCUS_05770 116085 115063 gene locus_tag LOCUS_05780 116085 115063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 117672 116203 gene locus_tag LOCUS_05790 gene eutA 117672 116203 CDS product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868839.1 protein_id gnl|my_center|LOCUS_05790 118872 117778 gene locus_tag LOCUS_05800 118872 117778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 118977 119531 gene locus_tag LOCUS_05810 118977 119531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 119532 120152 gene locus_tag LOCUS_05820 119532 120152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 120257 121228 gene locus_tag LOCUS_05830 120257 121228 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807628.1 protein_id gnl|my_center|LOCUS_05830 121248 122267 gene locus_tag LOCUS_05840 121248 122267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 122331 123143 gene locus_tag LOCUS_05850 122331 123143 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943778.1 protein_id gnl|my_center|LOCUS_05850 123167 124081 gene locus_tag LOCUS_05860 123167 124081 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240519.1 protein_id gnl|my_center|LOCUS_05860 124330 124106 gene locus_tag LOCUS_05870 124330 124106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 124511 125302 gene locus_tag LOCUS_05880 124511 125302 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 protein_id gnl|my_center|LOCUS_05880 126476 125307 gene locus_tag LOCUS_05890 126476 125307 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_05890 127744 127322 gene locus_tag LOCUS_05900 127744 127322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 129345 129791 gene locus_tag LOCUS_05910 129345 129791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 130128 130499 gene locus_tag LOCUS_05920 130128 130499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 130610 130912 gene locus_tag LOCUS_05930 130610 130912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 130912 131637 gene locus_tag LOCUS_05940 130912 131637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 131634 131846 gene locus_tag LOCUS_05950 131634 131846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 131843 132814 gene locus_tag LOCUS_05960 131843 132814 CDS product UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884438.1 protein_id gnl|my_center|LOCUS_05960 132826 134151 gene locus_tag LOCUS_05970 132826 134151 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250183.1 protein_id gnl|my_center|LOCUS_05970 134401 135279 gene locus_tag LOCUS_05980 134401 135279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 135276 136265 gene locus_tag LOCUS_05990 135276 136265 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990845.1 protein_id gnl|my_center|LOCUS_05990 136265 138427 gene locus_tag LOCUS_06000 136265 138427 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924817.1 protein_id gnl|my_center|LOCUS_06000 138440 139411 gene locus_tag LOCUS_06010 138440 139411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 139408 140304 gene locus_tag LOCUS_06020 139408 140304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 140285 142033 gene locus_tag LOCUS_06030 140285 142033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 142034 144253 gene locus_tag LOCUS_06040 142034 144253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 144250 144624 gene locus_tag LOCUS_06050 144250 144624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 144693 145772 gene locus_tag LOCUS_06060 144693 145772 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868579.1 protein_id gnl|my_center|LOCUS_06060 145780 146730 gene locus_tag LOCUS_06070 145780 146730 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_06070 146693 147886 gene locus_tag LOCUS_06080 146693 147886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 147862 149112 gene locus_tag LOCUS_06090 147862 149112 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022158.1 protein_id gnl|my_center|LOCUS_06090 149113 150069 gene locus_tag LOCUS_06100 149113 150069 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_06100 150078 151400 gene locus_tag LOCUS_06110 150078 151400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 151378 152499 gene locus_tag LOCUS_06120 151378 152499 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_06120 152496 154106 gene locus_tag LOCUS_06130 152496 154106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 154106 158434 gene locus_tag LOCUS_06140 154106 158434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 158666 159247 gene locus_tag LOCUS_06150 158666 159247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 159350 160450 gene locus_tag LOCUS_06160 159350 160450 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250274.1 protein_id gnl|my_center|LOCUS_06160 160477 164364 gene locus_tag LOCUS_06170 160477 164364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 167997 164383 gene locus_tag LOCUS_06180 167997 164383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 168254 168874 gene locus_tag LOCUS_06190 168254 168874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 168892 169983 gene locus_tag LOCUS_06200 168892 169983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 170098 170913 gene locus_tag LOCUS_06210 170098 170913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 171092 171967 gene locus_tag LOCUS_06220 171092 171967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 172266 172769 gene locus_tag LOCUS_06230 172266 172769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 172856 174193 gene locus_tag LOCUS_06240 172856 174193 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064256.1 protein_id gnl|my_center|LOCUS_06240 174190 174927 gene locus_tag LOCUS_06250 174190 174927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 174931 176331 gene locus_tag LOCUS_06260 174931 176331 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868281.1 protein_id gnl|my_center|LOCUS_06260 176375 177061 gene locus_tag LOCUS_06270 176375 177061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 177368 177997 gene locus_tag LOCUS_06280 177368 177997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 179203 178214 gene locus_tag LOCUS_06290 179203 178214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 179442 179915 gene locus_tag LOCUS_06300 179442 179915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 180099 180425 gene locus_tag LOCUS_06310 180099 180425 CDS product DUF4364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978761.1 protein_id gnl|my_center|LOCUS_06310 180660 181106 gene locus_tag LOCUS_06320 180660 181106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 181453 181151 gene locus_tag LOCUS_06330 181453 181151 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978640.1 protein_id gnl|my_center|LOCUS_06330 181842 183308 gene locus_tag LOCUS_06340 181842 183308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 183424 184572 gene locus_tag LOCUS_06350 183424 184572 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868366.1 protein_id gnl|my_center|LOCUS_06350 184566 185894 gene locus_tag LOCUS_06360 184566 185894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 186020 187084 gene locus_tag LOCUS_06370 186020 187084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 187088 187843 gene locus_tag LOCUS_06380 187088 187843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 187840 188094 gene locus_tag LOCUS_06390 187840 188094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 188180 189133 gene locus_tag LOCUS_06400 188180 189133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 189123 190076 gene locus_tag LOCUS_06410 189123 190076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 190091 191485 gene locus_tag LOCUS_06420 190091 191485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 191475 192632 gene locus_tag LOCUS_06430 191475 192632 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978258.1 protein_id gnl|my_center|LOCUS_06430 192667 192912 gene locus_tag LOCUS_06440 192667 192912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 193633 192926 gene locus_tag LOCUS_06450 193633 192926 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444475.1 protein_id gnl|my_center|LOCUS_06450 193816 195171 gene locus_tag LOCUS_06460 193816 195171 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_06460 195281 195709 gene locus_tag LOCUS_06470 gene moaC 195281 195709 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978449.1 protein_id gnl|my_center|LOCUS_06470 195706 196230 gene locus_tag LOCUS_06480 195706 196230 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762932.1 protein_id gnl|my_center|LOCUS_06480 196563 196210 gene locus_tag LOCUS_06490 196563 196210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 197305 196565 gene locus_tag LOCUS_06500 197305 196565 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249696.1 protein_id gnl|my_center|LOCUS_06500 198154 197306 gene locus_tag LOCUS_06510 198154 197306 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877312.1 protein_id gnl|my_center|LOCUS_06510 198984 198145 gene locus_tag LOCUS_06520 198984 198145 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867495.1 protein_id gnl|my_center|LOCUS_06520 200267 199233 gene locus_tag LOCUS_06530 200267 199233 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870502.1 protein_id gnl|my_center|LOCUS_06530 200653 200273 gene locus_tag LOCUS_06540 200653 200273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 200907 200650 gene locus_tag LOCUS_06550 200907 200650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 201097 200885 gene locus_tag LOCUS_06560 201097 200885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 201914 201081 gene locus_tag LOCUS_06570 gene rrp42 201914 201081 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867735.1 protein_id gnl|my_center|LOCUS_06570 202643 201915 gene locus_tag LOCUS_06580 gene rrp41 202643 201915 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867734.1 protein_id gnl|my_center|LOCUS_06580 203400 202648 gene locus_tag LOCUS_06590 gene rrp4 203400 202648 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876323.1 protein_id gnl|my_center|LOCUS_06590 204090 203401 gene locus_tag LOCUS_06600 204090 203401 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762590.1 protein_id gnl|my_center|LOCUS_06600 204867 204226 gene locus_tag LOCUS_06610 204867 204226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 205678 204947 gene locus_tag LOCUS_06620 205678 204947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 206455 205724 gene locus_tag LOCUS_06630 gene psmA 206455 205724 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877997.1 protein_id gnl|my_center|LOCUS_06630 206585 207652 gene locus_tag LOCUS_06640 gene mtnA 206585 207652 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080652.1 protein_id gnl|my_center|LOCUS_06640 207694 208347 gene locus_tag LOCUS_06650 207694 208347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 208801 208364 gene locus_tag LOCUS_06660 208801 208364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 208947 209273 gene locus_tag LOCUS_06670 208947 209273 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902485.1 protein_id gnl|my_center|LOCUS_06670 209844 209257 gene locus_tag LOCUS_06680 209844 209257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 210108 211367 gene locus_tag LOCUS_06690 210108 211367 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_06690 211501 212583 gene locus_tag LOCUS_06700 211501 212583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 212610 213095 gene locus_tag LOCUS_06710 212610 213095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 213495 213217 gene locus_tag LOCUS_06720 213495 213217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 213830 213555 gene locus_tag LOCUS_06730 213830 213555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 213741 215702 gene locus_tag LOCUS_06740 213741 215702 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618845.1 protein_id gnl|my_center|LOCUS_06740 217707 215713 gene locus_tag LOCUS_06750 217707 215713 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234782358.1 protein_id gnl|my_center|LOCUS_06750 219378 217792 gene locus_tag LOCUS_06760 219378 217792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 220523 219759 gene locus_tag LOCUS_06770 gene deoC 220523 219759 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763033.1 protein_id gnl|my_center|LOCUS_06770 222096 220645 gene locus_tag LOCUS_06780 222096 220645 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_06780 222628 222284 gene locus_tag LOCUS_06790 222628 222284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 224192 222747 gene locus_tag LOCUS_06800 224192 222747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979730.1 protein_id gnl|my_center|LOCUS_06800 225097 224189 gene locus_tag LOCUS_06810 225097 224189 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979801.1 protein_id gnl|my_center|LOCUS_06810 225553 225188 gene locus_tag LOCUS_06820 225553 225188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 225934 226236 gene locus_tag LOCUS_06830 225934 226236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 226233 226679 gene locus_tag LOCUS_06840 226233 226679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 226806 227084 gene locus_tag LOCUS_06850 226806 227084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 227667 227248 gene locus_tag LOCUS_06860 227667 227248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 228782 227754 gene locus_tag LOCUS_06870 228782 227754 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842311.1 protein_id gnl|my_center|LOCUS_06870 228894 230549 gene locus_tag LOCUS_06880 228894 230549 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879525.1 protein_id gnl|my_center|LOCUS_06880 232124 230649 gene locus_tag LOCUS_06890 232124 230649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 233458 232136 gene locus_tag LOCUS_06900 233458 232136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 235061 233736 gene locus_tag LOCUS_06910 235061 233736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 235699 235139 gene locus_tag LOCUS_06920 235699 235139 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469482.1 protein_id gnl|my_center|LOCUS_06920 235803 237611 gene locus_tag LOCUS_06930 235803 237611 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_06930 238513 237677 gene locus_tag LOCUS_06940 238513 237677 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941492.1 protein_id gnl|my_center|LOCUS_06940 238982 239581 gene locus_tag LOCUS_06950 238982 239581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 239660 240001 gene locus_tag LOCUS_06960 239660 240001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 240767 240288 gene locus_tag LOCUS_06970 gene kdpC 240767 240288 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388912.1 protein_id gnl|my_center|LOCUS_06970 242872 240773 gene locus_tag LOCUS_06980 gene kdpB 242872 240773 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943118.1 protein_id gnl|my_center|LOCUS_06980 244603 242945 gene locus_tag LOCUS_06990 gene kdpA 244603 242945 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638330.1 protein_id gnl|my_center|LOCUS_06990 244979 244662 gene locus_tag LOCUS_07000 244979 244662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 246074 245118 gene locus_tag LOCUS_07010 246074 245118 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243771.1 protein_id gnl|my_center|LOCUS_07010 246405 246599 gene locus_tag LOCUS_07020 246405 246599 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979944.1 protein_id gnl|my_center|LOCUS_07020 246865 248553 gene locus_tag LOCUS_07030 246865 248553 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229182.1 protein_id gnl|my_center|LOCUS_07030 248554 250110 gene locus_tag LOCUS_07040 248554 250110 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015590753.1 protein_id gnl|my_center|LOCUS_07040 250656 250264 gene locus_tag LOCUS_07050 250656 250264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 251442 250663 gene locus_tag LOCUS_07060 251442 250663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 251939 251442 gene locus_tag LOCUS_07070 251939 251442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 253004 251943 gene locus_tag LOCUS_07080 253004 251943 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979941.1 protein_id gnl|my_center|LOCUS_07080 254317 253007 gene locus_tag LOCUS_07090 254317 253007 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846995.1 protein_id gnl|my_center|LOCUS_07090 255084 254320 gene locus_tag LOCUS_07100 255084 254320 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880210.1 protein_id gnl|my_center|LOCUS_07100 255226 255603 gene locus_tag LOCUS_07110 255226 255603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 255609 256046 gene locus_tag LOCUS_07120 255609 256046 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881076.1 protein_id gnl|my_center|LOCUS_07120 256072 256719 gene locus_tag LOCUS_07130 256072 256719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 257190 256786 gene locus_tag LOCUS_07140 257190 256786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 257523 257879 gene locus_tag LOCUS_07150 257523 257879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 260410 257921 gene locus_tag LOCUS_07160 260410 257921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 260633 262093 gene locus_tag LOCUS_07170 260633 262093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 262319 262741 gene locus_tag LOCUS_07180 262319 262741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 262867 263631 gene locus_tag LOCUS_07190 262867 263631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 263635 264102 gene locus_tag LOCUS_07200 gene aprB 263635 264102 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879165.1 protein_id gnl|my_center|LOCUS_07200 264099 265943 gene locus_tag LOCUS_07210 gene aprA 264099 265943 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879166.1 protein_id gnl|my_center|LOCUS_07210 265970 267124 gene locus_tag LOCUS_07220 gene sat 265970 267124 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868287.1 protein_id gnl|my_center|LOCUS_07220 267359 267153 gene locus_tag LOCUS_07230 267359 267153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 267905 268840 gene locus_tag LOCUS_07240 267905 268840 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259143.1 protein_id gnl|my_center|LOCUS_07240 270659 268866 gene locus_tag LOCUS_07250 270659 268866 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979987.1 protein_id gnl|my_center|LOCUS_07250 271730 270672 gene locus_tag LOCUS_07260 271730 270672 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846673.1 protein_id gnl|my_center|LOCUS_07260 273126 271738 gene locus_tag LOCUS_07270 273126 271738 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156015092.1 protein_id gnl|my_center|LOCUS_07270 274328 273291 gene locus_tag LOCUS_07280 274328 273291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 275378 274461 gene locus_tag LOCUS_07290 275378 274461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 276477 275503 gene locus_tag LOCUS_07300 276477 275503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 277068 276826 gene locus_tag LOCUS_07310 277068 276826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 279128 277065 gene locus_tag LOCUS_07320 279128 277065 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861457.1 protein_id gnl|my_center|LOCUS_07320 279880 279248 gene locus_tag LOCUS_07330 279880 279248 CDS product TRASH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249785.1 protein_id gnl|my_center|LOCUS_07330 279956 280123 gene locus_tag LOCUS_07340 279956 280123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 280865 280167 gene locus_tag LOCUS_07350 280865 280167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 281114 281719 gene locus_tag LOCUS_07360 281114 281719 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_07360 281817 282995 gene locus_tag LOCUS_07370 281817 282995 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141490.1 protein_id gnl|my_center|LOCUS_07370 283289 284821 gene locus_tag LOCUS_07380 283289 284821 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978681.1 protein_id gnl|my_center|LOCUS_07380 285423 285073 gene locus_tag LOCUS_07390 285423 285073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07390 286142 285420 gene locus_tag LOCUS_07400 286142 285420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07400 286448 286170 gene locus_tag LOCUS_07410 286448 286170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07410 287122 286718 gene locus_tag LOCUS_07420 287122 286718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 287173 288078 gene locus_tag LOCUS_07430 287173 288078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 288141 289754 gene locus_tag LOCUS_07440 288141 289754 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980566.1 protein_id gnl|my_center|LOCUS_07440 289916 291016 gene locus_tag LOCUS_07450 289916 291016 CDS product muconate/chloromuconate family cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206897.1 protein_id gnl|my_center|LOCUS_07450 291083 292213 gene locus_tag LOCUS_07460 291083 292213 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704492.1 protein_id gnl|my_center|LOCUS_07460 292217 293167 gene locus_tag LOCUS_07470 292217 293167 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978653.1 protein_id gnl|my_center|LOCUS_07470 294004 293195 gene locus_tag LOCUS_07480 294004 293195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013597.1 protein_id gnl|my_center|LOCUS_07480 295598 294234 gene locus_tag LOCUS_07490 295598 294234 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455014.1 protein_id gnl|my_center|LOCUS_07490 297337 295709 gene locus_tag LOCUS_07500 297337 295709 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_07500 298597 297437 gene locus_tag LOCUS_07510 298597 297437 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925160.1 protein_id gnl|my_center|LOCUS_07510 300078 298594 gene locus_tag LOCUS_07520 300078 298594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 300335 301066 gene locus_tag LOCUS_07530 300335 301066 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089550.1 protein_id gnl|my_center|LOCUS_07530 301189 302574 gene locus_tag LOCUS_07540 301189 302574 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083638.1 protein_id gnl|my_center|LOCUS_07540 303550 302558 gene locus_tag LOCUS_07550 gene ala 303550 302558 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879161.1 protein_id gnl|my_center|LOCUS_07550 303897 305258 gene locus_tag LOCUS_07560 303897 305258 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483346.1 protein_id gnl|my_center|LOCUS_07560 305777 305367 gene locus_tag LOCUS_07570 305777 305367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 305983 306882 gene locus_tag LOCUS_07580 305983 306882 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055428724.1 protein_id gnl|my_center|LOCUS_07580 308746 306872 gene locus_tag LOCUS_07590 308746 306872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 310074 309130 gene locus_tag LOCUS_07600 310074 309130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 310188 310919 gene locus_tag LOCUS_07610 310188 310919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 310977 313208 gene locus_tag LOCUS_07620 310977 313208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 313257 314114 gene locus_tag LOCUS_07630 313257 314114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 314863 314336 gene locus_tag LOCUS_07640 314863 314336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 315357 315752 gene locus_tag LOCUS_07650 315357 315752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 315850 316320 gene locus_tag LOCUS_07660 315850 316320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 316324 316809 gene locus_tag LOCUS_07670 316324 316809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 316814 317398 gene locus_tag LOCUS_07680 316814 317398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 317420 318169 gene locus_tag LOCUS_07690 317420 318169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 318232 318474 gene locus_tag LOCUS_07700 318232 318474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 318471 320369 gene locus_tag LOCUS_07710 318471 320369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 320370 321356 gene locus_tag LOCUS_07720 320370 321356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 321470 322393 gene locus_tag LOCUS_07730 321470 322393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 322446 323408 gene locus_tag LOCUS_07740 322446 323408 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 protein_id gnl|my_center|LOCUS_07740 323405 324652 gene locus_tag LOCUS_07750 323405 324652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 324659 325285 gene locus_tag LOCUS_07760 324659 325285 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_07760 325372 326544 gene locus_tag LOCUS_07770 325372 326544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 326562 327188 gene locus_tag LOCUS_07780 326562 327188 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223962128.1 protein_id gnl|my_center|LOCUS_07780 327226 327423 gene locus_tag LOCUS_07790 327226 327423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 327470 327802 gene locus_tag LOCUS_07800 327470 327802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 327840 328538 gene locus_tag LOCUS_07810 gene fsa 327840 328538 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356970.1 protein_id gnl|my_center|LOCUS_07810 328829 329368 gene locus_tag LOCUS_07820 328829 329368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 329384 330301 gene locus_tag LOCUS_07830 329384 330301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 330348 331343 gene locus_tag LOCUS_07840 330348 331343 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_07840 331347 332048 gene locus_tag LOCUS_07850 331347 332048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 332144 333094 gene locus_tag LOCUS_07860 332144 333094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 333100 333990 gene locus_tag LOCUS_07870 333100 333990 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729564.1 protein_id gnl|my_center|LOCUS_07870 333987 334907 gene locus_tag LOCUS_07880 gene galE 333987 334907 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548187.1 protein_id gnl|my_center|LOCUS_07880 335136 335639 gene locus_tag LOCUS_07890 335136 335639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 335646 336560 gene locus_tag LOCUS_07900 335646 336560 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878124.