>Feature sequence01 1239 223 gene locus_tag LOCUS_00010 1239 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1598 1248 gene locus_tag LOCUS_00020 1598 1248 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_00020 1890 1606 gene locus_tag LOCUS_00030 1890 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3198 1903 gene locus_tag LOCUS_00040 gene hisS 3198 1903 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978283.1 protein_id gnl|my_center|LOCUS_00040 4079 3195 gene locus_tag LOCUS_00050 4079 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4591 4076 gene locus_tag LOCUS_00060 4591 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4626 5642 gene locus_tag LOCUS_00070 gene mtnA 4626 5642 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249511.1 protein_id gnl|my_center|LOCUS_00070 6390 5623 gene locus_tag LOCUS_00080 6390 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6460 6855 gene locus_tag LOCUS_00090 gene speD 6460 6855 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979389.1 protein_id gnl|my_center|LOCUS_00090 7493 6861 gene locus_tag LOCUS_00100 7493 6861 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763249.1 protein_id gnl|my_center|LOCUS_00100 8260 7490 gene locus_tag LOCUS_00110 gene pstB 8260 7490 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_00110 9153 8263 gene locus_tag LOCUS_00120 gene pstA 9153 8263 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005618859.1 protein_id gnl|my_center|LOCUS_00120 10058 9150 gene locus_tag LOCUS_00130 gene pstC 10058 9150 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140449.1 protein_id gnl|my_center|LOCUS_00130 11222 10080 gene locus_tag LOCUS_00140 gene pstS 11222 10080 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582618.1 protein_id gnl|my_center|LOCUS_00140 11345 12361 gene locus_tag LOCUS_00150 11345 12361 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979533.1 protein_id gnl|my_center|LOCUS_00150 12435 12361 gene locus_tag LOCUS_t00010 12435 12361 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 12861 12436 gene locus_tag LOCUS_00160 12861 12436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 12860 13549 gene locus_tag LOCUS_00170 12860 13549 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869667.1 protein_id gnl|my_center|LOCUS_00170 14574 13546 gene locus_tag LOCUS_00180 gene fen 14574 13546 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250232.1 protein_id gnl|my_center|LOCUS_00180 14806 14555 gene locus_tag LOCUS_00190 14806 14555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 16986 14803 gene locus_tag LOCUS_00200 16986 14803 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429724.1 protein_id gnl|my_center|LOCUS_00200 17263 16994 gene locus_tag LOCUS_00210 17263 16994 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877307.1 protein_id gnl|my_center|LOCUS_00210 17341 17505 gene locus_tag LOCUS_00220 17341 17505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 18616 17477 gene locus_tag LOCUS_00230 18616 17477 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871044.1 protein_id gnl|my_center|LOCUS_00230 18651 18998 gene locus_tag LOCUS_00240 gene pth2 18651 18998 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320039.1 protein_id gnl|my_center|LOCUS_00240 20281 18995 gene locus_tag LOCUS_00250 gene aspS 20281 18995 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978146.1 protein_id gnl|my_center|LOCUS_00250 20789 20283 gene locus_tag LOCUS_00260 20789 20283 CDS product transcription elongation factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978145.1 protein_id gnl|my_center|LOCUS_00260 21043 21117 gene locus_tag LOCUS_t00020 21043 21117 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 21867 21118 gene locus_tag LOCUS_00270 21867 21118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 22305 21898 gene locus_tag LOCUS_00280 22305 21898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 22660 22295 gene locus_tag LOCUS_00290 22660 22295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 22757 24496 gene locus_tag LOCUS_00300 22757 24496 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879805.1 protein_id gnl|my_center|LOCUS_00300 24534 25604 gene locus_tag LOCUS_00310 24534 25604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 25601 26128 gene locus_tag LOCUS_00320 25601 26128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 26125 26394 gene locus_tag LOCUS_00330 26125 26394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 27533 26547 gene locus_tag LOCUS_00340 27533 26547 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249841.1 protein_id gnl|my_center|LOCUS_00340 27575 27650 gene locus_tag LOCUS_t00030 27575 27650 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 28626 27799 gene locus_tag LOCUS_00350 28626 27799 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980282.1 protein_id gnl|my_center|LOCUS_00350 28681 29448 gene locus_tag LOCUS_00360 gene sufC 28681 29448 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929160.1 protein_id gnl|my_center|LOCUS_00360 29491 30888 gene locus_tag LOCUS_00370 gene sufB 29491 30888 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259322.1 protein_id gnl|my_center|LOCUS_00370 30896 32293 gene locus_tag LOCUS_00380 gene sufD 30896 32293 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228602.1 protein_id gnl|my_center|LOCUS_00380 32293 32595 gene locus_tag LOCUS_00390 32293 32595 CDS product MocE family 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061915.1 protein_id gnl|my_center|LOCUS_00390 32625 33026 gene locus_tag LOCUS_00400 32625 33026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 33198 35018 gene locus_tag LOCUS_00410 gene glmS 33198 35018 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867349.1 protein_id gnl|my_center|LOCUS_00410 35376 35702 gene locus_tag LOCUS_00420 35376 35702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 35725 36189 gene locus_tag LOCUS_00430 35725 36189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 36186 36674 gene locus_tag LOCUS_00440 36186 36674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 36667 37245 gene locus_tag LOCUS_00450 36667 37245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 37249 37956 gene locus_tag LOCUS_00460 37249 37956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 37956 38195 gene locus_tag LOCUS_00470 37956 38195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 38492 40075 gene locus_tag LOCUS_00480 38492 40075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 40062 41021 gene locus_tag LOCUS_00490 40062 41021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 41018 41947 gene locus_tag LOCUS_00500 41018 41947 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 protein_id gnl|my_center|LOCUS_00500 41944 43242 gene locus_tag LOCUS_00510 41944 43242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 43244 44134 gene locus_tag LOCUS_00520 43244 44134 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876013.1 protein_id gnl|my_center|LOCUS_00520 44131 45306 gene locus_tag LOCUS_00530 44131 45306 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776619.1 protein_id gnl|my_center|LOCUS_00530 45306 47009 gene locus_tag LOCUS_00540 45306 47009 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249504.1 protein_id gnl|my_center|LOCUS_00540 47009 48871 gene locus_tag LOCUS_00550 47009 48871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 48922 49626 gene locus_tag LOCUS_00560 48922 49626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 49623 49805 gene locus_tag LOCUS_00570 49623 49805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 49987 51162 gene locus_tag LOCUS_00580 49987 51162 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461038.1 protein_id gnl|my_center|LOCUS_00580 51149 52282 gene locus_tag LOCUS_00590 51149 52282 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582704.1 protein_id gnl|my_center|LOCUS_00590 52308 54131 gene locus_tag LOCUS_00600 gene asnB 52308 54131 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906399.1 protein_id gnl|my_center|LOCUS_00600 54473 54715 gene locus_tag LOCUS_00610 54473 54715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 54679 55893 gene locus_tag LOCUS_00620 54679 55893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 56605 57675 gene locus_tag LOCUS_00630 56605 57675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 57720 58028 gene locus_tag LOCUS_00640 57720 58028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 58025 58183 gene locus_tag LOCUS_00650 58025 58183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 58252 59355 gene locus_tag LOCUS_00660 58252 59355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 59663 60364 gene locus_tag LOCUS_00670 59663 60364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 60668 61792 gene locus_tag LOCUS_00680 60668 61792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 61793 62815 gene locus_tag LOCUS_00690 61793 62815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 62815 63816 gene locus_tag LOCUS_00700 62815 63816 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582950.1 protein_id gnl|my_center|LOCUS_00700 63803 64414 gene locus_tag LOCUS_00710 63803 64414 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763299.1 protein_id gnl|my_center|LOCUS_00710 64515 65753 gene locus_tag LOCUS_00720 64515 65753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 66097 66432 gene locus_tag LOCUS_00730 66097 66432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 66495 67478 gene locus_tag LOCUS_00740 66495 67478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 67526 68539 gene locus_tag LOCUS_00750 67526 68539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 68532 69671 gene locus_tag LOCUS_00760 68532 69671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 69699 70082 gene locus_tag LOCUS_00770 69699 70082 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249176.1 protein_id gnl|my_center|LOCUS_00770 70070 70408 gene locus_tag LOCUS_00780 70070 70408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 70689 72254 gene locus_tag LOCUS_00790 70689 72254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 72254 73360 gene locus_tag LOCUS_00800 72254 73360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 73841 74899 gene locus_tag LOCUS_00810 73841 74899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 75191 76480 gene locus_tag LOCUS_00820 75191 76480 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023489.1 protein_id gnl|my_center|LOCUS_00820 76793 76996 gene locus_tag LOCUS_00830 76793 76996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 77184 77020 gene locus_tag LOCUS_00840 77184 77020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 77379 78419 gene locus_tag LOCUS_00850 77379 78419 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909115.1 protein_id gnl|my_center|LOCUS_00850 78490 78744 gene locus_tag LOCUS_00860 78490 78744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 78769 79872 gene locus_tag LOCUS_00870 78769 79872 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966351.1 protein_id gnl|my_center|LOCUS_00870 79931 80794 gene locus_tag LOCUS_00880 79931 80794 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763234.1 protein_id gnl|my_center|LOCUS_00880 80816 82159 gene locus_tag LOCUS_00890 80816 82159 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064256.1 protein_id gnl|my_center|LOCUS_00890 82185 83246 gene locus_tag LOCUS_00900 82185 83246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 83278 84267 gene locus_tag LOCUS_00910 83278 84267 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925382.1 protein_id gnl|my_center|LOCUS_00910 84321 85646 gene locus_tag LOCUS_00920 84321 85646 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582949.1 protein_id gnl|my_center|LOCUS_00920 85715 86308 gene locus_tag LOCUS_00930 85715 86308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 86284 87306 gene locus_tag LOCUS_00940 gene fen 86284 87306 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867862.1 protein_id gnl|my_center|LOCUS_00940 87309 87794 gene locus_tag LOCUS_00950 87309 87794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 87781 88380 gene locus_tag LOCUS_00960 87781 88380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 88377 89474 gene locus_tag LOCUS_00970 88377 89474 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_00970 89474 90580 gene locus_tag LOCUS_00980 89474 90580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 90577 91716 gene locus_tag LOCUS_00990 90577 91716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 92648 93241 gene locus_tag LOCUS_01000 92648 93241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 93272 94201 gene locus_tag LOCUS_01010 93272 94201 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_01010 97307 94257 gene locus_tag LOCUS_r00010 97307 94257 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 98950 97462 gene locus_tag LOCUS_r00020 98950 97462 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 99176 99250 gene locus_tag LOCUS_t00040 99176 99250 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 99606 100961 gene locus_tag LOCUS_01020 gene tiaS 99606 100961 CDS product tRNA(Ile2) 2-agmatinylcytidine synthetase TiaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867493.1 protein_id gnl|my_center|LOCUS_01020 101783 100923 gene locus_tag LOCUS_01030 101783 100923 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496764.1 protein_id gnl|my_center|LOCUS_01030 103507 101789 gene locus_tag LOCUS_01040 gene hutU 103507 101789 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416948.1 protein_id gnl|my_center|LOCUS_01040 104382 103528 gene locus_tag LOCUS_01050 104382 103528 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762468.1 protein_id gnl|my_center|LOCUS_01050 104465 104392 gene locus_tag LOCUS_t00050 104465 104392 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 105979 104630 gene locus_tag LOCUS_01060 105979 104630 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763469.1 protein_id gnl|my_center|LOCUS_01060 106031 106519 gene locus_tag LOCUS_01070 106031 106519 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583265.1 protein_id gnl|my_center|LOCUS_01070 107409 106504 gene locus_tag LOCUS_01080 107409 106504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 108421 108248 gene locus_tag LOCUS_01090 108421 108248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 110628 108439 gene locus_tag LOCUS_01100 110628 108439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 111227 110625 gene locus_tag LOCUS_01110 111227 110625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 111966 111202 gene locus_tag LOCUS_01120 111966 111202 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868227.1 protein_id gnl|my_center|LOCUS_01120 112202 111963 gene locus_tag LOCUS_01130 112202 111963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 112707 112333 gene locus_tag LOCUS_01140 112707 112333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 112784 112711 gene locus_tag LOCUS_t00060 112784 112711 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 112838 114748 gene locus_tag LOCUS_01150 112838 114748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 115056 114745 gene locus_tag LOCUS_01160 115056 114745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 115874 115053 gene locus_tag LOCUS_01170 gene serK 115874 115053 CDS product L-serine kinase SerK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249333.1 protein_id gnl|my_center|LOCUS_01170 116107 115871 gene locus_tag LOCUS_01180 116107 115871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 116196 117854 gene locus_tag LOCUS_01190 gene thsB 116196 117854 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846874.1 protein_id gnl|my_center|LOCUS_01190 117851 118411 gene locus_tag LOCUS_01200 117851 118411 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978114.1 protein_id gnl|my_center|LOCUS_01200 119478 118408 gene locus_tag LOCUS_01210 119478 118408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 119867 119475 gene locus_tag LOCUS_01220 119867 119475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 120082 119849 gene locus_tag LOCUS_01230 120082 119849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 120719 120096 gene locus_tag LOCUS_01240 120719 120096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 121221 120706 gene locus_tag LOCUS_01250 121221 120706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 122911 121208 gene locus_tag LOCUS_01260 122911 121208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 123299 122895 gene locus_tag LOCUS_01270 123299 122895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 124236 123283 gene locus_tag LOCUS_01280 124236 123283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 124391 124804 gene locus_tag LOCUS_01290 124391 124804 CDS product Lsm family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846267.1 protein_id gnl|my_center|LOCUS_01290 124812 126437 gene locus_tag LOCUS_01300 gene tgtA 124812 126437 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978287.1 protein_id gnl|my_center|LOCUS_01300 127163 126426 gene locus_tag LOCUS_01310 127163 126426 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978288.1 protein_id gnl|my_center|LOCUS_01310 127220 128482 gene locus_tag LOCUS_01320 127220 128482 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980269.1 protein_id gnl|my_center|LOCUS_01320 128460 129335 gene locus_tag LOCUS_01330 128460 129335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 129532 129332 gene locus_tag LOCUS_01340 129532 129332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 129649 129575 gene locus_tag LOCUS_t00070 129649 129575 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 130631 133591 gene locus_tag LOCUS_01350 130631 133591 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868000.1 protein_id gnl|my_center|LOCUS_01350 133591 136959 gene locus_tag LOCUS_01360 133591 136959 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080572.1 protein_id gnl|my_center|LOCUS_01360 136956 137387 gene locus_tag LOCUS_01370 136956 137387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 137401 140361 gene locus_tag LOCUS_01380 137401 140361 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868003.1 protein_id gnl|my_center|LOCUS_01380 140361 141626 gene locus_tag LOCUS_01390 140361 141626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 142486 142414 gene locus_tag LOCUS_t00080 142486 142414 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 142903 142682 gene locus_tag LOCUS_01400 142903 142682 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846912.1 protein_id gnl|my_center|LOCUS_01400 142953 143456 gene locus_tag LOCUS_01410 142953 143456 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980422.1 protein_id gnl|my_center|LOCUS_01410 145360 143459 gene locus_tag LOCUS_01420 145360 143459 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546184.1 protein_id gnl|my_center|LOCUS_01420 146013 145360 gene locus_tag LOCUS_01430 gene psmB 146013 145360 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870749.1 protein_id gnl|my_center|LOCUS_01430 146804 146061 gene locus_tag LOCUS_01440 146804 146061 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762843.1 protein_id gnl|my_center|LOCUS_01440 147334 146828 gene locus_tag LOCUS_01450 gene cyaB 147334 146828 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869738.1 protein_id gnl|my_center|LOCUS_01450 147384 147584 gene locus_tag LOCUS_01460 147384 147584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 148674 147571 gene locus_tag LOCUS_01470 148674 147571 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061314.1 protein_id gnl|my_center|LOCUS_01470 148712 149506 gene locus_tag LOCUS_01480 148712 149506 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240518.1 protein_id gnl|my_center|LOCUS_01480 149499 150560 gene locus_tag LOCUS_01490 gene rtcA 149499 150560 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762505.1 protein_id gnl|my_center|LOCUS_01490 150592 151200 gene locus_tag LOCUS_01500 gene psmB 150592 151200 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762506.1 protein_id gnl|my_center|LOCUS_01500 151324 151250 gene locus_tag LOCUS_t00090 151324 151250 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 151428 151685 gene locus_tag LOCUS_01510 151428 151685 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846238.1 protein_id gnl|my_center|LOCUS_01510 151682 155020 gene locus_tag LOCUS_01520 151682 155020 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978227.1 protein_id gnl|my_center|LOCUS_01520 155011 157602 gene locus_tag LOCUS_01530 gene rpoA1 155011 157602 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846236.1 protein_id gnl|my_center|LOCUS_01530 157599 158822 gene locus_tag LOCUS_01540 gene rpoA2 157599 158822 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846867.1 protein_id gnl|my_center|LOCUS_01540 158806 159111 gene locus_tag LOCUS_01550 158806 159111 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978224.1 protein_id gnl|my_center|LOCUS_01550 159104 159541 gene locus_tag LOCUS_01560 159104 159541 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978223.1 protein_id gnl|my_center|LOCUS_01560 159581 160018 gene locus_tag LOCUS_01570 159581 160018 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978222.1 protein_id gnl|my_center|LOCUS_01570 160015 160596 gene locus_tag LOCUS_01580 160015 160596 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978220.1 protein_id gnl|my_center|LOCUS_01580 160640 161935 gene locus_tag LOCUS_01590 gene tuf 160640 161935 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978219.1 protein_id gnl|my_center|LOCUS_01590 161935 162243 gene locus_tag LOCUS_01600 gene rpsJ 161935 162243 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867802.1 protein_id gnl|my_center|LOCUS_01600 162531 162923 gene locus_tag LOCUS_01610 gene speD 162531 162923 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081137.1 protein_id gnl|my_center|LOCUS_01610 163048 163836 gene locus_tag LOCUS_01620 163048 163836 CDS product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978403.1 protein_id gnl|my_center|LOCUS_01620 163905 164840 gene locus_tag LOCUS_01630 163905 164840 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240490.1 protein_id gnl|my_center|LOCUS_01630 164837 165655 gene locus_tag LOCUS_01640 gene rpl4p 164837 165655 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867463.1 protein_id gnl|my_center|LOCUS_01640 165652 165903 gene locus_tag LOCUS_01650 165652 165903 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763522.1 protein_id gnl|my_center|LOCUS_01650 165903 166628 gene locus_tag LOCUS_01660 165903 166628 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762841.1 protein_id gnl|my_center|LOCUS_01660 166656 167051 gene locus_tag LOCUS_01670 166656 167051 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250489.1 protein_id gnl|my_center|LOCUS_01670 167053 167514 gene locus_tag LOCUS_01680 gene rplV 167053 167514 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064485.1 protein_id gnl|my_center|LOCUS_01680 167514 168158 gene locus_tag LOCUS_01690 167514 168158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 168155 168385 gene locus_tag LOCUS_01700 168155 168385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 168351 168608 gene locus_tag LOCUS_01710 168351 168608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 168605 168931 gene locus_tag LOCUS_01720 168605 168931 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846880.1 protein_id gnl|my_center|LOCUS_01720 168974 169399 gene locus_tag LOCUS_01730 168974 169399 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762268.1 protein_id gnl|my_center|LOCUS_01730 169400 169762 gene locus_tag LOCUS_01740 gene rplX 169400 169762 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846306.1 protein_id gnl|my_center|LOCUS_01740 169759 170544 gene locus_tag LOCUS_01750 169759 170544 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875657.1 protein_id gnl|my_center|LOCUS_01750 170534 171052 gene locus_tag LOCUS_01760 170534 171052 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762516.1 protein_id gnl|my_center|LOCUS_01760 171256 171639 gene locus_tag LOCUS_01770 171256 171639 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763588.1 protein_id gnl|my_center|LOCUS_01770 171629 172204 gene locus_tag LOCUS_01780 171629 172204 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867447.1 protein_id gnl|my_center|LOCUS_01780 172206 172595 gene locus_tag LOCUS_01790 172206 172595 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867446.1 protein_id gnl|my_center|LOCUS_01790 172592 173023 gene locus_tag LOCUS_01800 172592 173023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 173025 173615 gene locus_tag LOCUS_01810 173025 173615 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869975.1 protein_id gnl|my_center|LOCUS_01810 173602 174207 gene locus_tag LOCUS_01820 173602 174207 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763044.1 protein_id gnl|my_center|LOCUS_01820 174209 174667 gene locus_tag LOCUS_01830 174209 174667 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250471.1 protein_id gnl|my_center|LOCUS_01830 174712 175164 gene locus_tag LOCUS_01840 174712 175164 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875667.1 protein_id gnl|my_center|LOCUS_01840 175151 176575 gene locus_tag LOCUS_01850 gene secY 175151 176575 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875668.1 protein_id gnl|my_center|LOCUS_01850 176707 177036 gene locus_tag LOCUS_01860 176707 177036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 