>Feature sequence01 150 422 gene locus_tag LOCUS_00010 150 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 515 805 gene locus_tag LOCUS_00020 515 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 845 1777 gene locus_tag LOCUS_00030 845 1777 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140077.1 protein_id gnl|my_center|LOCUS_00030 1929 2174 gene locus_tag LOCUS_00040 1929 2174 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883358.1 protein_id gnl|my_center|LOCUS_00040 4825 2213 gene locus_tag LOCUS_00050 4825 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4946 4873 gene locus_tag LOCUS_t00010 4946 4873 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6671 5049 gene locus_tag LOCUS_00060 6671 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7085 7588 gene locus_tag LOCUS_00070 7085 7588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7594 8256 gene locus_tag LOCUS_00080 gene dapB 7594 8256 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400159.1 protein_id gnl|my_center|LOCUS_00080 8327 9964 gene locus_tag LOCUS_00090 8327 9964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 10029 10853 gene locus_tag LOCUS_00100 gene kdsA 10029 10853 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883359.1 protein_id gnl|my_center|LOCUS_00100 10853 11467 gene locus_tag LOCUS_00110 10853 11467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11464 13122 gene locus_tag LOCUS_00120 11464 13122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13119 13946 gene locus_tag LOCUS_00130 gene lptB 13119 13946 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047473.1 protein_id gnl|my_center|LOCUS_00130 13956 14375 gene locus_tag LOCUS_00140 13956 14375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15464 14349 gene locus_tag LOCUS_00150 gene rfaQ 15464 14349 CDS product putative lipopolysaccharide heptosyltransferase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094901.1 protein_id gnl|my_center|LOCUS_00150 15770 16195 gene locus_tag LOCUS_00160 gene ndk 15770 16195 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444482.1 protein_id gnl|my_center|LOCUS_00160 16896 16516 gene locus_tag LOCUS_00170 16896 16516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18706 16898 gene locus_tag LOCUS_00180 18706 16898 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933885.1 protein_id gnl|my_center|LOCUS_00180 19810 18710 gene locus_tag LOCUS_00190 19810 18710 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883485.1 protein_id gnl|my_center|LOCUS_00190 23345 19854 gene locus_tag LOCUS_00200 23345 19854 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883484.1 protein_id gnl|my_center|LOCUS_00200 23758 23829 gene locus_tag LOCUS_t00020 23758 23829 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 23895 23966 gene locus_tag LOCUS_t00030 23895 23966 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 23996 25315 gene locus_tag LOCUS_00210 gene tig 23996 25315 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873310.1 protein_id gnl|my_center|LOCUS_00210 25449 26054 gene locus_tag LOCUS_00220 25449 26054 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883482.1 protein_id gnl|my_center|LOCUS_00220 26077 27291 gene locus_tag LOCUS_00230 gene clpX 26077 27291 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873309.1 protein_id gnl|my_center|LOCUS_00230 28883 27378 gene locus_tag LOCUS_00240 28883 27378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 29344 30120 gene locus_tag LOCUS_00250 29344 30120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 30148 30579 gene locus_tag LOCUS_00260 30148 30579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 30605 32035 gene locus_tag LOCUS_00270 30605 32035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 32071 32973 gene locus_tag LOCUS_00280 32071 32973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 33057 34685 gene locus_tag LOCUS_00290 33057 34685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 35152 34682 gene locus_tag LOCUS_00300 35152 34682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 35580 35152 gene locus_tag LOCUS_00310 35580 35152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 35813 36223 gene locus_tag LOCUS_00320 35813 36223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 36255 37985 gene locus_tag LOCUS_00330 36255 37985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 38012 38290 gene locus_tag LOCUS_00340 38012 38290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 38308 38556 gene locus_tag LOCUS_00350 38308 38556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 38602 39048 gene locus_tag LOCUS_00360 38602 39048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 39326 39988 gene locus_tag LOCUS_00370 39326 39988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 40071 41390 gene locus_tag LOCUS_00380 gene sctN 40071 41390 CDS product type III secretion system ATPase SctN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883345.1 protein_id gnl|my_center|LOCUS_00380 41387 41899 gene locus_tag LOCUS_00390 41387 41899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 42021 43367 gene locus_tag LOCUS_00400 42021 43367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 43367 44059 gene locus_tag LOCUS_00410 43367 44059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 44056 45267 gene locus_tag LOCUS_00420 44056 45267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 