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence03 2704 566 gene locus_tag LOCUS_07910 2704 566 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839420.1 protein_id gnl|my_center|LOCUS_07910 3127 3888 gene locus_tag LOCUS_07920 3127 3888 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251231.1 protein_id gnl|my_center|LOCUS_07920 3885 5447 gene locus_tag LOCUS_07930 3885 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 5526 8378 gene locus_tag LOCUS_07940 5526 8378 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020807.1 protein_id gnl|my_center|LOCUS_07940 8587 9573 gene locus_tag LOCUS_07950 8587 9573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 9702 9986 gene locus_tag LOCUS_07960 9702 9986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 10304 9993 gene locus_tag LOCUS_07970 10304 9993 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846979.1 protein_id gnl|my_center|LOCUS_07970 10443 11837 gene locus_tag LOCUS_07980 gene gcvPA 10443 11837 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868897.1 protein_id gnl|my_center|LOCUS_07980 11839 13380 gene locus_tag LOCUS_07990 gene gcvPB 11839 13380 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868896.1 protein_id gnl|my_center|LOCUS_07990 13500 14432 gene locus_tag LOCUS_08000 13500 14432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 14782 14453 gene locus_tag LOCUS_08010 14782 14453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 14995 15348 gene locus_tag LOCUS_08020 14995 15348 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877371.1 protein_id gnl|my_center|LOCUS_08020 15356 15664 gene locus_tag LOCUS_08030 15356 15664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 15726 16037 gene locus_tag LOCUS_08040 gene eif1A 15726 16037 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869944.1 protein_id gnl|my_center|LOCUS_08040 16034 16822 gene locus_tag LOCUS_08050 16034 16822 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060945.1 protein_id gnl|my_center|LOCUS_08050 16819 17382 gene locus_tag LOCUS_08060 16819 17382 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249751.1 protein_id gnl|my_center|LOCUS_08060 17513 19057 gene locus_tag LOCUS_08070 17513 19057 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979316.1 protein_id gnl|my_center|LOCUS_08070 19026 21614 gene locus_tag LOCUS_08080 19026 21614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 21685 21879 gene locus_tag LOCUS_08090 21685 21879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 21881 22855 gene locus_tag LOCUS_08100 21881 22855 CDS product L-myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846748.1 protein_id gnl|my_center|LOCUS_08100 23598 25145 gene locus_tag LOCUS_08110 23598 25145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 25862 25239 gene locus_tag LOCUS_08120 25862 25239 CDS product NAD(P)H-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082483.1 protein_id gnl|my_center|LOCUS_08120 26066 27742 gene locus_tag LOCUS_08130 26066 27742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 28233 27766 gene locus_tag LOCUS_08140 28233 27766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 28482 30065 gene locus_tag LOCUS_08150 28482 30065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 30202 30663 gene locus_tag LOCUS_08160 30202 30663 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867606.1 protein_id gnl|my_center|LOCUS_08160 30803 32293 gene locus_tag LOCUS_08170 gene glnA 30803 32293 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979431.1 protein_id gnl|my_center|LOCUS_08170 32349 33926 gene locus_tag LOCUS_08180 gene pruA 32349 33926 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243454.1 protein_id gnl|my_center|LOCUS_08180 35260 33959 gene locus_tag LOCUS_08190 35260 33959 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763576.1 protein_id gnl|my_center|LOCUS_08190 36301 35330 gene locus_tag LOCUS_08200 36301 35330 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229044.1 protein_id gnl|my_center|LOCUS_08200 38219 36291 gene locus_tag LOCUS_08210 38219 36291 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980386.1 protein_id gnl|my_center|LOCUS_08210 38629 38249 gene locus_tag LOCUS_08220 38629 38249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 38736 39650 gene locus_tag LOCUS_08230 gene mdh 38736 39650 CDS product NAD-dependent malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762366.1 protein_id gnl|my_center|LOCUS_08230 40155 39676 gene locus_tag LOCUS_08240 40155 39676 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763400.1 protein_id gnl|my_center|LOCUS_08240 41535 40171 gene locus_tag LOCUS_08250 41535 40171 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763417.1 protein_id gnl|my_center|LOCUS_08250 41632 42807 gene locus_tag LOCUS_08260 41632 42807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 42804 43901 gene locus_tag LOCUS_08270 42804 43901 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048184.1 protein_id gnl|my_center|LOCUS_08270 43885 45579 gene locus_tag LOCUS_08280 43885 45579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 46444 45836 gene locus_tag LOCUS_08290 46444 45836 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763732.1 protein_id gnl|my_center|LOCUS_08290 46575 47135 gene locus_tag LOCUS_08300 46575 47135 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761840.1 protein_id gnl|my_center|LOCUS_08300 47299 48927 gene locus_tag LOCUS_08310 47299 48927 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391946.1 protein_id gnl|my_center|LOCUS_08310 48939 49745 gene locus_tag LOCUS_08320 48939 49745 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391947.1 protein_id gnl|my_center|LOCUS_08320 50733 50260 gene locus_tag LOCUS_08330 50733 50260 CDS product AAA-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980406.1 protein_id gnl|my_center|LOCUS_08330 52204 50801 gene locus_tag LOCUS_08340 52204 50801 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256756.1 protein_id gnl|my_center|LOCUS_08340 52335 54152 gene locus_tag LOCUS_08350 52335 54152 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878912.1 protein_id gnl|my_center|LOCUS_08350 54258 55361 gene locus_tag LOCUS_08360 54258 55361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 55414 55914 gene locus_tag LOCUS_08370 gene rimI 55414 55914 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978207.1 protein_id gnl|my_center|LOCUS_08370 55916 57556 gene locus_tag LOCUS_08380 55916 57556 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320246.1 protein_id gnl|my_center|LOCUS_08380 57794 58591 gene locus_tag LOCUS_08390 57794 58591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 58812 58588 gene locus_tag LOCUS_08400 58812 58588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 59534 58920 gene locus_tag LOCUS_08410 gene pdxT 59534 58920 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979489.1 protein_id gnl|my_center|LOCUS_08410 60499 59531 gene locus_tag LOCUS_08420 gene pdxS 60499 59531 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979488.1 protein_id gnl|my_center|LOCUS_08420 61579 60599 gene locus_tag LOCUS_08430 61579 60599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 61728 62189 gene locus_tag LOCUS_08440 gene azlB 61728 62189 CDS product azlBCD operon transcriptional regulator AzlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399001.1 protein_id gnl|my_center|LOCUS_08440 63166 62216 gene locus_tag LOCUS_08450 gene arcC 63166 62216 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868005.1 protein_id gnl|my_center|LOCUS_08450 63401 64090 gene locus_tag LOCUS_08460 63401 64090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 64137 65765 gene locus_tag LOCUS_08470 64137 65765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 66075 65824 gene locus_tag LOCUS_08480 66075 65824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 66444 66106 gene locus_tag LOCUS_08490 66444 66106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 66629 66441 gene locus_tag LOCUS_08500 66629 66441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 67222 66716 gene locus_tag LOCUS_08510 67222 66716 CDS product GTP-dependent dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868805.1 protein_id gnl|my_center|LOCUS_08510 67411 67223 gene locus_tag LOCUS_08520 67411 67223 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023600.1 protein_id gnl|my_center|LOCUS_08520 68006 67404 gene locus_tag LOCUS_08530 gene rpoE 68006 67404 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869896.1 protein_id gnl|my_center|LOCUS_08530 68518 68126 gene locus_tag LOCUS_08540 68518 68126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 69752 68508 gene locus_tag LOCUS_08550 69752 68508 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496772.1 protein_id gnl|my_center|LOCUS_08550 70222 69803 gene locus_tag LOCUS_08560 70222 69803 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763318.1 protein_id gnl|my_center|LOCUS_08560 70322 71128 gene locus_tag LOCUS_08570 70322 71128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 71271 71089 gene locus_tag LOCUS_08580 71271 71089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 73200 71314 gene locus_tag LOCUS_08590 73200 71314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 75065 74664 gene locus_tag LOCUS_08600 gene ndk 75065 74664 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_08600 75256 75062 gene locus_tag LOCUS_08610 75256 75062 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978232.1 protein_id gnl|my_center|LOCUS_08610 75779 75564 gene locus_tag LOCUS_08620 75779 75564 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978233.1 protein_id gnl|my_center|LOCUS_08620 76194 75796 gene locus_tag LOCUS_08630 gene rpl7ae 76194 75796 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240293.1 protein_id gnl|my_center|LOCUS_08630 78078 76312 gene locus_tag LOCUS_08640 78078 76312 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867608.1 protein_id gnl|my_center|LOCUS_08640 79077 78088 gene locus_tag LOCUS_08650 gene idsA 79077 78088 CDS product short chain isoprenyl diphosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875690.1 protein_id gnl|my_center|LOCUS_08650 80146 79085 gene locus_tag LOCUS_08660 gene fni 80146 79085 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875688.1 protein_id gnl|my_center|LOCUS_08660 80901 80143 gene locus_tag LOCUS_08670 80901 80143 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762949.1 protein_id gnl|my_center|LOCUS_08670 81764 80889 gene locus_tag LOCUS_08680 81764 80889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 82502 81825 gene locus_tag LOCUS_08690 gene amrB 82502 81825 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875685.1 protein_id gnl|my_center|LOCUS_08690 83328 82663 gene locus_tag LOCUS_08700 gene rpsB 83328 82663 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762850.1 protein_id gnl|my_center|LOCUS_08700 83641 83411 gene locus_tag LOCUS_08710 83641 83411 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867658.1 protein_id gnl|my_center|LOCUS_08710 84896 83739 gene locus_tag LOCUS_08720 84896 83739 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980299.1 protein_id gnl|my_center|LOCUS_08720 85398 84880 gene locus_tag LOCUS_08730 85398 84880 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846746.1 protein_id gnl|my_center|LOCUS_08730 85909 85388 gene locus_tag LOCUS_08740 85909 85388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 86511 85906 gene locus_tag LOCUS_08750 86511 85906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 86912 88732 gene locus_tag LOCUS_08760 86912 88732 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143530.1 protein_id gnl|my_center|LOCUS_08760 89556 88846 gene locus_tag LOCUS_08770 89556 88846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 90193 89777 gene locus_tag LOCUS_08780 90193 89777 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061175.1 protein_id gnl|my_center|LOCUS_08780 90669 90190 gene locus_tag LOCUS_08790 gene rplM 90669 90190 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250452.1 protein_id gnl|my_center|LOCUS_08790 90970 90629 gene locus_tag LOCUS_08800 90970 90629 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762450.1 protein_id gnl|my_center|LOCUS_08800 91644 90997 gene locus_tag LOCUS_08810 91644 90997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 92064 91651 gene locus_tag LOCUS_08820 92064 91651 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867653.1 protein_id gnl|my_center|LOCUS_08820 92561 92064 gene locus_tag LOCUS_08830 92561 92064 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867652.1 protein_id gnl|my_center|LOCUS_08830 93014 92568 gene locus_tag LOCUS_08840 93014 92568 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980145.1 protein_id gnl|my_center|LOCUS_08840 94238 93288 gene locus_tag LOCUS_08850 94238 93288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 94393 96150 gene locus_tag LOCUS_08860 gene glmS 94393 96150 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867349.1 protein_id gnl|my_center|LOCUS_08860 97330 96161 gene locus_tag LOCUS_08870 97330 96161 CDS product aconitase X catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250200.1 protein_id gnl|my_center|LOCUS_08870 98187 97342 gene locus_tag LOCUS_08880 gene udp 98187 97342 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250430.1 protein_id gnl|my_center|LOCUS_08880 99695 98688 gene locus_tag LOCUS_08890 99695 98688 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869643.1 protein_id gnl|my_center|LOCUS_08890 100267 99692 gene locus_tag LOCUS_08900 100267 99692 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978376.1 protein_id gnl|my_center|LOCUS_08900 100791 100285 gene locus_tag LOCUS_08910 100791 100285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 101550 100969 gene locus_tag LOCUS_08920 101550 100969 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146533.1 protein_id gnl|my_center|LOCUS_08920 102976 101537 gene locus_tag LOCUS_08930 gene secY 102976 101537 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978380.1 protein_id gnl|my_center|LOCUS_08930 103414 102983 gene locus_tag LOCUS_08940 103414 102983 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869978.1 protein_id gnl|my_center|LOCUS_08940 103934 103470 gene locus_tag LOCUS_08950 103934 103470 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867442.1 protein_id gnl|my_center|LOCUS_08950 104574 103942 gene locus_tag LOCUS_08960 104574 103942 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978383.1 protein_id gnl|my_center|LOCUS_08960 105206 104592 gene locus_tag LOCUS_08970 105206 104592 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763591.1 protein_id gnl|my_center|LOCUS_08970 105659 105216 gene locus_tag LOCUS_08980 105659 105216 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763590.1 protein_id gnl|my_center|LOCUS_08980 106048 105656 gene locus_tag LOCUS_08990 106048 105656 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867446.1 protein_id gnl|my_center|LOCUS_08990 106618 106055 gene locus_tag LOCUS_09000 106618 106055 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867447.1 protein_id gnl|my_center|LOCUS_09000 107000 106608 gene locus_tag LOCUS_09010 107000 106608 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867448.1 protein_id gnl|my_center|LOCUS_09010 107180 107016 gene locus_tag LOCUS_09020 107180 107016 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250478.1 protein_id gnl|my_center|LOCUS_09020 107722 107186 gene locus_tag LOCUS_09030 107722 107186 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762516.1 protein_id gnl|my_center|LOCUS_09030 108466 107732 gene locus_tag LOCUS_09040 108466 107732 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875657.1 protein_id gnl|my_center|LOCUS_09040 108855 108466 gene locus_tag LOCUS_09050 gene rplX 108855 108466 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867452.1 protein_id gnl|my_center|LOCUS_09050 109282 108848 gene locus_tag LOCUS_09060 109282 108848 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867453.1 protein_id gnl|my_center|LOCUS_09060 109644 109315 gene locus_tag LOCUS_09070 109644 109315 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846880.1 protein_id gnl|my_center|LOCUS_09070 109880 109641 gene locus_tag LOCUS_09080 109880 109641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 110086 109877 gene locus_tag LOCUS_09090 110086 109877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 110729 110073 gene locus_tag LOCUS_09100 110729 110073 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875650.1 protein_id gnl|my_center|LOCUS_09100 111194 110730 gene locus_tag LOCUS_09110 gene rplV 111194 110730 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875649.1 protein_id gnl|my_center|LOCUS_09110 112067 111297 gene locus_tag LOCUS_09120 112067 111297 CDS product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867465.1 protein_id gnl|my_center|LOCUS_09120 112227 112595 gene locus_tag LOCUS_09130 112227 112595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 112986 112603 gene locus_tag LOCUS_09140 gene rpsS 112986 112603 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867460.1 protein_id gnl|my_center|LOCUS_09140 113765 113016 gene locus_tag LOCUS_09150 113765 113016 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867461.1 protein_id gnl|my_center|LOCUS_09150 114047 113781 gene locus_tag LOCUS_09160 114047 113781 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867462.1 protein_id gnl|my_center|LOCUS_09160 114845 114057 gene locus_tag LOCUS_09170 gene rpl4p 114845 114057 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875645.1 protein_id gnl|my_center|LOCUS_09170 115828 114845 gene locus_tag LOCUS_09180 gene rpl3p 115828 114845 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879418.1 protein_id gnl|my_center|LOCUS_09180 116165 117706 gene locus_tag LOCUS_09190 gene gapN 116165 117706 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249656.1 protein_id gnl|my_center|LOCUS_09190 117905 118426 gene locus_tag LOCUS_09200 117905 118426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 118480 118677 gene locus_tag LOCUS_09210 118480 118677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 118740 119699 gene locus_tag LOCUS_09220 118740 119699 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978799.1 protein_id gnl|my_center|LOCUS_09220 119712 119906 gene locus_tag LOCUS_09230 119712 119906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 120608 119907 gene locus_tag LOCUS_09240 120608 119907 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966429.1 protein_id gnl|my_center|LOCUS_09240 121192 121283 gene locus_tag LOCUS_t00080 121192 121283 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 121515 122837 gene locus_tag LOCUS_09250 121515 122837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 123668 122859 gene locus_tag LOCUS_09260 123668 122859 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_09260 123769 124329 gene locus_tag LOCUS_09270 gene apt 123769 124329 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081583.1 protein_id gnl|my_center|LOCUS_09270 125139 124372 gene locus_tag LOCUS_09280 125139 124372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 125271 126464 gene locus_tag LOCUS_09290 125271 126464 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878825.1 protein_id gnl|my_center|LOCUS_09290 126490 127920 gene locus_tag LOCUS_09300 126490 127920 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878367.1 protein_id gnl|my_center|LOCUS_09300 127863 129230 gene locus_tag LOCUS_09310 127863 129230 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878369.1 protein_id gnl|my_center|LOCUS_09310 129374 129925 gene locus_tag LOCUS_09320 129374 129925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 130029 130607 gene locus_tag LOCUS_09330 130029 130607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 130886 131254 gene locus_tag LOCUS_09340 130886 131254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 131556 132944 gene locus_tag LOCUS_09350 131556 132944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 132957 133595 gene locus_tag LOCUS_09360 132957 133595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 133544 134482 gene locus_tag LOCUS_09370 133544 134482 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241141.1 protein_id gnl|my_center|LOCUS_09370 136036 134753 gene locus_tag LOCUS_09380 136036 134753 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980484.1 protein_id gnl|my_center|LOCUS_09380 136179 136661 gene locus_tag LOCUS_09390 136179 136661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 136757 137005 gene locus_tag LOCUS_09400 136757 137005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 137418 137035 gene locus_tag LOCUS_09410 137418 137035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 138034 137801 gene locus_tag LOCUS_09420 138034 137801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 138186 139058 gene locus_tag LOCUS_09430 138186 139058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 139062 139742 gene locus_tag LOCUS_09440 139062 139742 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256391.1 protein_id gnl|my_center|LOCUS_09440 141012 139825 gene locus_tag LOCUS_09450 141012 139825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 142030 141083 gene locus_tag LOCUS_09460 142030 141083 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979837.1 protein_id gnl|my_center|LOCUS_09460 143054 142041 gene locus_tag LOCUS_09470 143054 142041 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979838.1 protein_id gnl|my_center|LOCUS_09470 143626 143051 gene locus_tag LOCUS_09480 143626 143051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 143805 144536 gene locus_tag LOCUS_09490 143805 144536 