177038 177298 gene locus_tag LOCUS_01870 177038 177298 CDS product 50S ribosomal protein L34e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978377.1 protein_id gnl|my_center|LOCUS_01870 177295 177855 gene locus_tag LOCUS_01880 177295 177855 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870161.1 protein_id gnl|my_center|LOCUS_01880 177830 178105 gene locus_tag LOCUS_01890 177830 178105 CDS product 50S ribosomal protein L14e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978366.1 protein_id gnl|my_center|LOCUS_01890 178102 178347 gene locus_tag LOCUS_01900 178102 178347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01900 178416 179078 gene locus_tag LOCUS_01910 178416 179078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01910 179162 179078 gene locus_tag LOCUS_t00100 179162 179078 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 179209 179655 gene locus_tag LOCUS_01920 179209 179655 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762661.1 protein_id gnl|my_center|LOCUS_01920 179657 180115 gene locus_tag LOCUS_01930 179657 180115 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980144.1 protein_id gnl|my_center|LOCUS_01930 180112 180507 gene locus_tag LOCUS_01940 180112 180507 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846715.1 protein_id gnl|my_center|LOCUS_01940 180482 180985 gene locus_tag LOCUS_01950 180482 180985 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023461.1 protein_id gnl|my_center|LOCUS_01950 180975 182444 gene locus_tag LOCUS_01960 180975 182444 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869988.1 protein_id gnl|my_center|LOCUS_01960 182444 184105 gene locus_tag LOCUS_01970 gene pheT 182444 184105 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878921.1 protein_id gnl|my_center|LOCUS_01970 184257 185420 gene locus_tag LOCUS_01980 gene dnaG 184257 185420 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762711.1 protein_id gnl|my_center|LOCUS_01980 185401 186447 gene locus_tag LOCUS_01990 185401 186447 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061107.1 protein_id gnl|my_center|LOCUS_01990 186447 187649 gene locus_tag LOCUS_02000 186447 187649 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184650980.1 protein_id gnl|my_center|LOCUS_02000 187649 188578 gene locus_tag LOCUS_02010 187649 188578 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867617.1 protein_id gnl|my_center|LOCUS_02010 189082 189534 gene locus_tag LOCUS_02020 189082 189534 CDS product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870211.1 protein_id gnl|my_center|LOCUS_02020 189729 189646 gene locus_tag LOCUS_t00110 189729 189646 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 189757 190689 gene locus_tag LOCUS_02030 189757 190689 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065652.1 protein_id gnl|my_center|LOCUS_02030 190744 190671 gene locus_tag LOCUS_t00120 190744 190671 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 191274 190744 gene locus_tag LOCUS_02040 191274 190744 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978294.1 protein_id gnl|my_center|LOCUS_02040 191769 191302 gene locus_tag LOCUS_02050 191769 191302 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762824.1 protein_id gnl|my_center|LOCUS_02050 191799 192290 gene locus_tag LOCUS_02060 191799 192290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 192283 192648 gene locus_tag LOCUS_02070 192283 192648 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875816.1 protein_id gnl|my_center|LOCUS_02070 192645 193169 gene locus_tag LOCUS_02080 192645 193169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 193717 193166 gene locus_tag LOCUS_02090 193717 193166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 194024 193710 gene locus_tag LOCUS_02100 194024 193710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 194222 194446 gene locus_tag LOCUS_02110 194222 194446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 194446 196239 gene locus_tag LOCUS_02120 194446 196239 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978275.1 protein_id gnl|my_center|LOCUS_02120 196270 197373 gene locus_tag LOCUS_02130 gene fbp 196270 197373 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762924.1 protein_id gnl|my_center|LOCUS_02130 197370 198056 gene locus_tag LOCUS_02140 gene tpiA 197370 198056 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871052.1 protein_id gnl|my_center|LOCUS_02140 198053 198757 gene locus_tag LOCUS_02150 198053 198757 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763582.1 protein_id gnl|my_center|LOCUS_02150 199485 198754 gene locus_tag LOCUS_02160 199485 198754 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867248.1 protein_id gnl|my_center|LOCUS_02160 199545 199619 gene locus_tag LOCUS_t00130 199545 199619 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 199638 200114 gene locus_tag LOCUS_02170 199638 200114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 200114 200761 gene locus_tag LOCUS_02180 200114 200761 CDS product HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147184.1 protein_id gnl|my_center|LOCUS_02180 201250 200747 gene locus_tag LOCUS_02190 201250 200747 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846759.1 protein_id gnl|my_center|LOCUS_02190 201297 201989 gene locus_tag LOCUS_02200 201297 201989 CDS product TrmJ/YjtD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496840.1 protein_id gnl|my_center|LOCUS_02200 201977 202591 gene locus_tag LOCUS_02210 201977 202591 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877716.1 protein_id gnl|my_center|LOCUS_02210 202584 203138 gene locus_tag LOCUS_02220 202584 203138 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250120.1 protein_id gnl|my_center|LOCUS_02220 203150 203443 gene locus_tag LOCUS_02230 203150 203443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 203421 203855 gene locus_tag LOCUS_02240 203421 203855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 203803 204129 gene locus_tag LOCUS_02250 203803 204129 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870659.1 protein_id gnl|my_center|LOCUS_02250 204167 204913 gene locus_tag LOCUS_02260 204167 204913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 204910 205929 gene locus_tag LOCUS_02270 204910 205929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 205916 207151 gene locus_tag LOCUS_02280 gene priS 205916 207151 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870353.1 protein_id gnl|my_center|LOCUS_02280 207138 207632 gene locus_tag LOCUS_02290 207138 207632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 207902 208102 gene locus_tag LOCUS_02300 207902 208102 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978936.1 protein_id gnl|my_center|LOCUS_02300 208095 208880 gene locus_tag LOCUS_02310 208095 208880 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867969.1 protein_id gnl|my_center|LOCUS_02310 211156 209027 gene locus_tag LOCUS_02320 211156 209027 CDS product STT3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762186.1 protein_id gnl|my_center|LOCUS_02320 211196 211579 gene locus_tag LOCUS_02330 gene gcvH 211196 211579 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583866.1 protein_id gnl|my_center|LOCUS_02330 212073 211576 gene locus_tag LOCUS_02340 212073 211576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 212111 212509 gene locus_tag LOCUS_02350 212111 212509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 213043 212510 gene locus_tag LOCUS_02360 213043 212510 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871125.1 protein_id gnl|my_center|LOCUS_02360 213609 213031 gene locus_tag LOCUS_02370 213609 213031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 213660 213584 gene locus_tag LOCUS_t00140 213660 213584 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 214124 214546 gene locus_tag LOCUS_02380 214124 214546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 214580 215506 gene locus_tag LOCUS_02390 214580 215506 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 protein_id gnl|my_center|LOCUS_02390 215564 216001 gene locus_tag LOCUS_02400 215564 216001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 216032 217399 gene locus_tag LOCUS_02410 gene glmM 216032 217399 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978186.1 protein_id gnl|my_center|LOCUS_02410 217392 218462 gene locus_tag LOCUS_02420 217392 218462 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931696.1 protein_id gnl|my_center|LOCUS_02420 218446 219186 gene locus_tag LOCUS_02430 218446 219186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 219183 220199 gene locus_tag LOCUS_02440 219183 220199 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545565.1 protein_id gnl|my_center|LOCUS_02440 221173 220196 gene locus_tag LOCUS_02450 221173 220196 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257842.1 protein_id gnl|my_center|LOCUS_02450 221889 221170 gene locus_tag LOCUS_02460 221889 221170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 >Feature sequence02 554 282 gene locus_tag LOCUS_02470 554 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 737 555 gene locus_tag LOCUS_02480 737 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 1947 1261 gene locus_tag LOCUS_02490 1947 1261 CDS product DUF4443 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868435.1 protein_id gnl|my_center|LOCUS_02490 2094 2522 gene locus_tag LOCUS_02500 2094 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 2524 3027 gene locus_tag LOCUS_02510 2524 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 3070 3267 gene locus_tag LOCUS_02520 3070 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 3264 4064 gene locus_tag LOCUS_02530 3264 4064 CDS product nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979458.1 protein_id gnl|my_center|LOCUS_02530 4061 4828 gene locus_tag LOCUS_02540 4061 4828 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978941.1 protein_id gnl|my_center|LOCUS_02540 4880 5779 gene locus_tag LOCUS_02550 4880 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 5837 6928 gene locus_tag LOCUS_02560 5837 6928 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147160.1 protein_id gnl|my_center|LOCUS_02560 8001 6919 gene locus_tag LOCUS_02570 8001 6919 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979428.1 protein_id gnl|my_center|LOCUS_02570 9163 8027 gene locus_tag LOCUS_02580 9163 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 9227 9883 gene locus_tag LOCUS_02590 9227 9883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 10619 9852 gene locus_tag LOCUS_02600 10619 9852 CDS product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878991.1 protein_id gnl|my_center|LOCUS_02600 11823 10606 gene locus_tag LOCUS_02610 11823 10606 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762522.1 protein_id gnl|my_center|LOCUS_02610 12521 11820 gene locus_tag LOCUS_02620 gene uppS 12521 11820 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870889.1 protein_id gnl|my_center|LOCUS_02620 12660 13004 gene locus_tag LOCUS_02630 12660 13004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 13294 15777 gene locus_tag LOCUS_02640 13294 15777 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762703.1 protein_id gnl|my_center|LOCUS_02640 16899 15985 gene locus_tag LOCUS_02650 16899 15985 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060851.1 protein_id gnl|my_center|LOCUS_02650 17094 17021 gene locus_tag LOCUS_t00150 17094 17021 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 18752 17214 gene locus_tag LOCUS_02660 18752 17214 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240273.1 protein_id gnl|my_center|LOCUS_02660 19601 18780 gene locus_tag LOCUS_02670 19601 18780 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250373.1 protein_id gnl|my_center|LOCUS_02670 20170 19598 gene locus_tag LOCUS_02680 gene endA 20170 19598 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762644.1 protein_id gnl|my_center|LOCUS_02680 20602 21183 gene locus_tag LOCUS_02690 20602 21183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 21430 21170 gene locus_tag LOCUS_02700 21430 21170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 22231 24285 gene locus_tag LOCUS_02710 22231 24285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 25774 24275 gene locus_tag LOCUS_02720 gene glyS 25774 24275 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978316.1 protein_id gnl|my_center|LOCUS_02720 25839 27578 gene locus_tag LOCUS_02730 25839 27578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 27578 28477 gene locus_tag LOCUS_02740 gene speB 27578 28477 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978315.1 protein_id gnl|my_center|LOCUS_02740 28752 29066 gene locus_tag LOCUS_02750 gene yciH 28752 29066 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978313.1 protein_id gnl|my_center|LOCUS_02750 29066 29275 gene locus_tag LOCUS_02760 29066 29275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 29633 29247 gene locus_tag LOCUS_02770 29633 29247 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978185.1 protein_id gnl|my_center|LOCUS_02770 30418 29660 gene locus_tag LOCUS_02780 30418 29660 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979296.1 protein_id gnl|my_center|LOCUS_02780 30990 30418 gene locus_tag LOCUS_02790 30990 30418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 32808 31024 gene locus_tag LOCUS_02800 32808 31024 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978165.1 protein_id gnl|my_center|LOCUS_02800 33559 32855 gene locus_tag LOCUS_02810 33559 32855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 34718 33552 gene locus_tag LOCUS_02820 34718 33552 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496769.1 protein_id gnl|my_center|LOCUS_02820 35343 34705 gene locus_tag LOCUS_02830 35343 34705 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249129.1 protein_id gnl|my_center|LOCUS_02830 35814 35344 gene locus_tag LOCUS_02840 35814 35344 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978170.1 protein_id gnl|my_center|LOCUS_02840 36662 35811 gene locus_tag LOCUS_02850 36662 35811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 37544 36708 gene locus_tag LOCUS_02860 37544 36708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 38097 37546 gene locus_tag LOCUS_02870 38097 37546 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870158.1 protein_id gnl|my_center|LOCUS_02870 39854 38112 gene locus_tag LOCUS_02880 gene rqcH 39854 38112 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871150.1 protein_id gnl|my_center|LOCUS_02880 40031 40372 gene locus_tag LOCUS_02890 40031 40372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 40666 40298 gene locus_tag LOCUS_02900 40666 40298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 41381 40650 gene locus_tag LOCUS_02910 41381 40650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 41398 42096 gene locus_tag LOCUS_02920 41398 42096 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762865.1 protein_id gnl|my_center|LOCUS_02920 42101 42376 gene locus_tag LOCUS_02930 42101 42376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 43559 42606 gene locus_tag LOCUS_02940 gene radA 43559 42606 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762467.1 protein_id gnl|my_center|LOCUS_02940 43636 43899 gene locus_tag LOCUS_02950 43636 43899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 44295 43891 gene locus_tag LOCUS_02960 44295 43891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 46261 44318 gene locus_tag LOCUS_02970 46261 44318 CDS product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598715.1 protein_id gnl|my_center|LOCUS_02970 47165 46293 gene locus_tag LOCUS_02980 gene sucD 47165 46293 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774550.1 protein_id gnl|my_center|LOCUS_02980 48279 47167 gene locus_tag LOCUS_02990 gene sucC 48279 47167 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762775.1 protein_id gnl|my_center|LOCUS_02990 48402 48980 gene locus_tag LOCUS_03000 48402 48980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 49074 50708 gene locus_tag LOCUS_03010 49074 50708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 50705 51415 gene locus_tag LOCUS_03020 50705 51415 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_03020 52490 51393 gene locus_tag LOCUS_03030 52490 51393 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876249.1 protein_id gnl|my_center|LOCUS_03030 52551 53786 gene locus_tag LOCUS_03040 52551 53786 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582434.1 protein_id gnl|my_center|LOCUS_03040 54852 53779 gene locus_tag LOCUS_03050 54852 53779 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249523.1 protein_id gnl|my_center|LOCUS_03050 55211 54852 gene locus_tag LOCUS_03060 55211 54852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 56131 55208 gene locus_tag LOCUS_03070 56131 55208 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867803.1 protein_id gnl|my_center|LOCUS_03070 56352 56128 gene locus_tag LOCUS_03080 56352 56128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 56714 56424 gene locus_tag LOCUS_03090 56714 56424 CDS product signal recognition particle subunit SRP19/SEC65 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875804.1 protein_id gnl|my_center|LOCUS_03090 57097 56711 gene locus_tag LOCUS_03100 57097 56711 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978126.1 protein_id gnl|my_center|LOCUS_03100 57209 57134 gene locus_tag LOCUS_t00160 57209 57134 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 57274 57350 gene locus_tag LOCUS_t00170 57274 57350 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 57825 57331 gene locus_tag LOCUS_03110 57825 57331 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761848.1 protein_id gnl|my_center|LOCUS_03110 58583 57822 gene locus_tag LOCUS_03120 gene fabG 58583 57822 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_03120 59095 58580 gene locus_tag LOCUS_03130 59095 58580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 59201 59131 gene locus_tag LOCUS_t00180 59201 59131 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 61452 59245 gene locus_tag LOCUS_03140 61452 59245 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763679.1 protein_id gnl|my_center|LOCUS_03140 62521 61505 gene locus_tag LOCUS_03150 62521 61505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 62694 63287 gene locus_tag LOCUS_03160 62694 63287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 63307 63642 gene locus_tag LOCUS_03170 63307 63642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 66750 63625 gene locus_tag LOCUS_03180 66750 63625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 66833 67396 gene locus_tag LOCUS_03190 66833 67396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867709.1 protein_id gnl|my_center|LOCUS_03190 69041 67383 gene locus_tag LOCUS_03200 69041 67383 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320246.1 protein_id gnl|my_center|LOCUS_03200 71704 69038 gene locus_tag LOCUS_03210 gene ppdK 71704 69038 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 protein_id gnl|my_center|LOCUS_03210 72141 71737 gene locus_tag LOCUS_03220 72141 71737 CDS product YbgC/FadM family acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880969.1 protein_id gnl|my_center|LOCUS_03220 73016 72144 gene locus_tag LOCUS_03230 73016 72144 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198019.1 protein_id gnl|my_center|LOCUS_03230 73436 73927 gene locus_tag LOCUS_03240 73436 73927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 74837 73917 gene locus_tag LOCUS_03250 74837 73917 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879317.1 protein_id gnl|my_center|LOCUS_03250 74868 75383 gene locus_tag LOCUS_03260 74868 75383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 75510 78170 gene locus_tag LOCUS_03270 75510 78170 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762664.1 protein_id gnl|my_center|LOCUS_03270 78261 79271 gene locus_tag LOCUS_03280 78261 79271 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868869.1 protein_id gnl|my_center|LOCUS_03280 79271 80695 gene locus_tag LOCUS_03290 79271 80695 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250753.1 protein_id gnl|my_center|LOCUS_03290 80697 81665 gene locus_tag LOCUS_03300 80697 81665 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 protein_id gnl|my_center|LOCUS_03300 81672 82727 gene locus_tag LOCUS_03310 81672 82727 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868866.1 protein_id gnl|my_center|LOCUS_03310 83080 82724 gene locus_tag LOCUS_03320 83080 82724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 83131 84030 gene locus_tag LOCUS_03330 83131 84030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 84008 84970 gene locus_tag LOCUS_03340 84008 84970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 86251 84953 gene locus_tag LOCUS_03350 86251 84953 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979394.1 protein_id gnl|my_center|LOCUS_03350 86311 87618 gene locus_tag LOCUS_03360 86311 87618 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250842.1 protein_id gnl|my_center|LOCUS_03360 88196 87624 gene locus_tag LOCUS_03370 88196 87624 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583777.1 protein_id gnl|my_center|LOCUS_03370 88230 88664 gene locus_tag LOCUS_03380 88230 88664 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251243.1 protein_id gnl|my_center|LOCUS_03380 88692 88775 gene locus_tag LOCUS_t00190 88692 88775 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 89422 88769 gene locus_tag LOCUS_03390 89422 88769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 89515 90177 gene locus_tag LOCUS_03400 89515 90177 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251052.1 protein_id gnl|my_center|LOCUS_03400 90209 91225 gene locus_tag LOCUS_03410 90209 91225 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879789.1 protein_id gnl|my_center|LOCUS_03410 91265 91834 gene locus_tag LOCUS_03420 91265 91834 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978534.1 protein_id gnl|my_center|LOCUS_03420 92920 91835 gene locus_tag LOCUS_03430 gene hflX 92920 91835 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250926.1 protein_id gnl|my_center|LOCUS_03430 93751 92930 gene locus_tag LOCUS_03440 93751 92930 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250749.1 protein_id gnl|my_center|LOCUS_03440 93786 94622 gene locus_tag LOCUS_03450 93786 94622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03450 94612 95298 gene locus_tag LOCUS_03460 94612 95298 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876695.1 protein_id gnl|my_center|LOCUS_03460 95317 96600 gene locus_tag LOCUS_03470 gene asnS 95317 96600 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762130.1 protein_id gnl|my_center|LOCUS_03470 96693 97337 gene locus_tag LOCUS_03480 96693 97337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 97339 97959 gene locus_tag LOCUS_03490 gene cdvA 97339 97959 CDS product cell division protein CdvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979232.1 protein_id gnl|my_center|LOCUS_03490 97969 98736 gene locus_tag LOCUS_03500 97969 98736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 98738 99862 gene locus_tag LOCUS_03510 gene cdvC 98738 99862 CDS product cell division protein CdvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979234.1 protein_id gnl|my_center|LOCUS_03510 100314 99859 gene locus_tag LOCUS_03520 100314 99859 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878465.1 protein_id gnl|my_center|LOCUS_03520 100819 100316 gene locus_tag LOCUS_03530 100819 100316 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979867.1 protein_id gnl|my_center|LOCUS_03530 101994 100816 gene locus_tag LOCUS_03540 101994 100816 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979868.1 protein_id gnl|my_center|LOCUS_03540 103142 101997 gene locus_tag LOCUS_03550 103142 101997 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081868529.1 protein_id gnl|my_center|LOCUS_03550 104362 103172 gene locus_tag LOCUS_03560 104362 103172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 104441 105499 gene locus_tag LOCUS_03570 gene amrS 104441 105499 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979564.1 protein_id gnl|my_center|LOCUS_03570 105506 106645 gene locus_tag LOCUS_03580 105506 106645 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259674.1 protein_id gnl|my_center|LOCUS_03580 106683 107027 gene locus_tag LOCUS_03590 gene erpA 106683 107027 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881213.1 protein_id gnl|my_center|LOCUS_03590 107859 107410 gene locus_tag LOCUS_03600 107859 107410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 107947 108825 gene locus_tag LOCUS_03610 107947 108825 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868260.1 protein_id gnl|my_center|LOCUS_03610 108822 109127 gene locus_tag LOCUS_03620 108822 109127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 110203 109178 gene locus_tag LOCUS_03630 110203 109178 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980425.1 protein_id gnl|my_center|LOCUS_03630 110730 110200 gene locus_tag LOCUS_03640 110730 110200 CDS product ADP-ribose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880613.1 protein_id gnl|my_center|LOCUS_03640 111332 110700 gene locus_tag LOCUS_03650 111332 110700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 111952 111329 gene locus_tag LOCUS_03660 111952 111329 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256468.1 protein_id gnl|my_center|LOCUS_03660 112502 112014 gene locus_tag LOCUS_03670 112502 112014 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327407.1 protein_id