45276 46871 gene locus_tag LOCUS_00430 45276 46871 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883341.1 protein_id gnl|my_center|LOCUS_00430 47823 46852 gene locus_tag LOCUS_00440 47823 46852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 48003 51860 gene locus_tag LOCUS_00450 48003 51860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 51896 52540 gene locus_tag LOCUS_00460 51896 52540 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202235.1 protein_id gnl|my_center|LOCUS_00460 52618 53331 gene locus_tag LOCUS_00470 52618 53331 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202235.1 protein_id gnl|my_center|LOCUS_00470 54293 53466 gene locus_tag LOCUS_00480 54293 53466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 54786 54598 gene locus_tag LOCUS_00490 54786 54598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 56369 55050 gene locus_tag LOCUS_00500 56369 55050 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444892.1 protein_id gnl|my_center|LOCUS_00500 57854 56595 gene locus_tag LOCUS_00510 gene proA 57854 56595 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893267.1 protein_id gnl|my_center|LOCUS_00510 58555 57869 gene locus_tag LOCUS_00520 58555 57869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 59749 59282 gene locus_tag LOCUS_00530 59749 59282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 61953 60400 gene locus_tag LOCUS_00540 61953 60400 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387598.1 protein_id gnl|my_center|LOCUS_00540 63030 61957 gene locus_tag LOCUS_00550 63030 61957 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896855.1 protein_id gnl|my_center|LOCUS_00550 64237 63011 gene locus_tag LOCUS_00560 64237 63011 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893249.1 protein_id gnl|my_center|LOCUS_00560 64576 64238 gene locus_tag LOCUS_00570 64576 64238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 65522 64728 gene locus_tag LOCUS_00580 65522 64728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 65564 65749 gene locus_tag LOCUS_00590 65564 65749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 66130 66056 gene locus_tag LOCUS_t00040 66130 66056 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 68211 66205 gene locus_tag LOCUS_00600 68211 66205 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126182.1 protein_id gnl|my_center|LOCUS_00600 68596 68967 gene locus_tag LOCUS_00610 gene rpsL 68596 68967 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883190.1 protein_id gnl|my_center|LOCUS_00610 69499 69972 gene locus_tag LOCUS_00620 gene rpsG 69499 69972 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872655.1 protein_id gnl|my_center|LOCUS_00620 69986 72091 gene locus_tag LOCUS_00630 gene fusA 69986 72091 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883188.1 protein_id gnl|my_center|LOCUS_00630 72111 72431 gene locus_tag LOCUS_00640 gene rpsJ 72111 72431 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883187.1 protein_id gnl|my_center|LOCUS_00640 >Feature sequence02 310 1572 gene locus_tag LOCUS_00650 310 1572 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882754.1 protein_id gnl|my_center|LOCUS_00650 1632 2408 gene locus_tag LOCUS_00660 1632 2408 CDS product DUF455 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174163.1 protein_id gnl|my_center|LOCUS_00660 3717 2419 gene locus_tag LOCUS_00670 3717 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 4549 3719 gene locus_tag LOCUS_00680 4549 3719 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872212.1 protein_id gnl|my_center|LOCUS_00680 4886 8149 gene locus_tag LOCUS_00690 4886 8149 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883617.1 protein_id gnl|my_center|LOCUS_00690 8170 9240 gene locus_tag LOCUS_00700 8170 9240 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873440.1 protein_id gnl|my_center|LOCUS_00700 10850 13822 gene locus_tag LOCUS_00710 10850 13822 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873436.1 protein_id gnl|my_center|LOCUS_00710 14637 14119 gene locus_tag LOCUS_00720 14637 14119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 14823 16445 gene locus_tag LOCUS_00730 14823 16445 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883612.1 protein_id gnl|my_center|LOCUS_00730 16442 16864 gene locus_tag LOCUS_00740 16442 16864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 16842 18110 gene locus_tag LOCUS_00750 16842 18110 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629647.1 protein_id gnl|my_center|LOCUS_00750 18216 21587 gene locus_tag LOCUS_00760 18216 21587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 23131 21584 gene locus_tag LOCUS_00770 23131 21584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 24594 23446 gene locus_tag LOCUS_00780 24594 23446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 25475 24591 gene locus_tag LOCUS_00790 gene sucD 25475 24591 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883607.1 protein_id gnl|my_center|LOCUS_00790 26646 25480 gene locus_tag LOCUS_00800 gene sucC 26646 25480 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244732.1 protein_id gnl|my_center|LOCUS_00800 27023 27958 gene locus_tag LOCUS_00810 gene ftsY 27023 27958 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007650.1 protein_id gnl|my_center|LOCUS_00810 28068 29492 gene locus_tag LOCUS_00820 28068 29492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 