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_09490 145673 144507 gene locus_tag LOCUS_09500 145673 144507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 146320 145730 gene locus_tag LOCUS_09510 146320 145730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 147938 146325 gene locus_tag LOCUS_09520 147938 146325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 148043 149641 gene locus_tag LOCUS_09530 gene spoVB 148043 149641 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812078.1 protein_id gnl|my_center|LOCUS_09530 149733 150320 gene locus_tag LOCUS_09540 149733 150320 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229800.1 protein_id gnl|my_center|LOCUS_09540 150850 150464 gene locus_tag LOCUS_09550 150850 150464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978746.1 protein_id gnl|my_center|LOCUS_09550 151026 151337 gene locus_tag LOCUS_09560 151026 151337 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249128.1 protein_id gnl|my_center|LOCUS_09560 151565 152941 gene locus_tag LOCUS_09570 151565 152941 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186205.1 protein_id gnl|my_center|LOCUS_09570 153144 153647 gene locus_tag LOCUS_09580 153144 153647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 154774 153674 gene locus_tag LOCUS_09590 154774 153674 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761873.1 protein_id gnl|my_center|LOCUS_09590 156505 154928 gene locus_tag LOCUS_09600 156505 154928 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877864.1 protein_id gnl|my_center|LOCUS_09600 157872 156502 gene locus_tag LOCUS_09610 157872 156502 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022374.1 protein_id gnl|my_center|LOCUS_09610 158069 158842 gene locus_tag LOCUS_09620 158069 158842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 159347 159538 gene locus_tag LOCUS_09630 159347 159538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 160672 159566 gene locus_tag LOCUS_09640 160672 159566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 160950 160669 gene locus_tag LOCUS_09650 160950 160669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 160834 161352 gene locus_tag LOCUS_09660 160834 161352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 161401 162240 gene locus_tag LOCUS_09670 161401 162240 CDS product G1 family endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228226.1 protein_id gnl|my_center|LOCUS_09670 163717 162758 gene locus_tag LOCUS_09680 163717 162758 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_09680 163719 165752 gene locus_tag LOCUS_09690 163719 165752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 166382 165804 gene locus_tag LOCUS_09700 166382 165804 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980595.1 protein_id gnl|my_center|LOCUS_09700 166716 167759 gene locus_tag LOCUS_09710 166716 167759 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528955.1 protein_id gnl|my_center|LOCUS_09710 168800 167865 gene locus_tag LOCUS_09720 168800 167865 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970215.1 protein_id gnl|my_center|LOCUS_09720 169825 168797 gene locus_tag LOCUS_09730 169825 168797 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878388.1 protein_id gnl|my_center|LOCUS_09730 171410 169827 gene locus_tag LOCUS_09740 171410 169827 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948025.1 protein_id gnl|my_center|LOCUS_09740 172891 172049 gene locus_tag LOCUS_09750 172891 172049 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870112.1 protein_id gnl|my_center|LOCUS_09750 174377 173169 gene locus_tag LOCUS_09760 174377 173169 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978005.1 protein_id gnl|my_center|LOCUS_09760 174849 174340 gene locus_tag LOCUS_09770 174849 174340 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978007.1 protein_id gnl|my_center|LOCUS_09770 174960 176114 gene locus_tag LOCUS_09780 174960 176114 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064882.1 protein_id gnl|my_center|LOCUS_09780 176202 177581 gene locus_tag LOCUS_09790 176202 177581 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240446.1 protein_id gnl|my_center|LOCUS_09790 177630 178505 gene locus_tag LOCUS_09800 177630 178505 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_09800 178538 179509 gene locus_tag LOCUS_09810 178538 179509 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807650.1 protein_id gnl|my_center|LOCUS_09810 179506 180258 gene locus_tag LOCUS_09820 179506 180258 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921642.1 protein_id gnl|my_center|LOCUS_09820 180255 180986 gene locus_tag LOCUS_09830 180255 180986 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_09830 181009 182238 gene locus_tag LOCUS_09840 181009 182238 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877874.1 protein_id gnl|my_center|LOCUS_09840 182560 183777 gene locus_tag LOCUS_09850 182560 183777 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861718.1 protein_id gnl|my_center|LOCUS_09850 183774 184508 gene locus_tag LOCUS_09860 183774 184508 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434222.1 protein_id gnl|my_center|LOCUS_09860 184535 185158 gene locus_tag LOCUS_09870 gene bluB 184535 185158 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391283.1 protein_id gnl|my_center|LOCUS_09870 185165 186136 gene locus_tag LOCUS_09880 185165 186136 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064134.1 protein_id gnl|my_center|LOCUS_09880 186137 186967 gene locus_tag LOCUS_09890 186137 186967 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545272.1 protein_id gnl|my_center|LOCUS_09890 187852 186968 gene locus_tag LOCUS_09900 187852 186968 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_09900 188967 187990 gene locus_tag LOCUS_09910 188967 187990 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257499.1 protein_id gnl|my_center|LOCUS_09910 190786 189050 gene locus_tag LOCUS_09920 190786 189050 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970501.1 protein_id gnl|my_center|LOCUS_09920 190940 192022 gene locus_tag LOCUS_09930 gene ykfB 190940 192022 CDS product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244980.1 protein_id gnl|my_center|LOCUS_09930 192298 193596 gene locus_tag LOCUS_09940 192298 193596 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023306.1 protein_id gnl|my_center|LOCUS_09940 196420 193643 gene locus_tag LOCUS_09950 196420 193643 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879008.1 protein_id gnl|my_center|LOCUS_09950 196464 197609 gene locus_tag LOCUS_09960 196464 197609 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742140.1 protein_id gnl|my_center|LOCUS_09960 198192 197827 gene locus_tag LOCUS_09970 198192 197827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 198971 198189 gene locus_tag LOCUS_09980 198971 198189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 199260 198973 gene locus_tag LOCUS_09990 199260 198973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 199615 199253 gene locus_tag LOCUS_10000 199615 199253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 201306 199852 gene locus_tag LOCUS_10010 201306 199852 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203961.1 protein_id gnl|my_center|LOCUS_10010 201764 202975 gene locus_tag LOCUS_10020 201764 202975 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762231.1 protein_id gnl|my_center|LOCUS_10020 203931 203023 gene locus_tag LOCUS_10030 203931 203023 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762228.1 protein_id gnl|my_center|LOCUS_10030 205051 203936 gene locus_tag LOCUS_10040 205051 203936 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249610.1 protein_id gnl|my_center|LOCUS_10040 206558 205026 gene locus_tag LOCUS_10050 206558 205026 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249609.1 protein_id gnl|my_center|LOCUS_10050 206663 208003 gene locus_tag LOCUS_10060 206663 208003 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_10060 208945 208334 gene locus_tag LOCUS_10070 208945 208334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 209372 210232 gene locus_tag LOCUS_10080 gene pheA 209372 210232 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583989.1 protein_id gnl|my_center|LOCUS_10080 210717 210385 gene locus_tag LOCUS_10090 210717 210385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 211053 210814 gene locus_tag LOCUS_10100 211053 210814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 211254 212411 gene locus_tag LOCUS_10110 211254 212411 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979804.1 protein_id gnl|my_center|LOCUS_10110 214037 212742 gene locus_tag LOCUS_10120 gene purB 214037 212742 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257052.1 protein_id gnl|my_center|LOCUS_10120 215241 214027 gene locus_tag LOCUS_10130 215241 214027 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880823.1 protein_id gnl|my_center|LOCUS_10130 216557 215244 gene locus_tag LOCUS_10140 gene guaB 216557 215244 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881325.1 protein_id gnl|my_center|LOCUS_10140 216990 217286 gene locus_tag LOCUS_10150 216990 217286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 217299 217526 gene locus_tag LOCUS_10160 217299 217526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 217647 218129 gene locus_tag LOCUS_10170 217647 218129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 218136 218600 gene locus_tag LOCUS_10180 218136 218600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 218605 219363 gene locus_tag LOCUS_10190 218605 219363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 219949 219701 gene locus_tag LOCUS_10200 219949 219701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 220805 222076 gene locus_tag LOCUS_10210 220805 222076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 >Feature sequence04 978 688 gene locus_tag LOCUS_10220 978 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1291 986 gene locus_tag LOCUS_10230 1291 986 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_10230 1955 1374 gene locus_tag LOCUS_10240 1955 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 2665 2249 gene locus_tag LOCUS_10250 2665 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 3430 2675 gene locus_tag LOCUS_10260 3430 2675 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878746.1 protein_id gnl|my_center|LOCUS_10260 4151 3699 gene locus_tag LOCUS_10270 gene trxA 4151 3699 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878779.1 protein_id gnl|my_center|LOCUS_10270 5030 4311 gene locus_tag LOCUS_10280 5030 4311 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583126.1 protein_id gnl|my_center|LOCUS_10280 5337 5050 gene locus_tag LOCUS_10290 5337 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 6463 5513 gene locus_tag LOCUS_10300 6463 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847040.1 protein_id gnl|my_center|LOCUS_10300 6619 6798 gene locus_tag LOCUS_10310 6619 6798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 6868 7572 gene locus_tag LOCUS_10320 6868 7572 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892625.1 protein_id gnl|my_center|LOCUS_10320 7834 7622 gene locus_tag LOCUS_10330 7834 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 8403 7837 gene locus_tag LOCUS_10340 8403 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 9837 8791 gene locus_tag LOCUS_10350 9837 8791 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730143.1 protein_id gnl|my_center|LOCUS_10350 10625 9876 gene locus_tag LOCUS_10360 10625 9876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 10790 12085 gene locus_tag LOCUS_10370 10790 12085 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103412.1 protein_id gnl|my_center|LOCUS_10370 12728 14086 gene locus_tag LOCUS_10380 12728 14086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 14194 14646 gene locus_tag LOCUS_10390 14194 14646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 14739 15242 gene locus_tag LOCUS_10400 14739 15242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 17196 15349 gene locus_tag LOCUS_10410 17196 15349 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403165.1 protein_id gnl|my_center|LOCUS_10410 18611 17193 gene locus_tag LOCUS_10420 18611 17193 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978976.1 protein_id gnl|my_center|LOCUS_10420 19315 18611 gene locus_tag LOCUS_10430 19315 18611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 21299 19524 gene locus_tag LOCUS_10440 21299 19524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 21864 21415 gene locus_tag LOCUS_10450 21864 21415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 22006 23157 gene locus_tag LOCUS_10460 22006 23157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 23661 23263 gene locus_tag LOCUS_10470 23661 23263 CDS product DUF2203 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881169.1 protein_id gnl|my_center|LOCUS_10470 23886 25676 gene locus_tag LOCUS_10480 23886 25676 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584026.1 protein_id gnl|my_center|LOCUS_10480 25669 26529 gene locus_tag LOCUS_10490 25669 26529 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256841.1 protein_id gnl|my_center|LOCUS_10490 26539 26829 gene locus_tag LOCUS_10500 26539 26829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 27171 26836 gene locus_tag LOCUS_10510 27171 26836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 27785 27294 gene locus_tag LOCUS_10520 27785 27294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 28270 28770 gene locus_tag LOCUS_10530 28270 28770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 29712 28855 gene locus_tag LOCUS_10540 29712 28855 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971159.1 protein_id gnl|my_center|LOCUS_10540 30673 31299 gene locus_tag LOCUS_10550 30673 31299 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978815.1 protein_id gnl|my_center|LOCUS_10550 31839 31336 gene locus_tag LOCUS_10560 31839 31336 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228850.1 protein_id gnl|my_center|LOCUS_10560 33883 31841 gene locus_tag LOCUS_10570 33883 31841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 35134 33884 gene locus_tag LOCUS_10580 35134 33884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 35677 35156 gene locus_tag LOCUS_10590 35677 35156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 35709 36323 gene locus_tag LOCUS_10600 35709 36323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 36780 38237 gene locus_tag LOCUS_10610 36780 38237 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762961.1 protein_id gnl|my_center|LOCUS_10610 38283 38861 gene locus_tag LOCUS_10620 gene endA 38283 38861 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496827.1 protein_id gnl|my_center|LOCUS_10620 38869 39714 gene locus_tag LOCUS_10630 38869 39714 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274369.1 protein_id gnl|my_center|LOCUS_10630 39716 40921 gene locus_tag LOCUS_10640 39716 40921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 40927 41631 gene locus_tag LOCUS_10650 40927 41631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 42796 41606 gene locus_tag LOCUS_10660 42796 41606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 45039 42868 gene locus_tag LOCUS_10670 45039 42868 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868004.1 protein_id gnl|my_center|LOCUS_10670 45158 45733 gene locus_tag LOCUS_10680 45158 45733 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880118.1 protein_id gnl|my_center|LOCUS_10680 46039 45770 gene locus_tag LOCUS_10690 46039 45770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 48601 46142 gene locus_tag LOCUS_10700 48601 46142 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065536.1 protein_id gnl|my_center|LOCUS_10700 54069 48829 gene locus_tag LOCUS_10710 54069 48829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 54625 54077 gene locus_tag LOCUS_10720 54625 54077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 55197 55778 gene locus_tag LOCUS_10730 55197 55778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 56830 56078 gene locus_tag LOCUS_10740 56830 56078 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763691.1 protein_id gnl|my_center|LOCUS_10740 57747 56827 gene locus_tag LOCUS_10750 57747 56827 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053639.1 protein_id gnl|my_center|LOCUS_10750 58823 58017 gene locus_tag LOCUS_10760 58823 58017 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763052.1 protein_id gnl|my_center|LOCUS_10760 58976 59185 gene locus_tag LOCUS_10770 58976 59185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 59605 59327 gene locus_tag LOCUS_10780 59605 59327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 61927 59927 gene locus_tag LOCUS_10790 61927 59927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 62668 62973 gene locus_tag LOCUS_10800 62668 62973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 63303 64655 gene locus_tag LOCUS_10810 63303 64655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 64661 65488 gene locus_tag LOCUS_10820 64661 65488 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173997.1 protein_id gnl|my_center|LOCUS_10820 65485 66300 gene locus_tag LOCUS_10830 65485 66300 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315797.1 protein_id gnl|my_center|LOCUS_10830 66297 67283 gene locus_tag LOCUS_10840 66297 67283 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867312.1 protein_id gnl|my_center|LOCUS_10840 68886 69743 gene locus_tag LOCUS_10850 68886 69743 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020646525.1 protein_id gnl|my_center|LOCUS_10850 69806 71023 gene locus_tag LOCUS_10860 69806 71023 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979972.1 protein_id gnl|my_center|LOCUS_10860 71242 72213 gene locus_tag LOCUS_10870 71242 72213 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978451.1 protein_id gnl|my_center|LOCUS_10870 72210 73466 gene locus_tag LOCUS_10880 gene hisS 72210 73466 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868795.1 protein_id gnl|my_center|LOCUS_10880 74689 73478 gene locus_tag LOCUS_10890 74689 73478 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228352.1 protein_id gnl|my_center|LOCUS_10890 75528 74722 gene locus_tag LOCUS_10900 gene paaG 75528 74722 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528003.1 protein_id gnl|my_center|LOCUS_10900 76312 75533 gene locus_tag LOCUS_10910 76312 75533 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256011.1 protein_id gnl|my_center|LOCUS_10910 77174 76335 gene locus_tag LOCUS_10920 77174 76335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 77315 78334 gene locus_tag LOCUS_10930 77315 78334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 79778 78342 gene locus_tag LOCUS_10940 79778 78342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 79816 81507 gene locus_tag LOCUS_10950 79816 81507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 81987 83156 gene locus_tag LOCUS_10960 81987 83156 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_10960 83343 84908 gene locus_tag LOCUS_10970 83343 84908 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246447.1 protein_id gnl|my_center|LOCUS_10970 85871 86206 gene locus_tag LOCUS_10980 85871 86206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 87733 86474 gene locus_tag LOCUS_10990 87733 86474 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022104.1 protein_id gnl|my_center|LOCUS_10990 89832 87730 gene locus_tag LOCUS_11000 89832 87730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 90421 90266 gene locus_tag LOCUS_11010 90421 90266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 90469 90756 gene locus_tag LOCUS_11020 90469 90756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 90936 94958 gene locus_tag LOCUS_11030 90936 94958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 96065 96403 gene locus_tag LOCUS_11040 96065 96403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 96809 98749 gene locus_tag LOCUS_11050 96809 98749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 99090 98863 gene locus_tag LOCUS_11060 99090 98863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 99526 99095 gene locus_tag LOCUS_11070 99526 99095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 100964 100329 gene locus_tag LOCUS_11080 100964 100329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 101746 101081 gene locus_tag LOCUS_11090 101746 101081 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980308.1 protein_id gnl|my_center|LOCUS_11090 102919 101891 gene locus_tag LOCUS_11100 102919 101891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225204.1 protein_id gnl|my_center|LOCUS_11100 103131 102916 gene locus_tag LOCUS_11110 103131 102916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 103198 103650 gene locus_tag LOCUS_11120 103198 103650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 103788 104429 gene locus_tag LOCUS_11130 103788 104429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 104581 105345 gene locus_tag LOCUS_11140 104581 105345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 106309 105440 gene locus_tag LOCUS_11150 106309 105440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 107604 106372 gene locus_tag LOCUS_11160 107604 106372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 108903 107677 gene locus_tag LOCUS_11170 108903 107677 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250397.1 protein_id gnl|my_center|LOCUS_11170 109844 108900 gene locus_tag LOCUS_11180 109844 108900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 110466 110023 gene locus_tag LOCUS_11190 110466 110023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 111135 111512 gene locus_tag LOCUS_11200 111135 111512 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173512.1 protein_id gnl|my_center|LOCUS_11200 112481 111582 gene locus_tag LOCUS_11210 112481 111582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 113739 112600 gene locus_tag LOCUS_11220 113739 112600 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082450.1 protein_id gnl|my_center|LOCUS_11220 113991 116459 gene locus_tag LOCUS_11230 113991 116459 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_11230 116456 116833 gene locus_tag LOCUS_11240 116456 116833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 117812 116895 gene locus_tag LOCUS_11250 117812 116895 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763004.1 protein_id gnl|my_center|LOCUS_11250 118000 118956 gene locus_tag LOCUS_11260 gene kdgK 118000 118956 CDS product bifunctional 2-dehydro-3-deoxygluconokinase/2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980563.1 protein_id gnl|my_center|LOCUS_11260 118953 119840 gene locus_tag LOCUS_11270 118953 119840 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289156.1 protein_id gnl|my_center|LOCUS_11270 120169 119894 gene locus_tag LOCUS_11280 120169 119894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 120698 120132 gene locus_tag LOCUS_11290 120698 120132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 121175 120900 gene locus_tag LOCUS_11300 121175 120900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 122156 121320 gene locus_tag LOCUS_11310 122156 121320 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042382595.1 protein_id gnl|my_center|LOCUS_11310 122511 123602 gene locus_tag LOCUS_11320 gene menC 122511 123602 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228259.1 protein_id gnl|my_center|LOCUS_11320 123976 123599 gene locus_tag LOCUS_11330 123976 123599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 124208 125620 gene locus_tag LOCUS_11340 124208 125620 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_11340 126022 125597 gene locus_tag LOCUS_11350 126022 125597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 126271 127473 gene locus_tag LOCUS_11360 126271 127473 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246392.1 protein_id gnl|my_center|LOCUS_11360 128338 127487 gene locus_tag LOCUS_11370 128338 127487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 128992 128597 gene locus_tag LOCUS_11380 128992 128597 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940795.1 protein_id gnl|my_center|LOCUS_11380 129421 129035 gene locus_tag LOCUS_11390 129421 129035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 129667 131478 gene locus_tag LOCUS_11400 129667 131478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 131693 132487 gene locus_tag LOCUS_11410 131693 132487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 132675 132959 gene locus_tag LOCUS_11420 132675 132959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 133336 134154 gene locus_tag LOCUS_11430 133336 134154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 134389 135561 gene locus_tag LOCUS_11440 134389 135561 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879390.1 protein_id gnl|my_center|LOCUS_11440 135661 136620 gene locus_tag LOCUS_11450 gene htpX 135661 136620 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980430.1 protein_id gnl|my_center|LOCUS_11450 136750 138426 gene locus_tag LOCUS_11460 gene thsB 136750 138426 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879727.1 protein_id gnl|my_center|LOCUS_11460 138570 138962 gene locus_tag LOCUS_11470 138570 138962 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879687.1 protein_id gnl|my_center|LOCUS_11470 138910 139509 gene locus_tag LOCUS_11480 138910 139509 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256875.1 protein_id gnl|my_center|LOCUS_11480 140812 139586 gene locus_tag LOCUS_11490 140812 139586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 140901 141635 gene locus_tag LOCUS_11500 140901 141635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 141705 143225 gene locus_tag LOCUS_11510 141705 143225 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257475.1 protein_id gnl|my_center|LOCUS_11510 144753 144052 gene locus_tag LOCUS_11520 gene pqqC 144753 144052 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729288.1 protein_id gnl|my_center|LOCUS_11520 146546 144750 gene locus_tag LOCUS_11530 146546 144750 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229128.1 protein_id gnl|my_center|LOCUS_11530 147551 146550 gene locus_tag LOCUS_11540 147551 146550 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681411.