gnl|my_center|LOCUS_03670 115013 112599 gene locus_tag LOCUS_03680 115013 112599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 118726 115010 gene locus_tag LOCUS_03690 gene rgy 118726 115010 CDS product reverse gyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846290.1 protein_id gnl|my_center|LOCUS_03690 119431 119207 gene locus_tag LOCUS_03700 119431 119207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 119581 120174 gene locus_tag LOCUS_03710 119581 120174 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978560.1 protein_id gnl|my_center|LOCUS_03710 120174 121004 gene locus_tag LOCUS_03720 120174 121004 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846658.1 protein_id gnl|my_center|LOCUS_03720 121034 121531 gene locus_tag LOCUS_03730 121034 121531 CDS product DUF2258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846425.1 protein_id gnl|my_center|LOCUS_03730 121790 121512 gene locus_tag LOCUS_03740 121790 121512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 121805 122773 gene locus_tag LOCUS_03750 gene ilvA 121805 122773 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890721.1 protein_id gnl|my_center|LOCUS_03750 123426 122761 gene locus_tag LOCUS_03760 123426 122761 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545344.1 protein_id gnl|my_center|LOCUS_03760 124389 123457 gene locus_tag LOCUS_03770 gene mdh 124389 123457 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_03770 126038 124749 gene locus_tag LOCUS_03780 126038 124749 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936956.1 protein_id gnl|my_center|LOCUS_03780 127971 126031 gene locus_tag LOCUS_03790 127971 126031 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979843.1 protein_id gnl|my_center|LOCUS_03790 128898 128713 gene locus_tag LOCUS_03800 128898 128713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 129222 129905 gene locus_tag LOCUS_03810 gene pyrF 129222 129905 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251226.1 protein_id gnl|my_center|LOCUS_03810 129889 130407 gene locus_tag LOCUS_03820 gene pyrE 129889 130407 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868222.1 protein_id gnl|my_center|LOCUS_03820 130440 131351 gene locus_tag LOCUS_03830 gene pyrB 130440 131351 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 protein_id gnl|my_center|LOCUS_03830 131353 131832 gene locus_tag LOCUS_03840 gene pyrI 131353 131832 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251145.1 protein_id gnl|my_center|LOCUS_03840 131816 133030 gene locus_tag LOCUS_03850 131816 133030 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868871.1 protein_id gnl|my_center|LOCUS_03850 133064 134023 gene locus_tag LOCUS_03860 133064 134023 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285058.1 protein_id gnl|my_center|LOCUS_03860 134020 134820 gene locus_tag LOCUS_03870 134020 134820 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582436.1 protein_id gnl|my_center|LOCUS_03870 134811 135632 gene locus_tag LOCUS_03880 134811 135632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 136540 135629 gene locus_tag LOCUS_03890 136540 135629 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978544.1 protein_id gnl|my_center|LOCUS_03890 137212 136553 gene locus_tag LOCUS_03900 137212 136553 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319832.1 protein_id gnl|my_center|LOCUS_03900 137265 137909 gene locus_tag LOCUS_03910 137265 137909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 137899 138213 gene locus_tag LOCUS_03920 137899 138213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 138633 138223 gene locus_tag LOCUS_03930 138633 138223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 140001 138679 gene locus_tag LOCUS_03940 gene thrC 140001 138679 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867870.1 protein_id gnl|my_center|LOCUS_03940 140017 140412 gene locus_tag LOCUS_03950 140017 140412 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060955.1 protein_id gnl|my_center|LOCUS_03950 141185 140403 gene locus_tag LOCUS_03960 141185 140403 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249248.1 protein_id gnl|my_center|LOCUS_03960 142139 141228 gene locus_tag LOCUS_03970 142139 141228 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532030.1 protein_id gnl|my_center|LOCUS_03970 142770 142129 gene locus_tag LOCUS_03980 142770 142129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 142815 144365 gene locus_tag LOCUS_03990 142815 144365 CDS product dihydropteroate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877347.1 protein_id gnl|my_center|LOCUS_03990 144425 145198 gene locus_tag LOCUS_04000 144425 145198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 145203 146105 gene locus_tag LOCUS_04010 145203 146105 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892274.1 protein_id gnl|my_center|LOCUS_04010 146426 146097 gene locus_tag LOCUS_04020 146426 146097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 146767 146423 gene locus_tag LOCUS_04030 146767 146423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 147459 146764 gene locus_tag LOCUS_04040 147459 146764 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456956.1 protein_id gnl|my_center|LOCUS_04040 149161 147461 gene locus_tag LOCUS_04050 149161 147461 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 protein_id gnl|my_center|LOCUS_04050 149216 149575 gene locus_tag LOCUS_04060 gene ndhC 149216 149575 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257856.1 protein_id gnl|my_center|LOCUS_04060 149763 150161 gene locus_tag LOCUS_04070 149763 150161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 150158 150580 gene locus_tag LOCUS_04080 150158 150580 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392494.1 protein_id gnl|my_center|LOCUS_04080 150574 151689 gene locus_tag LOCUS_04090 gene nuoD 150574 151689 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_04090 151694 152791 gene locus_tag LOCUS_04100 gene nuoH 151694 152791 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_04100 152824 153261 gene locus_tag LOCUS_04110 152824 153261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 153261 153917 gene locus_tag LOCUS_04120 153261 153917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 154784 153921 gene locus_tag LOCUS_04130 154784 153921 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259324.1 protein_id gnl|my_center|LOCUS_04130 154868 155362 gene locus_tag LOCUS_04140 154868 155362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 155359 155664 gene locus_tag LOCUS_04150 gene nuoK 155359 155664 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404194.1 protein_id gnl|my_center|LOCUS_04150 155661 157097 gene locus_tag LOCUS_04160 gene fpoN 155661 157097 CDS product F(420)H(2) dehydrogenase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 protein_id gnl|my_center|LOCUS_04160 158035 157094 gene locus_tag LOCUS_04170 158035 157094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 158106 158924 gene locus_tag LOCUS_04180 158106 158924 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869770.1 protein_id gnl|my_center|LOCUS_04180 158964 159998 gene locus_tag LOCUS_04190 158964 159998 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979957.1 protein_id gnl|my_center|LOCUS_04190 160021 160713 gene locus_tag LOCUS_04200 160021 160713 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868497.1 protein_id gnl|my_center|LOCUS_04200 160679 161299 gene locus_tag LOCUS_04210 160679 161299 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_04210 161302 162378 gene locus_tag LOCUS_04220 161302 162378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 162378 162908 gene locus_tag LOCUS_04230 162378 162908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 163016 163516 gene locus_tag LOCUS_04240 163016 163516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846767.1 protein_id gnl|my_center|LOCUS_04240 163679 163530 gene locus_tag LOCUS_04250 163679 163530 CDS product YHS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755885.1 protein_id gnl|my_center|LOCUS_04250 163854 165803 gene locus_tag LOCUS_04260 163854 165803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 166171 165800 gene locus_tag LOCUS_04270 166171 165800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 166184 167263 gene locus_tag LOCUS_04280 gene adhP 166184 167263 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258663.1 protein_id gnl|my_center|LOCUS_04280 168667 167252 gene locus_tag LOCUS_04290 168667 167252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 168717 169616 gene locus_tag LOCUS_04300 168717 169616 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879344.1 protein_id gnl|my_center|LOCUS_04300 171116 169650 gene locus_tag LOCUS_04310 171116 169650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 172337 171204 gene locus_tag LOCUS_04320 172337 171204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 173208 172312 gene locus_tag LOCUS_04330 gene arcC 173208 172312 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868005.1 protein_id gnl|my_center|LOCUS_04330 173288 174691 gene locus_tag LOCUS_04340 173288 174691 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867476.1 protein_id gnl|my_center|LOCUS_04340 174688 175383 gene locus_tag LOCUS_04350 174688 175383 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762240.1 protein_id gnl|my_center|LOCUS_04350 176095 175367 gene locus_tag LOCUS_04360 176095 175367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 176169 177095 gene locus_tag LOCUS_04370 gene cofD 176169 177095 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870769.1 protein_id gnl|my_center|LOCUS_04370 177096 177749 gene locus_tag LOCUS_04380 gene cofC 177096 177749 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496647.1 protein_id gnl|my_center|LOCUS_04380 177709 178473 gene locus_tag LOCUS_04390 177709 178473 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870273.1 protein_id gnl|my_center|LOCUS_04390 179008 178466 gene locus_tag LOCUS_04400 179008 178466 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762118.1 protein_id gnl|my_center|LOCUS_04400 179931 179005 gene locus_tag LOCUS_04410 gene hutG 179931 179005 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399848.1 protein_id gnl|my_center|LOCUS_04410 180058 181485 gene locus_tag LOCUS_04420 gene thiI 180058 181485 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762723.1 protein_id gnl|my_center|LOCUS_04420 182279 181482 gene locus_tag LOCUS_04430 182279 181482 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979915.1 protein_id gnl|my_center|LOCUS_04430 183109 182282 gene locus_tag LOCUS_04440 183109 182282 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249125.1 protein_id gnl|my_center|LOCUS_04440 183348 183160 gene locus_tag LOCUS_04450 183348 183160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 184331 183411 gene locus_tag LOCUS_04460 184331 183411 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846833.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04460 184390 184695 gene locus_tag LOCUS_04470 184390 184695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 186562 184688 gene locus_tag LOCUS_04480 186562 184688 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249735.1 protein_id gnl|my_center|LOCUS_04480 187170 186583 gene locus_tag LOCUS_04490 gene trmY 187170 186583 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871164.1 protein_id gnl|my_center|LOCUS_04490 187809 187201 gene locus_tag LOCUS_04500 187809 187201 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964931.1 protein_id gnl|my_center|LOCUS_04500 187814 188551 gene locus_tag LOCUS_04510 187814 188551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545105.1 protein_id gnl|my_center|LOCUS_04510 189180 188548 gene locus_tag LOCUS_04520 189180 188548 CDS product CRISPR-associated transcriptional regulator Csa3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879362.1 protein_id gnl|my_center|LOCUS_04520 189258 190202 gene locus_tag LOCUS_04530 189258 190202 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980488.1 protein_id gnl|my_center|LOCUS_04530 191309 190197 gene locus_tag LOCUS_04540 191309 190197 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978530.1 protein_id gnl|my_center|LOCUS_04540 191380 191724 gene locus_tag LOCUS_04550 191380 191724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 193171 191714 gene locus_tag LOCUS_04560 193171 191714 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980439.1 protein_id gnl|my_center|LOCUS_04560 193764 193168 gene locus_tag LOCUS_04570 193764 193168 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143585.1 protein_id gnl|my_center|LOCUS_04570 194429 193851 gene locus_tag LOCUS_04580 194429 193851 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762923.1 protein_id gnl|my_center|LOCUS_04580 194710 194429 gene locus_tag LOCUS_04590 194710 194429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 195254 194742 gene locus_tag LOCUS_04600 195254 194742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 195169 195417 gene locus_tag LOCUS_04610 195169 195417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 195425 196084 gene locus_tag LOCUS_04620 195425 196084 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319832.1 protein_id gnl|my_center|LOCUS_04620 196149 196961 gene locus_tag LOCUS_04630 196149 196961 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496728.1 protein_id gnl|my_center|LOCUS_04630 197687 197031 gene locus_tag LOCUS_04640 197687 197031 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021463.1 protein_id gnl|my_center|LOCUS_04640 <198337 197725 gene locus_tag LOCUS_04650 <198337 197725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250249.1:DUF1464 family protein >Feature sequence03 2460 562 gene locus_tag LOCUS_04660 gene glgB 2460 562 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880434.1 protein_id gnl|my_center|LOCUS_04660 2507 3739 gene locus_tag LOCUS_04670 gene glyA 2507 3739 CDS product bifunctional serine hydroxymethyltransferase/L-allo-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871121.1 protein_id gnl|my_center|LOCUS_04670 3843 4160 gene locus_tag LOCUS_04680 3843 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 4233 4460 gene locus_tag LOCUS_04690 4233 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 4476 5339 gene locus_tag LOCUS_04700 4476 5339 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895075.1 protein_id gnl|my_center|LOCUS_04700 5340 5735 gene locus_tag LOCUS_04710 5340 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04710 6887 5877 gene locus_tag LOCUS_04720 6887 5877 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879267.1 protein_id gnl|my_center|LOCUS_04720 7845 6871 gene locus_tag LOCUS_04730 7845 6871 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879266.1 protein_id gnl|my_center|LOCUS_04730 8708 7842 gene locus_tag LOCUS_04740 8708 7842 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879265.1 protein_id gnl|my_center|LOCUS_04740 9711 8710 gene locus_tag LOCUS_04750 9711 8710 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064459.1 protein_id gnl|my_center|LOCUS_04750 11319 9742 gene locus_tag LOCUS_04760 11319 9742 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762356.1 protein_id gnl|my_center|LOCUS_04760 11628 12233 gene locus_tag LOCUS_04770 11628 12233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 12489 13697 gene locus_tag LOCUS_04780 12489 13697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 13728 14273 gene locus_tag LOCUS_04790 13728 14273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 14425 15159 gene locus_tag LOCUS_04800 gene proC 14425 15159 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978628.1 protein_id gnl|my_center|LOCUS_04800 15183 16283 gene locus_tag LOCUS_04810 15183 16283 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978775.1 protein_id gnl|my_center|LOCUS_04810 16759 16343 gene locus_tag LOCUS_04820 16759 16343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 17803 16889 gene locus_tag LOCUS_04830 17803 16889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 18082 18630 gene locus_tag LOCUS_04840 18082 18630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 20287 18617 gene locus_tag LOCUS_04850 20287 18617 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979769.1 protein_id gnl|my_center|LOCUS_04850 20526 21611 gene locus_tag LOCUS_04860 20526 21611 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318704.1 protein_id gnl|my_center|LOCUS_04860 22487 21612 gene locus_tag LOCUS_04870 gene menA 22487 21612 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081897.1 protein_id gnl|my_center|LOCUS_04870 23068 22484 gene locus_tag LOCUS_04880 23068 22484 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081900.1 protein_id gnl|my_center|LOCUS_04880 24056 23058 gene locus_tag LOCUS_04890 gene mer 24056 23058 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_04890 24324 25070 gene locus_tag LOCUS_04900 gene fabG 24324 25070 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_04900 25138 25806 gene locus_tag LOCUS_04910 25138 25806 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083177.1 protein_id gnl|my_center|LOCUS_04910 25971 26600 gene locus_tag LOCUS_04920 25971 26600 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978857.1 protein_id gnl|my_center|LOCUS_04920 27266 26625 gene locus_tag LOCUS_04930 27266 26625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 28667 27321 gene locus_tag LOCUS_04940 28667 27321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04940 29183 28785 gene locus_tag LOCUS_04950 29183 28785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04950 29810 29238 gene locus_tag LOCUS_04960 29810 29238 CDS product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138383.1 protein_id gnl|my_center|LOCUS_04960 30190 29807 gene locus_tag LOCUS_04970 30190 29807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 30830 30183 gene locus_tag LOCUS_04980 30830 30183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 31666 30854 gene locus_tag LOCUS_04990 31666 30854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979078.1 protein_id gnl|my_center|LOCUS_04990 32450 31668 gene locus_tag LOCUS_05000 32450 31668 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979077.1 protein_id gnl|my_center|LOCUS_05000 32612 34633 gene locus_tag LOCUS_05010 gene acs 32612 34633 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978720.1 protein_id gnl|my_center|LOCUS_05010 34807 35595 gene locus_tag LOCUS_05020 34807 35595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 35993 38587 gene locus_tag LOCUS_05030 35993 38587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 39106 38588 gene locus_tag LOCUS_05040 39106 38588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 39228 39776 gene locus_tag LOCUS_05050 39228 39776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 40059 39781 gene locus_tag LOCUS_05060 40059 39781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05060 40366 40196 gene locus_tag LOCUS_05070 40366 40196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 42014 40359 gene locus_tag LOCUS_05080 42014 40359 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229182.1 protein_id gnl|my_center|LOCUS_05080 42095 42490 gene locus_tag LOCUS_05090 42095 42490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 46128 42499 gene locus_tag LOCUS_05100 46128 42499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 46292 47497 gene locus_tag LOCUS_05110 46292 47497 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186205.1 protein_id gnl|my_center|LOCUS_05110 48225 54035 gene locus_tag LOCUS_05120 48225 54035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 54320 54844 gene locus_tag LOCUS_05130 54320 54844 CDS product AAA-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980406.1 protein_id gnl|my_center|LOCUS_05130 55704 54925 gene locus_tag LOCUS_05140 55704 54925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 57299 55701 gene locus_tag LOCUS_05150 57299 55701 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583136.1 protein_id gnl|my_center|LOCUS_05150 57787 57419 gene locus_tag LOCUS_05160 57787 57419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 57986 59047 gene locus_tag LOCUS_05170 57986 59047 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533145.1 protein_id gnl|my_center|LOCUS_05170 59058 59921 gene locus_tag LOCUS_05180 59058 59921 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_05180 60805 59918 gene locus_tag LOCUS_05190 60805 59918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 61386 61192 gene locus_tag LOCUS_05200 61386 61192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 61534 63759 gene locus_tag LOCUS_05210 61534 63759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 63962 64540 gene locus_tag LOCUS_05220 63962 64540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 64747 65376 gene locus_tag LOCUS_05230 64747 65376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 65978 66757 gene locus_tag LOCUS_05240 65978 66757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 66944 67129 gene locus_tag LOCUS_05250 66944 67129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240564.1 protein_id gnl|my_center|LOCUS_05250 68562 67414 gene locus_tag LOCUS_05260 68562 67414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 68571 69227 gene locus_tag LOCUS_05270 68571 69227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 69313 69774 gene locus_tag LOCUS_05280 69313 69774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 70117 69926 gene locus_tag LOCUS_05290 70117 69926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 70505 70134 gene locus_tag LOCUS_05300 70505 70134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 70835 71101 gene locus_tag LOCUS_05310 70835 71101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 71098 72417 gene locus_tag LOCUS_05320 gene cas7a 71098 72417 CDS product type I-A CRISPR-associated protein Cas7/Csa2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125740408.1 protein_id gnl|my_center|LOCUS_05320 72414 73178 gene locus_tag LOCUS_05330 72414 73178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 73168 74247 gene locus_tag LOCUS_05340 73168 74247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 74244 76004 gene locus_tag LOCUS_05350 74244 76004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 75997 76677 gene locus_tag LOCUS_05360 75997 76677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 76788 84294 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcaattcccttcttgggattc 84464 85447 gene locus_tag LOCUS_05370 gene cas4a 84464 85447 CDS product type I-A CRISPR-associated protein Cas4/Csa1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977960.1 protein_id gnl|my_center|LOCUS_05370 85486 86475 gene locus_tag LOCUS_05380 gene cas1 85486 86475 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879371.1 protein_id gnl|my_center|LOCUS_05380 86481 86759 gene locus_tag LOCUS_05390 86481 86759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 86811 87404 gene locus_tag LOCUS_05400 86811 87404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 87593 88078 gene locus_tag LOCUS_05410 87593 88078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 88395 88925 gene locus_tag LOCUS_05420 88395 88925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 89136 88948 gene locus_tag LOCUS_05430 89136 88948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 89615 90523 gene locus_tag LOCUS_05440 89615 90523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 92056 90530 gene locus_tag LOCUS_05450 92056 90530 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978659.1 protein_id gnl|my_center|LOCUS_05450 92571 92053 gene locus_tag LOCUS_05460 92571 92053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 92735 93880 gene locus_tag LOCUS_05470 92735 93880 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761873.1 protein_id gnl|my_center|LOCUS_05470 94325 93837 gene locus_tag LOCUS_05480 94325 93837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 95437 94493 gene locus_tag LOCUS_05490 95437 94493 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978831.1 protein_id gnl|my_center|LOCUS_05490 95510 95584 gene locus_tag LOCUS_t00200 95510 95584 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 96720 95584 gene locus_tag LOCUS_05500 96720 95584 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064776.1 protein_id gnl|my_center|LOCUS_05500 98055 96721 gene locus_tag LOCUS_05510 98055 96721 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879784.1 protein_id gnl|my_center|LOCUS_05510 98228 99160 gene locus_tag LOCUS_05520 98228 99160 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245086.1 protein_id gnl|my_center|LOCUS_05520 99208 99825 gene locus_tag LOCUS_05530 99208 99825 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112368.1 protein_id gnl|my_center|LOCUS_05530 99828 101369 gene locus_tag LOCUS_05540 99828 101369 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245821.1 protein_id gnl|my_center|LOCUS_05540 101359 102117 gene locus_tag LOCUS_05550 101359 102117 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986508.1 protein_id gnl|my_center|LOCUS_05550 102735 102094 gene locus_tag LOCUS_05560 gene thiE 102735 102094 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244128.1 protein_id gnl|my_center|LOCUS_05560 103802 102762 gene locus_tag LOCUS_05570 103802 102762 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846612.1 protein_id gnl|my_center|LOCUS_05570 104463 103795 gene locus_tag LOCUS_05580 104463 103795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 104504 105445 gene