31297 30662 gene locus_tag LOCUS_00830 31297 30662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 31511 32113 gene locus_tag LOCUS_00840 31511 32113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 32106 33053 gene locus_tag LOCUS_00850 32106 33053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 33050 35275 gene locus_tag LOCUS_00860 gene priA 33050 35275 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883559.1 protein_id gnl|my_center|LOCUS_00860 35521 37089 gene locus_tag LOCUS_00870 gene lysS 35521 37089 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873399.1 protein_id gnl|my_center|LOCUS_00870 37355 37104 gene locus_tag LOCUS_00880 37355 37104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 39208 37355 gene locus_tag LOCUS_00890 39208 37355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 41924 39225 gene locus_tag LOCUS_00900 41924 39225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 42287 42565 gene locus_tag LOCUS_00910 42287 42565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 42729 42983 gene locus_tag LOCUS_00920 42729 42983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 43606 43040 gene locus_tag LOCUS_00930 43606 43040 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909445.1 protein_id gnl|my_center|LOCUS_00930 44770 43955 gene locus_tag LOCUS_00940 44770 43955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 45207 44782 gene locus_tag LOCUS_00950 45207 44782 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883552.1 protein_id gnl|my_center|LOCUS_00950 46478 45213 gene locus_tag LOCUS_00960 gene fabF 46478 45213 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872915.1 protein_id gnl|my_center|LOCUS_00960 47029 46631 gene locus_tag LOCUS_00970 gene rsfS 47029 46631 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883550.1 protein_id gnl|my_center|LOCUS_00970 47921 47301 gene locus_tag LOCUS_00980 gene nadD 47921 47301 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226053.1 protein_id gnl|my_center|LOCUS_00980 48526 47861 gene locus_tag LOCUS_00990 48526 47861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 50524 48812 gene locus_tag LOCUS_01000 50524 48812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883547.1 protein_id gnl|my_center|LOCUS_01000 51911 50871 gene locus_tag LOCUS_01010 gene miaA 51911 50871 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883545.1 protein_id gnl|my_center|LOCUS_01010 52249 51914 gene locus_tag LOCUS_01020 52249 51914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 52673 52443 gene locus_tag LOCUS_01030 52673 52443 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883358.1 protein_id gnl|my_center|LOCUS_01030 53000 53290 gene locus_tag LOCUS_01040 53000 53290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 55494 53695 gene locus_tag LOCUS_01050 gene dnaG 55494 53695 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883577.1 protein_id gnl|my_center|LOCUS_01050 55867 56418 gene locus_tag LOCUS_01060 55867 56418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 56543 59155 gene locus_tag LOCUS_01070 gene mutS 56543 59155 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010892221.1 protein_id gnl|my_center|LOCUS_01070 59155 60987 gene locus_tag LOCUS_01080 gene uvrC 59155 60987 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883575.1 protein_id gnl|my_center|LOCUS_01080 62524 60965 gene locus_tag LOCUS_01090 62524 60965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 63147 62641 gene locus_tag LOCUS_01100 63147 62641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 63634 63164 gene locus_tag LOCUS_01110 63634 63164 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883574.1 protein_id gnl|my_center|LOCUS_01110 65030 63900 gene locus_tag LOCUS_01120 65030 63900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 >Feature sequence03 665 117 gene locus_tag LOCUS_01130 665 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 2164 704 gene locus_tag LOCUS_01140 gene gnd 2164 704 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477829.1 protein_id gnl|my_center|LOCUS_01140 2237 2312 gene locus_tag LOCUS_t00050 2237 2312 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3048 2317 gene locus_tag LOCUS_01150 3048 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 3584 3069 gene locus_tag LOCUS_01160 gene msrA 3584 3069 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947811.1 protein_id gnl|my_center|LOCUS_01160 3652 4071 gene locus_tag LOCUS_01170 gene msrB 3652 4071 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876350.1 protein_id gnl|my_center|LOCUS_01170 4026 4268 gene locus_tag LOCUS_01180 4026 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 4597 4265 gene locus_tag LOCUS_01190 4597 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 6096 4594 gene locus_tag LOCUS_01200 6096 4594 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_01200 8108 6084 gene locus_tag LOCUS_01210 8108 6084 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883062.1 protein_id gnl|my_center|LOCUS_01210 8506 8135 gene locus_tag LOCUS_01220 8506 8135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 9118 8519 gene locus_tag LOCUS_01230 9118 8519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01230 9444 9109 gene locus_tag LOCUS_01240 9444 9109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01240 9994 9434 gene locus_tag LOCUS_01250 9994 