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence05 246 374 gene locus_tag LOCUS_11550 246 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 935 858 gene locus_tag LOCUS_t00090 935 858 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1106 1729 gene locus_tag LOCUS_11560 1106 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1739 3112 gene locus_tag LOCUS_11570 gene glmM 1739 3112 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868348.1 protein_id gnl|my_center|LOCUS_11570 3295 3119 gene locus_tag LOCUS_11580 3295 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 4356 3382 gene locus_tag LOCUS_11590 gene thiL 4356 3382 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066048.1 protein_id gnl|my_center|LOCUS_11590 5657 4353 gene locus_tag LOCUS_11600 gene glmM 5657 4353 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877965.1 protein_id gnl|my_center|LOCUS_11600 5829 5754 gene locus_tag LOCUS_t00100 5829 5754 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6006 6093 gene locus_tag LOCUS_t00110 6006 6093 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6313 6666 gene locus_tag LOCUS_11610 6313 6666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 6638 7066 gene locus_tag LOCUS_11620 6638 7066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 7411 7166 gene locus_tag LOCUS_11630 7411 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 8201 7518 gene locus_tag LOCUS_11640 8201 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 10125 8437 gene locus_tag LOCUS_11650 gene polX 10125 8437 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_11650 11767 10190 gene locus_tag LOCUS_11660 11767 10190 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156014205.1 protein_id gnl|my_center|LOCUS_11660 12507 11764 gene locus_tag LOCUS_11670 gene fabG 12507 11764 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979123.1 protein_id gnl|my_center|LOCUS_11670 12932 12552 gene locus_tag LOCUS_11680 12932 12552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 14035 12929 gene locus_tag LOCUS_11690 14035 12929 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979124.1 protein_id gnl|my_center|LOCUS_11690 15676 14234 gene locus_tag LOCUS_11700 15676 14234 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589538.1 protein_id gnl|my_center|LOCUS_11700 15804 16379 gene locus_tag LOCUS_11710 15804 16379 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979589.1 protein_id gnl|my_center|LOCUS_11710 16436 17986 gene locus_tag LOCUS_11720 16436 17986 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903114.1 protein_id gnl|my_center|LOCUS_11720 17996 19519 gene locus_tag LOCUS_11730 17996 19519 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020720.1 protein_id gnl|my_center|LOCUS_11730 19506 19994 gene locus_tag LOCUS_11740 19506 19994 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789540.1 protein_id gnl|my_center|LOCUS_11740 21016 20003 gene locus_tag LOCUS_11750 21016 20003 CDS product acryloyl-coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978456.1 protein_id gnl|my_center|LOCUS_11750 23933 21075 gene locus_tag LOCUS_11760 gene leuS 23933 21075 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879908.1 protein_id gnl|my_center|LOCUS_11760 26717 23988 gene locus_tag LOCUS_11770 gene alaS 26717 23988 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762670.1 protein_id gnl|my_center|LOCUS_11770 26942 27325 gene locus_tag LOCUS_11780 26942 27325 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876242.1 protein_id gnl|my_center|LOCUS_11780 27388 27789 gene locus_tag LOCUS_11790 27388 27789 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979712.1 protein_id gnl|my_center|LOCUS_11790 29371 27794 gene locus_tag LOCUS_11800 29371 27794 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289376.1 protein_id gnl|my_center|LOCUS_11800 29917 30378 gene locus_tag LOCUS_11810 29917 30378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 30375 31055 gene locus_tag LOCUS_11820 30375 31055 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763579.1 protein_id gnl|my_center|LOCUS_11820 32054 31056 gene locus_tag LOCUS_11830 32054 31056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 32946 32089 gene locus_tag LOCUS_11840 32946 32089 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249796.1 protein_id gnl|my_center|LOCUS_11840 33024 33770 gene locus_tag LOCUS_11850 33024 33770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 33777 34772 gene locus_tag LOCUS_11860 33777 34772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 36159 34756 gene locus_tag LOCUS_11870 gene glmM 36159 34756 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065480.1 protein_id gnl|my_center|LOCUS_11870 36735 36187 gene locus_tag LOCUS_11880 36735 36187 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_11880 38697 36967 gene locus_tag LOCUS_11890 38697 36967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 40089 39124 gene locus_tag LOCUS_11900 40089 39124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 41899 40778 gene locus_tag LOCUS_11910 41899 40778 CDS product [LysW]-lysine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888052.1 protein_id gnl|my_center|LOCUS_11910 43096 41903 gene locus_tag LOCUS_11920 43096 41903 CDS product acetylornithine/succinylornithine family transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877594.1 protein_id gnl|my_center|LOCUS_11920 43898 43089 gene locus_tag LOCUS_11930 43898 43089 CDS product [LysW]-aminoadipate/[LysW]-glutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978133.1 protein_id gnl|my_center|LOCUS_11930 44963 43908 gene locus_tag LOCUS_11940 gene argC 44963 43908 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762032.1 protein_id gnl|my_center|LOCUS_11940 45822 44965 gene locus_tag LOCUS_11950 gene lysX 45822 44965 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_11950 46006 45833 gene locus_tag LOCUS_11960 gene lysW/argW 46006 45833 CDS product alpha-aminoadipate/glutamate carrier protein LysW/ArgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978131.1 protein_id gnl|my_center|LOCUS_11960 47472 46006 gene locus_tag LOCUS_11970 gene argH 47472 46006 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875908.1 protein_id gnl|my_center|LOCUS_11970 48671 47469 gene locus_tag LOCUS_11980 48671 47469 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167827706.1 protein_id gnl|my_center|LOCUS_11980 48740 49459 gene locus_tag LOCUS_11990 48740 49459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 49677 50945 gene locus_tag LOCUS_12000 49677 50945 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980446.1 protein_id gnl|my_center|LOCUS_12000 51000 52562 gene locus_tag LOCUS_12010 51000 52562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 52796 54067 gene locus_tag LOCUS_12020 52796 54067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 54094 54660 gene locus_tag LOCUS_12030 54094 54660 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020756.1 protein_id gnl|my_center|LOCUS_12030 54778 55539 gene locus_tag LOCUS_12040 54778 55539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 56454 55720 gene locus_tag LOCUS_12050 56454 55720 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867607.1 protein_id gnl|my_center|LOCUS_12050 56552 58108 gene locus_tag LOCUS_12060 56552 58108 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980566.1 protein_id gnl|my_center|LOCUS_12060 58121 59116 gene locus_tag LOCUS_12070 58121 59116 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035552.1 protein_id gnl|my_center|LOCUS_12070 59237 59602 gene locus_tag LOCUS_12080 59237 59602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 60649 62616 gene locus_tag LOCUS_12090 60649 62616 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066875.1 protein_id gnl|my_center|LOCUS_12090 63377 62622 gene locus_tag LOCUS_12100 63377 62622 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268058.1 protein_id gnl|my_center|LOCUS_12100 63890 64120 gene locus_tag LOCUS_12110 63890 64120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 64183 64860 gene locus_tag LOCUS_12120 64183 64860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 64853 65191 gene locus_tag LOCUS_12130 64853 65191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 66020 65478 gene locus_tag LOCUS_12140 gene yjjX 66020 65478 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847016.1 protein_id gnl|my_center|LOCUS_12140 67147 66119 gene locus_tag LOCUS_12150 67147 66119 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846488.1 protein_id gnl|my_center|LOCUS_12150 68763 67144 gene locus_tag LOCUS_12160 68763 67144 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979152.1 protein_id gnl|my_center|LOCUS_12160 69551 68760 gene locus_tag LOCUS_12170 69551 68760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 69984 70511 gene locus_tag LOCUS_12180 69984 70511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 71902 70535 gene locus_tag LOCUS_12190 71902 70535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 71976 73226 gene locus_tag LOCUS_12200 71976 73226 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258527.1 protein_id gnl|my_center|LOCUS_12200 73324 74223 gene locus_tag LOCUS_12210 73324 74223 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846488.1 protein_id gnl|my_center|LOCUS_12210 75586 74393 gene locus_tag LOCUS_12220 75586 74393 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846343.1 protein_id gnl|my_center|LOCUS_12220 76212 75583 gene locus_tag LOCUS_12230 76212 75583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 76337 76846 gene locus_tag LOCUS_12240 76337 76846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 78332 76848 gene locus_tag LOCUS_12250 78332 76848 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846351.1 protein_id gnl|my_center|LOCUS_12250 78402 79118 gene locus_tag LOCUS_12260 78402 79118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 79137 79496 gene locus_tag LOCUS_12270 79137 79496 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_12270 79731 80699 gene locus_tag LOCUS_12280 gene ilvA 79731 80699 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272642.1 protein_id gnl|my_center|LOCUS_12280 80728 81102 gene locus_tag LOCUS_12290 80728 81102 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_12290 82255 81092 gene locus_tag LOCUS_12300 82255 81092 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877916.1 protein_id gnl|my_center|LOCUS_12300 83553 82252 gene locus_tag LOCUS_12310 gene lysA 83553 82252 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_12310 84718 83546 gene locus_tag LOCUS_12320 84718 83546 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876437.1 protein_id gnl|my_center|LOCUS_12320 85521 84715 gene locus_tag LOCUS_12330 gene dapB 85521 84715 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_12330 86587 85514 gene locus_tag LOCUS_12340 gene dapA 86587 85514 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081879.1 protein_id gnl|my_center|LOCUS_12340 87229 86651 gene locus_tag LOCUS_12350 87229 86651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 87402 87797 gene locus_tag LOCUS_12360 87402 87797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 88233 87739 gene locus_tag LOCUS_12370 88233 87739 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_12370 89948 88209 gene locus_tag LOCUS_12380 89948 88209 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_12380 90027 91034 gene locus_tag LOCUS_12390 gene meaB 90027 91034 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867373.1 protein_id gnl|my_center|LOCUS_12390 92284 91031 gene locus_tag LOCUS_12400 92284 91031 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966033.1 protein_id gnl|my_center|LOCUS_12400 93303 93025 gene locus_tag LOCUS_12410 93303 93025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 94031 93552 gene locus_tag LOCUS_12420 94031 93552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 94447 94220 gene locus_tag LOCUS_12430 94447 94220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 96057 95143 gene locus_tag LOCUS_12440 96057 95143 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980282.1 protein_id gnl|my_center|LOCUS_12440 96183 96273 gene locus_tag LOCUS_t00120 96183 96273 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 96604 97602 gene locus_tag LOCUS_12450 96604 97602 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878432.1 protein_id gnl|my_center|LOCUS_12450 98589 97627 gene locus_tag LOCUS_12460 98589 97627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 99381 98989 gene locus_tag LOCUS_12470 99381 98989 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762335.1 protein_id gnl|my_center|LOCUS_12470 99844 99443 gene locus_tag LOCUS_12480 99844 99443 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944306.1 protein_id gnl|my_center|LOCUS_12480 99903 101114 gene locus_tag LOCUS_12490 99903 101114 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763168.1 protein_id gnl|my_center|LOCUS_12490 101134 101910 gene locus_tag LOCUS_12500 101134 101910 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762508.1 protein_id gnl|my_center|LOCUS_12500 101907 102863 gene locus_tag LOCUS_12510 101907 102863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 103008 104618 gene locus_tag LOCUS_12520 103008 104618 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181877.1 protein_id gnl|my_center|LOCUS_12520 104628 105809 gene locus_tag LOCUS_12530 104628 105809 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763169.1 protein_id gnl|my_center|LOCUS_12530 105806 106324 gene locus_tag LOCUS_12540 105806 106324 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978019.1 protein_id gnl|my_center|LOCUS_12540 107513 106329 gene locus_tag LOCUS_12550 107513 106329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 107866 107513 gene locus_tag LOCUS_12560 107866 107513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 108060 109919 gene locus_tag LOCUS_12570 108060 109919 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240475.1 protein_id gnl|my_center|LOCUS_12570 109922 110362 gene locus_tag LOCUS_12580 gene cdd 109922 110362 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080780.1 protein_id gnl|my_center|LOCUS_12580 110379 111179 gene locus_tag LOCUS_12590 110379 111179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 112328 111189 gene locus_tag LOCUS_12600 112328 111189 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 protein_id gnl|my_center|LOCUS_12600 113066 112356 gene locus_tag LOCUS_12610 113066 112356 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485759.1 protein_id gnl|my_center|LOCUS_12610 114238 113066 gene locus_tag LOCUS_12620 114238 113066 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382128.1 protein_id gnl|my_center|LOCUS_12620 114858 114430 gene locus_tag LOCUS_12630 114858 114430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 115091 115007 gene locus_tag LOCUS_t00130 115091 115007 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 115459 115214 gene locus_tag LOCUS_12640 115459 115214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 116420 115611 gene locus_tag LOCUS_12650 116420 115611 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867617.1 protein_id gnl|my_center|LOCUS_12650 116639 116917 gene locus_tag LOCUS_12660 116639 116917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 117962 116907 gene locus_tag LOCUS_12670 117962 116907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 119153 117972 gene locus_tag LOCUS_12680 gene dnaG 119153 117972 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879392.1 protein_id gnl|my_center|LOCUS_12680 119606 119247 gene locus_tag LOCUS_12690 119606 119247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 120649 119870 gene locus_tag LOCUS_12700 gene fabG 120649 119870 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_12700 121253 120684 gene locus_tag LOCUS_12710 121253 120684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 122378 121317 gene locus_tag LOCUS_12720 122378 121317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 122902 124071 gene locus_tag LOCUS_12730 122902 124071 CDS product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068577384.1 protein_id gnl|my_center|LOCUS_12730 124167 124514 gene locus_tag LOCUS_12740 124167 124514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 124511 125923 gene locus_tag LOCUS_12750 gene moeB 124511 125923 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_12750 126065 126955 gene locus_tag LOCUS_12760 126065 126955 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979100.1 protein_id gnl|my_center|LOCUS_12760 127261 129840 gene locus_tag LOCUS_12770 127261 129840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 129837 130028 gene locus_tag LOCUS_12780 129837 130028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 130295 130095 gene locus_tag LOCUS_12790 130295 130095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 130431 132554 gene locus_tag LOCUS_12800 130431 132554 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979927.1 protein_id gnl|my_center|LOCUS_12800 132556 133383 gene locus_tag LOCUS_12810 132556 133383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846787.1 protein_id gnl|my_center|LOCUS_12810 133478 134017 gene locus_tag LOCUS_12820 133478 134017 CDS product DUF1404 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978076.1 protein_id gnl|my_center|LOCUS_12820 134679 134260 gene locus_tag LOCUS_12830 134679 134260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 135077 135451 gene locus_tag LOCUS_12840 135077 135451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 135633 136094 gene locus_tag LOCUS_12850 135633 136094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 137119 136295 gene locus_tag LOCUS_12860 137119 136295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 137241 137453 gene locus_tag LOCUS_12870 137241 137453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 137964 138364 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccttcaacgaagccataaccttttggttatggagac 138623 141151 gene locus_tag LOCUS_12880 gene cas3u 138623 141151 CDS product type I-U CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930412.1 protein_id gnl|my_center|LOCUS_12880 141138 141953 gene locus_tag LOCUS_12890 gene cas8c 141138 141953 CDS product type I-U CRISPR-associated protein Cas8c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940730.1 protein_id gnl|my_center|LOCUS_12890 141987 143093 gene locus_tag LOCUS_12900 gene cas7u 141987 143093 CDS product type I-U CRISPR-associated RAMP protein Csb1/Cas7u inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940731.1 protein_id gnl|my_center|LOCUS_12900 143094 144527 gene locus_tag LOCUS_12910 gene csb2 143094 144527 CDS product type I-U CRISPR-associated protein Csb2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940732.1 protein_id gnl|my_center|LOCUS_12910 144548 146197 gene locus_tag LOCUS_12920 gene cas1 144548 146197 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_12920 146202 146492 gene locus_tag LOCUS_12930 gene cas2 146202 146492 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387937.1 protein_id gnl|my_center|LOCUS_12930 146952 146578 gene locus_tag LOCUS_12940 146952 146578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 147301 146858 gene locus_tag LOCUS_12950 147301 146858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 147510 147298 gene locus_tag LOCUS_12960 147510 147298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence06 <1 578 gene locus_tag LOCUS_12970 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876071.1:TIGR00289 family protein 571 1896 gene locus_tag LOCUS_12980 571 1896 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867603.1 protein_id gnl|my_center|LOCUS_12980 2713 3042 gene locus_tag LOCUS_12990 2713 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 3176 3379 gene locus_tag LOCUS_13000 3176 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 3385 3726 gene locus_tag LOCUS_13010 3385 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 3848 4417 gene locus_tag LOCUS_13020 3848 4417 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867500.1 protein_id gnl|my_center|LOCUS_13020 4408 5160 gene locus_tag LOCUS_13030 gene rsmA 4408 5160 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990848.1 protein_id gnl|my_center|LOCUS_13030 5157 5699 gene locus_tag LOCUS_13040 5157 5699 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867555.1 protein_id gnl|my_center|LOCUS_13040 5816 6508 gene locus_tag LOCUS_13050 5816 6508 CDS product TrmJ/YjtD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877451.1 protein_id gnl|my_center|LOCUS_13050 7694 6513 gene locus_tag LOCUS_13060 7694 6513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 8013 8429 gene locus_tag LOCUS_13070 8013 8429 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846759.1 protein_id gnl|my_center|LOCUS_13070 8422 9441 gene locus_tag LOCUS_13080 gene dph2 8422 9441 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876932.1 protein_id gnl|my_center|LOCUS_13080 10224 10517 gene locus_tag LOCUS_13090 10224 10517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 10517 10858 gene locus_tag LOCUS_13100 10517 10858 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870659.1 protein_id gnl|my_center|LOCUS_13100 11876 11211 gene locus_tag LOCUS_13110 11876 11211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 13533 12529 gene locus_tag LOCUS_13120 13533 12529 CDS product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080192.1 protein_id gnl|my_center|LOCUS_13120 14172 13795 gene locus_tag LOCUS_13130 14172 13795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 14776 14420 gene locus_tag LOCUS_13140 14776 14420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 15053 15126 gene locus_tag LOCUS_t00140 15053 15126 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 15528 15866 gene locus_tag LOCUS_13150 15528 15866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 16447 15932 gene locus_tag LOCUS_13160 16447 15932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 16881 16444 gene locus_tag LOCUS_13170 16881 16444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 17087 