locus_tag LOCUS_05590 104504 105445 CDS product thiamine-phosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846193.1 protein_id gnl|my_center|LOCUS_05590 105488 105901 gene locus_tag LOCUS_05600 gene trxA 105488 105901 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846726.1 protein_id gnl|my_center|LOCUS_05600 105992 106306 gene locus_tag LOCUS_05610 105992 106306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 106332 107021 gene locus_tag LOCUS_05620 106332 107021 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904152.1 protein_id gnl|my_center|LOCUS_05620 107797 107087 gene locus_tag LOCUS_05630 107797 107087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 108789 107824 gene locus_tag LOCUS_05640 108789 107824 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546129.1 protein_id gnl|my_center|LOCUS_05640 109292 108786 gene locus_tag LOCUS_05650 109292 108786 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846164.1 protein_id gnl|my_center|LOCUS_05650 109318 111405 gene locus_tag LOCUS_05660 109318 111405 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023776.1 protein_id gnl|my_center|LOCUS_05660 112086 111406 gene locus_tag LOCUS_05670 gene rpiA 112086 111406 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060856.1 protein_id gnl|my_center|LOCUS_05670 112184 112675 gene locus_tag LOCUS_05680 112184 112675 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979504.1 protein_id gnl|my_center|LOCUS_05680 112668 113198 gene locus_tag LOCUS_05690 112668 113198 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932608.1 protein_id gnl|my_center|LOCUS_05690 113237 113977 gene locus_tag LOCUS_05700 113237 113977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 113974 114927 gene locus_tag LOCUS_05710 113974 114927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 114917 116047 gene locus_tag LOCUS_05720 114917 116047 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868029.1 protein_id gnl|my_center|LOCUS_05720 116089 117612 gene locus_tag LOCUS_05730 116089 117612 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762722.1 protein_id gnl|my_center|LOCUS_05730 117638 117713 gene locus_tag LOCUS_t00210 117638 117713 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 118732 117713 gene locus_tag LOCUS_05740 118732 117713 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877133.1 protein_id gnl|my_center|LOCUS_05740 119068 118742 gene locus_tag LOCUS_05750 119068 118742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 119663 119055 gene locus_tag LOCUS_05760 119663 119055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 120088 119660 gene locus_tag LOCUS_05770 120088 119660 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879807.1 protein_id gnl|my_center|LOCUS_05770 120140 120865 gene locus_tag LOCUS_05780 gene psmA 120140 120865 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867731.1 protein_id gnl|my_center|LOCUS_05780 120904 121596 gene locus_tag LOCUS_05790 120904 121596 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762590.1 protein_id gnl|my_center|LOCUS_05790 121593 122276 gene locus_tag LOCUS_05800 gene rrp4 121593 122276 CDS product exosome complex protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877999.1 protein_id gnl|my_center|LOCUS_05800 122280 122993 gene locus_tag LOCUS_05810 gene rrp41 122280 122993 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846320.1 protein_id gnl|my_center|LOCUS_05810 122993 123820 gene locus_tag LOCUS_05820 gene rrp42 122993 123820 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867735.1 protein_id gnl|my_center|LOCUS_05820 123813 124115 gene locus_tag LOCUS_05830 123813 124115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 124078 124584 gene locus_tag LOCUS_05840 124078 124584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 124562 124816 gene locus_tag LOCUS_05850 124562 124816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 124813 125193 gene locus_tag LOCUS_05860 124813 125193 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878647.1 protein_id gnl|my_center|LOCUS_05860 125246 126091 gene locus_tag LOCUS_05870 125246 126091 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867495.1 protein_id gnl|my_center|LOCUS_05870 126075 126899 gene locus_tag LOCUS_05880 126075 126899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05880 126892 127602 gene locus_tag LOCUS_05890 126892 127602 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249696.1 protein_id gnl|my_center|LOCUS_05890 127641 128690 gene locus_tag LOCUS_05900 127641 128690 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249136.1 protein_id gnl|my_center|LOCUS_05900 128687 129841 gene locus_tag LOCUS_05910 128687 129841 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868485.1 protein_id gnl|my_center|LOCUS_05910 129838 130233 gene locus_tag LOCUS_05920 129838 130233 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762564.1 protein_id gnl|my_center|LOCUS_05920 131139 130225 gene locus_tag LOCUS_05930 131139 130225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 132218 131139 gene locus_tag LOCUS_05940 gene gcvT 132218 131139 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979225.1 protein_id gnl|my_center|LOCUS_05940 132292 132365 gene locus_tag LOCUS_t00220 132292 132365 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 134027 132363 gene locus_tag LOCUS_05950 134027 132363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 134157 135383 gene locus_tag LOCUS_05960 gene gcvPA 134157 135383 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250331.1 protein_id gnl|my_center|LOCUS_05960 135376 136917 gene locus_tag LOCUS_05970 gene gcvPB 135376 136917 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868896.1 protein_id gnl|my_center|LOCUS_05970 138186 136894 gene locus_tag LOCUS_05980 138186 136894 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762100.1 protein_id gnl|my_center|LOCUS_05980 139891 138230 gene locus_tag LOCUS_05990 gene metG 139891 138230 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979477.1 protein_id gnl|my_center|LOCUS_05990 140747 139941 gene locus_tag LOCUS_06000 140747 139941 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867247.1 protein_id gnl|my_center|LOCUS_06000 140820 141212 gene locus_tag LOCUS_06010 140820 141212 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013749.1 protein_id gnl|my_center|LOCUS_06010 141212 141889 gene locus_tag LOCUS_06020 141212 141889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 141919 142218 gene locus_tag LOCUS_06030 gene eif1A 141919 142218 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064286.1 protein_id gnl|my_center|LOCUS_06030 142918 142208 gene locus_tag LOCUS_06040 142918 142208 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846354.1 protein_id gnl|my_center|LOCUS_06040 142956 143498 gene locus_tag LOCUS_06050 142956 143498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 143495 145009 gene locus_tag LOCUS_06060 143495 145009 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979316.1 protein_id gnl|my_center|LOCUS_06060 144993 146054 gene locus_tag LOCUS_06070 144993 146054 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876639.1 protein_id gnl|my_center|LOCUS_06070 146095 147246 gene locus_tag LOCUS_06080 146095 147246 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870036.1 protein_id gnl|my_center|LOCUS_06080 147243 147695 gene locus_tag LOCUS_06090 147243 147695 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867606.1 protein_id gnl|my_center|LOCUS_06090 147692 148447 gene locus_tag LOCUS_06100 gene queC 147692 148447 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876732.1 protein_id gnl|my_center|LOCUS_06100 148447 148926 gene locus_tag LOCUS_06110 148447 148926 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256436.1 protein_id gnl|my_center|LOCUS_06110 149788 148916 gene locus_tag LOCUS_06120 gene cyoE 149788 148916 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846973.1 protein_id gnl|my_center|LOCUS_06120 149850 150353 gene locus_tag LOCUS_06130 149850 150353 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761840.1 protein_id gnl|my_center|LOCUS_06130 150585 150301 gene locus_tag LOCUS_06140 150585 150301 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980242.1 protein_id gnl|my_center|LOCUS_06140 151001 150594 gene locus_tag LOCUS_06150 151001 150594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 151231 150998 gene locus_tag LOCUS_06160 151231 150998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 152678 151425 gene locus_tag LOCUS_06170 152678 151425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 153327 152680 gene locus_tag LOCUS_06180 gene soxL2 153327 152680 CDS product Rieske iron-sulfur protein SoxL2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979725.1 protein_id gnl|my_center|LOCUS_06180 153837 153373 gene locus_tag LOCUS_06190 153837 153373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 153871 154188 gene locus_tag LOCUS_06200 153871 154188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 154214 155659 gene locus_tag LOCUS_06210 gene guaB 154214 155659 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871141.1 protein_id gnl|my_center|LOCUS_06210 156319 155627 gene locus_tag LOCUS_06220 156319 155627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 156885 156319 gene locus_tag LOCUS_06230 156885 156319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 158062 156878 gene locus_tag LOCUS_06240 158062 156878 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980429.1 protein_id gnl|my_center|LOCUS_06240 159009 158122 gene locus_tag LOCUS_06250 gene map 159009 158122 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762710.1 protein_id gnl|my_center|LOCUS_06250 159053 159652 gene locus_tag LOCUS_06260 159053 159652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 159649 160014 gene locus_tag LOCUS_06270 159649 160014 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869688.1 protein_id gnl|my_center|LOCUS_06270 160029 160457 gene locus_tag LOCUS_06280 gene rplM 160029 160457 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867656.1 protein_id gnl|my_center|LOCUS_06280 160457 160864 gene locus_tag LOCUS_06290 160457 160864 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064334.1 protein_id gnl|my_center|LOCUS_06290 160867 161142 gene locus_tag LOCUS_06300 160867 161142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 161139 162374 gene locus_tag LOCUS_06310 161139 162374 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762845.1 protein_id gnl|my_center|LOCUS_06310 162401 163039 gene locus_tag LOCUS_06320 gene rpsB 162401 163039 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878629.1 protein_id gnl|my_center|LOCUS_06320 163338 163045 gene locus_tag LOCUS_06330 163338 163045 CDS product ATP cone domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761814.1 protein_id gnl|my_center|LOCUS_06330 163371 164222 gene locus_tag LOCUS_06340 gene amrB 163371 164222 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980136.1 protein_id gnl|my_center|LOCUS_06340 165192 164209 gene locus_tag LOCUS_06350 165192 164209 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867665.1 protein_id gnl|my_center|LOCUS_06350 165241 166017 gene locus_tag LOCUS_06360 165241 166017 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867666.1 protein_id gnl|my_center|LOCUS_06360 166046 167005 gene locus_tag LOCUS_06370 166046 167005 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146738.1 protein_id gnl|my_center|LOCUS_06370 167005 168780 gene locus_tag LOCUS_06380 167005 168780 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762126.1 protein_id gnl|my_center|LOCUS_06380 168834 169247 gene locus_tag LOCUS_06390 gene rpl7ae 168834 169247 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979469.1 protein_id gnl|my_center|LOCUS_06390 169247 169462 gene locus_tag LOCUS_06400 169247 169462 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978233.1 protein_id gnl|my_center|LOCUS_06400 169674 171425 gene locus_tag LOCUS_06410 gene infB 169674 171425 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978230.1 protein_id gnl|my_center|LOCUS_06410 171456 171797 gene locus_tag LOCUS_06420 171456 171797 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875899.1 protein_id gnl|my_center|LOCUS_06420 171829 173085 gene locus_tag LOCUS_06430 171829 173085 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867591.1 protein_id gnl|my_center|LOCUS_06430 173082 173453 gene locus_tag LOCUS_06440 173082 173453 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147239.1 protein_id gnl|my_center|LOCUS_06440 173556 174071 gene locus_tag LOCUS_06450 173556 174071 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978343.1 protein_id gnl|my_center|LOCUS_06450 174073 174282 gene locus_tag LOCUS_06460 174073 174282 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762672.1 protein_id gnl|my_center|LOCUS_06460 174263 174841 gene locus_tag LOCUS_06470 174263 174841 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023601.1 protein_id gnl|my_center|LOCUS_06470 174844 175209 gene locus_tag LOCUS_06480 174844 175209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 175370 176356 gene locus_tag LOCUS_06490 gene kae1 175370 176356 CDS product KEOPS complex N(6)-L-threonylcarbamoyladenine synthase Kae1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763615.1 protein_id gnl|my_center|LOCUS_06490 176341 176997 gene locus_tag LOCUS_06500 176341 176997 CDS product Kae1-associated kinase Bud32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978327.1 protein_id gnl|my_center|LOCUS_06500 177537 176968 gene locus_tag LOCUS_06510 177537 176968 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978328.1 protein_id gnl|my_center|LOCUS_06510 177571 178011 gene locus_tag LOCUS_06520 177571 178011 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978348.1 protein_id gnl|my_center|LOCUS_06520 178012 179349 gene locus_tag LOCUS_06530 gene recJ 178012 179349 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875803.1 protein_id gnl|my_center|LOCUS_06530 179346 179567 gene locus_tag LOCUS_06540 179346 179567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 >Feature sequence04 <1 1124 gene locus_tag LOCUS_06550 <1 1124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002263028.1:cysteine synthase A 1254 2012 gene locus_tag LOCUS_06560 1254 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 2043 2693 gene locus_tag LOCUS_06570 2043 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762167.1 protein_id gnl|my_center|LOCUS_06570 2671 3345 gene locus_tag LOCUS_06580 2671 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 5282 3339 gene locus_tag LOCUS_06590 5282 3339 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878618.1 protein_id gnl|my_center|LOCUS_06590 5912 5319 gene locus_tag LOCUS_06600 5912 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 6511 6047 gene locus_tag LOCUS_06610 6511 6047 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228850.1 protein_id gnl|my_center|LOCUS_06610 6717 7865 gene locus_tag LOCUS_06620 gene trm14 6717 7865 CDS product tRNA (guanine(6)-N2)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869937.1 protein_id gnl|my_center|LOCUS_06620 8397 7852 gene locus_tag LOCUS_06630 8397 7852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 8902 8432 gene locus_tag LOCUS_06640 8902 8432 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545669.1 protein_id gnl|my_center|LOCUS_06640 9521 8895 gene locus_tag LOCUS_06650 9521 8895 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379308.1 protein_id gnl|my_center|LOCUS_06650 9654 10955 gene locus_tag LOCUS_06660 9654 10955 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146581.1 protein_id gnl|my_center|LOCUS_06660 11825 10932 gene locus_tag LOCUS_06670 11825 10932 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868132.1 protein_id gnl|my_center|LOCUS_06670 11872 12180 gene locus_tag LOCUS_06680 11872 12180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 12210 13787 gene locus_tag LOCUS_06690 12210 13787 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932252.1 protein_id gnl|my_center|LOCUS_06690 15126 13825 gene locus_tag LOCUS_06700 15126 13825 CDS product hydroxyacid-oxoacid transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_06700 15330 16142 gene locus_tag LOCUS_06710 15330 16142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 17469 16453 gene locus_tag LOCUS_06720 17469 16453 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761771.1 protein_id gnl|my_center|LOCUS_06720 17968 17462 gene locus_tag LOCUS_06730 17968 17462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761769.1 protein_id gnl|my_center|LOCUS_06730 19104 17965 gene locus_tag LOCUS_06740 19104 17965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 19679 19140 gene locus_tag LOCUS_06750 gene msrA 19679 19140 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_06750 19848 20360 gene locus_tag LOCUS_06760 19848 20360 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979589.1 protein_id gnl|my_center|LOCUS_06760 20434 21267 gene locus_tag LOCUS_06770 gene ripC 20434 21267 CDS product itaconate degradation C-C-lyase RipC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212068.1 protein_id gnl|my_center|LOCUS_06770 23025 21496 gene locus_tag LOCUS_06780 gene gapN 23025 21496 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980562.1 protein_id gnl|my_center|LOCUS_06780 24181 23324 gene locus_tag LOCUS_06790 24181 23324 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846803.1 protein_id gnl|my_center|LOCUS_06790 24239 25294 gene locus_tag LOCUS_06800 24239 25294 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928792.1 protein_id gnl|my_center|LOCUS_06800 25876 25295 gene locus_tag LOCUS_06810 25876 25295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 27083 25860 gene locus_tag LOCUS_06820 gene coaBC 27083 25860 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867837.1 protein_id gnl|my_center|LOCUS_06820 27217 27600 gene locus_tag LOCUS_06830 27217 27600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 29028 27601 gene locus_tag LOCUS_06840 29028 27601 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980691.1 protein_id gnl|my_center|LOCUS_06840 29741 29073 gene locus_tag LOCUS_06850 gene alaXM 29741 29073 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846184.1 protein_id gnl|my_center|LOCUS_06850 30185 29787 gene locus_tag LOCUS_06860 30185 29787 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249520.1 protein_id gnl|my_center|LOCUS_06860 30416 30562 gene locus_tag LOCUS_06870 30416 30562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 30877 30587 gene locus_tag LOCUS_06880 30877 30587 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978750.1 protein_id gnl|my_center|LOCUS_06880 30943 31413 gene locus_tag LOCUS_06890 30943 31413 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939462.1 protein_id gnl|my_center|LOCUS_06890 31529 33157 gene locus_tag LOCUS_06900 gene ade 31529 33157 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876499.1 protein_id gnl|my_center|LOCUS_06900 33321 33488 gene locus_tag LOCUS_06910 33321 33488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 34315 34037 gene locus_tag LOCUS_06920 34315 34037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 36035 34944 gene locus_tag LOCUS_06930 36035 34944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 36199 36387 gene locus_tag LOCUS_06940 36199 36387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 37011 36559 gene locus_tag LOCUS_06950 37011 36559 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258287.1 protein_id gnl|my_center|LOCUS_06950 37254 38162 gene locus_tag LOCUS_06960 37254 38162 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728056.1 protein_id gnl|my_center|LOCUS_06960 39752 38163 gene locus_tag LOCUS_06970 39752 38163 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978016.1 protein_id gnl|my_center|LOCUS_06970 39794 40828 gene locus_tag LOCUS_06980 39794 40828 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980662.1 protein_id gnl|my_center|LOCUS_06980 42151 40829 gene locus_tag LOCUS_06990 42151 40829 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503612.1 protein_id gnl|my_center|LOCUS_06990 42223 43944 gene locus_tag LOCUS_07000 42223 43944 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979811.1 protein_id gnl|my_center|LOCUS_07000 44622 43954 gene locus_tag LOCUS_07010 44622 43954 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_07010 44974 44615 gene locus_tag LOCUS_07020 44974 44615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 45042 46040 gene locus_tag LOCUS_07030 45042 46040 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879275.1 protein_id gnl|my_center|LOCUS_07030 46040 47731 gene locus_tag LOCUS_07040 46040 47731 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879276.1 protein_id gnl|my_center|LOCUS_07040 47769 48596 gene locus_tag LOCUS_07050 47769 48596 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082270.1 protein_id gnl|my_center|LOCUS_07050 50680 48659 gene locus_tag LOCUS_07060 gene glgX 50680 48659 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978922.1 protein_id gnl|my_center|LOCUS_07060 52044 50995 gene locus_tag LOCUS_07070 52044 50995 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393776.1 protein_id gnl|my_center|LOCUS_07070 53125 52046 gene locus_tag LOCUS_07080 53125 52046 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537508.1 protein_id gnl|my_center|LOCUS_07080 53190 54842 gene locus_tag LOCUS_07090 53190 54842 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066780.1 protein_id gnl|my_center|LOCUS_07090 54845 55867 gene locus_tag LOCUS_07100 54845 55867 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810095.1 protein_id gnl|my_center|LOCUS_07100 55864 56748 gene locus_tag LOCUS_07110 55864 56748 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_07110 56748 57698 gene locus_tag LOCUS_07120 56748 57698 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_07120 57769 58488 gene locus_tag LOCUS_07130 57769 58488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 58513 59187 gene locus_tag LOCUS_07140 58513 59187 CDS product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391756.1 protein_id gnl|my_center|LOCUS_07140 59314 60417 gene locus_tag LOCUS_07150 59314 60417 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721245.1 protein_id gnl|my_center|LOCUS_07150 60414 61985 gene locus_tag LOCUS_07160 60414 61985 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454432.1 protein_id gnl|my_center|LOCUS_07160 62362 61994 gene locus_tag LOCUS_07170 62362 61994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 63714 62359 gene locus_tag LOCUS_07180 63714 62359 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729038.1 protein_id gnl|my_center|LOCUS_07180 64164 65633 gene locus_tag LOCUS_07190 64164 65633 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868191.1 protein_id gnl|my_center|LOCUS_07190 66897 65626 gene locus_tag LOCUS_07200 66897 65626 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980708.1 protein_id gnl|my_center|LOCUS_07200 67033 67845 gene locus_tag LOCUS_07210 67033 67845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 67820 68431 gene locus_tag LOCUS_07220 67820 68431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 69348 68428 gene locus_tag LOCUS_07230 69348 68428 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221267088.1 protein_id gnl|my_center|LOCUS_07230 69460 70698 gene locus_tag LOCUS_07240 69460 70698 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004069588.1 protein_id gnl|my_center|LOCUS_07240 71342 70695 gene locus_tag LOCUS_07250 71342 70695 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429825.1 protein_id gnl|my_center|LOCUS_07250 71472 72641 gene locus_tag LOCUS_07260 71472 72641 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870830.1 protein_id gnl|my_center|LOCUS_07260 72638 73018 gene locus_tag LOCUS_07270 72638 73018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 73050 73952 gene locus_tag LOCUS_07280 73050 73952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 74848 73943 gene locus_tag LOCUS_07290 74848 73943 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978683.1 protein_id gnl|my_center|LOCUS_07290 75293 74880 gene locus_tag LOCUS_07300 75293 74880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 76687 75428 gene locus_tag LOCUS_07310 gene glnA 76687 75428 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868727.1 protein_id gnl|my_center|LOCUS_07310 78362 76884 gene locus_tag LOCUS_07320 78362 76884 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015590753.1 protein_id gnl|my_center|LOCUS_07320 78532 79275 gene locus_tag LOCUS_07330 78532 79275 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978591.1 protein_id gnl|my_center|LOCUS_07330 79306 79500 gene locus_tag LOCUS_07340 79306 79500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 80675 79497 gene locus_tag LOCUS_07350 gene megL 80675 79497 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400106.1 protein_id gnl|my_center|LOCUS_07350 81048 80680 gene locus_tag LOCUS_07360 81048 80680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07360 81902 81111 gene locus_tag LOCUS_07370 81902 81111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07370 83782 82103 gene locus_tag LOCUS_07380 83782 82103 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979803.1 protein_id gnl|my_center|LOCUS_07380 83838 84662 gene locus_tag LOCUS_07390 83838 84662 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979166.1 protein_id gnl|my_center|LOCUS_07390 84829 85725 gene locus_tag LOCUS_07400 84829 85725 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_07400 85750 86172 gene locus_tag LOCUS_07410 85750 86172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 86612 86436 gene locus_tag LOCUS_07420 86612 86436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 87131 86910 gene locus_tag LOCUS_07430 87131 86910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 87124 87603 gene locus_tag LOCUS_07440 87124 87603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 87651 88175 gene locus_tag LOCUS_07450 87651 88175 CDS product DUF996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867948.1 protein_id gnl|my_center|LOCUS_07450 88208 89503 gene locus_tag LOCUS_07460 88208 89503 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980340.1 protein_id gnl|my_center|LOCUS_07460 89542 90066 gene locus_tag LOCUS_07470 89542 90066 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931087.1 protein_id gnl|my_center|LOCUS_07470 90105 91307 gene locus_tag LOCUS_07480 90105 91307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 92525 91296 gene locus_tag LOCUS_07490 92525 91296 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015323.1 protein_id gnl|my_center|LOCUS_07490 93340 92522 gene locus_tag LOCUS_07500 93340 92522 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958565.1 protein_id gnl|my_center|LOCUS_07500 94131 93364 gene locus_tag LOCUS_07510 94131 93364 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904312.1 protein_id gnl|my_center|LOCUS_07510 94309 94917 gene locus_tag LOCUS_07520 94309 94917 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978110.1 protein_id gnl|my_center|LOCUS_07520 94945 95547 gene locus_tag LOCUS_07530 94945 95547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 95576 96406 gene locus_tag LOCUS_07540 95576 96406 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064408.1 protein_id gnl|my_center|LOCUS_07540 96403 97143 gene locus_tag LOCUS_07550 96403 97143 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979631.1 protein_id gnl|my_center|LOCUS_07550 98939 97677 gene locus_tag LOCUS_07560 98939 97677 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250796.1 protein_id gnl|my_center|LOCUS_07560 99877 98939 gene locus_tag LOCUS_07570 99877 98939 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 protein_id gnl|my_center|LOCUS_07570 100329 99871 gene locus_tag LOCUS_07580 100329 99871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 100630 100322 gene locus_tag LOCUS_07590 100630 100322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 102225 101017 gene locus_tag LOCUS_07600 102225 101017 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978015.1 protein_id gnl|my_center|LOCUS_07600 103426 102290 gene locus_tag LOCUS_07610 103426 102290 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546236.1 protein_id gnl|my_center|LOCUS_07610 103464 104822 gene locus_tag LOCUS_07620 103464 104822 CDS product RuvB-like helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763420.1 protein_id gnl|my_center|LOCUS_07620 104860 106317 gene locus_tag LOCUS_07630 gene hutH 104860 106317 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017128.1 protein_id gnl|my_center|LOCUS_07630 107244 106291 gene locus_tag LOCUS_07640 107244 106291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 107681 107307 gene locus_tag LOCUS_07650 107681 107307 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846979.1 protein_id gnl|my_center|LOCUS_07650 109590 107683 gene locus_tag LOCUS_07660 gene gatE 109590 107683 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979281.1 protein_id gnl|my_center|LOCUS_07660 110772 109606 gene locus_tag LOCUS_07670 110772 109606 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979578.1 protein_id gnl|my_center|LOCUS_07670 110822 111706 gene locus_tag LOCUS_07680 gene hpaI 110822 111706 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144460629.1 protein_id gnl|my_center|LOCUS_07680 111703 112443 gene locus_tag LOCUS_07690 111703 112443 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228327.1 protein_id gnl|my_center|LOCUS_07690 112468 112983 gene locus_tag LOCUS_07700 112468 112983 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886218.1 protein_id gnl|my_center|LOCUS_07700 113966 112980 gene locus_tag LOCUS_07710 gene hpaD 113966 112980 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528545.1 protein_id gnl|my_center|LOCUS_07710 115417 113963 gene locus_tag LOCUS_07720 gene hpaB 115417 113963 CDS product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228328.1 protein_id gnl|my_center|LOCUS_07720 116905 115418 gene locus_tag LOCUS_07730 gene hpaE 116905 115418 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889479.1 protein_id gnl|my_center|LOCUS_07730 116955 118094 gene locus_tag LOCUS_07740 116955 118094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 118932 118081 gene locus_tag LOCUS_07750 118932 118081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 119671 118964 gene locus_tag LOCUS_07760 119671 118964 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546217.1 protein_id gnl|my_center|LOCUS_07760 120434 119664 gene locus_tag LOCUS_07770 120434 119664 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095657.1 protein_id gnl|my_center|LOCUS_07770 121101 120484 gene locus_tag LOCUS_07780 121101 120484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980231.1 protein_id gnl|my_center|LOCUS_07780 121196 121696 gene locus_tag LOCUS_07790 121196 121696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 124402 121715 gene locus_tag LOCUS_07800 124402 121715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 125991 124525 gene locus_tag LOCUS_07810 125991 124525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 126892 125984 gene locus_tag LOCUS_07820 126892 125984 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846625.1 protein_id gnl|my_center|LOCUS_07820 127506 126928 gene locus_tag LOCUS_07830 127506 126928 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072194.1 protein_id gnl|my_center|LOCUS_07830 128702 127551 gene locus_tag LOCUS_07840 128702 127551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 129346 128702 gene locus_tag LOCUS_07850 129346 128702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 <130046 129343 gene locus_tag LOCUS_07860 <130046 129343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978478.1:VWA domain-containing protein >Feature sequence05 148 1203 gene locus_tag LOCUS_07870 gene aroB 148 1203 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980356.1 protein_id gnl|my_center|LOCUS_07870 1200 1970 gene locus_tag LOCUS_07880 1200 1970 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980357.1 protein_id gnl|my_center|LOCUS_07880 1957 3129 gene locus_tag LOCUS_07890 gene aroC 1957 3129 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980358.1 protein_id gnl|my_center|LOCUS_07890 3081 3884 gene locus_tag LOCUS_07900 3081 3884 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980360.1 protein_id gnl|my_center|LOCUS_07900 3881 5125 gene locus_tag LOCUS_07910 gene aroA 3881 5125 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980361.1 protein_id gnl|my_center|LOCUS_07910 5115 5741 gene locus_tag LOCUS_07920 5115 5741 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980362.1 protein_id gnl|my_center|LOCUS_07920 5762 6976 gene locus_tag LOCUS_07930 5762 6976 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108464.1 protein_id gnl|my_center|LOCUS_07930 7035 8582 gene locus_tag LOCUS_07940 7035 8582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 8781 9722 gene locus_tag LOCUS_07950 8781 9722 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978014.1 protein_id gnl|my_center|LOCUS_07950 10180 9935 gene locus_tag LOCUS_07960 10180 9935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 10408 11769 gene locus_tag LOCUS_07970 10408 11769 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061441.1 protein_id gnl|my_center|LOCUS_07970 11920 12780 gene locus_tag LOCUS_07980 11920 12780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761944.1 protein_id gnl|my_center|LOCUS_07980 13538 12909 gene locus_tag LOCUS_07990 13538 12909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 15135 13723 gene locus_tag LOCUS_08000 gene merA 15135 13723 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846936.1 protein_id gnl|my_center|LOCUS_08000 15190 15582 gene locus_tag LOCUS_08010 15190 15582 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021357.1 protein_id gnl|my_center|LOCUS_08010 16578 15781 gene locus_tag LOCUS_08020 16578 15781 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084304.1 protein_id gnl|my_center|LOCUS_08020 17672 16575 gene locus_tag LOCUS_08030 17672 16575 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171355.1 protein_id gnl|my_center|LOCUS_08030 17859 18731 gene locus_tag LOCUS_08040 17859 18731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08040 19092 18784 gene locus_tag LOCUS_08050 19092 18784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 19248 20654 gene locus_tag LOCUS_08060 gene bgaS 19248 20654 CDS product beta-galactosidase BgaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868057.1 protein_id gnl|my_center|LOCUS_08060 21760 20633 gene locus_tag LOCUS_08070 21760 20633 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879898.1 protein_id gnl|my_center|LOCUS_08070 22693 21785 gene locus_tag LOCUS_08080 22693 21785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 23474 22872 gene locus_tag LOCUS_08090 23474 22872 CDS product protoglobin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256689.1 protein_id gnl|my_center|LOCUS_08090 23572 24597 gene locus_tag LOCUS_08100 23572 24597 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_08100 25465 24587 gene locus_tag LOCUS_08110 25465 24587 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463396.1 protein_id gnl|my_center|LOCUS_08110 26252 25518 gene locus_tag LOCUS_08120 26252 25518 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156015265.1 protein_id gnl|my_center|LOCUS_08120 27106 26345 gene locus_tag LOCUS_08130 27106 26345 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184651002.1 protein_id gnl|my_center|LOCUS_08130 28472 27147 gene locus_tag LOCUS_08140 28472 27147 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099715.1 protein_id gnl|my_center|LOCUS_08140 29460 28474 gene locus_tag LOCUS_08150 29460 28474 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978088.1 protein_id gnl|my_center|LOCUS_08150 29669 30766 gene locus_tag LOCUS_08160 29669 30766 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763559.1 protein_id gnl|my_center|LOCUS_08160 32522 30774 gene locus_tag LOCUS_08170 32522 30774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980450.1 protein_id gnl|my_center|LOCUS_08170 33427 32648 gene locus_tag LOCUS_08180 33427 32648 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930746.1 protein_id gnl|my_center|LOCUS_08180 34341 33604 gene locus_tag LOCUS_08190 34341 33604 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080870.1 protein_id gnl|my_center|LOCUS_08190 35394 34351 gene locus_tag LOCUS_08200 35394 34351 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761793.1 protein_id gnl|my_center|LOCUS_08200 35548 36894 gene locus_tag LOCUS_08210 35548 36894 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980446.1 protein_id gnl|my_center|LOCUS_08210 36947 37288 gene locus_tag LOCUS_08220 36947 37288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 37285 39504 gene locus_tag LOCUS_08230 37285 39504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 39534 39893 gene locus_tag LOCUS_08240 39534 39893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 39877 40812 gene locus_tag LOCUS_08250 39877 40812 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761777.1 protein_id gnl|my_center|LOCUS_08250 41967 40801 gene locus_tag LOCUS_08260 41967 40801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 43221 42058 gene locus_tag LOCUS_08270 43221 42058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 44668 43208 gene locus_tag LOCUS_08280 44668 43208 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240545.1 protein_id gnl|my_center|LOCUS_08280 46190 45192 gene locus_tag LOCUS_08290 46190 45192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08290 46975 46190 gene locus_tag LOCUS_08300 gene dapF 46975 46190 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546632.1 protein_id gnl|my_center|LOCUS_08300 48147 46972 gene locus_tag LOCUS_08310 48147 46972 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546563.1 protein_id gnl|my_center|LOCUS_08310 49229 48144 gene locus_tag LOCUS_08320 gene asd 49229 48144 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496420.1 protein_id gnl|my_center|LOCUS_08320 50502 49183 gene locus_tag LOCUS_08330 50502 49183 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870075.1 protein_id gnl|my_center|LOCUS_08330 51242 50499 gene locus_tag LOCUS_08340 gene dapB 51242 50499 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838584.1 protein_id gnl|my_center|LOCUS_08340 52078 51239 gene locus_tag LOCUS_08350 gene dapA 52078 51239 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869742.1 protein_id gnl|my_center|LOCUS_08350 52378 53004 gene locus_tag LOCUS_08360 52378 53004 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979649.1 protein_id gnl|my_center|LOCUS_08360 53043 53459 gene locus_tag LOCUS_08370 53043 53459 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979839.1 protein_id gnl|my_center|LOCUS_08370 53461 54465 gene locus_tag LOCUS_08380 53461 54465 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979838.1 protein_id gnl|my_center|LOCUS_08380 54514 55353 gene locus_tag LOCUS_08390 54514 55353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013597.1 protein_id gnl|my_center|LOCUS_08390 55408 57006 gene locus_tag LOCUS_08400 55408 57006 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979926.1 protein_id gnl|my_center|LOCUS_08400 57956 57003 gene locus_tag LOCUS_08410 57956 57003 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978653.1 protein_id gnl|my_center|LOCUS_08410 58052 59008 gene locus_tag LOCUS_08420 58052 59008 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979837.1 protein_id gnl|my_center|LOCUS_08420 60001 59009 gene locus_tag LOCUS_08430 60001 59009 CDS product DUF1152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218267286.1 protein_id gnl|my_center|LOCUS_08430 60766 60008 gene locus_tag LOCUS_08440 60766 60008 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846768.1 protein_id gnl|my_center|LOCUS_08440 61182 60778 gene locus_tag LOCUS_08450 61182 60778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 61371 61901 gene locus_tag LOCUS_08460 61371 61901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 62179 63039 gene locus_tag LOCUS_08470 62179 63039 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980461.1 protein_id gnl|my_center|LOCUS_08470 63029 63394 gene locus_tag LOCUS_08480 63029 63394 CDS product DUF1634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980460.1 protein_id gnl|my_center|LOCUS_08480 63441 65243 gene locus_tag LOCUS_08490 63441 65243 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980092.1 protein_id gnl|my_center|LOCUS_08490 66321 65248 gene locus_tag LOCUS_08500 66321 65248 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979764.1 protein_id gnl|my_center|LOCUS_08500 66403 67587 gene locus_tag LOCUS_08510 66403 67587 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980451.1 protein_id gnl|my_center|LOCUS_08510 67589 68461 gene locus_tag LOCUS_08520 67589 68461 CDS product bifunctional 2-dehydro-3-deoxy-phosphogluconate/2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846807.1 protein_id gnl|my_center|LOCUS_08520 68458 69384 gene locus_tag LOCUS_08530 gene kdgK 68458 69384 CDS product bifunctional 2-dehydro-3-deoxygluconokinase/2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980563.1 protein_id gnl|my_center|LOCUS_08530 69924 69385 gene locus_tag LOCUS_08540 69924 69385 CDS product DUF2258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846425.1 protein_id gnl|my_center|LOCUS_08540 69964 70671 gene locus_tag LOCUS_08550 69964 70671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156006377.1 protein_id gnl|my_center|LOCUS_08550 70739 72082 gene locus_tag LOCUS_08560 70739 72082 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978631.1 protein_id gnl|my_center|LOCUS_08560 73968 72193 gene locus_tag LOCUS_08570 gene treH2 73968 72193 CDS product alpha,alpha-trehalase TreH2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184651037.1 protein_id gnl|my_center|LOCUS_08570 75098 74028 gene locus_tag LOCUS_08580 75098 74028 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250726.1 protein_id gnl|my_center|LOCUS_08580 75938 75102 gene locus_tag LOCUS_08590 75938 75102 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 protein_id gnl|my_center|LOCUS_08590 76725 75931 gene locus_tag LOCUS_08600 76725 75931 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257890.1 protein_id gnl|my_center|LOCUS_08600 78216 76906 gene locus_tag LOCUS_08610 78216 76906 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257891.1 protein_id gnl|my_center|LOCUS_08610 78287 79300 gene locus_tag LOCUS_08620 78287 79300 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080903.1 protein_id gnl|my_center|LOCUS_08620 80328 79297 gene locus_tag LOCUS_08630 80328 79297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 82498 80351 gene locus_tag LOCUS_08640 82498 80351 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886611.1 protein_id gnl|my_center|LOCUS_08640 83163 82495 gene locus_tag LOCUS_08650 83163 82495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 83448 83203 gene locus_tag LOCUS_08660 83448 83203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 85299 83725 gene locus_tag LOCUS_08670 85299 83725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 86535 85858 gene locus_tag LOCUS_08680 86535 85858 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870115.1 protein_id gnl|my_center|LOCUS_08680 86588 87763 gene locus_tag LOCUS_08690 86588 87763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 87760 89940 gene locus_tag LOCUS_08700 87760 89940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 89937 92741 gene locus_tag LOCUS_08710 89937 92741 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762372.1 protein_id gnl|my_center|LOCUS_08710 92820 93026 gene locus_tag LOCUS_08720 92820 93026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 93389 93048 gene locus_tag LOCUS_08730 93389 93048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 94610 93426 gene locus_tag LOCUS_08740 94610 93426 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680038.1 protein_id gnl|my_center|LOCUS_08740 94660 95691 gene locus_tag LOCUS_08750 gene tdh 94660 95691 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244880.1 protein_id gnl|my_center|LOCUS_08750 96060 95692 gene locus_tag LOCUS_08760 96060 95692 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762119.1 protein_id gnl|my_center|LOCUS_08760 96129 96836 gene locus_tag LOCUS_08770 gene sfsA 96129 96836 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249730.1 protein_id gnl|my_center|LOCUS_08770 97964 96831 gene locus_tag LOCUS_08780 97964 96831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 98039 98449 gene locus_tag LOCUS_08790 98039 98449 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980316.1 protein_id gnl|my_center|LOCUS_08790 98470 99516 gene locus_tag LOCUS_08800 98470 99516 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774414.1 protein_id gnl|my_center|LOCUS_08800 99538 101025 gene locus_tag LOCUS_08810 gene cysS 99538 101025 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546384.1 protein_id gnl|my_center|LOCUS_08810 101043 101765 gene locus_tag LOCUS_08820 101043 101765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 101750 102319 gene locus_tag LOCUS_08830 101750 102319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 103850 102321 gene locus_tag LOCUS_08840 103850 102321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 104098 104976 gene locus_tag LOCUS_08850 104098 104976 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392337.1 protein_id gnl|my_center|LOCUS_08850 106299 104977 gene locus_tag LOCUS_08860 106299 104977 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065661.1 protein_id gnl|my_center|LOCUS_08860 107684 106296 gene locus_tag LOCUS_08870 107684 106296 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876489.1 protein_id gnl|my_center|LOCUS_08870 109004 107691 gene locus_tag LOCUS_08880 gene hemL 109004 107691 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545461.1 protein_id gnl|my_center|LOCUS_08880 109041 109472 gene locus_tag LOCUS_08890 109041 109472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 109570 110664 gene locus_tag LOCUS_08900 109570 110664 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023499.1 protein_id gnl|my_center|LOCUS_08900 110933 111802 gene locus_tag LOCUS_08910 110933 111802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 113511 111799 gene locus_tag LOCUS_08920 113511 111799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 113525 114205 gene locus_tag LOCUS_08930 113525 114205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 114715 114200 gene locus_tag LOCUS_08940 114715 114200 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846254.1 protein_id gnl|my_center|LOCUS_08940 115392 114748 gene locus_tag LOCUS_08950 115392 114748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 116353 115394 gene locus_tag LOCUS_08960 116353 115394 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978312.1 protein_id gnl|my_center|LOCUS_08960 116482 117258 gene locus_tag LOCUS_08970 116482 117258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 117275 117348 gene locus_tag LOCUS_t00230 117275 117348 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence06 <1 572 gene locus_tag LOCUS_08980 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978426.1:30S ribosomal protein S3ae 1692 565 gene locus_tag LOCUS_08990 1692 565 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061074.1 protein_id gnl|my_center|LOCUS_08990 1583 2497 gene locus_tag LOCUS_09000 1583 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 2547 9416 gene locus_tag LOCUS_09010 2547 9416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 9448 10389 gene locus_tag LOCUS_09020 9448 10389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 10403 10849 gene locus_tag LOCUS_09030 10403 10849 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867981.1 protein_id gnl|my_center|LOCUS_09030 10851 11267 gene locus_tag LOCUS_09040 10851 11267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 11438 12460 gene locus_tag LOCUS_09050 11438 12460 CDS product TIGR01177 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876363.1 protein_id gnl|my_center|LOCUS_09050 12426 13325 gene locus_tag LOCUS_09060 gene rnz 12426 13325 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_09060 13731 13288 gene locus_tag LOCUS_09070 13731 13288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 14242 13724 gene locus_tag LOCUS_09080 14242 13724 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870916.1 protein_id gnl|my_center|LOCUS_09080 14281 14826 gene locus_tag LOCUS_09090 gene thpR 14281 14826 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762325.1 protein_id gnl|my_center|LOCUS_09090 14823 16178 gene locus_tag LOCUS_09100 gene cca 14823 16178 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762324.1 protein_id gnl|my_center|LOCUS_09100 16168 16872 gene locus_tag LOCUS_09110 16168 16872 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867963.1 protein_id gnl|my_center|LOCUS_09110 17638 16874 gene locus_tag LOCUS_09120 gene tatC 17638 16874 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760986.1 protein_id gnl|my_center|LOCUS_09120 17677 18000 gene locus_tag LOCUS_09130 17677 18000 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240464.1 protein_id gnl|my_center|LOCUS_09130 18409 17993 gene locus_tag LOCUS_09140 18409 17993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 18476 19834 gene locus_tag LOCUS_09150 gene purB 18476 19834 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868368.1 protein_id gnl|my_center|LOCUS_09150 20345 19815 gene locus_tag LOCUS_09160 20345 19815 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970048.1 protein_id gnl|my_center|LOCUS_09160 20381 20722 gene locus_tag LOCUS_09170 20381 20722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 21851 20691 gene locus_tag LOCUS_09180 21851 20691 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251201.1 protein_id gnl|my_center|LOCUS_09180 23622 21910 gene locus_tag LOCUS_09190 23622 21910 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057930.1 protein_id gnl|my_center|LOCUS_09190 24268 23615 gene locus_tag LOCUS_09200 24268 23615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 25380 24265 gene locus_tag LOCUS_09210 25380 24265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 25946 25407 gene locus_tag LOCUS_09220 25946 25407 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871083.1 protein_id gnl|my_center|LOCUS_09220 27079 25943 gene locus_tag LOCUS_09230 27079 25943 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978108.1 protein_id gnl|my_center|LOCUS_09230 27895 27095 gene locus_tag LOCUS_09240 27895 27095 CDS product inorganic polyphosphate/ATP-NAD kinase (Poly(P)/ATP NAD kinase) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546481.1 protein_id gnl|my_center|LOCUS_09240 28008 27934 gene locus_tag LOCUS_t00240 28008 27934 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 