17509 gene locus_tag LOCUS_13180 17087 17509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 18720 17515 gene locus_tag LOCUS_13190 18720 17515 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090011.1 protein_id gnl|my_center|LOCUS_13190 20154 18772 gene locus_tag LOCUS_13200 20154 18772 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475806.1 protein_id gnl|my_center|LOCUS_13200 20941 20534 gene locus_tag LOCUS_13210 20941 20534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13210 21587 22024 gene locus_tag LOCUS_13220 21587 22024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 22793 23350 gene locus_tag LOCUS_13230 22793 23350 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986565.1 protein_id gnl|my_center|LOCUS_13230 24125 23352 gene locus_tag LOCUS_13240 24125 23352 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061277.1 protein_id gnl|my_center|LOCUS_13240 24901 24122 gene locus_tag LOCUS_13250 24901 24122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 25842 24898 gene locus_tag LOCUS_13260 25842 24898 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250095.1 protein_id gnl|my_center|LOCUS_13260 26012 27427 gene locus_tag LOCUS_13270 26012 27427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 27530 28678 gene locus_tag LOCUS_13280 27530 28678 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_13280 28675 28980 gene locus_tag LOCUS_13290 28675 28980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 29091 30359 gene locus_tag LOCUS_13300 29091 30359 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_13300 30425 31249 gene locus_tag LOCUS_13310 30425 31249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 31308 31529 gene locus_tag LOCUS_13320 31308 31529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 31848 32753 gene locus_tag LOCUS_13330 31848 32753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 33572 32871 gene locus_tag LOCUS_13340 33572 32871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 33948 34385 gene locus_tag LOCUS_13350 33948 34385 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868810.1 protein_id gnl|my_center|LOCUS_13350 34488 35780 gene locus_tag LOCUS_13360 34488 35780 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_13360 36254 35826 gene locus_tag LOCUS_13370 36254 35826 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942008.1 protein_id gnl|my_center|LOCUS_13370 36420 36737 gene locus_tag LOCUS_13380 36420 36737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 37679 36807 gene locus_tag LOCUS_13390 37679 36807 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870010.1 protein_id gnl|my_center|LOCUS_13390 38341 37685 gene locus_tag LOCUS_13400 38341 37685 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878987.1 protein_id gnl|my_center|LOCUS_13400 38838 38338 gene locus_tag LOCUS_13410 38838 38338 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867125.1 protein_id gnl|my_center|LOCUS_13410 39376 38915 gene locus_tag LOCUS_13420 39376 38915 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869871.1 protein_id gnl|my_center|LOCUS_13420 39556 39377 gene locus_tag LOCUS_13430 39556 39377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 39814 40731 gene locus_tag LOCUS_13440 gene argF 39814 40731 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584136.1 protein_id gnl|my_center|LOCUS_13440 41617 40709 gene locus_tag LOCUS_13450 gene ftsY 41617 40709 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867626.1 protein_id gnl|my_center|LOCUS_13450 42062 41622 gene locus_tag LOCUS_13460 42062 41622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 42755 42075 gene locus_tag LOCUS_13470 42755 42075 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496375.1 protein_id gnl|my_center|LOCUS_13470 43322 42798 gene locus_tag LOCUS_13480 43322 42798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 43786 43502 gene locus_tag LOCUS_13490 43786 43502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 44778 45305 gene locus_tag LOCUS_13500 44778 45305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13500 45449 45526 gene locus_tag LOCUS_t00150 45449 45526 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 45938 46153 gene locus_tag LOCUS_13510 45938 46153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 46408 46587 gene locus_tag LOCUS_13520 46408 46587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 48062 47586 gene locus_tag LOCUS_13530 48062 47586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 49012 48434 gene locus_tag LOCUS_13540 49012 48434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 51030 49822 gene locus_tag LOCUS_13550 51030 49822 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014128488.1 protein_id gnl|my_center|LOCUS_13550 51414 51100 gene locus_tag LOCUS_13560 51414 51100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 51567 52136 gene locus_tag LOCUS_13570 51567 52136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 52853 52509 gene locus_tag LOCUS_13580 52853 52509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 53483 52908 gene locus_tag LOCUS_13590 gene dps 53483 52908 CDS product DNA protection during starvation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144276.1 protein_id gnl|my_center|LOCUS_13590 54147 53779 gene locus_tag LOCUS_13600 54147 53779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 54720 54265 gene locus_tag LOCUS_13610 54720 54265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 54961 55719 gene locus_tag LOCUS_13620 54961 55719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 56562 57446 gene locus_tag LOCUS_13630 56562 57446 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064254.1 protein_id gnl|my_center|LOCUS_13630 57674 59734 gene locus_tag LOCUS_13640 gene topA 57674 59734 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868544.1 protein_id gnl|my_center|LOCUS_13640 60268 59729 gene locus_tag LOCUS_13650 60268 59729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 60414 60629 gene locus_tag LOCUS_13660 60414 60629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 63118 60758 gene locus_tag LOCUS_13670 63118 60758 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762768.1 protein_id gnl|my_center|LOCUS_13670 64428 63175 gene locus_tag LOCUS_13680 gene prf1 64428 63175 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876511.1 protein_id gnl|my_center|LOCUS_13680 64475 65155 gene locus_tag LOCUS_13690 gene pyrH 64475 65155 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979322.1 protein_id gnl|my_center|LOCUS_13690 66011 65379 gene locus_tag LOCUS_13700 66011 65379 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_13700 66012 67430 gene locus_tag LOCUS_13710 66012 67430 CDS product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877017.1 protein_id gnl|my_center|LOCUS_13710 68648 67440 gene locus_tag LOCUS_13720 68648 67440 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250852.1 protein_id gnl|my_center|LOCUS_13720 69111 68929 gene locus_tag LOCUS_13730 69111 68929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 69111 69536 gene locus_tag LOCUS_13740 69111 69536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 70064 69549 gene locus_tag LOCUS_13750 70064 69549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 70586 70140 gene locus_tag LOCUS_13760 70586 70140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 70746 70898 gene locus_tag LOCUS_13770 70746 70898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 70906 71640 gene locus_tag LOCUS_13780 70906 71640 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868227.1 protein_id gnl|my_center|LOCUS_13780 71666 74992 gene locus_tag LOCUS_13790 gene polC 71666 74992 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879218.1 protein_id gnl|my_center|LOCUS_13790 75973 74978 gene locus_tag LOCUS_13800 75973 74978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13800 76341 76096 gene locus_tag LOCUS_13810 76341 76096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 77163 76831 gene locus_tag LOCUS_13820 77163 76831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 77309 78529 gene locus_tag LOCUS_13830 77309 78529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 78648 80009 gene locus_tag LOCUS_13840 78648 80009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 82144 80006 gene locus_tag LOCUS_13850 82144 80006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 83854 83003 gene locus_tag LOCUS_13860 83854 83003 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060997.1 protein_id gnl|my_center|LOCUS_13860 84687 84307 gene locus_tag LOCUS_13870 84687 84307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 85201 85470 gene locus_tag LOCUS_13880 85201 85470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 85534 85968 gene locus_tag LOCUS_13890 85534 85968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 86021 87223 gene locus_tag LOCUS_13900 86021 87223 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970459.1 protein_id gnl|my_center|LOCUS_13900 88497 87463 gene locus_tag LOCUS_13910 88497 87463 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980491.1 protein_id gnl|my_center|LOCUS_13910 89993 89526 gene locus_tag LOCUS_13920 89993 89526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 90071 90376 gene locus_tag LOCUS_13930 90071 90376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 91310 91498 gene locus_tag LOCUS_13940 91310 91498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence07 517 35 gene locus_tag LOCUS_13950 517 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 1378 4296 gene locus_tag LOCUS_13960 1378 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 5382 5047 gene locus_tag LOCUS_13970 5382 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 6708 5725 gene locus_tag LOCUS_13980 6708 5725 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980518.1 protein_id gnl|my_center|LOCUS_13980 8644 6698 gene locus_tag LOCUS_13990 8644 6698 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980386.1 protein_id gnl|my_center|LOCUS_13990 9223 8792 gene locus_tag LOCUS_14000 gene zfx1 9223 8792 CDS product zinc-containing ferredoxin Zfx1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978102.1 protein_id gnl|my_center|LOCUS_14000 9673 9230 gene locus_tag LOCUS_14010 9673 9230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 10826 9816 gene locus_tag LOCUS_14020 10826 9816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979645.1 protein_id gnl|my_center|LOCUS_14020 10898 11506 gene locus_tag LOCUS_14030 10898 11506 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976893.1 protein_id gnl|my_center|LOCUS_14030 12789 11608 gene locus_tag LOCUS_14040 12789 11608 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899055.1 protein_id gnl|my_center|LOCUS_14040 14487 13132 gene locus_tag LOCUS_14050 14487 13132 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860267.1 protein_id gnl|my_center|LOCUS_14050 15059 14484 gene locus_tag LOCUS_14060 15059 14484 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031813.1 protein_id gnl|my_center|LOCUS_14060 15891 15043 gene locus_tag LOCUS_14070 15891 15043 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958565.1 protein_id gnl|my_center|LOCUS_14070 16321 16046 gene locus_tag LOCUS_14080 16321 16046 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256599.1 protein_id gnl|my_center|LOCUS_14080 16795 17433 gene locus_tag LOCUS_14090 16795 17433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 17437 17757 gene locus_tag LOCUS_14100 17437 17757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 17826 18971 gene locus_tag LOCUS_14110 17826 18971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257446.1 protein_id gnl|my_center|LOCUS_14110 19617 19186 gene locus_tag LOCUS_14120 19617 19186 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838707.1 protein_id gnl|my_center|LOCUS_14120 20440 21336 gene locus_tag LOCUS_14130 20440 21336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 22523 21537 gene locus_tag LOCUS_14140 22523 21537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 23123 22659 gene locus_tag LOCUS_14150 23123 22659 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967591.1 protein_id gnl|my_center|LOCUS_14150 23853 23194 gene locus_tag LOCUS_14160 23853 23194 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096121.1 protein_id gnl|my_center|LOCUS_14160 24564 23938 gene locus_tag LOCUS_14170 24564 23938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 24704 25282 gene locus_tag LOCUS_14180 24704 25282 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021972.1 protein_id gnl|my_center|LOCUS_14180 25784 25266 gene locus_tag LOCUS_14190 25784 25266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 27037 25781 gene locus_tag LOCUS_14200 27037 25781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 28105 27092 gene locus_tag LOCUS_14210 28105 27092 CDS product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063658.1 protein_id gnl|my_center|LOCUS_14210 28875 28159 gene locus_tag LOCUS_14220 gene narI 28875 28159 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969195.1 protein_id gnl|my_center|LOCUS_14220 29407 28862 gene locus_tag LOCUS_14230 gene narJ 29407 28862 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814217.1 protein_id gnl|my_center|LOCUS_14230 30990 29404 gene locus_tag LOCUS_14240 gene narH 30990 29404 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692685.1 protein_id gnl|my_center|LOCUS_14240 34525 30980 gene locus_tag LOCUS_14250 34525 30980 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729064.1 protein_id gnl|my_center|LOCUS_14250 35421 34774 gene locus_tag LOCUS_14260 35421 34774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 35666 36118 gene locus_tag LOCUS_14270 35666 36118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 36258 37475 gene locus_tag LOCUS_14280 36258 37475 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978775.1 protein_id gnl|my_center|LOCUS_14280 37632 38153 gene locus_tag LOCUS_14290 37632 38153 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583273.1 protein_id gnl|my_center|LOCUS_14290 39762 38185 gene locus_tag LOCUS_14300 gene hutU 39762 38185 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416707.1 protein_id gnl|my_center|LOCUS_14300 39920 41173 gene locus_tag LOCUS_14310 gene hutI 39920 41173 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887529.1 protein_id gnl|my_center|LOCUS_14310 42650 41175 gene locus_tag LOCUS_14320 gene hutH 42650 41175 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243255.1 protein_id gnl|my_center|LOCUS_14320 42719 43684 gene locus_tag LOCUS_14330 gene hutG 42719 43684 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243908.1 protein_id gnl|my_center|LOCUS_14330 44554 43715 gene locus_tag LOCUS_14340 44554 43715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 44924 46843 gene locus_tag LOCUS_14350 44924 46843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 49519 46994 gene locus_tag LOCUS_14360 49519 46994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 50013 49681 gene locus_tag LOCUS_14370 50013 49681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 50520 50035 gene locus_tag LOCUS_14380 50520 50035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 50577 50987 gene locus_tag LOCUS_14390 50577 50987 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876368.1 protein_id gnl|my_center|LOCUS_14390 50989 52152 gene locus_tag LOCUS_14400 gene hflX 50989 52152 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870637.1 protein_id gnl|my_center|LOCUS_14400 52713 52141 gene locus_tag LOCUS_14410 52713 52141 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053622.1 protein_id gnl|my_center|LOCUS_14410 52751 53299 gene locus_tag LOCUS_14420 gene tfe 52751 53299 CDS product transcription factor E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250974.1 protein_id gnl|my_center|LOCUS_14420 53863 53282 gene locus_tag LOCUS_14430 53863 53282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 54144 53860 gene locus_tag LOCUS_14440 54144 53860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 54316 54900 gene locus_tag LOCUS_14450 gene msrA 54316 54900 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_14450 55943 54897 gene locus_tag LOCUS_14460 55943 54897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 56940 56002 gene locus_tag LOCUS_14470 56940 56002 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_14470 57243 57968 gene locus_tag LOCUS_14480 57243 57968 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023615.1 protein_id gnl|my_center|LOCUS_14480 58196 59056 gene locus_tag LOCUS_14490 gene dapA 58196 59056 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940835.1 protein_id gnl|my_center|LOCUS_14490 60385 59138 gene locus_tag LOCUS_14500 gene eno 60385 59138 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065179.1 protein_id gnl|my_center|LOCUS_14500 61065 60652 gene locus_tag LOCUS_14510 61065 60652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 61297 61049 gene locus_tag LOCUS_14520 61297 61049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 62140 63324 gene locus_tag LOCUS_14530 62140 63324 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980657.1 protein_id gnl|my_center|LOCUS_14530 63430 64854 gene locus_tag LOCUS_14540 gene pyk 63430 64854 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584142.1 protein_id gnl|my_center|LOCUS_14540 66200 64890 gene locus_tag LOCUS_14550 66200 64890 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938066.1 protein_id gnl|my_center|LOCUS_14550 66370 67434 gene locus_tag LOCUS_14560 66370 67434 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141167.1 protein_id gnl|my_center|LOCUS_14560 67668 68486 gene locus_tag LOCUS_14570 gene surE 67668 68486 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020163.1 protein_id gnl|my_center|LOCUS_14570 68617 69501 gene locus_tag LOCUS_14580 68617 69501 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763484.1 protein_id gnl|my_center|LOCUS_14580 69564 70379 gene locus_tag LOCUS_14590 69564 70379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 71542 70388 gene locus_tag LOCUS_14600 gene metK 71542 70388 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392413.1 protein_id gnl|my_center|LOCUS_14600 71754 71954 gene locus_tag LOCUS_14610 71754 71954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 73261 71972 gene locus_tag LOCUS_14620 73261 71972 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528603.1 protein_id gnl|my_center|LOCUS_14620 73962 75539 gene locus_tag LOCUS_14630 gene ggt 73962 75539 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808651.1 protein_id gnl|my_center|LOCUS_14630 75617 76117 gene locus_tag LOCUS_14640 75617 76117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 76663 76157 gene locus_tag LOCUS_14650 76663 76157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 76818 77366 gene locus_tag LOCUS_14660 76818 77366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 77378 78871 gene locus_tag LOCUS_14670 gene gltA 77378 78871 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023687.1 protein_id gnl|my_center|LOCUS_14670 79037 79276 gene locus_tag LOCUS_14680 79037 79276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 79233 79637 gene locus_tag LOCUS_14690 79233 79637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14690 80044 80967 gene locus_tag LOCUS_14700 80044 80967 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256181.1 protein_id gnl|my_center|LOCUS_14700 80964 81710 gene locus_tag LOCUS_14710 80964 81710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 82043 81852 gene locus_tag LOCUS_14720 82043 81852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 82244 82507 gene locus_tag LOCUS_14730 82244 82507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 82729 83781 gene locus_tag LOCUS_14740 82729 83781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence08 633 3488 gene locus_tag LOCUS_14750 633 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 3924 3571 gene locus_tag LOCUS_14760 3924 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 4017 4946 gene locus_tag LOCUS_14770 4017 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 4975 5556 gene locus_tag LOCUS_14780 4975 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 5929 6963 gene locus_tag LOCUS_14790 5929 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 6953 7924 gene locus_tag LOCUS_14800 6953 7924 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978966.1 protein_id gnl|my_center|LOCUS_14800 7984 9075 gene locus_tag LOCUS_14810 gene wecB 7984 9075 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_14810 9215 10543 gene locus_tag LOCUS_14820 9215 10543 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762251.1 protein_id gnl|my_center|LOCUS_14820 10540 11169 gene locus_tag LOCUS_14830 10540 11169 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403266.1 protein_id gnl|my_center|LOCUS_14830 12776 11619 gene locus_tag LOCUS_14840 12776 11619 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878467.1 protein_id gnl|my_center|LOCUS_14840 13898 12783 gene locus_tag LOCUS_14850 13898 12783 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081868529.1 protein_id gnl|my_center|LOCUS_14850 15165 14266 gene locus_tag LOCUS_14860 15165 14266 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209658.1 protein_id gnl|my_center|LOCUS_14860 15698 15174 gene locus_tag LOCUS_14870 gene pxpB 15698 15174 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868109.1 protein_id gnl|my_center|LOCUS_14870 16683 15892 gene locus_tag LOCUS_14880 16683 15892 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731005.1 protein_id gnl|my_center|LOCUS_14880 17508 16744 gene locus_tag LOCUS_14890 17508 16744 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867271.1 protein_id gnl|my_center|LOCUS_14890 18810 17596 gene locus_tag LOCUS_14900 18810 17596 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061074.1 protein_id gnl|my_center|LOCUS_14900 19242 19691 gene locus_tag LOCUS_14910 19242 19691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 19747 20751 gene locus_tag LOCUS_14920 19747 20751 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014745580.1 protein_id gnl|my_center|LOCUS_14920 20893 21900 gene locus_tag LOCUS_14930 20893 21900 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013682815.1 protein_id gnl|my_center|LOCUS_14930 22037 22675 gene locus_tag LOCUS_14940 22037 22675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 22713 23201 gene locus_tag LOCUS_14950 22713 23201 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_14950 23868 23194 gene locus_tag LOCUS_14960 23868 23194 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545344.1 protein_id gnl|my_center|LOCUS_14960 24228 23914 gene locus_tag LOCUS_14970 24228 23914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 24753 24304 gene locus_tag LOCUS_14980 24753 24304 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546540.1 protein_id gnl|my_center|LOCUS_14980 26004 24817 gene locus_tag LOCUS_14990 26004 24817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 27304 26042 gene locus_tag LOCUS_15000 gene pgk 27304 26042 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061271.1 protein_id gnl|my_center|LOCUS_15000 27424 27858 gene locus_tag LOCUS_15010 27424 27858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 27877 28161 gene locus_tag LOCUS_15020 27877 28161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 28166 28393 gene locus_tag LOCUS_15030 28166 28393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 28591 28415 gene locus_tag LOCUS_15040 28591 28415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 29459 29121 gene locus_tag LOCUS_15050 29459 29121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 29719 33081 gene locus_tag LOCUS_15060 29719 33081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 33560 33270 gene locus_tag LOCUS_15070 33560 33270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 34669 33557 gene locus_tag LOCUS_15080 34669 33557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 34940 36676 gene locus_tag LOCUS_15090 34940 36676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 36681 37682 gene locus_tag LOCUS_15100 36681 37682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 