28064 29098 gene locus_tag LOCUS_09250 28064 29098 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979575.1 protein_id gnl|my_center|LOCUS_09250 29115 30050 gene locus_tag LOCUS_09260 29115 30050 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056897.1 protein_id gnl|my_center|LOCUS_09260 30160 32031 gene locus_tag LOCUS_09270 30160 32031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 32250 33296 gene locus_tag LOCUS_09280 32250 33296 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064241.1 protein_id gnl|my_center|LOCUS_09280 33314 34285 gene locus_tag LOCUS_09290 33314 34285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 34282 35247 gene locus_tag LOCUS_09300 34282 35247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868097.1 protein_id gnl|my_center|LOCUS_09300 35322 35248 gene locus_tag LOCUS_t00250 35322 35248 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 35394 35717 gene locus_tag LOCUS_09310 35394 35717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 35714 37024 gene locus_tag LOCUS_09320 35714 37024 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250437.1 protein_id gnl|my_center|LOCUS_09320 37008 38258 gene locus_tag LOCUS_09330 37008 38258 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021461.1 protein_id gnl|my_center|LOCUS_09330 38457 38212 gene locus_tag LOCUS_09340 38457 38212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 38593 38907 gene locus_tag LOCUS_09350 38593 38907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 38914 39543 gene locus_tag LOCUS_09360 38914 39543 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876938.1 protein_id gnl|my_center|LOCUS_09360 39936 39547 gene locus_tag LOCUS_09370 39936 39547 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762335.1 protein_id gnl|my_center|LOCUS_09370 39999 40802 gene locus_tag LOCUS_09380 39999 40802 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876505.1 protein_id gnl|my_center|LOCUS_09380 40795 41280 gene locus_tag LOCUS_09390 40795 41280 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249292.1 protein_id gnl|my_center|LOCUS_09390 41249 42397 gene locus_tag LOCUS_09400 41249 42397 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868893.1 protein_id gnl|my_center|LOCUS_09400 42433 44142 gene locus_tag LOCUS_09410 42433 44142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 44164 45105 gene locus_tag LOCUS_09420 44164 45105 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861326.1 protein_id gnl|my_center|LOCUS_09420 45098 45379 gene locus_tag LOCUS_09430 45098 45379 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763032.1 protein_id gnl|my_center|LOCUS_09430 45414 45872 gene locus_tag LOCUS_09440 45414 45872 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868831.1 protein_id gnl|my_center|LOCUS_09440 45826 46521 gene locus_tag LOCUS_09450 gene queC 45826 46521 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779268.1 protein_id gnl|my_center|LOCUS_09450 46551 47267 gene locus_tag LOCUS_09460 gene folE2 46551 47267 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582988.1 protein_id gnl|my_center|LOCUS_09460 47303 47387 gene locus_tag LOCUS_t00260 47303 47387 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 47607 47683 gene locus_tag LOCUS_t00270 47607 47683 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 47721 48083 gene locus_tag LOCUS_09470 47721 48083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 48166 49194 gene locus_tag LOCUS_09480 48166 49194 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880876.1 protein_id gnl|my_center|LOCUS_09480 49194 49679 gene locus_tag LOCUS_09490 49194 49679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 49705 50898 gene locus_tag LOCUS_09500 49705 50898 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429732.1 protein_id gnl|my_center|LOCUS_09500 50885 51160 gene locus_tag LOCUS_09510 50885 51160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 51200 52168 gene locus_tag LOCUS_09520 51200 52168 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978451.1 protein_id gnl|my_center|LOCUS_09520 52165 53430 gene locus_tag LOCUS_09530 52165 53430 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846342.1 protein_id gnl|my_center|LOCUS_09530 54438 53416 gene locus_tag LOCUS_09540 54438 53416 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146584.1 protein_id gnl|my_center|LOCUS_09540 54476 55015 gene locus_tag LOCUS_09550 54476 55015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 55018 57054 gene locus_tag LOCUS_09560 55018 57054 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846340.1 protein_id gnl|my_center|LOCUS_09560 57056 59173 gene locus_tag LOCUS_09570 57056 59173 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 protein_id gnl|my_center|LOCUS_09570 59199 60365 gene locus_tag LOCUS_09580 59199 60365 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865373.1 protein_id gnl|my_center|LOCUS_09580 60362 62791 gene locus_tag LOCUS_09590 gene rad50 60362 62791 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846723.1 protein_id gnl|my_center|LOCUS_09590 62828 64273 gene locus_tag LOCUS_09600 62828 64273 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429773.1 protein_id gnl|my_center|LOCUS_09600 65960 64260 gene locus_tag LOCUS_09610 65960 64260 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763167.1 protein_id gnl|my_center|LOCUS_09610 66458 65982 gene locus_tag LOCUS_09620 66458 65982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 66352 66564 gene locus_tag LOCUS_09630 66352 66564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 66497 67864 gene locus_tag LOCUS_09640 66497 67864 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979669.1 protein_id gnl|my_center|LOCUS_09640 67864 69090 gene locus_tag LOCUS_09650 67864 69090 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979670.1 protein_id gnl|my_center|LOCUS_09650 70021 69083 gene locus_tag LOCUS_09660 70021 69083 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762507.1 protein_id gnl|my_center|LOCUS_09660 70818 70018 gene locus_tag LOCUS_09670 70818 70018 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762508.1 protein_id gnl|my_center|LOCUS_09670 70894 72075 gene locus_tag LOCUS_09680 70894 72075 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763169.1 protein_id gnl|my_center|LOCUS_09680 72072 72611 gene locus_tag LOCUS_09690 72072 72611 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978019.1 protein_id gnl|my_center|LOCUS_09690 73366 72608 gene locus_tag LOCUS_09700 73366 72608 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979296.1 protein_id gnl|my_center|LOCUS_09700 73470 73868 gene locus_tag LOCUS_09710 73470 73868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 76515 73861 gene locus_tag LOCUS_09720 76515 73861 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146858.1 protein_id gnl|my_center|LOCUS_09720 76633 78051 gene locus_tag LOCUS_09730 76633 78051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 78835 78023 gene locus_tag LOCUS_09740 78835 78023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 79234 78839 gene locus_tag LOCUS_09750 79234 78839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 80166 79252 gene locus_tag LOCUS_09760 80166 79252 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496430.1 protein_id gnl|my_center|LOCUS_09760 80273 82804 gene locus_tag LOCUS_09770 80273 82804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 82801 83502 gene locus_tag LOCUS_09780 82801 83502 CDS product ribonucleotide reductase system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704811.1 protein_id gnl|my_center|LOCUS_09780 83525 84658 gene locus_tag LOCUS_09790 83525 84658 CDS product TGS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978498.1 protein_id gnl|my_center|LOCUS_09790 84655 85491 gene locus_tag LOCUS_09800 84655 85491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 85509 85997 gene locus_tag LOCUS_09810 85509 85997 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_09810 85994 86278 gene locus_tag LOCUS_09820 85994 86278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 86265 86681 gene locus_tag LOCUS_09830 86265 86681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 87006 86674 gene locus_tag LOCUS_09840 gene trxA 87006 86674 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878779.1 protein_id gnl|my_center|LOCUS_09840 87040 87426 gene locus_tag LOCUS_09850 87040 87426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 87645 87415 gene locus_tag LOCUS_09860 87645 87415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 87807 88370 gene locus_tag LOCUS_09870 87807 88370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868040.1 protein_id gnl|my_center|LOCUS_09870 88339 89166 gene locus_tag LOCUS_09880 88339 89166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 90563 89163 gene locus_tag LOCUS_09890 90563 89163 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909061.1 protein_id gnl|my_center|LOCUS_09890 90890 92281 gene locus_tag LOCUS_09900 90890 92281 CDS product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846143.1 protein_id gnl|my_center|LOCUS_09900 92840 92316 gene locus_tag LOCUS_09910 92840 92316 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024397.1 protein_id gnl|my_center|LOCUS_09910 93713 92871 gene locus_tag LOCUS_09920 93713 92871 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763172.1 protein_id gnl|my_center|LOCUS_09920 94227 95957 gene locus_tag LOCUS_09930 94227 95957 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980101.1 protein_id gnl|my_center|LOCUS_09930 96082 96729 gene locus_tag LOCUS_09940 96082 96729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 96753 98306 gene locus_tag LOCUS_09950 96753 98306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 98841 98488 gene locus_tag LOCUS_09960 98841 98488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 101342 98844 gene locus_tag LOCUS_09970 101342 98844 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_09970 101351 101557 gene locus_tag LOCUS_09980 101351 101557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 103751 101574 gene locus_tag LOCUS_09990 103751 101574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 104432 103773 gene locus_tag LOCUS_10000 104432 103773 CDS product DUF1122 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980155.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence07 1270 530 gene locus_tag LOCUS_10010 1270 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10010 1692 1240 gene locus_tag LOCUS_10020 1692 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10020 1819 2343 gene locus_tag LOCUS_10030 1819 2343 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878254.1 protein_id gnl|my_center|LOCUS_10030 3231 2335 gene locus_tag LOCUS_10040 3231 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 3299 4495 gene locus_tag LOCUS_10050 3299 4495 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888344.1 protein_id gnl|my_center|LOCUS_10050 4724 5542 gene locus_tag LOCUS_10060 4724 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 5709 7151 gene locus_tag LOCUS_10070 5709 7151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 7366 7842 gene locus_tag LOCUS_10080 7366 7842 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023392.1 protein_id gnl|my_center|LOCUS_10080 8642 7824 gene locus_tag LOCUS_10090 8642 7824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 9661 8639 gene locus_tag LOCUS_10100 9661 8639 CDS product acryloyl-coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978456.1 protein_id gnl|my_center|LOCUS_10100 10597 9695 gene locus_tag LOCUS_10110 gene hemH 10597 9695 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727378.1 protein_id gnl|my_center|LOCUS_10110 11625 10594 gene locus_tag LOCUS_10120 11625 10594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 12914 11622 gene locus_tag LOCUS_10130 gene hemL 12914 11622 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880497.1 protein_id gnl|my_center|LOCUS_10130 13891 12911 gene locus_tag LOCUS_10140 gene hemB 13891 12911 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_10140 14606 13884 gene locus_tag LOCUS_10150 14606 13884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 15495 14599 gene locus_tag LOCUS_10160 gene hemC 15495 14599 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861963.1 protein_id gnl|my_center|LOCUS_10160 16123 15485 gene locus_tag LOCUS_10170 16123 15485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 18345 16810 gene locus_tag LOCUS_10180 18345 16810 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868194.1 protein_id gnl|my_center|LOCUS_10180 19445 18414 gene locus_tag LOCUS_10190 19445 18414 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978803.1 protein_id gnl|my_center|LOCUS_10190 19956 19480 gene locus_tag LOCUS_10200 gene purE 19956 19480 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978802.1 protein_id gnl|my_center|LOCUS_10200 20010 21305 gene locus_tag LOCUS_10210 20010 21305 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006789594.1 protein_id gnl|my_center|LOCUS_10210 21346 22143 gene locus_tag LOCUS_10220 21346 22143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 22231 23244 gene locus_tag LOCUS_10230 22231 23244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 25780 23234 gene locus_tag LOCUS_10240 gene acnA 25780 23234 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846424.1 protein_id gnl|my_center|LOCUS_10240 26150 25782 gene locus_tag LOCUS_10250 26150 25782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 27168 26362 gene locus_tag LOCUS_10260 27168 26362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 27937 27158 gene locus_tag LOCUS_10270 27937 27158 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250978.1 protein_id gnl|my_center|LOCUS_10270 28884 27934 gene locus_tag LOCUS_10280 28884 27934 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762654.1 protein_id gnl|my_center|LOCUS_10280 30145 28886 gene locus_tag LOCUS_10290 30145 28886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 30683 30138 gene locus_tag LOCUS_10300 30683 30138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 31283 30759 gene locus_tag LOCUS_10310 31283 30759 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939694.1 protein_id gnl|my_center|LOCUS_10310 32575 31310 gene locus_tag LOCUS_10320 32575 31310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 33480 32572 gene locus_tag LOCUS_10330 33480 32572 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865109.1 protein_id gnl|my_center|LOCUS_10330 33535 34149 gene locus_tag LOCUS_10340 33535 34149 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762237.1 protein_id gnl|my_center|LOCUS_10340 34421 35815 gene locus_tag LOCUS_10350 34421 35815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 36734 35817 gene locus_tag LOCUS_10360 36734 35817 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156014454.1 protein_id gnl|my_center|LOCUS_10360 37891 36767 gene locus_tag LOCUS_10370 37891 36767 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496748.1 protein_id gnl|my_center|LOCUS_10370 39071 40420 gene locus_tag LOCUS_10380 gene pyk 39071 40420 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979673.1 protein_id gnl|my_center|LOCUS_10380 41214 40417 gene locus_tag LOCUS_10390 41214 40417 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986927.1 protein_id gnl|my_center|LOCUS_10390 42373 41204 gene locus_tag LOCUS_10400 42373 41204 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761791.1 protein_id gnl|my_center|LOCUS_10400 43211 42675 gene locus_tag LOCUS_10410 43211 42675 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943415.1 protein_id gnl|my_center|LOCUS_10410 43406 43636 gene locus_tag LOCUS_10420 43406 43636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 43590 45308 gene locus_tag LOCUS_10430 43590 45308 CDS product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979739.1 protein_id gnl|my_center|LOCUS_10430 45298 45885 gene locus_tag LOCUS_10440 45298 45885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979738.1 protein_id gnl|my_center|LOCUS_10440 45969 47231 gene locus_tag LOCUS_10450 45969 47231 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890051.1 protein_id gnl|my_center|LOCUS_10450 47328 48527 gene locus_tag LOCUS_10460 47328 48527 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_10460 49515 48658 gene locus_tag LOCUS_10470 49515 48658 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788767.1 protein_id gnl|my_center|LOCUS_10470 51373 49607 gene locus_tag LOCUS_10480 51373 49607 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878782.1 protein_id gnl|my_center|LOCUS_10480 51468 52346 gene locus_tag LOCUS_10490 51468 52346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 52348 53502 gene locus_tag LOCUS_10500 52348 53502 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980491.1 protein_id gnl|my_center|LOCUS_10500 54145 53471 gene locus_tag LOCUS_10510 54145 53471 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583126.1 protein_id gnl|my_center|LOCUS_10510 55122 54178 gene locus_tag LOCUS_10520 gene menA 55122 54178 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081897.1 protein_id gnl|my_center|LOCUS_10520 56872 55220 gene locus_tag LOCUS_10530 56872 55220 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258288.1 protein_id gnl|my_center|LOCUS_10530 57387 56869 gene locus_tag LOCUS_10540 57387 56869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 57755 58750 gene locus_tag LOCUS_10550 57755 58750 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867784.1 protein_id gnl|my_center|LOCUS_10550 58747 59514 gene locus_tag LOCUS_10560 58747 59514 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224893.1 protein_id gnl|my_center|LOCUS_10560 59555 60508 gene locus_tag LOCUS_10570 59555 60508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 60562 61839 gene locus_tag LOCUS_10580 60562 61839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 62596 61964 gene locus_tag LOCUS_10590 62596 61964 CDS product TenA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763697.1 protein_id gnl|my_center|LOCUS_10590 63030 63998 gene locus_tag LOCUS_10600 63030 63998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 63999 65339 gene locus_tag LOCUS_10610 63999 65339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 66587 65541 gene locus_tag LOCUS_10620 66587 65541 CDS product N-acetyl-lysine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978128.1 protein_id gnl|my_center|LOCUS_10620 67728 66574 gene locus_tag LOCUS_10630 67728 66574 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965684.1 protein_id gnl|my_center|LOCUS_10630 68528 67722 gene locus_tag LOCUS_10640 68528 67722 CDS product [LysW]-aminoadipate/[LysW]-glutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978133.1 protein_id gnl|my_center|LOCUS_10640 69568 68525 gene locus_tag LOCUS_10650 gene argC 69568 68525 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762032.1 protein_id gnl|my_center|LOCUS_10650 70400 69561 gene locus_tag LOCUS_10660 gene lysX 70400 69561 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_10660 70581 70402 gene locus_tag LOCUS_10670 gene lysW 70581 70402 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101022.1 protein_id gnl|my_center|LOCUS_10670 71773 70574 gene locus_tag LOCUS_10680 71773 70574 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167827706.1 protein_id gnl|my_center|LOCUS_10680 71819 72520 gene locus_tag LOCUS_10690 71819 72520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 72513 73898 gene locus_tag LOCUS_10700 gene argH 72513 73898 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870298.1 protein_id gnl|my_center|LOCUS_10700 73961 74530 gene locus_tag LOCUS_10710 73961 74530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 74687 75631 gene locus_tag LOCUS_10720 74687 75631 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081437.1 protein_id gnl|my_center|LOCUS_10720 75631 76521 gene locus_tag LOCUS_10730 75631 76521 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065067.1 protein_id gnl|my_center|LOCUS_10730 76518 77864 gene locus_tag LOCUS_10740 76518 77864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 77861 79144 gene locus_tag LOCUS_10750 77861 79144 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_10750 79152 81062 gene locus_tag LOCUS_10760 79152 81062 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979746.1 protein_id gnl|my_center|LOCUS_10760 81059 82591 gene locus_tag LOCUS_10770 81059 82591 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979745.1 protein_id gnl|my_center|LOCUS_10770 83674 82595 gene locus_tag LOCUS_10780 83674 82595 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870783.1 protein_id gnl|my_center|LOCUS_10780 84610 83702 gene locus_tag LOCUS_10790 84610 83702 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496774.1 protein_id gnl|my_center|LOCUS_10790 84654 85943 gene locus_tag LOCUS_10800 84654 85943 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240264.1 protein_id gnl|my_center|LOCUS_10800 86332 85946 gene locus_tag LOCUS_10810 86332 85946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 86417 87661 gene locus_tag LOCUS_10820 86417 87661 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979899.1 protein_id gnl|my_center|LOCUS_10820 88342 87668 gene locus_tag LOCUS_10830 88342 87668 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980489.1 protein_id gnl|my_center|LOCUS_10830 88741 88358 gene locus_tag LOCUS_10840 88741 88358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 89932 88748 gene locus_tag LOCUS_10850 89932 88748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 90165 91013 gene locus_tag LOCUS_10860 90165 91013 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090008.1 protein_id gnl|my_center|LOCUS_10860 91882 91010 gene locus_tag LOCUS_10870 91882 91010 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023015.1 protein_id gnl|my_center|LOCUS_10870 93630 91879 gene locus_tag LOCUS_10880 93630 91879 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545733.1 protein_id gnl|my_center|LOCUS_10880 93938 95050 gene locus_tag LOCUS_10890 93938 95050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 95059 95499 gene locus_tag LOCUS_10900 95059 95499 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763493.1 protein_id gnl|my_center|LOCUS_10900 95534 96175 gene locus_tag LOCUS_10910 95534 96175 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722009.1 protein_id gnl|my_center|LOCUS_10910 96198 98384 gene locus_tag LOCUS_10920 96198 98384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence08 954 1283 gene locus_tag LOCUS_10930 954 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 1294 1860 gene locus_tag LOCUS_10940 1294 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10940 1954 1880 gene locus_tag LOCUS_t00280 1954 1880 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2081 2005 gene locus_tag LOCUS_t00290 2081 2005 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4985 2115 gene locus_tag LOCUS_10950 gene leuS 4985 2115 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879908.1 protein_id gnl|my_center|LOCUS_10950 7702 4982 gene locus_tag LOCUS_10960 gene alaS 7702 4982 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870068.1 protein_id gnl|my_center|LOCUS_10960 8023 7709 gene locus_tag LOCUS_10970 gene rpl12p 8023 7709 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250366.1 protein_id gnl|my_center|LOCUS_10970 8908 8057 gene locus_tag LOCUS_10980 8908 8057 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742658.1 protein_id gnl|my_center|LOCUS_10980 9561 8908 gene locus_tag LOCUS_10990 9561 8908 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762220.1 protein_id gnl|my_center|LOCUS_10990 10049 9564 gene locus_tag LOCUS_11000 10049 9564 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867125.1 protein_id gnl|my_center|LOCUS_11000 10540 10061 gene locus_tag LOCUS_11010 10540 10061 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878044.1 protein_id gnl|my_center|LOCUS_11010 10793 10515 gene locus_tag LOCUS_11020 10793 10515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 11743 10805 gene locus_tag LOCUS_11030 gene argF 11743 10805 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584136.1 protein_id gnl|my_center|LOCUS_11030 12641 11730 gene locus_tag LOCUS_11040 gene ftsY 12641 11730 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867626.1 protein_id gnl|my_center|LOCUS_11040 13060 12641 gene locus_tag LOCUS_11050 gene pfdA 13060 12641 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868641.1 protein_id gnl|my_center|LOCUS_11050 13768 13094 gene locus_tag LOCUS_11060 13768 13094 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496375.1 protein_id gnl|my_center|LOCUS_11060 14154 13768 gene locus_tag LOCUS_11070 14154 13768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 14321 14157 gene locus_tag LOCUS_11080 14321 14157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 14661 14323 gene locus_tag LOCUS_11090 14661 14323 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870196.1 protein_id gnl|my_center|LOCUS_11090 15127 14648 gene locus_tag LOCUS_11100 15127 14648 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762195.1 protein_id gnl|my_center|LOCUS_11100 15434 15144 gene locus_tag LOCUS_11110 15434 15144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 15543 15617 gene locus_tag LOCUS_t00300 15543 15617 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 15618 15691 gene locus_tag LOCUS_t00310 15618 15691 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 15730 16971 gene locus_tag LOCUS_11120 