37687 38220 gene locus_tag LOCUS_15110 37687 38220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 38217 39512 gene locus_tag LOCUS_15120 38217 39512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 39509 41488 gene locus_tag LOCUS_15130 39509 41488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 41489 44296 gene locus_tag LOCUS_15140 41489 44296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 44343 45053 gene locus_tag LOCUS_15150 44343 45053 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877951.1 protein_id gnl|my_center|LOCUS_15150 45050 46948 gene locus_tag LOCUS_15160 45050 46948 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250186.1 protein_id gnl|my_center|LOCUS_15160 47012 48013 gene locus_tag LOCUS_15170 47012 48013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 48010 48774 gene locus_tag LOCUS_15180 gene gph 48010 48774 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532061.1 protein_id gnl|my_center|LOCUS_15180 49447 48752 gene locus_tag LOCUS_15190 gene tpiA 49447 48752 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868855.1 protein_id gnl|my_center|LOCUS_15190 50564 49434 gene locus_tag LOCUS_15200 gene fbp 50564 49434 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846263.1 protein_id gnl|my_center|LOCUS_15200 50901 51431 gene locus_tag LOCUS_15210 50901 51431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 51483 52313 gene locus_tag LOCUS_15220 51483 52313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 52341 53291 gene locus_tag LOCUS_15230 52341 53291 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892274.1 protein_id gnl|my_center|LOCUS_15230 53926 53315 gene locus_tag LOCUS_15240 53926 53315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 54148 54735 gene locus_tag LOCUS_15250 54148 54735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 55563 54841 gene locus_tag LOCUS_15260 55563 54841 CDS product DUF981 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979588.1 protein_id gnl|my_center|LOCUS_15260 56105 56686 gene locus_tag LOCUS_15270 56105 56686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 56891 57430 gene locus_tag LOCUS_15280 56891 57430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 57636 57545 gene locus_tag LOCUS_t00160 57636 57545 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 57887 57708 gene locus_tag LOCUS_15290 57887 57708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 58408 59550 gene locus_tag LOCUS_15300 58408 59550 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980340.1 protein_id gnl|my_center|LOCUS_15300 60293 59535 gene locus_tag LOCUS_15310 60293 59535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 60715 60284 gene locus_tag LOCUS_15320 60715 60284 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761848.1 protein_id gnl|my_center|LOCUS_15320 61863 60730 gene locus_tag LOCUS_15330 61863 60730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 62205 62594 gene locus_tag LOCUS_15340 62205 62594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 62960 62622 gene locus_tag LOCUS_15350 62960 62622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 63194 63487 gene locus_tag LOCUS_15360 63194 63487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 63514 64191 gene locus_tag LOCUS_15370 63514 64191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 64166 64450 gene locus_tag LOCUS_15380 64166 64450 CDS product archaellum operon transcriptional activator EarA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878956.1 protein_id gnl|my_center|LOCUS_15380 64644 65945 gene locus_tag LOCUS_15390 gene agl3 64644 65945 CDS product UDP-sulfoquinovose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846779.1 protein_id gnl|my_center|LOCUS_15390 66025 67077 gene locus_tag LOCUS_15400 66025 67077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 67170 68273 gene locus_tag LOCUS_15410 67170 68273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence09 1 79 gene locus_tag LOCUS_t00170 1 79 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 522 115 gene locus_tag LOCUS_15420 522 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1637 852 gene locus_tag LOCUS_15430 1637 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 3322 1898 gene locus_tag LOCUS_15440 3322 1898 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979769.1 protein_id gnl|my_center|LOCUS_15440 4500 3565 gene locus_tag LOCUS_15450 4500 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847040.1 protein_id gnl|my_center|LOCUS_15450 4873 4487 gene locus_tag LOCUS_15460 4873 4487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 6920 5106 gene locus_tag LOCUS_15470 6920 5106 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979769.1 protein_id gnl|my_center|LOCUS_15470 7224 7075 gene locus_tag LOCUS_15480 7224 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 7330 7593 gene locus_tag LOCUS_15490 7330 7593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 7590 8651 gene locus_tag LOCUS_15500 7590 8651 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223900.1 protein_id gnl|my_center|LOCUS_15500 9224 8856 gene locus_tag LOCUS_15510 9224 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 9308 9430 gene locus_tag LOCUS_15520 9308 9430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 9615 10523 gene locus_tag LOCUS_15530 9615 10523 CDS product EF-Tu/IF-2/RF-3 family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869822.1 protein_id gnl|my_center|LOCUS_15530 11726 10503 gene locus_tag LOCUS_15540 11726 10503 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405266.1 protein_id gnl|my_center|LOCUS_15540 12264 11998 gene locus_tag LOCUS_15550 12264 11998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 12406 13275 gene locus_tag LOCUS_15560 12406 13275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 13330 14394 gene locus_tag LOCUS_15570 gene asd 13330 14394 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876434.1 protein_id gnl|my_center|LOCUS_15570 14558 15376 gene locus_tag LOCUS_15580 14558 15376 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259324.1 protein_id gnl|my_center|LOCUS_15580 16036 15377 gene locus_tag LOCUS_15590 16036 15377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 16101 17192 gene locus_tag LOCUS_15600 gene amrS 16101 17192 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979564.1 protein_id gnl|my_center|LOCUS_15600 17506 17222 gene locus_tag LOCUS_15610 17506 17222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 17781 18908 gene locus_tag LOCUS_15620 17781 18908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 18901 20214 gene locus_tag LOCUS_15630 18901 20214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 20332 20598 gene locus_tag LOCUS_15640 20332 20598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 20595 22280 gene locus_tag LOCUS_15650 20595 22280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 22877 22407 gene locus_tag LOCUS_15660 22877 22407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 23049 24929 gene locus_tag LOCUS_15670 23049 24929 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 protein_id gnl|my_center|LOCUS_15670 25345 24932 gene locus_tag LOCUS_15680 25345 24932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 25465 25776 gene locus_tag LOCUS_15690 25465 25776 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074197.1 protein_id gnl|my_center|LOCUS_15690 25791 28547 gene locus_tag LOCUS_15700 gene acnA 25791 28547 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228149.1 protein_id gnl|my_center|LOCUS_15700 29122 28697 gene locus_tag LOCUS_15710 gene zfx1 29122 28697 CDS product zinc-containing ferredoxin Zfx1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978102.1 protein_id gnl|my_center|LOCUS_15710 29873 31942 gene locus_tag LOCUS_15720 29873 31942 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_15720 32092 32529 gene locus_tag LOCUS_15730 32092 32529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 33043 32753 gene locus_tag LOCUS_15740 33043 32753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 33412 33056 gene locus_tag LOCUS_15750 33412 33056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 33840 33427 gene locus_tag LOCUS_15760 33840 33427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 34320 33958 gene locus_tag LOCUS_15770 34320 33958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 35105 34344 gene locus_tag LOCUS_15780 35105 34344 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357819.1 protein_id gnl|my_center|LOCUS_15780 35310 35164 gene locus_tag LOCUS_15790 35310 35164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 35971 35393 gene locus_tag LOCUS_15800 35971 35393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 37647 35989 gene locus_tag LOCUS_15810 37647 35989 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879805.1 protein_id gnl|my_center|LOCUS_15810 38655 37807 gene locus_tag LOCUS_15820 gene tatC 38655 37807 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545000.1 protein_id gnl|my_center|LOCUS_15820 38943 38707 gene locus_tag LOCUS_15830 38943 38707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 39626 39069 gene locus_tag LOCUS_15840 39626 39069 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250601.1 protein_id gnl|my_center|LOCUS_15840 40252 39695 gene locus_tag LOCUS_15850 40252 39695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 41313 41447 gene locus_tag LOCUS_15860 41313 41447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 41454 41654 gene locus_tag LOCUS_15870 41454 41654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 41763 42671 gene locus_tag LOCUS_15880 41763 42671 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808204.1 protein_id gnl|my_center|LOCUS_15880 42668 43516 gene locus_tag LOCUS_15890 42668 43516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 45889 44108 gene locus_tag LOCUS_15900 45889 44108 CDS product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000371.1 protein_id gnl|my_center|LOCUS_15900 48607 46640 gene locus_tag LOCUS_15910 48607 46640 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525144.1 protein_id gnl|my_center|LOCUS_15910 49562 51400 gene locus_tag LOCUS_15920 49562 51400 CDS product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895174.1 protein_id gnl|my_center|LOCUS_15920 51400 52527 gene locus_tag LOCUS_15930 51400 52527 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080048.1 protein_id gnl|my_center|LOCUS_15930 53471 52557 gene locus_tag LOCUS_15940 53471 52557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 55449 53566 gene locus_tag LOCUS_15950 55449 53566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 56074 55565 gene locus_tag LOCUS_15960 56074 55565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 56609 56076 gene locus_tag LOCUS_15970 56609 56076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 57118 56597 gene locus_tag LOCUS_15980 57118 56597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 58829 57600 gene locus_tag LOCUS_15990 58829 57600 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878822.1 protein_id gnl|my_center|LOCUS_15990 59448 58966 gene locus_tag LOCUS_16000 59448 58966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence10 2289 991 gene locus_tag LOCUS_16010 gene glyA 2289 991 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061037.1 protein_id gnl|my_center|LOCUS_16010 2536 3603 gene locus_tag LOCUS_16020 2536 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 3648 5048 gene locus_tag LOCUS_16030 3648 5048 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807812.1 protein_id gnl|my_center|LOCUS_16030 6297 5095 gene locus_tag LOCUS_16040 6297 5095 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142523.1 protein_id gnl|my_center|LOCUS_16040 7006 6350 gene locus_tag LOCUS_16050 7006 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 7477 7031 gene locus_tag LOCUS_16060 7477 7031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 8584 7658 gene locus_tag LOCUS_16070 gene pyrB 8584 7658 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 protein_id gnl|my_center|LOCUS_16070 9528 8644 gene locus_tag LOCUS_16080 9528 8644 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540892.1 protein_id gnl|my_center|LOCUS_16080 12098 9756 gene locus_tag LOCUS_16090 12098 9756 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257971.1 protein_id gnl|my_center|LOCUS_16090 13593 12205 gene locus_tag LOCUS_16100 13593 12205 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455014.1 protein_id gnl|my_center|LOCUS_16100 15495 13714 gene locus_tag LOCUS_16110 gene ade 15495 13714 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392001.1 protein_id gnl|my_center|LOCUS_16110 15512 15712 gene locus_tag LOCUS_16120 15512 15712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 15764 16195 gene locus_tag LOCUS_16130 15764 16195 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761914.1 protein_id gnl|my_center|LOCUS_16130 17584 16199 gene locus_tag LOCUS_16140 17584 16199 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978631.1 protein_id gnl|my_center|LOCUS_16140 17996 17649 gene locus_tag LOCUS_16150 gene trxA 17996 17649 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392444.1 protein_id gnl|my_center|LOCUS_16150 18189 18512 gene locus_tag LOCUS_16160 18189 18512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 18726 19346 gene locus_tag LOCUS_16170 18726 19346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 19648 20424 gene locus_tag LOCUS_16180 gene sufC 19648 20424 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228949.1 protein_id gnl|my_center|LOCUS_16180 20490 21893 gene locus_tag LOCUS_16190 gene sufB 20490 21893 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259322.1 protein_id gnl|my_center|LOCUS_16190 21917 23146 gene locus_tag LOCUS_16200 21917 23146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 23215 24450 gene locus_tag LOCUS_16210 23215 24450 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_16210 24447 24878 gene locus_tag LOCUS_16220 24447 24878 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_16220 25309 25028 gene locus_tag LOCUS_16230 25309 25028 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978435.1 protein_id gnl|my_center|LOCUS_16230 25431 25772 gene locus_tag LOCUS_16240 25431 25772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 27302 25788 gene locus_tag LOCUS_16250 27302 25788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 27377 28246 gene locus_tag LOCUS_16260 27377 28246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 28275 29582 gene locus_tag LOCUS_16270 28275 29582 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867468.1 protein_id gnl|my_center|LOCUS_16270 29988 29596 gene locus_tag LOCUS_16280 29988 29596 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868733.1 protein_id gnl|my_center|LOCUS_16280 31381 29993 gene locus_tag LOCUS_16290 31381 29993 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870644.1 protein_id gnl|my_center|LOCUS_16290 31561 33342 gene locus_tag LOCUS_16300 31561 33342 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868460.1 protein_id gnl|my_center|LOCUS_16300 33524 34048 gene locus_tag LOCUS_16310 33524 34048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 34391 34032 gene locus_tag LOCUS_16320 34391 34032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 35147 34401 gene locus_tag LOCUS_16330 gene pcn 35147 34401 CDS product proliferating cell nuclear antigen (pcna) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762193.1 protein_id gnl|my_center|LOCUS_16330 35248 36393 gene locus_tag LOCUS_16340 gene priS 35248 36393 CDS product DNA primase small subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978939.1 protein_id gnl|my_center|LOCUS_16340 36483 37151 gene locus_tag LOCUS_16350 36483 37151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 37148 37429 gene locus_tag LOCUS_16360 37148 37429 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978937.1 protein_id gnl|my_center|LOCUS_16360 37503 37703 gene locus_tag LOCUS_16370 37503 37703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 37700 38479 gene locus_tag LOCUS_16380 37700 38479 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867969.1 protein_id gnl|my_center|LOCUS_16380 40864 38645 gene locus_tag LOCUS_16390 40864 38645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 41317 40910 gene locus_tag LOCUS_16400 gene gcvH 41317 40910 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146698.1 protein_id gnl|my_center|LOCUS_16400 42428 41304 gene locus_tag LOCUS_16410 gene gcvT 42428 41304 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082884.1 protein_id gnl|my_center|LOCUS_16410 42482 43255 gene locus_tag LOCUS_16420 gene cofE 42482 43255 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023428.1 protein_id gnl|my_center|LOCUS_16420 43910 43227 gene locus_tag LOCUS_16430 43910 43227 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880570.1 protein_id gnl|my_center|LOCUS_16430 44048 44875 gene locus_tag LOCUS_16440 44048 44875 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880570.1 protein_id gnl|my_center|LOCUS_16440 44916 46565 gene locus_tag LOCUS_16450 gene metG 44916 46565 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762101.1 protein_id gnl|my_center|LOCUS_16450 46993 46562 gene locus_tag LOCUS_16460 46993 46562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 47087 48085 gene locus_tag LOCUS_16470 gene trxB 47087 48085 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_16470 49172 48054 gene locus_tag LOCUS_16480 gene dinB 49172 48054 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066563.1 protein_id gnl|my_center|LOCUS_16480 50071 49874 gene locus_tag LOCUS_16490 50071 49874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 50505 50242 gene locus_tag LOCUS_16500 50505 50242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 51304 51684 gene locus_tag LOCUS_16510 51304 51684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 51692 52837 gene locus_tag LOCUS_16520 gene arsB 51692 52837 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393695.1 protein_id gnl|my_center|LOCUS_16520 52838 53263 gene locus_tag LOCUS_16530 52838 53263 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_16530 53591 54424 gene locus_tag LOCUS_16540 53591 54424 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989337.1 protein_id gnl|my_center|LOCUS_16540 55629 54421 gene locus_tag LOCUS_16550 55629 54421 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003041753.1 protein_id gnl|my_center|LOCUS_16550 56087 57172 gene locus_tag LOCUS_16560 56087 57172 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868111.1 protein_id gnl|my_center|LOCUS_16560 57330 57581 gene locus_tag LOCUS_16570 57330 57581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 57560 57880 gene locus_tag LOCUS_16580 57560 57880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 57979 59040 gene locus_tag LOCUS_16590 57979 59040 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867726.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence11 1221 1532 gene locus_tag LOCUS_16600 1221 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 1639 2748 gene locus_tag LOCUS_16610 1639 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 3130 2831 gene locus_tag LOCUS_16620 3130 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 3539 4651 gene locus_tag LOCUS_16630 gene pepQ 3539 4651 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994047.1 protein_id gnl|my_center|LOCUS_16630 4697 5431 gene locus_tag LOCUS_16640 4697 5431 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978977.1 protein_id gnl|my_center|LOCUS_16640 5501 6343 gene locus_tag LOCUS_16650 5501 6343 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868130.1 protein_id gnl|my_center|LOCUS_16650 6471 7871 gene locus_tag LOCUS_16660 gene gndA 6471 7871 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 protein_id gnl|my_center|LOCUS_16660 7878 8987 gene locus_tag LOCUS_16670 7878 8987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 11337 8995 gene locus_tag LOCUS_16680 11337 8995 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257971.1 protein_id gnl|my_center|LOCUS_16680 12618 11392 gene locus_tag LOCUS_16690 12618 11392 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978898.1 protein_id gnl|my_center|LOCUS_16690 12936 12730 gene locus_tag LOCUS_16700 12936 12730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 13598 12933 gene locus_tag LOCUS_16710 13598 12933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 13767 14603 gene locus_tag LOCUS_16720 13767 14603 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 protein_id gnl|my_center|LOCUS_16720 16585 14630 gene locus_tag LOCUS_16730 gene acs 16585 14630 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762026.1 protein_id gnl|my_center|LOCUS_16730 16758 17663 gene locus_tag LOCUS_16740 gene moaA 16758 17663 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546124.1 protein_id gnl|my_center|LOCUS_16740 17670 17930 gene locus_tag LOCUS_16750 17670 17930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 18053 18481 gene locus_tag LOCUS_16760 18053 18481 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232367.1 protein_id gnl|my_center|LOCUS_16760 18560 19765 gene locus_tag LOCUS_16770 18560 19765 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_16770 20688 19861 gene locus_tag LOCUS_16780 20688 19861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846484.1 protein_id gnl|my_center|LOCUS_16780 20782 22185 gene locus_tag LOCUS_16790 gene hydA 20782 22185 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979132.1 protein_id gnl|my_center|LOCUS_16790 23541 22204 gene locus_tag LOCUS_16800 23541 22204 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979128.1 protein_id gnl|my_center|LOCUS_16800 25087 23597 gene locus_tag LOCUS_16810 25087 23597 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257638.1 protein_id gnl|my_center|LOCUS_16810 25738 25130 gene locus_tag LOCUS_16820 25738 25130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 27014 25731 gene locus_tag LOCUS_16830 27014 25731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 27963 27019 gene locus_tag LOCUS_16840 27963 27019 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 protein_id gnl|my_center|LOCUS_16840 28453 27965 gene locus_tag LOCUS_16850 28453 27965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 29211 28450 gene locus_tag LOCUS_16860 29211 28450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 30338 29478 gene locus_tag LOCUS_16870 30338 29478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 31739 31578 gene locus_tag LOCUS_16880 31739 31578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 32126 31833 gene locus_tag LOCUS_16890 32126 31833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 32507 34603 gene locus_tag LOCUS_16900 32507 34603 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023776.1 protein_id gnl|my_center|LOCUS_16900 34654 35202 gene locus_tag LOCUS_16910 34654 35202 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878776.1 protein_id gnl|my_center|LOCUS_16910 35277 36929 gene locus_tag LOCUS_16920 35277 36929 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338336.1 protein_id gnl|my_center|LOCUS_16920 37022 38179 gene locus_tag LOCUS_16930 37022 38179 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762413.1 protein_id gnl|my_center|LOCUS_16930 38187 38495 gene locus_tag LOCUS_16940 38187 38495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 39171 38479 gene locus_tag LOCUS_16950 39171 38479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 39227 39946 gene locus_tag LOCUS_16960 39227 39946 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169713.1 protein_id gnl|my_center|LOCUS_16960 40001 40663 gene locus_tag LOCUS_16970 gene upp 40001 40663 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763370.1 protein_id gnl|my_center|LOCUS_16970 42083 40779 gene locus_tag LOCUS_16980 42083 40779 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978901.1 protein_id gnl|my_center|LOCUS_16980 43816 42101 gene locus_tag LOCUS_16990 43816 42101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 44523 43819 gene locus_tag LOCUS_17000 44523 43819 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_17000 