gene prf1 15730 16971 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870340.1 protein_id gnl|my_center|LOCUS_11120 16968 17645 gene locus_tag LOCUS_11130 gene pyrH 16968 17645 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979322.1 protein_id gnl|my_center|LOCUS_11130 17646 17733 gene locus_tag LOCUS_t00320 17646 17733 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18493 17756 gene locus_tag LOCUS_11140 18493 17756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 18690 18490 gene locus_tag LOCUS_11150 18690 18490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 19837 19148 gene locus_tag LOCUS_11160 19837 19148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 20240 19839 gene locus_tag LOCUS_11170 20240 19839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 20631 20227 gene locus_tag LOCUS_11180 20631 20227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 22502 20631 gene locus_tag LOCUS_11190 22502 20631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 24084 22495 gene locus_tag LOCUS_11200 24084 22495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 24590 24081 gene locus_tag LOCUS_11210 24590 24081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 25000 24587 gene locus_tag LOCUS_11220 25000 24587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 25689 25000 gene locus_tag LOCUS_11230 25689 25000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 27119 25686 gene locus_tag LOCUS_11240 27119 25686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 27251 27336 gene locus_tag LOCUS_t00330 27251 27336 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 27406 28137 gene locus_tag LOCUS_11250 27406 28137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 28237 28431 gene locus_tag LOCUS_11260 28237 28431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 28867 28487 gene locus_tag LOCUS_11270 gene gloA 28867 28487 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 protein_id gnl|my_center|LOCUS_11270 29479 31191 gene locus_tag LOCUS_11280 29479 31191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11280 31188 31961 gene locus_tag LOCUS_11290 31188 31961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11290 33232 31958 gene locus_tag LOCUS_11300 gene aceA 33232 31958 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259719.1 protein_id gnl|my_center|LOCUS_11300 33771 33289 gene locus_tag LOCUS_11310 33771 33289 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227655.1 protein_id gnl|my_center|LOCUS_11310 33848 34966 gene locus_tag LOCUS_11320 33848 34966 CDS product asparagine synthetase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762509.1 protein_id gnl|my_center|LOCUS_11320 34963 36351 gene locus_tag LOCUS_11330 34963 36351 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761902.1 protein_id gnl|my_center|LOCUS_11330 37500 36352 gene locus_tag LOCUS_11340 37500 36352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 37549 37623 gene locus_tag LOCUS_t00340 37549 37623 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 37647 39017 gene locus_tag LOCUS_11350 gene gndA 37647 39017 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081528.1 protein_id gnl|my_center|LOCUS_11350 40385 39003 gene locus_tag LOCUS_11360 40385 39003 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251177.1 protein_id gnl|my_center|LOCUS_11360 40648 40385 gene locus_tag LOCUS_11370 40648 40385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 40717 41076 gene locus_tag LOCUS_11380 40717 41076 CDS product Sjogren's syndrome/scleroderma autoantigen 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197030934.1 protein_id gnl|my_center|LOCUS_11380 41079 41684 gene locus_tag LOCUS_11390 gene tmk 41079 41684 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496455.1 protein_id gnl|my_center|LOCUS_11390 41665 42906 gene locus_tag LOCUS_11400 41665 42906 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867468.1 protein_id gnl|my_center|LOCUS_11400 44245 42899 gene locus_tag LOCUS_11410 44245 42899 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877006.1 protein_id gnl|my_center|LOCUS_11410 44238 46091 gene locus_tag LOCUS_11420 44238 46091 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868460.1 protein_id gnl|my_center|LOCUS_11420 46213 47352 gene locus_tag LOCUS_11430 46213 47352 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762522.1 protein_id gnl|my_center|LOCUS_11430 47342 49936 gene locus_tag LOCUS_11440 47342 49936 CDS product DNA-directed DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762568.1 protein_id gnl|my_center|LOCUS_11440 50237 49929 gene locus_tag LOCUS_11450 50237 49929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 51023 50268 gene locus_tag LOCUS_11460 51023 50268 CDS product A24 family peptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024381.1 protein_id gnl|my_center|LOCUS_11460 52787 51453 gene locus_tag LOCUS_11470 52787 51453 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146938.1 protein_id gnl|my_center|LOCUS_11470 54190 52775 gene locus_tag LOCUS_11480 54190 52775 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868372.1 protein_id gnl|my_center|LOCUS_11480 54806 54222 gene locus_tag LOCUS_11490 54806 54222 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762243.1 protein_id gnl|my_center|LOCUS_11490 56404 54806 gene locus_tag LOCUS_11500 gene lysS 56404 54806 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583287.1 protein_id gnl|my_center|LOCUS_11500 56691 56404 gene locus_tag LOCUS_11510 56691 56404 CDS product 30S ribosomal protein S26e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979487.1 protein_id gnl|my_center|LOCUS_11510 58160 56745 gene locus_tag LOCUS_11520 gene proS 58160 56745 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979486.1 protein_id gnl|my_center|LOCUS_11520 58969 58199 gene locus_tag LOCUS_11530 58969 58199 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978333.1 protein_id gnl|my_center|LOCUS_11530 59159 58962 gene locus_tag LOCUS_11540 59159 58962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 59323 59156 gene locus_tag LOCUS_11550 59323 59156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 59445 59918 gene locus_tag LOCUS_11560 59445 59918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 60081 59902 gene locus_tag LOCUS_11570 60081 59902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 60403 60990 gene locus_tag LOCUS_11580 60403 60990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 61006 61314 gene locus_tag LOCUS_11590 61006 61314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 61295 61663 gene locus_tag LOCUS_11600 61295 61663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 61999 61658 gene locus_tag LOCUS_11610 61999 61658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 62990 62646 gene locus_tag LOCUS_11620 gene albA 62990 62646 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979310.1 protein_id gnl|my_center|LOCUS_11620 64215 63040 gene locus_tag LOCUS_11630 64215 63040 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881286.1 protein_id gnl|my_center|LOCUS_11630 64320 64643 gene locus_tag LOCUS_11640 64320 64643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 64906 64640 gene locus_tag LOCUS_11650 64906 64640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 66542 64896 gene locus_tag LOCUS_11660 gene thsA 66542 64896 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240279.1 protein_id gnl|my_center|LOCUS_11660 66599 66790 gene locus_tag LOCUS_11670 66599 66790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 66835 67170 gene locus_tag LOCUS_11680 66835 67170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 67648 67157 gene locus_tag LOCUS_11690 gene rimI 67648 67157 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762816.1 protein_id gnl|my_center|LOCUS_11690 67691 68734 gene locus_tag LOCUS_11700 67691 68734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 69289 68717 gene locus_tag LOCUS_11710 69289 68717 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762559.1 protein_id gnl|my_center|LOCUS_11710 69824 69309 gene locus_tag LOCUS_11720 69824 69309 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868568.1 protein_id gnl|my_center|LOCUS_11720 70357 69824 gene locus_tag LOCUS_11730 70357 69824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 >Feature sequence09 1099 2322 gene locus_tag LOCUS_11740 gene hmgA 1099 2322 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249865.1 protein_id gnl|my_center|LOCUS_11740 2319 2912 gene locus_tag LOCUS_11750 2319 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 3000 3221 gene locus_tag LOCUS_11760 3000 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 4572 3208 gene locus_tag LOCUS_11770 gene truD 4572 3208 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065655.1 protein_id gnl|my_center|LOCUS_11770 4972 5187 gene locus_tag LOCUS_11780 4972 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 5490 7880 gene locus_tag LOCUS_11790 gene valS 5490 7880 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060895.1 protein_id gnl|my_center|LOCUS_11790 9072 7867 gene locus_tag LOCUS_11800 9072 7867 CDS product putative sugar nucleotidyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256908.1 protein_id gnl|my_center|LOCUS_11800 9109 9531 gene locus_tag LOCUS_11810 9109 9531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 9887 9528 gene locus_tag LOCUS_11820 9887 9528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 10014 10523 gene locus_tag LOCUS_11830 10014 10523 CDS product protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846965.1 protein_id gnl|my_center|LOCUS_11830 10774 10514 gene locus_tag LOCUS_11840 10774 10514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 10813 11337 gene locus_tag LOCUS_11850 10813 11337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 11660 11334 gene locus_tag LOCUS_11860 11660 11334 CDS product 30S ribosomal protein S25e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762560.1 protein_id gnl|my_center|LOCUS_11860 11715 12029 gene locus_tag LOCUS_11870 11715 12029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 12026 13060 gene locus_tag LOCUS_11880 12026 13060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 15082 13049 gene locus_tag LOCUS_11890 15082 13049 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979478.1 protein_id gnl|my_center|LOCUS_11890 15132 15431 gene locus_tag LOCUS_11900 15132 15431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 15435 16028 gene locus_tag LOCUS_11910 15435 16028 CDS product V-type ATP synthase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876589.1 protein_id gnl|my_center|LOCUS_11910 16030 17808 gene locus_tag LOCUS_11920 16030 17808 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250553.1 protein_id gnl|my_center|LOCUS_11920 17801 19189 gene locus_tag LOCUS_11930 17801 19189 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053740.1 protein_id gnl|my_center|LOCUS_11930 19191 19844 gene locus_tag LOCUS_11940 19191 19844 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979483.1 protein_id gnl|my_center|LOCUS_11940 19828 19971 gene locus_tag LOCUS_11950 19828 19971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 19973 20269 gene locus_tag LOCUS_11960 19973 20269 CDS product ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762800.1 protein_id gnl|my_center|LOCUS_11960 20504 22003 gene locus_tag LOCUS_11970 20504 22003 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240506.1 protein_id gnl|my_center|LOCUS_11970 22040 22270 gene locus_tag LOCUS_11980 22040 22270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 23446 22247 gene locus_tag LOCUS_11990 23446 22247 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979420.1 protein_id gnl|my_center|LOCUS_11990 24676 23456 gene locus_tag LOCUS_12000 24676 23456 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531949.1 protein_id gnl|my_center|LOCUS_12000 24741 25943 gene locus_tag LOCUS_12010 24741 25943 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763576.1 protein_id gnl|my_center|LOCUS_12010 26882 25944 gene locus_tag LOCUS_12020 26882 25944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 27583 26879 gene locus_tag LOCUS_12030 27583 26879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 27635 28480 gene locus_tag LOCUS_12040 27635 28480 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436783.1 protein_id gnl|my_center|LOCUS_12040 28960 28448 gene locus_tag LOCUS_12050 28960 28448 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546295.1 protein_id gnl|my_center|LOCUS_12050 29280 28957 gene locus_tag LOCUS_12060 29280 28957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 29314 32472 gene locus_tag LOCUS_12070 gene ileS 29314 32472 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868042.1 protein_id gnl|my_center|LOCUS_12070 32511 33392 gene locus_tag LOCUS_12080 32511 33392 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762475.1 protein_id gnl|my_center|LOCUS_12080 33464 33784 gene locus_tag LOCUS_12090 33464 33784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 33825 35066 gene locus_tag LOCUS_12100 gene ahcY 33825 35066 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880742.1 protein_id gnl|my_center|LOCUS_12100 35704 35063 gene locus_tag LOCUS_12110 gene rnhB 35704 35063 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867642.1 protein_id gnl|my_center|LOCUS_12110 35730 36407 gene locus_tag LOCUS_12120 35730 36407 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979446.1 protein_id gnl|my_center|LOCUS_12120 38199 36484 gene locus_tag LOCUS_12130 38199 36484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 39152 38196 gene locus_tag LOCUS_12140 39152 38196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 39468 39124 gene locus_tag LOCUS_12150 39468 39124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 40573 39479 gene locus_tag LOCUS_12160 40573 39479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 41907 40570 gene locus_tag LOCUS_12170 41907 40570 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272524.1 protein_id gnl|my_center|LOCUS_12170 43407 41908 gene locus_tag LOCUS_12180 gene purH 43407 41908 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745439.1 protein_id gnl|my_center|LOCUS_12180 43477 44313 gene locus_tag LOCUS_12190 43477 44313 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863110.1 protein_id gnl|my_center|LOCUS_12190 44282 45355 gene locus_tag LOCUS_12200 gene purM 44282 45355 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869698.1 protein_id gnl|my_center|LOCUS_12200 45359 46792 gene locus_tag LOCUS_12210 gene purF 45359 46792 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060868.1 protein_id gnl|my_center|LOCUS_12210 46785 48107 gene locus_tag LOCUS_12220 gene purD 46785 48107 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061056.1 protein_id gnl|my_center|LOCUS_12220 48101 48949 gene locus_tag LOCUS_12230 gene folD 48101 48949 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545120.1 protein_id gnl|my_center|LOCUS_12230 48946 49581 gene locus_tag LOCUS_12240 gene purN 48946 49581 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_12240 49636 49563 gene locus_tag LOCUS_t00350 49636 49563 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 49983 49663 gene locus_tag LOCUS_12250 49983 49663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 51440 50016 gene locus_tag LOCUS_12260 51440 50016 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256756.1 protein_id gnl|my_center|LOCUS_12260 52984 51539 gene locus_tag LOCUS_12270 52984 51539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979010.1 protein_id gnl|my_center|LOCUS_12270 53219 53371 gene locus_tag LOCUS_12280 53219 53371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 54788 53397 gene locus_tag LOCUS_12290 54788 53397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979010.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence10 <1 839 gene locus_tag LOCUS_12300 <1 839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227796.1:dihydrolipoamide acetyltransferase family protein 1492 836 gene locus_tag LOCUS_12310 1492 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1527 2159 gene locus_tag LOCUS_12320 1527 2159 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880973.1 protein_id gnl|my_center|LOCUS_12320 2197 3225 gene locus_tag LOCUS_12330 gene fgd 2197 3225 CDS product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892203.1 protein_id gnl|my_center|LOCUS_12330 4395 3229 gene locus_tag LOCUS_12340 4395 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 4445 5818 gene locus_tag LOCUS_12350 gene lpdA 4445 5818 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260104.1 protein_id gnl|my_center|LOCUS_12350 5815 6477 gene locus_tag LOCUS_12360 gene lipB 5815 6477 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174104.1 protein_id gnl|my_center|LOCUS_12360 7665 6460 gene locus_tag LOCUS_12370 7665 6460 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228352.1 protein_id gnl|my_center|LOCUS_12370 8491 7703 gene locus_tag LOCUS_12380 8491 7703 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 protein_id gnl|my_center|LOCUS_12380 8869 8513 gene locus_tag LOCUS_12390 8869 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 9614 8835 gene locus_tag LOCUS_12400 9614 8835 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533693.1 protein_id gnl|my_center|LOCUS_12400 10583 9639 gene locus_tag LOCUS_12410 gene meaB 10583 9639 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_12410 10623 12407 gene locus_tag LOCUS_12420 10623 12407 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250100.1 protein_id gnl|my_center|LOCUS_12420 12376 12846 gene locus_tag LOCUS_12430 12376 12846 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_12430 13990 12836 gene locus_tag LOCUS_12440 13990 12836 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978565.1 protein_id gnl|my_center|LOCUS_12440 14873 14007 gene locus_tag LOCUS_12450 gene prpB 14873 14007 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846659.1 protein_id gnl|my_center|LOCUS_12450 16207 14870 gene locus_tag LOCUS_12460 16207 14870 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763429.1 protein_id gnl|my_center|LOCUS_12460 16296 16841 gene locus_tag LOCUS_12470 16296 16841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 16881 17567 gene locus_tag LOCUS_12480 16881 17567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 17599 18897 gene locus_tag LOCUS_12490 17599 18897 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087715.1 protein_id gnl|my_center|LOCUS_12490 18894 19283 gene locus_tag LOCUS_12500 18894 19283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 19312 20271 gene locus_tag LOCUS_12510 19312 20271 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080738.1 protein_id gnl|my_center|LOCUS_12510 20427 20275 gene locus_tag LOCUS_12520 20427 20275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 20753 22030 gene locus_tag LOCUS_12530 20753 22030 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461742.1 protein_id gnl|my_center|LOCUS_12530 22032 22331 gene locus_tag LOCUS_12540 22032 22331 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391609.1 protein_id gnl|my_center|LOCUS_12540 22377 22670 gene locus_tag LOCUS_12550 22377 22670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846426.1 protein_id gnl|my_center|LOCUS_12550 22667 23755 gene locus_tag LOCUS_12560 gene dinB 22667 23755 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066563.1 protein_id gnl|my_center|LOCUS_12560 24226 23750 gene locus_tag LOCUS_12570 24226 23750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 24270 25115 gene locus_tag LOCUS_12580 gene speE 24270 25115 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763050.1 protein_id gnl|my_center|LOCUS_12580 25687 25112 gene locus_tag LOCUS_12590 25687 25112 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020996754.1 protein_id gnl|my_center|LOCUS_12590 26673 25684 gene locus_tag LOCUS_12600 26673 25684 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978561.1 protein_id gnl|my_center|LOCUS_12600 28112 26673 gene locus_tag LOCUS_12610 28112 26673 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978681.1 protein_id gnl|my_center|LOCUS_12610 28170 29111 gene locus_tag LOCUS_12620 28170 29111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 30209 29088 gene locus_tag LOCUS_12630 gene cysS 30209 29088 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_12630 30311 30550 gene locus_tag LOCUS_12640 30311 30550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 31272 30547 gene locus_tag LOCUS_12650 31272 30547 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038619.1 protein_id gnl|my_center|LOCUS_12650 31988 31272 gene locus_tag LOCUS_12660 31988 31272 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867275.1 protein_id gnl|my_center|LOCUS_12660 32047 32373 gene locus_tag LOCUS_12670 32047 32373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 32380 33201 gene locus_tag LOCUS_12680 32380 33201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 34493 33198 gene locus_tag LOCUS_12690 34493 33198 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250393.1 protein_id gnl|my_center|LOCUS_12690 34547 35851 gene locus_tag LOCUS_12700 34547 35851 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978992.1 protein_id gnl|my_center|LOCUS_12700 36508 35831 gene locus_tag LOCUS_12710 gene npdG 36508 35831 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878392.1 protein_id gnl|my_center|LOCUS_12710 36581 38143 gene locus_tag LOCUS_12720 36581 38143 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249122.1 protein_id gnl|my_center|LOCUS_12720 38376 38140 gene locus_tag LOCUS_12730 38376 38140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 38461 39483 gene locus_tag LOCUS_12740 38461 39483 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024104.1 protein_id gnl|my_center|LOCUS_12740 39480 39746 gene locus_tag LOCUS_12750 39480 39746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 39771 41534 gene locus_tag LOCUS_12760 39771 41534 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726783.1 protein_id gnl|my_center|LOCUS_12760 41534 42043 gene locus_tag LOCUS_12770 41534 42043 CDS product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890466.1 protein_id gnl|my_center|LOCUS_12770 43949 42027 gene locus_tag LOCUS_12780 43949 42027 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013267177.1 protein_id gnl|my_center|LOCUS_12780 43984 44844 gene locus_tag LOCUS_12790 43984 44844 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879952.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence11 <1 1478 gene locus_tag LOCUS_12800 <1 1478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258712.1:SBBP repeat-containing protein 2178 1483 gene locus_tag LOCUS_12810 2178 1483 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875742.1 protein_id gnl|my_center|LOCUS_12810 2664 3962 gene locus_tag LOCUS_12820 2664 3962 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763069.1 protein_id gnl|my_center|LOCUS_12820 4779 4021 gene locus_tag LOCUS_12830 4779 4021 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184651002.1 protein_id gnl|my_center|LOCUS_12830 4812 6260 gene locus_tag LOCUS_12840 gene tcuA 4812 6260 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966591.1 protein_id gnl|my_center|LOCUS_12840 7696 6257 gene locus_tag LOCUS_12850 7696 6257 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040326.1 protein_id gnl|my_center|LOCUS_12850 9650 7884 gene locus_tag LOCUS_12860 9650 7884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 10611 10063 gene locus_tag LOCUS_12870 10611 10063 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879640.1 protein_id gnl|my_center|LOCUS_12870 10728 11120 gene locus_tag LOCUS_12880 10728 11120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 11299 11484 gene locus_tag LOCUS_12890 11299 11484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 12199 13017 gene locus_tag LOCUS_12900 12199 13017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 13272 14447 gene locus_tag LOCUS_12910 13272 14447 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986780.1 protein_id gnl|my_center|LOCUS_12910 14485 14706 gene locus_tag LOCUS_12920 14485 14706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 15059 15301 gene locus_tag LOCUS_12930 15059 15301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12930 16155 15856 gene locus_tag LOCUS_12940 16155 15856 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_12940 17137 16217 gene locus_tag LOCUS_12950 17137 16217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 17441 17082 gene locus_tag LOCUS_12960 17441 17082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 18042 17713 gene locus_tag LOCUS_12970 18042 17713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 19427 18996 gene locus_tag LOCUS_12980 19427 18996 CDS product Holliday junction resolvase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116954.1 protein_id gnl|my_center|LOCUS_12980 19610 20053 gene locus_tag LOCUS_12990 19610 20053 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979189.1 protein_id gnl|my_center|LOCUS_12990 20442 21680 gene locus_tag LOCUS_13000 20442 21680 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545078.1 protein_id gnl|my_center|LOCUS_13000 21729 23018 gene locus_tag LOCUS_13010 21729 23018 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979146.1 protein_id gnl|my_center|LOCUS_13010 23161 24972 gene locus_tag LOCUS_13020 23161 24972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 25178 26425 gene locus_tag LOCUS_13030 gene thrC 25178 26425 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880362.1 protein_id gnl|my_center|LOCUS_13030 26418 26684 gene locus_tag LOCUS_13040 26418 26684 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056827.1 protein_id gnl|my_center|LOCUS_13040 26686 27753 gene locus_tag LOCUS_13050 26686 27753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 27776 28126 gene locus_tag LOCUS_13060 27776 28126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 28492 28100 gene locus_tag LOCUS_13070 28492 28100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 28985 28479 gene locus_tag LOCUS_13080 28985 28479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 29277 28972 gene locus_tag LOCUS_13090 29277 28972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 30238 29255 gene locus_tag LOCUS_13100 30238 29255 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870653.1 protein_id gnl|my_center|LOCUS_13100 31254 30235 gene locus_tag LOCUS_13110 31254 30235 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870653.1 protein_id gnl|my_center|LOCUS_13110 31520 31251 gene locus_tag LOCUS_13120 31520 31251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 33271 31577 gene locus_tag LOCUS_13130 33271 31577 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880806.1 protein_id gnl|my_center|LOCUS_13130 34307 33528 gene locus_tag LOCUS_13140 34307 33528 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846813.1 protein_id gnl|my_center|LOCUS_13140 35906 34320 gene locus_tag LOCUS_13150 35906 34320 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980485.1 protein_id gnl|my_center|LOCUS_13150 36448 35963 gene locus_tag LOCUS_13160 36448 35963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 36831 36445 gene locus_tag LOCUS_13170 36831 36445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 37112 36828 gene locus_tag LOCUS_13180 37112 36828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 37385 37131 gene locus_tag LOCUS_13190 37385 37131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 38094 37375 gene locus_tag LOCUS_13200 38094 37375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 38127 38645 gene locus_tag LOCUS_13210 38127 38645 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867555.