44580 44789 gene locus_tag LOCUS_17010 44580 44789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 45337 44906 gene locus_tag LOCUS_17020 45337 44906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 45581 45318 gene locus_tag LOCUS_17030 45581 45318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 47131 45896 gene locus_tag LOCUS_17040 47131 45896 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256214.1 protein_id gnl|my_center|LOCUS_17040 47903 47244 gene locus_tag LOCUS_17050 47903 47244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 48287 47952 gene locus_tag LOCUS_17060 48287 47952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 48368 49645 gene locus_tag LOCUS_17070 48368 49645 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763075.1 protein_id gnl|my_center|LOCUS_17070 49794 51605 gene locus_tag LOCUS_17080 49794 51605 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146933.1 protein_id gnl|my_center|LOCUS_17080 51621 52478 gene locus_tag LOCUS_17090 gene trm5b 51621 52478 CDS product tRNA (guanine(37)-N1)-methyltransferase Trm5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867861.1 protein_id gnl|my_center|LOCUS_17090 53051 52473 gene locus_tag LOCUS_17100 53051 52473 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762930.1 protein_id gnl|my_center|LOCUS_17100 53585 53067 gene locus_tag LOCUS_17110 53585 53067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 53975 53697 gene locus_tag LOCUS_17120 53975 53697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 54200 53982 gene locus_tag LOCUS_17130 54200 53982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 54334 54410 gene locus_tag LOCUS_t00180 54334 54410 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 54555 54698 gene locus_tag LOCUS_17140 54555 54698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 55336 55133 gene locus_tag LOCUS_17150 55336 55133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 55762 55493 gene locus_tag LOCUS_17160 55762 55493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence12 1556 924 gene locus_tag LOCUS_17170 1556 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 2141 2869 gene locus_tag LOCUS_17180 2141 2869 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080184.1 protein_id gnl|my_center|LOCUS_17180 4338 2890 gene locus_tag LOCUS_17190 4338 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 5307 4735 gene locus_tag LOCUS_17200 5307 4735 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111108.1 protein_id gnl|my_center|LOCUS_17200 5495 6967 gene locus_tag LOCUS_17210 5495 6967 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256756.1 protein_id gnl|my_center|LOCUS_17210 7084 7413 gene locus_tag LOCUS_17220 7084 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 8575 7598 gene locus_tag LOCUS_17230 8575 7598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 9678 8809 gene locus_tag LOCUS_17240 9678 8809 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970212.1 protein_id gnl|my_center|LOCUS_17240 11100 9715 gene locus_tag LOCUS_17250 11100 9715 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978087.1 protein_id gnl|my_center|LOCUS_17250 11690 11280 gene locus_tag LOCUS_17260 11690 11280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 12227 11790 gene locus_tag LOCUS_17270 12227 11790 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_17270 12475 13467 gene locus_tag LOCUS_17280 12475 13467 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091562.1 protein_id gnl|my_center|LOCUS_17280 13464 14246 gene locus_tag LOCUS_17290 gene fabG 13464 14246 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_17290 14264 15445 gene locus_tag LOCUS_17300 14264 15445 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816570.1 protein_id gnl|my_center|LOCUS_17300 15493 16500 gene locus_tag LOCUS_17310 15493 16500 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_17310 16590 17936 gene locus_tag LOCUS_17320 16590 17936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 18009 18980 gene locus_tag LOCUS_17330 gene cysK 18009 18980 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_17330 18993 20270 gene locus_tag LOCUS_17340 gene thrC 18993 20270 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061193.1 protein_id gnl|my_center|LOCUS_17340 21032 20304 gene locus_tag LOCUS_17350 21032 20304 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_17350 21153 21527 gene locus_tag LOCUS_17360 gene gloA 21153 21527 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 protein_id gnl|my_center|LOCUS_17360 21583 22605 gene locus_tag LOCUS_17370 21583 22605 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475604.1 protein_id gnl|my_center|LOCUS_17370 22898 24160 gene locus_tag LOCUS_17380 22898 24160 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082184.1 protein_id gnl|my_center|LOCUS_17380 24247 25230 gene locus_tag LOCUS_17390 24247 25230 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_17390 25764 25252 gene locus_tag LOCUS_17400 25764 25252 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454093.1 protein_id gnl|my_center|LOCUS_17400 26007 27380 gene locus_tag LOCUS_17410 26007 27380 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979148.1 protein_id gnl|my_center|LOCUS_17410 28279 27515 gene locus_tag LOCUS_17420 28279 27515 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_17420 28648 28433 gene locus_tag LOCUS_17430 28648 28433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 28530 30029 gene locus_tag LOCUS_17440 28530 30029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 30245 31675 gene locus_tag LOCUS_17450 30245 31675 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021657.1 protein_id gnl|my_center|LOCUS_17450 31863 32729 gene locus_tag LOCUS_17460 31863 32729 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_17460 32831 33358 gene locus_tag LOCUS_17470 32831 33358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 33355 35001 gene locus_tag LOCUS_17480 33355 35001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 35002 36456 gene locus_tag LOCUS_17490 35002 36456 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980691.1 protein_id gnl|my_center|LOCUS_17490 37384 36524 gene locus_tag LOCUS_17500 37384 36524 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460669.1 protein_id gnl|my_center|LOCUS_17500 37900 37565 gene locus_tag LOCUS_17510 37900 37565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 38974 38432 gene locus_tag LOCUS_17520 38974 38432 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060842.1 protein_id gnl|my_center|LOCUS_17520 39036 39269 gene locus_tag LOCUS_17530 39036 39269 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_17530 39364 40644 gene locus_tag LOCUS_17540 39364 40644 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876597.1 protein_id gnl|my_center|LOCUS_17540 41569 41997 gene locus_tag LOCUS_17550 41569 41997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 44381 42357 gene locus_tag LOCUS_17560 44381 42357 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839420.1 protein_id gnl|my_center|LOCUS_17560 45802 44585 gene locus_tag LOCUS_17570 45802 44585 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941161.1 protein_id gnl|my_center|LOCUS_17570 46633 46232 gene locus_tag LOCUS_17580 46633 46232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 46788 46865 gene locus_tag LOCUS_t00190 46788 46865 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence13 490 651 gene locus_tag LOCUS_17590 490 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 1909 785 gene locus_tag LOCUS_17600 1909 785 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223454.1 protein_id gnl|my_center|LOCUS_17600 3228 3157 gene locus_tag LOCUS_t00200 3228 3157 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4905 3244 gene locus_tag LOCUS_17610 4905 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 6854 4905 gene locus_tag LOCUS_17620 6854 4905 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084207611.1 protein_id gnl|my_center|LOCUS_17620 7982 6903 gene locus_tag LOCUS_17630 gene dnaJ 7982 6903 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876908.1 protein_id gnl|my_center|LOCUS_17630 9883 8012 gene locus_tag LOCUS_17640 gene dnaK 9883 8012 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_17640 10452 9880 gene locus_tag LOCUS_17650 gene grpE 10452 9880 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392121.1 protein_id gnl|my_center|LOCUS_17650 10587 11381 gene locus_tag LOCUS_17660 10587 11381 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251231.1 protein_id gnl|my_center|LOCUS_17660 11473 13050 gene locus_tag LOCUS_17670 11473 13050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 13860 13057 gene locus_tag LOCUS_17680 13860 13057 CDS product extradiol dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868422.1 protein_id gnl|my_center|LOCUS_17680 13965 14261 gene locus_tag LOCUS_17690 13965 14261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 14459 15613 gene locus_tag LOCUS_17700 14459 15613 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542268.1 protein_id gnl|my_center|LOCUS_17700 15621 16769 gene locus_tag LOCUS_17710 15621 16769 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870473.1 protein_id gnl|my_center|LOCUS_17710 16865 17719 gene locus_tag LOCUS_17720 16865 17719 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 protein_id gnl|my_center|LOCUS_17720 17927 19195 gene locus_tag LOCUS_17730 17927 19195 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876437.1 protein_id gnl|my_center|LOCUS_17730 19196 19990 gene locus_tag LOCUS_17740 19196 19990 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876218.1 protein_id gnl|my_center|LOCUS_17740 19977 20969 gene locus_tag LOCUS_17750 19977 20969 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870761.1 protein_id gnl|my_center|LOCUS_17750 21027 21677 gene locus_tag LOCUS_17760 21027 21677 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867573.1 protein_id gnl|my_center|LOCUS_17760 21674 22510 gene locus_tag LOCUS_17770 21674 22510 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892481.1 protein_id gnl|my_center|LOCUS_17770 22507 23385 gene locus_tag LOCUS_17780 22507 23385 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021396.1 protein_id gnl|my_center|LOCUS_17780 23382 24677 gene locus_tag LOCUS_17790 gene aroA 23382 24677 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876404.1 protein_id gnl|my_center|LOCUS_17790 24674 25780 gene locus_tag LOCUS_17800 gene aroC 24674 25780 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_17800 25904 27178 gene locus_tag LOCUS_17810 gene mfnC 25904 27178 CDS product (5-formylfuran-3-yl)methyl phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870189.1 protein_id gnl|my_center|LOCUS_17810 27175 28017 gene locus_tag LOCUS_17820 27175 28017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 28813 28010 gene locus_tag LOCUS_17830 gene trpA 28813 28010 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750470.1 protein_id gnl|my_center|LOCUS_17830 29979 28810 gene locus_tag LOCUS_17840 gene trpB 29979 28810 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867583.1 protein_id gnl|my_center|LOCUS_17840 30624 29986 gene locus_tag LOCUS_17850 30624 29986 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903201.1 protein_id gnl|my_center|LOCUS_17850 31409 30627 gene locus_tag LOCUS_17860 gene trpC 31409 30627 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_17860 32445 31390 gene locus_tag LOCUS_17870 gene trpD 32445 31390 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869732.1 protein_id gnl|my_center|LOCUS_17870 33035 32448 gene locus_tag LOCUS_17880 33035 32448 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880323.1 protein_id gnl|my_center|LOCUS_17880 34429 33032 gene locus_tag LOCUS_17890 gene trpE 34429 33032 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877263.1 protein_id gnl|my_center|LOCUS_17890 34506 35870 gene locus_tag LOCUS_17900 34506 35870 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146581.1 protein_id gnl|my_center|LOCUS_17900 36212 36661 gene locus_tag LOCUS_17910 36212 36661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 37411 36632 gene locus_tag LOCUS_17920 37411 36632 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_17920 37546 38142 gene locus_tag LOCUS_17930 37546 38142 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781269.1 protein_id gnl|my_center|LOCUS_17930 38361 38864 gene locus_tag LOCUS_17940 38361 38864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 39994 38999 gene locus_tag LOCUS_17950 39994 38999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 40711 41415 gene locus_tag LOCUS_17960 40711 41415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 42117 41638 gene locus_tag LOCUS_17970 42117 41638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 42205 42585 gene locus_tag LOCUS_17980 42205 42585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 42824 43120 gene locus_tag LOCUS_17990 42824 43120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 43349 43612 gene locus_tag LOCUS_18000 43349 43612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 44419 43616 gene locus_tag LOCUS_18010 44419 43616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 >Feature sequence14 628 122 gene locus_tag LOCUS_18020 628 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 691 816 gene locus_tag LOCUS_18030 691 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 1589 870 gene locus_tag LOCUS_18040 1589 870 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383856.1 protein_id gnl|my_center|LOCUS_18040 1722 2576 gene locus_tag LOCUS_18050 1722 2576 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867662.1 protein_id gnl|my_center|LOCUS_18050 3867 2581 gene locus_tag LOCUS_18060 3867 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 4008 4985 gene locus_tag LOCUS_18070 4008 4985 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392167.1 protein_id gnl|my_center|LOCUS_18070 4995 5981 gene locus_tag LOCUS_18080 4995 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 6029 6421 gene locus_tag LOCUS_18090 6029 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 7537 6443 gene locus_tag LOCUS_18100 7537 6443 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762008.1 protein_id gnl|my_center|LOCUS_18100 8443 7580 gene locus_tag LOCUS_18110 8443 7580 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812339.1 protein_id gnl|my_center|LOCUS_18110 10150 8483 gene locus_tag LOCUS_18120 10150 8483 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726981.1 protein_id gnl|my_center|LOCUS_18120 10239 11291 gene locus_tag LOCUS_18130 10239 11291 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879898.1 protein_id gnl|my_center|LOCUS_18130 12590 11925 gene locus_tag LOCUS_18140 12590 11925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 13270 12587 gene locus_tag LOCUS_18150 13270 12587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 14611 13328 gene locus_tag LOCUS_18160 14611 13328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18160 15123 14860 gene locus_tag LOCUS_18170 15123 14860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 16864 15296 gene locus_tag LOCUS_18180 16864 15296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 17860 16871 gene locus_tag LOCUS_18190 17860 16871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 18215 19339 gene locus_tag LOCUS_18200 18215 19339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 20275 20108 gene locus_tag LOCUS_18210 20275 20108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 20664 21197 gene locus_tag LOCUS_18220 20664 21197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 21194 21712 gene locus_tag LOCUS_18230 21194 21712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 23173 22790 gene locus_tag LOCUS_18240 23173 22790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 23604 24086 gene locus_tag LOCUS_18250 23604 24086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 24138 24305 gene locus_tag LOCUS_18260 24138 24305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 25558 26310 gene locus_tag LOCUS_18270 25558 26310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 26310 27521 gene locus_tag LOCUS_18280 26310 27521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 28122 27640 gene locus_tag LOCUS_18290 28122 27640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 28433 28194 gene locus_tag LOCUS_18300 28433 28194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 29113 28625 gene locus_tag LOCUS_18310 29113 28625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 30601 29699 gene locus_tag LOCUS_18320 30601 29699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 31697 30630 gene locus_tag LOCUS_18330 31697 30630 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877833.1 protein_id gnl|my_center|LOCUS_18330 32296 31727 gene locus_tag LOCUS_18340 gene rfbC 32296 31727 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_18340 33191 32301 gene locus_tag LOCUS_18350 33191 32301 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980041.1 protein_id gnl|my_center|LOCUS_18350 34208 33198 gene locus_tag LOCUS_18360 gene rfbB 34208 33198 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877832.1 protein_id gnl|my_center|LOCUS_18360 34599 34315 gene locus_tag LOCUS_18370 34599 34315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 35417 35040 gene locus_tag LOCUS_18380 35417 35040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 36470 35532 gene locus_tag LOCUS_18390 36470 35532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 38353 37403 gene locus_tag LOCUS_18400 38353 37403 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592106.1 protein_id gnl|my_center|LOCUS_18400 39530 38988 gene locus_tag LOCUS_18410 39530 38988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 40820 39579 gene locus_tag LOCUS_18420 40820 39579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 42106 40856 gene locus_tag LOCUS_18430 42106 40856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 43694 43374 gene locus_tag LOCUS_18440 43694 43374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 44387 44004 gene locus_tag LOCUS_18450 44387 44004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 >Feature sequence15 158 352 gene locus_tag LOCUS_18460 158 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 2787 349 gene locus_tag LOCUS_18470 2787 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 3007 3801 gene locus_tag LOCUS_18480 3007 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 5864 3804 gene locus_tag LOCUS_18490 5864 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 6291 5920 gene locus_tag LOCUS_18500 6291 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 6455 6288 gene locus_tag LOCUS_18510 6455 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 6862 6509 gene locus_tag LOCUS_18520 6862 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 7425 8453 gene locus_tag LOCUS_18530 7425 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 8924 11533 gene locus_tag LOCUS_18540 8924 11533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 12277 12465 gene locus_tag LOCUS_18550 12277 12465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 12472 13020 gene locus_tag LOCUS_18560 12472 13020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 13286 13567 gene locus_tag LOCUS_18570 13286 13567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 13564 14046 gene locus_tag LOCUS_18580 13564 14046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 14099 16267 gene locus_tag LOCUS_18590 14099 16267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 16301 16585 gene locus_tag LOCUS_18600 16301 16585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 16609 17037 gene locus_tag LOCUS_18610 16609 17037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 17046 17702 gene locus_tag LOCUS_18620 17046 17702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 17845 18339 gene locus_tag LOCUS_18630 17845 18339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 18413 18886 gene locus_tag LOCUS_18640 18413 18886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 18917 19141 gene locus_tag LOCUS_18650 18917 19141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 19444 20634 gene locus_tag LOCUS_18660 19444 20634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 20889 21749 gene locus_tag LOCUS_18670 20889 21749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 21896 22258 gene locus_tag LOCUS_18680 21896 22258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 23926 23648 gene locus_tag LOCUS_18690 23926 23648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 25250 26521 gene locus_tag LOCUS_18700 25250 26521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 26550 28901 gene locus_tag LOCUS_18710 26550 28901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 31626 31339 gene locus_tag LOCUS_18720 31626 31339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 31699 32433 gene locus_tag LOCUS_18730 31699 32433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 32829 34619 gene locus_tag LOCUS_18740 32829 34619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 34619 35185 gene locus_tag LOCUS_18750 34619 35185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 35664 36263 gene locus_tag LOCUS_18760 35664 36263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 37117 36821 gene locus_tag LOCUS_18770 37117 36821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 38008 37259 gene locus_tag LOCUS_18780 38008 37259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 >Feature sequence16 164 394 gene locus_tag LOCUS_18790 164 394 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_18790 488 3163 gene locus_tag LOCUS_18800 gene ppdK 488 3163 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 protein_id gnl|my_center|LOCUS_18800 3264 4124 gene locus_tag LOCUS_18810 gene cyoE 3264 4124 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846973.1 protein_id gnl|my_center|LOCUS_18810 4369 5019 gene locus_tag LOCUS_18820 4369 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 5022 7469 gene locus_tag LOCUS_18830 5022 7469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 7475 7750 gene locus_tag LOCUS_18840 7475 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 7765 8544 gene locus_tag LOCUS_18850 7765 8544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 8649 9134 gene locus_tag LOCUS_18860 8649 9134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 10190 9153 gene locus_tag LOCUS_18870 10190 9153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_18870 11686 10580 gene locus_tag LOCUS_18880 11686 10580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 13041 12382 gene locus_tag LOCUS_18890 13041 12382 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763249.1 protein_id gnl|my_center|LOCUS_18890 13892 13041 gene locus_tag LOCUS_18900 gene pstB 13892 13041 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_18900 14832 13909 gene locus_tag LOCUS_18910 gene pstA 14832 13909 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404794.1 protein_id gnl|my_center|LOCUS_18910 15820 14840 gene locus_tag LOCUS_18920 gene pstC 15820 14840 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404792.1 protein_id gnl|my_center|LOCUS_18920 17031 15838 gene locus_tag LOCUS_18930 gene pstS 17031 15838 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900236.1 protein_id gnl|my_center|LOCUS_18930 17204 17986 gene locus_tag LOCUS_18940 17204 17986 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928572.1 protein_id gnl|my_center|LOCUS_18940 18175 19443 gene locus_tag LOCUS_18950 18175 19443 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933494.1 protein_id gnl|my_center|LOCUS_18950 20578 20336 gene locus_tag LOCUS_18960 20578 20336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 21731 20712 gene locus_tag LOCUS_18970 21731 20712 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966531.1 protein_id gnl|my_center|LOCUS_18970 23288 24778 gene locus_tag LOCUS_18980 23288 24778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 25494 25210 gene locus_tag LOCUS_18990 25494 25210 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847047.1 protein_id gnl|my_center|LOCUS_18990 25646 25494 gene locus_tag LOCUS_19000 25646 25494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 26617 25994 gene locus_tag LOCUS_19010 26617 25994 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762040.1 protein_id gnl|my_center|LOCUS_19010 27038 27490 gene locus_tag LOCUS_19020 27038 27490 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258443.1 protein_id gnl|my_center|LOCUS_19020 28290 27613 gene locus_tag LOCUS_19030 28290 27613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 28993 30738 gene locus_tag LOCUS_19040 28993 30738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 30941 31396 gene locus_tag LOCUS_19050 30941 31396 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227162.1 protein_id gnl|my_center|LOCUS_19050 31777 32010 gene locus_tag LOCUS_19060 31777 32010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 31973 33103 gene locus_tag LOCUS_19070 gene cbsA 31973 33103 CDS product cytochrome b558/566 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979723.1 protein_id gnl|my_center|LOCUS_19070 33103 33843 gene locus_tag LOCUS_19080 gene soxL2 33103 33843 CDS product Rieske iron-sulfur protein SoxL2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979725.1 protein_id gnl|my_center|LOCUS_19080 33864 35513 gene locus_tag LOCUS_19090 33864 35513 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979726.1 protein_id gnl|my_center|LOCUS_19090 35577 36317 gene locus_tag LOCUS_19100 35577 36317 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901833.1 protein_id gnl|my_center|LOCUS_19100 36314 37363 gene locus_tag LOCUS_19110 36314 37363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 38043 37318 gene locus_tag LOCUS_19120 38043 37318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 >Feature sequence17 694 1767 gene locus_tag LOCUS_19130 694 1767 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868095.1 protein_id gnl|my_center|LOCUS_19130 2722 3384 gene locus_tag LOCUS_19140 2722 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980166.1 protein_id gnl|my_center|LOCUS_19140 4049 3582 gene locus_tag LOCUS_19150 4049 3582 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_19150 4373 4116 gene locus_tag LOCUS_19160 4373 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 4472 4930 gene locus_tag LOCUS_19170 4472 4930 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978712.1 protein_id gnl|my_center|LOCUS_19170 5351 4989 gene locus_tag LOCUS_19180 5351 4989 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228341.1 protein_id gnl|my_center|LOCUS_19180 6823 5918 gene locus_tag LOCUS_19190 6823 5918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 7298 8122 gene locus_tag LOCUS_19200 7298 8122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 8119 8631 gene locus_tag LOCUS_19210 8119 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 9733 8609 gene locus_tag LOCUS_19220 9733 8609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 10422 9748 gene locus_tag LOCUS_19230 gene lipB 10422 9748 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174104.1 protein_id gnl|my_center|LOCUS_19230 11842 10424 gene locus_tag LOCUS_19240 gene lpdA 11842 10424 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903648.1 protein_id gnl|my_center|LOCUS_19240 13070 11847 gene locus_tag LOCUS_19250 gene pdhC 13070 11847 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863430.1 protein_id gnl|my_center|LOCUS_19250 13858 13127 gene locus_tag LOCUS_19260 13858 13127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 14102 14587 gene locus_tag LOCUS_19270 14102 14587 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_19270 14896 14600 gene locus_tag LOCUS_19280 14896 14600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 15673 16098 gene locus_tag LOCUS_19290 15673 16098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 16453 16857 gene locus_tag LOCUS_19300 16453 16857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 16992 17936 gene locus_tag LOCUS_19310 16992 17936 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582519.1 protein_id gnl|my_center|LOCUS_19310 17938 19029 gene locus_tag LOCUS_19320 17938 19029 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705177.1 protein_id gnl|my_center|LOCUS_19320 19934 19122 gene locus_tag LOCUS_19330 19934 19122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 20899 19943 gene locus_tag LOCUS_19340 20899 19943 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256181.1 protein_id gnl|my_center|LOCUS_19340 22325 20931 gene locus_tag LOCUS_19350 22325 20931 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903377.1 protein_id gnl|my_center|LOCUS_19350 23479 22445 gene locus_tag LOCUS_19360 23479 22445 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020910.1 protein_id gnl|my_center|LOCUS_19360 25742 23592 gene locus_tag LOCUS_19370 25742 23592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 26800 25739 gene locus_tag LOCUS_19380 26800 25739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 27764 26811 gene locus_tag LOCUS_19390 gene radA 27764 26811 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762467.1 protein_id gnl|my_center|LOCUS_19390 28029 28697 gene locus_tag LOCUS_19400 28029 28697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 28836 29576 gene locus_tag LOCUS_19410 gene fabG 28836 29576 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_19410 29612 30154 gene locus_tag LOCUS_19420 29612 30154 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870785.1 protein_id gnl|my_center|LOCUS_19420 30151 30801 gene locus_tag LOCUS_19430 gene queC 30151 30801 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 protein_id gnl|my_center|LOCUS_19430 30783 31547 gene locus_tag LOCUS_19440 30783 31547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 31671 32645 gene locus_tag LOCUS_19450 gene dppB 31671 32645 CDS product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830232.1 protein_id gnl|my_center|LOCUS_19450 32661 33584 gene locus_tag LOCUS_19460 32661 33584 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868768.1 protein_id gnl|my_center|LOCUS_19460 33581 34576 gene locus_tag LOCUS_19470 33581 34576 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_19470 34578 35576 gene locus_tag LOCUS_19480 34578 35576 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_19480 35934 35584 gene locus_tag LOCUS_19490 35934 35584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 >Feature sequence18 281 613 gene locus_tag LOCUS_19500 281 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 597 914 gene locus_tag LOCUS_19510 597 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 1006 1299 gene locus_tag LOCUS_19520 1006 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 1296 1697 gene locus_tag LOCUS_19530 1296 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 1828 2085 gene locus_tag LOCUS_19540 1828 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 2078 2476 gene locus_tag LOCUS_19550 2078 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 2469 2774 gene locus_tag LOCUS_19560 2469 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 2780 3073 gene locus_tag LOCUS_19570 2780 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 3096 3575 gene locus_tag LOCUS_19580 3096 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 3565 4188 gene locus_tag LOCUS_19590 3565 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 5517 5257 gene locus_tag LOCUS_19600 5517 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 5932 5534 gene locus_tag LOCUS_19610 5932 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 6761 5988 gene locus_tag LOCUS_19620 6761 5988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 7907 7272 gene locus_tag LOCUS_19630 7907 7272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 7960 8700 gene locus_tag LOCUS_19640 7960 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 9188 8817 gene locus_tag LOCUS_19650 9188 8817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 10206 12119 gene locus_tag LOCUS_19660 10206 12119 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171602985.1 protein_id gnl|my_center|LOCUS_19660 12762 12580 gene locus_tag LOCUS_19670 12762 12580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 12907 13122 gene locus_tag LOCUS_19680 12907 13122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 13127 13966 gene locus_tag LOCUS_19690 13127 13966 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064366.1 protein_id gnl|my_center|LOCUS_19690 14605 16509 gene locus_tag LOCUS_19700 14605 16509 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234782358.1 protein_id gnl|my_center|LOCUS_19700 16882 16688 gene locus_tag LOCUS_19710 16882 16688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 19232 18219 gene locus_tag LOCUS_19720 19232 18219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 20363 19239 gene locus_tag LOCUS_19730 20363 19239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 21653 20505 gene locus_tag LOCUS_19740 21653 20505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 21724 22650 gene locus_tag LOCUS_19750 21724 22650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 22741 23049 gene locus_tag LOCUS_19760 22741 23049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 23266 24405 gene locus_tag LOCUS_19770 23266 24405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 25331 26374 gene locus_tag LOCUS_19780 25331 26374 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_19780 >Feature sequence19 780 397 gene locus_tag LOCUS_19790 780 397 CDS product methionine-R-sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853613.1 protein_id gnl|my_center|LOCUS_19790 1760 1281 gene locus_tag LOCUS_19800 1760 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 2320 1811 gene locus_tag LOCUS_19810 2320 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 4189 2459 gene locus_tag LOCUS_19820 4189 2459 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249122.1 protein_id gnl|my_center|LOCUS_19820 5446 4211 gene locus_tag LOCUS_19830 5446 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 6300 6112 gene locus_tag LOCUS_19840 6300 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 7002 7352 gene locus_tag LOCUS_19850 7002 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 7346 8617 gene locus_tag LOCUS_19860 7346 8617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 8618 8791 gene locus_tag LOCUS_19870 8618 8791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 9130 10146 gene locus_tag LOCUS_19880 9130 10146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 10153 10707 gene locus_tag LOCUS_19890 10153 10707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 11133 10960 gene locus_tag LOCUS_19900 11133 10960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 11666 11169 gene locus_tag LOCUS_19910 11666 11169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 12567 12746 gene locus_tag LOCUS_19920 12567 12746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 12901 13263 gene locus_tag LOCUS_19930 12901 13263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19930 13202 13495 gene locus_tag LOCUS_19940 13202 13495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 14744 14193 gene locus_tag LOCUS_19950 14744 14193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 15410 14832 gene locus_tag LOCUS_19960 15410 14832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 15624 15956 gene locus_tag LOCUS_19970 gene trxA 15624 15956 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879633.1 protein_id gnl|my_center|LOCUS_19970 15959 16456 gene locus_tag LOCUS_19980 15959 16456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 16453 16974 gene locus_tag LOCUS_19990 16453 16974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 17481 16981 gene locus_tag LOCUS_20000 17481 16981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 19668 18247 gene locus_tag LOCUS_20010 gene merA 19668 18247 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228473.1 protein_id gnl|my_center|LOCUS_20010 20079 19921 gene locus_tag LOCUS_20020 20079 19921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 22341 21775 gene locus_tag LOCUS_20030 22341 21775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 22621 22761 gene locus_tag LOCUS_20040 22621 22761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 24197 23568 gene locus_tag LOCUS_20050 24197 23568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 24864 25409 gene locus_tag LOCUS_20060 24864 25409 CDS product copper chaperone Copz family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256100.1 protein_id gnl|my_center|LOCUS_20060 >Feature sequence20 473 2053 gene locus_tag LOCUS_20070 473 2053 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051765.1 protein_id gnl|my_center|LOCUS_20070 3485 2388 gene locus_tag LOCUS_20080 3485 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 5624 4320 gene locus_tag LOCUS_20090 5624 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 6181 5621 gene locus_tag LOCUS_20100 6181 5621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 6411 6259 gene locus_tag LOCUS_20110 6411 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 6627 8183 gene locus_tag LOCUS_20120 6627 8183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 8180 8782 gene locus_tag LOCUS_20130 8180 8782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 9528 9118 gene locus_tag LOCUS_20140 9528 9118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 10155 9592 gene locus_tag LOCUS_20150 10155 9592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 11959 11069 gene locus_tag LOCUS_20160 11959 11069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 12391 12744 gene locus_tag LOCUS_20170 12391 12744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 13075 13353 gene locus_tag LOCUS_20180 13075 13353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 14750 13536 gene locus_tag LOCUS_20190 14750 13536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 15480 14755 gene locus_tag LOCUS_20200 15480 14755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 16153 15491 gene locus_tag LOCUS_20210 16153 15491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 17249 17611 gene locus_tag LOCUS_20220 17249 17611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 18375 17530 gene locus_tag LOCUS_20230 18375 17530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 19496 18456 gene locus_tag LOCUS_20240 19496 18456 CDS product IS481-like element ISA0963-2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877817.1 protein_id gnl|my_center|LOCUS_20240 19796 20113 gene locus_tag LOCUS_20250 19796 20113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 20527 20141 gene locus_tag LOCUS_20260 20527 20141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 22563 21961 gene locus_tag LOCUS_20270 22563 21961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 23184 22942 gene locus_tag LOCUS_20280 23184 22942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 23544 23329 gene locus_tag LOCUS_20290 23544 23329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence21 392 1216 gene locus_tag LOCUS_20300 392 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 1203 1733 gene locus_tag LOCUS_20310 gene nob1 1203 1733 CDS product type II toxin-antitoxin system toxin endoribonuclease Nob1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877892.1 protein_id gnl|my_center|LOCUS_20310 2694 1789 gene locus_tag LOCUS_20320 gene hemH 2694 1789 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727378.1 protein_id gnl|my_center|LOCUS_20320 3728 2691 gene locus_tag LOCUS_20330 gene hemE 3728 2691 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972892.1 protein_id gnl|my_center|LOCUS_20330 5008 3725 gene locus_tag LOCUS_20340 gene hemL 5008 3725 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398699.1 protein_id gnl|my_center|LOCUS_20340 5737 5018 gene locus_tag LOCUS_20350 5737 5018 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869292.1 protein_id gnl|my_center|LOCUS_20350 6729 5737 gene locus_tag LOCUS_20360 gene hemB 6729 5737 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881381.1 protein_id gnl|my_center|LOCUS_20360 7204 6719 gene locus_tag LOCUS_20370 7204 6719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 8403 7480 gene locus_tag LOCUS_20380 gene hemC 8403 7480 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_20380 8977 8390 gene locus_tag LOCUS_20390 8977 8390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 11712 9781 gene locus_tag LOCUS_20400 11712 9781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 13369 11954 gene locus_tag LOCUS_20410 gene merA 13369 11954 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846936.1 protein_id gnl|my_center|LOCUS_20410 15129 13984 gene locus_tag LOCUS_20420 15129 13984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 16946 16170 gene locus_tag LOCUS_20430 16946 16170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 16972 17229 gene locus_tag LOCUS_20440 16972 17229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 18377 17262 gene locus_tag LOCUS_20450 18377 17262 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147062.1 protein_id gnl|my_center|LOCUS_20450 18712 19467 gene locus_tag LOCUS_20460 18712 19467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 20223 19939 gene locus_tag LOCUS_20470 20223 19939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 20516 21487 gene locus_tag LOCUS_20480 20516 21487 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905888.1 protein_id gnl|my_center|LOCUS_20480 21484 21717 gene locus_tag LOCUS_20490 21484 21717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 22064 21804 gene locus_tag LOCUS_20500 22064 21804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 22343 22726 gene locus_tag LOCUS_20510 22343 22726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 22897 22742 gene locus_tag LOCUS_20520 22897 22742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 23203 23907 gene locus_tag LOCUS_20530 23203 23907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 >Feature sequence22 139 294 gene locus_tag LOCUS_20540 139 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 458 1132 gene locus_tag LOCUS_20550 458 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 1501 3330 gene locus_tag LOCUS_20560 1501 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 3887 3693 gene locus_tag LOCUS_20570 3887 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 4201 4010 gene locus_tag LOCUS_20580 4201 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 4368 4886 gene locus_tag LOCUS_20590 4368 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 5001 5282 gene locus_tag LOCUS_20600 5001 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 6998 5427 gene locus_tag LOCUS_20610 6998 5427 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089418476.1 protein_id gnl|my_center|LOCUS_20610 7739 6999 gene locus_tag LOCUS_20620 7739 6999 CDS product PaeR7I family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176598.1 protein_id gnl|my_center|LOCUS_20620 7982 7752 gene locus_tag LOCUS_20630 7982 7752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 9582 9211 gene locus_tag LOCUS_20640 9582 9211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 10033 12267 gene locus_tag LOCUS_20650 10033 12267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 13238 12507 gene locus_tag LOCUS_20660 13238 12507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 14519 13245 gene locus_tag LOCUS_20670 14519 13245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 15669 14509 gene locus_tag LOCUS_20680 15669 14509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 15768 16208 gene locus_tag LOCUS_20690 15768 16208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 16448 16678 gene locus_tag LOCUS_20700 16448 16678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 16653 17081 gene locus_tag LOCUS_20710 16653 17081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 18292 18035 gene locus_tag LOCUS_20720 18292 18035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 >Feature sequence23 1107 1322 gene locus_tag LOCUS_20730 1107 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 1421 2110 gene locus_tag LOCUS_20740 1421 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 3119 2652 gene locus_tag LOCUS_20750 3119 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 3904 3338 gene locus_tag LOCUS_20760 3904 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 4438 3929 gene locus_tag LOCUS_20770 4438 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 5174 5584 gene locus_tag LOCUS_20780 5174 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 5844 5581 gene locus_tag LOCUS_20790 5844 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 6812 6294 gene locus_tag LOCUS_20800 6812 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 6962 7195 gene locus_tag LOCUS_20810 6962 7195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 8929 7559 gene locus_tag LOCUS_20820 8929 7559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 10088 8970 gene locus_tag LOCUS_20830 10088 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 10769 10134 gene locus_tag LOCUS_20840 10769 10134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 13665 12967 gene locus_tag LOCUS_20850 13665 12967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 14063 14377 gene locus_tag LOCUS_20860 14063 14377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 15092 14934 gene locus_tag LOCUS_20870 15092 14934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 15187 15516 gene locus_tag LOCUS_20880 15187 15516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 16819 15518 gene locus_tag LOCUS_20890 16819 15518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence24 590 147 gene locus_tag LOCUS_20900 590 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 1139 612 gene locus_tag LOCUS_20910 gene cutC 1139 612 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846892.1 protein_id gnl|my_center|LOCUS_20910 2014 1142 gene locus_tag LOCUS_20920 2014 1142 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_20920 2129 3010 gene locus_tag LOCUS_20930 2129 3010 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072012.1 protein_id gnl|my_center|LOCUS_20930 4470 3007 gene locus_tag LOCUS_20940 4470 3007 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877720.1 protein_id gnl|my_center|LOCUS_20940 5157 4579 gene locus_tag LOCUS_20950 5157 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 5309 6604 gene locus_tag LOCUS_20960 5309 6604 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192776.1 protein_id gnl|my_center|LOCUS_20960 7961 6591 gene locus_tag LOCUS_20970 7961 6591 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939112.1 protein_id gnl|my_center|LOCUS_20970 <8551 7979 gene locus_tag LOCUS_20980 <8551 7979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879276.1:thiamine pyrophosphate-binding protein >Feature sequence25 860 540 gene locus_tag LOCUS_20990 860 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 1371 1081 gene locus_tag LOCUS_21000 1371 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 1966 1358 gene locus_tag LOCUS_21010 1966 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 2355 3065 gene locus_tag LOCUS_21020 2355 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 3796 3086 gene locus_tag LOCUS_21030 3796 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 <5614 4832 gene locus_tag LOCUS_21040 <5614 4832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003899284.1:phospholipase C >Feature sequence26 2097 343 gene locus_tag LOCUS_21050 gene poxB 2097 343 CDS product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729435.1 protein_id gnl|my_center|LOCUS_21050 3784 2186 gene locus_tag LOCUS_21060 3784 2186 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 protein_id gnl|my_center|LOCUS_21060 >Feature sequence27 2173 1178 gene locus_tag LOCUS_21070 2173 1178 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879275.1 protein_id gnl|my_center|LOCUS_21070 3150 2200 gene locus_tag LOCUS_21080 3150 2200 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978653.1 protein_id gnl|my_center|LOCUS_21080 <3942 3162 gene locus_tag LOCUS_21090 <3942 3162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979018.1:APC family permease