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence12 234 818 gene locus_tag LOCUS_13220 234 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1307 1528 gene locus_tag LOCUS_13230 1307 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1566 2129 gene locus_tag LOCUS_13240 1566 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 2582 2133 gene locus_tag LOCUS_13250 2582 2133 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258944.1 protein_id gnl|my_center|LOCUS_13250 3589 2579 gene locus_tag LOCUS_13260 3589 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980499.1 protein_id gnl|my_center|LOCUS_13260 3649 4677 gene locus_tag LOCUS_13270 3649 4677 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979533.1 protein_id gnl|my_center|LOCUS_13270 5177 4674 gene locus_tag LOCUS_13280 5177 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 5609 5208 gene locus_tag LOCUS_13290 5609 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 7183 5606 gene locus_tag LOCUS_13300 7183 5606 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846891.1 protein_id gnl|my_center|LOCUS_13300 7226 7876 gene locus_tag LOCUS_13310 7226 7876 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081034.1 protein_id gnl|my_center|LOCUS_13310 7873 10059 gene locus_tag LOCUS_13320 7873 10059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 10056 10922 gene locus_tag LOCUS_13330 gene mer 10056 10922 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023637.1 protein_id gnl|my_center|LOCUS_13330 11348 11509 gene locus_tag LOCUS_13340 11348 11509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 11580 12602 gene locus_tag LOCUS_13350 11580 12602 CDS product DUF1512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979465.1 protein_id gnl|my_center|LOCUS_13350 12599 12820 gene locus_tag LOCUS_13360 12599 12820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 14757 13495 gene locus_tag LOCUS_13370 gene serS 14757 13495 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_13370 16370 14754 gene locus_tag LOCUS_13380 16370 14754 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978180.1 protein_id gnl|my_center|LOCUS_13380 16427 17596 gene locus_tag LOCUS_13390 16427 17596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 17614 18630 gene locus_tag LOCUS_13400 17614 18630 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496543.1 protein_id gnl|my_center|LOCUS_13400 18627 19784 gene locus_tag LOCUS_13410 18627 19784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 19777 20013 gene locus_tag LOCUS_13420 19777 20013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 20014 20511 gene locus_tag LOCUS_13430 20014 20511 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020492.1 protein_id gnl|my_center|LOCUS_13430 20562 22547 gene locus_tag LOCUS_13440 20562 22547 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980386.1 protein_id gnl|my_center|LOCUS_13440 22537 23514 gene locus_tag LOCUS_13450 22537 23514 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229044.1 protein_id gnl|my_center|LOCUS_13450 24741 23506 gene locus_tag LOCUS_13460 24741 23506 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989988.1 protein_id gnl|my_center|LOCUS_13460 24813 25277 gene locus_tag LOCUS_13470 gene bcp 24813 25277 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292536.1 protein_id gnl|my_center|LOCUS_13470 25311 25787 gene locus_tag LOCUS_13480 25311 25787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 25820 27391 gene locus_tag LOCUS_13490 gene pruA 25820 27391 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243454.1 protein_id gnl|my_center|LOCUS_13490 27388 27609 gene locus_tag LOCUS_13500 27388 27609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 28692 27610 gene locus_tag LOCUS_13510 28692 27610 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257445.1 protein_id gnl|my_center|LOCUS_13510 28794 29057 gene locus_tag LOCUS_13520 28794 29057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 29041 29475 gene locus_tag LOCUS_13530 29041 29475 CDS product cytochrome B558 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978044.1 protein_id gnl|my_center|LOCUS_13530 29477 31837 gene locus_tag LOCUS_13540 29477 31837 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846854.1 protein_id gnl|my_center|LOCUS_13540 32268 31834 gene locus_tag LOCUS_13550 32268 31834 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869516.1 protein_id gnl|my_center|LOCUS_13550 33160 32261 gene locus_tag LOCUS_13560 33160 32261 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124643.1 protein_id gnl|my_center|LOCUS_13560 34616 33165 gene locus_tag LOCUS_13570 34616 33165 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942327.1 protein_id gnl|my_center|LOCUS_13570 >Feature sequence13 1304 330 gene locus_tag LOCUS_13580 1304 330 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227794.1 protein_id gnl|my_center|LOCUS_13580 2391 1306 gene locus_tag LOCUS_13590 gene pdhA 2391 1306 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035320.1 protein_id gnl|my_center|LOCUS_13590 3359 2445 gene locus_tag LOCUS_13600 gene lipA 3359 2445 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174105.1 protein_id gnl|my_center|LOCUS_13600 3417 3731 gene locus_tag LOCUS_13610 3417 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 3738 5186 gene locus_tag LOCUS_13620 3738 5186 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945999.1 protein_id gnl|my_center|LOCUS_13620 6346 5189 gene locus_tag LOCUS_13630 6346 5189 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397283.1 protein_id gnl|my_center|LOCUS_13630 6409 7017 gene locus_tag LOCUS_13640 6409 7017 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763413.1 protein_id gnl|my_center|LOCUS_13640 7042 8076 gene locus_tag LOCUS_13650 7042 8076 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763436.1 protein_id gnl|my_center|LOCUS_13650 8077 9369 gene locus_tag LOCUS_13660 gene pgk 8077 9369 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061271.1 protein_id gnl|my_center|LOCUS_13660 9394 10569 gene locus_tag LOCUS_13670 9394 10569 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_13670 10566 10946 gene locus_tag LOCUS_13680 10566 10946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 11477 10947 gene locus_tag LOCUS_13690 11477 10947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 11715 11509 gene locus_tag LOCUS_13700 11715 11509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 11807 12985 gene locus_tag LOCUS_13710 11807 12985 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979578.1 protein_id gnl|my_center|LOCUS_13710 12987 13934 gene locus_tag LOCUS_13720 12987 13934 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582557.1 protein_id gnl|my_center|LOCUS_13720 13927 15333 gene locus_tag LOCUS_13730 13927 15333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 15879 15310 gene locus_tag LOCUS_13740 15879 15310 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250983.1 protein_id gnl|my_center|LOCUS_13740 17083 15851 gene locus_tag LOCUS_13750 17083 15851 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978258.1 protein_id gnl|my_center|LOCUS_13750 17938 17162 gene locus_tag LOCUS_13760 17938 17162 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922163.1 protein_id gnl|my_center|LOCUS_13760 20297 17940 gene locus_tag LOCUS_13770 gene purL 20297 17940 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259203.1 protein_id gnl|my_center|LOCUS_13770 20760 20290 gene locus_tag LOCUS_13780 20760 20290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 20801 21373 gene locus_tag LOCUS_13790 20801 21373 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881124.1 protein_id gnl|my_center|LOCUS_13790 21351 22460 gene locus_tag LOCUS_13800 21351 22460 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880509.1 protein_id gnl|my_center|LOCUS_13800 22504 22577 gene locus_tag LOCUS_t00360 22504 22577 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 22610 23554 gene locus_tag LOCUS_13810 22610 23554 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922076.1 protein_id gnl|my_center|LOCUS_13810 24303 23551 gene locus_tag LOCUS_13820 24303 23551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 24846 24304 gene locus_tag LOCUS_13830 24846 24304 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978887.1 protein_id gnl|my_center|LOCUS_13830 25512 24868 gene locus_tag LOCUS_13840 25512 24868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 26441 25512 gene locus_tag LOCUS_13850 gene trxB 26441 25512 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_13850 26882 27205 gene locus_tag LOCUS_13860 26882 27205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 27777 27181 gene locus_tag LOCUS_13870 27777 27181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 27834 29711 gene locus_tag LOCUS_13880 gene fpoL 27834 29711 CDS product F420H2 dehydrogenase subunit FpoL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021518.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence14 431 868 gene locus_tag LOCUS_13890 431 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 870 1916 gene locus_tag LOCUS_13900 870 1916 CDS product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172490.1 protein_id gnl|my_center|LOCUS_13900 1957 2517 gene locus_tag LOCUS_13910 1957 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 3590 3027 gene locus_tag LOCUS_13920 3590 3027 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763353.1 protein_id gnl|my_center|LOCUS_13920 3681 6026 gene locus_tag LOCUS_13930 3681 6026 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978604.1 protein_id gnl|my_center|LOCUS_13930 6627 6037 gene locus_tag LOCUS_13940 6627 6037 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228142.1 protein_id gnl|my_center|LOCUS_13940 7268 6624 gene locus_tag LOCUS_13950 7268 6624 CDS product MtnX-like HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816647.1 protein_id gnl|my_center|LOCUS_13950 8539 7268 gene locus_tag LOCUS_13960 8539 7268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 8627 9031 gene locus_tag LOCUS_13970 8627 9031 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184651021.1 protein_id gnl|my_center|LOCUS_13970 9061 10425 gene locus_tag LOCUS_13980 9061 10425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 10422 11138 gene locus_tag LOCUS_13990 10422 11138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 12056 11124 gene locus_tag LOCUS_14000 12056 11124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 12116 15214 gene locus_tag LOCUS_14010 12116 15214 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977932.1 protein_id gnl|my_center|LOCUS_14010 15308 15721 gene locus_tag LOCUS_14020 15308 15721 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251148.1 protein_id gnl|my_center|LOCUS_14020 15855 16454 gene locus_tag LOCUS_14030 15855 16454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 16456 16653 gene locus_tag LOCUS_14040 16456 16653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 16893 16820 gene locus_tag LOCUS_t00370 16893 16820 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 16946 17500 gene locus_tag LOCUS_14050 16946 17500 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986296.1 protein_id gnl|my_center|LOCUS_14050 17956 17501 gene locus_tag LOCUS_14060 17956 17501 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978000.1 protein_id gnl|my_center|LOCUS_14060 18684 18016 gene locus_tag LOCUS_14070 18684 18016 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979569.1 protein_id gnl|my_center|LOCUS_14070 20020 18725 gene locus_tag LOCUS_14080 gene gatD 20020 18725 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867819.1 protein_id gnl|my_center|LOCUS_14080 20213 20028 gene locus_tag LOCUS_14090 20213 20028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 20289 21443 gene locus_tag LOCUS_14100 20289 21443 CDS product C/D box methylation guide ribonucleoprotein complex aNOP56 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156014546.1 protein_id gnl|my_center|LOCUS_14100 21440 22135 gene locus_tag LOCUS_14110 21440 22135 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762156.1 protein_id gnl|my_center|LOCUS_14110 22592 22107 gene locus_tag LOCUS_14120 22592 22107 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249196.1 protein_id gnl|my_center|LOCUS_14120 22641 23438 gene locus_tag LOCUS_14130 22641 23438 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020646525.1 protein_id gnl|my_center|LOCUS_14130 23620 24939 gene locus_tag LOCUS_14140 23620 24939 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978858.1 protein_id gnl|my_center|LOCUS_14140 25131 25487 gene locus_tag LOCUS_14150 25131 25487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 25872 25492 gene locus_tag LOCUS_14160 25872 25492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence15 1769 2938 gene locus_tag LOCUS_14170 gene thrC 1769 2938 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167827705.1 protein_id gnl|my_center|LOCUS_14170 2935 3864 gene locus_tag LOCUS_14180 2935 3864 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761815.1 protein_id gnl|my_center|LOCUS_14180 3922 4479 gene locus_tag LOCUS_14190 3922 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 6137 4686 gene locus_tag LOCUS_14200 6137 4686 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979709.1 protein_id gnl|my_center|LOCUS_14200 6421 8088 gene locus_tag LOCUS_14210 6421 8088 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385666.1 protein_id gnl|my_center|LOCUS_14210 8103 9137 gene locus_tag LOCUS_14220 8103 9137 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385664.1 protein_id gnl|my_center|LOCUS_14220 9134 10033 gene locus_tag LOCUS_14230 9134 10033 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383587.1 protein_id gnl|my_center|LOCUS_14230 10014 11000 gene locus_tag LOCUS_14240 10014 11000 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082281.1 protein_id gnl|my_center|LOCUS_14240 11098 13161 gene locus_tag LOCUS_14250 11098 13161 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_14250 13165 14910 gene locus_tag LOCUS_14260 13165 14910 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence16 517 1545 gene locus_tag LOCUS_14270 517 1545 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583847.1 protein_id gnl|my_center|LOCUS_14270 2724 1537 gene locus_tag LOCUS_14280 2724 1537 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880777.1 protein_id gnl|my_center|LOCUS_14280 3349 2786 gene locus_tag LOCUS_14290 3349 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 3435 5651 gene locus_tag LOCUS_14300 3435 5651 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762291.1 protein_id gnl|my_center|LOCUS_14300 5651 6970 gene locus_tag LOCUS_14310 5651 6970 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147002.1 protein_id gnl|my_center|LOCUS_14310 7891 6971 gene locus_tag LOCUS_14320 7891 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 8171 10054 gene locus_tag LOCUS_14330 8171 10054 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250186.1 protein_id gnl|my_center|LOCUS_14330 10090 10896 gene locus_tag LOCUS_14340 10090 10896 CDS product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209477179.1 protein_id gnl|my_center|LOCUS_14340 11218 11736 gene locus_tag LOCUS_14350 11218 11736 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_14350 <12254 11713 gene locus_tag LOCUS_14360 <12254 11713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545185.1:NADH-quinone oxidoreductase subunit M >Feature sequence17 1878 847 gene locus_tag LOCUS_14370 1878 847 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980354.1 protein_id gnl|my_center|LOCUS_14370 2794 1865 gene locus_tag LOCUS_14380 2794 1865 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980353.1 protein_id gnl|my_center|LOCUS_14380 3503 2787 gene locus_tag LOCUS_14390 3503 2787 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980352.1 protein_id gnl|my_center|LOCUS_14390 3667 4164 gene locus_tag LOCUS_14400 3667 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978727.1 protein_id gnl|my_center|LOCUS_14400 4177 4959 gene locus_tag LOCUS_14410 4177 4959 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979642.1 protein_id gnl|my_center|LOCUS_14410 5093 7129 gene locus_tag LOCUS_14420 5093 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 7943 7536 gene locus_tag LOCUS_14430 7943 7536 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979747.1 protein_id gnl|my_center|LOCUS_14430 8189 7950 gene locus_tag LOCUS_14440 8189 7950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 8667 8311 gene locus_tag LOCUS_14450 8667 8311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846631.1 protein_id gnl|my_center|LOCUS_14450 9035 8664 gene locus_tag LOCUS_14460 9035 8664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 9129 9881 gene locus_tag LOCUS_14470 9129 9881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 11298 9910 gene locus_tag LOCUS_14480 11298 9910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979010.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence18 5 2050 gene locus_tag LOCUS_14490 5 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 2034 2225 gene locus_tag LOCUS_14500 2034 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 2840 2229 gene locus_tag LOCUS_14510 2840 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 4647 2941 gene locus_tag LOCUS_14520 4647 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 5156 4644 gene locus_tag LOCUS_14530 5156 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 6852 5548 gene locus_tag LOCUS_14540 6852 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 7808 6849 gene locus_tag LOCUS_14550 7808 6849 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_14550 8217 7795 gene locus_tag LOCUS_14560 8217 7795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 8734 8204 gene locus_tag LOCUS_14570 8734 8204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 9456 8731 gene locus_tag LOCUS_14580 9456 8731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 >Feature sequence19 <1 1485 gene locus_tag LOCUS_14590 <1 1485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878821.1:FGGY-family carbohydrate kinase 1561 2730 gene locus_tag LOCUS_14600 1561 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 2767 3453 gene locus_tag LOCUS_14610 2767 3453 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_14610 3506 4690 gene locus_tag LOCUS_14620 3506 4690 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_14620 4888 5607 gene locus_tag LOCUS_14630 4888 5607 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978111.1 protein_id gnl|my_center|LOCUS_14630 6789 5596 gene locus_tag LOCUS_14640 gene hutI 6789 5596 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244327.1 protein_id gnl|my_center|LOCUS_14640 6839 7666 gene locus_tag LOCUS_14650 6839 7666 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082270.1 protein_id gnl|my_center|LOCUS_14650 >Feature sequence20 1 258 gene locus_tag LOCUS_14660 1 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 399 1757 gene locus_tag LOCUS_14670 399 1757 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674116.1 protein_id gnl|my_center|LOCUS_14670 1757 2935 gene locus_tag LOCUS_14680 1757 2935 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156006472.1 protein_id gnl|my_center|LOCUS_14680 3085 3672 gene locus_tag LOCUS_14690 3085 3672 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979808.1 protein_id gnl|my_center|LOCUS_14690 4264 5319 gene locus_tag LOCUS_14700 4264 5319 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147062.1 protein_id gnl|my_center|LOCUS_14700 5376 6656 gene locus_tag LOCUS_14710 5376 6656 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979709.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence21 587 515 gene locus_tag LOCUS_t00380 587 515 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1155 700 gene locus_tag LOCUS_14720 1155 700 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065213.1 protein_id gnl|my_center|LOCUS_14720 1942 1241 gene locus_tag LOCUS_14730 1942 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 2406 1942 gene locus_tag LOCUS_14740 2406 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 3308 2427 gene locus_tag LOCUS_14750 3308 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 4171 3293 gene locus_tag LOCUS_14760 4171 3293 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868818.1 protein_id gnl|my_center|LOCUS_14760 4600 4205 gene locus_tag LOCUS_14770 4600 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 5324 4626 gene locus_tag LOCUS_14780 gene radB 5324 4626 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320585.1 protein_id gnl|my_center|LOCUS_14780 6406 5321 gene locus_tag LOCUS_14790 6406 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 6981 6457 gene locus_tag LOCUS_14800 6981 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 >Feature sequence22 1400 21 gene locus_tag LOCUS_14810 1400 21 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539284.1 protein_id gnl|my_center|LOCUS_14810 1533 2546 gene locus_tag LOCUS_14820 1533 2546 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277419.1 protein_id gnl|my_center|LOCUS_14820 2931 2548 gene locus_tag LOCUS_14830 2931 2548 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349708.1 protein_id gnl|my_center|LOCUS_14830 3871 2906 gene locus_tag LOCUS_14840 3871 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 5319 3868 gene locus_tag LOCUS_14850 5319 3868 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141291.1 protein_id gnl|my_center|LOCUS_14850 6198 5368 gene locus_tag LOCUS_14860 6198 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence23 659 1132 gene locus_tag LOCUS_14870 659 1132 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249196.1 protein_id gnl|my_center|LOCUS_14870 2662 1652 gene locus_tag LOCUS_14880 2662 1652 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250179.1 protein_id gnl|my_center|LOCUS_14880 4110 2830 gene locus_tag LOCUS_14890 4110 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 4352 5452 gene locus_tag LOCUS_14900 4352 5452 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228926.1 protein_id gnl|my_center|LOCUS_14900 >Feature sequence24 707 240 gene locus_tag LOCUS_14910 707 240 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532101.1 protein_id gnl|my_center|LOCUS_14910 745 831 gene locus_tag LOCUS_t00390 745 831 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 865 1770 gene locus_tag LOCUS_14920 865 1770 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763484.1 protein_id gnl|my_center|LOCUS_14920 1764 2576 gene locus_tag LOCUS_14930 1764 2576 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013805.1 protein_id gnl|my_center|LOCUS_14930 2554 3420 gene locus_tag LOCUS_14940 2554 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 3476 4576 gene locus_tag LOCUS_14950 gene carA 3476 4576 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979553.1 protein_id gnl|my_center|LOCUS_14950 >Feature sequence25 1001 1207 gene locus_tag LOCUS_14960 1001 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 1258 2361 gene locus_tag LOCUS_14970 1258 2361 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879085.1 protein_id gnl|my_center|LOCUS_14970 2340 3008 gene locus_tag LOCUS_14980 2340 3008 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762140.1 protein_id gnl|my_center|LOCUS_14980