9434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 10194 10706 gene locus_tag LOCUS_01260 10194 10706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 10714 11109 gene locus_tag LOCUS_01270 10714 11109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883066.1 protein_id gnl|my_center|LOCUS_01270 13479 11119 gene locus_tag LOCUS_01280 13479 11119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 16829 13947 gene locus_tag LOCUS_01290 16829 13947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 17673 17383 gene locus_tag LOCUS_01300 17673 17383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 18217 19575 gene locus_tag LOCUS_01310 gene dnaA 18217 19575 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883067.1 protein_id gnl|my_center|LOCUS_01310 19875 20390 gene locus_tag LOCUS_01320 19875 20390 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883068.1 protein_id gnl|my_center|LOCUS_01320 21052 20387 gene locus_tag LOCUS_01330 21052 20387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 21477 21076 gene locus_tag LOCUS_01340 21477 21076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 25496 21489 gene locus_tag LOCUS_01350 25496 21489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 26149 26802 gene locus_tag LOCUS_01360 26149 26802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 26835 27269 gene locus_tag LOCUS_01370 26835 27269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 28643 27303 gene locus_tag LOCUS_01380 28643 27303 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_01380 30069 29035 gene locus_tag LOCUS_01390 30069 29035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444437.1 protein_id gnl|my_center|LOCUS_01390 30490 30131 gene locus_tag LOCUS_01400 gene gcvH 30490 30131 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390798.1 protein_id gnl|my_center|LOCUS_01400 31152 30502 gene locus_tag LOCUS_01410 31152 30502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 33512 31149 gene locus_tag LOCUS_01420 33512 31149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 35156 33633 gene locus_tag LOCUS_01430 gene proS 35156 33633 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921836.1 protein_id gnl|my_center|LOCUS_01430 35910 35158 gene locus_tag LOCUS_01440 35910 35158 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883079.1 protein_id gnl|my_center|LOCUS_01440 36107 38653 gene locus_tag LOCUS_01450 36107 38653 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873700.1 protein_id gnl|my_center|LOCUS_01450 38790 40607 gene locus_tag LOCUS_01460 38790 40607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 42534 40612 gene locus_tag LOCUS_01470 gene glgB 42534 40612 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125230.1 protein_id gnl|my_center|LOCUS_01470 42663 43814 gene locus_tag LOCUS_01480 42663 43814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 43902 44957 gene locus_tag LOCUS_01490 gene mnmA 43902 44957 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398509.1 protein_id gnl|my_center|LOCUS_01490 46191 44965 gene locus_tag LOCUS_01500 46191 44965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 46353 47837 gene locus_tag LOCUS_01510 46353 47837 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534804.1 protein_id gnl|my_center|LOCUS_01510 47834 49039 gene locus_tag LOCUS_01520 47834 49039 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112616.1 protein_id gnl|my_center|LOCUS_01520 49036 50574 gene locus_tag LOCUS_01530 49036 50574 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193982.1 protein_id gnl|my_center|LOCUS_01530 52114 50642 gene locus_tag LOCUS_01540 52114 50642 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144080476.1 protein_id gnl|my_center|LOCUS_01540 54988 54257 gene locus_tag LOCUS_01550 54988 54257 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882711.1 protein_id gnl|my_center|LOCUS_01550 55466 55017 gene locus_tag LOCUS_01560 55466 55017 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882710.1 protein_id gnl|my_center|LOCUS_01560 55968 55525 gene locus_tag LOCUS_01570 gene dut 55968 55525 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882709.1 protein_id gnl|my_center|LOCUS_01570 57021 56065 gene locus_tag LOCUS_01580 gene accD 57021 56065 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882708.1 protein_id gnl|my_center|LOCUS_01580 57753 57136 gene locus_tag LOCUS_01590 57753 57136 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882707.1 protein_id gnl|my_center|LOCUS_01590 57906 58589 gene locus_tag LOCUS_01600 57906 58589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 59151 58540 gene locus_tag LOCUS_01610 59151 58540 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083508.1 protein_id gnl|my_center|LOCUS_01610 59356 60072 gene locus_tag LOCUS_01620 59356 60072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 >Feature sequence04 1071 217 gene locus_tag LOCUS_01630 1071 217 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947112.1 protein_id gnl|my_center|LOCUS_01630 1182 1481 gene locus_tag LOCUS_01640 1182 1481 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994575.1 protein_id gnl|my_center|LOCUS_01640 1420 1749 gene locus_tag LOCUS_01650 1420 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 2338 1937 gene locus_tag LOCUS_01660 2338 1937 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_01660 2917 2372 gene locus_tag LOCUS_01670 2917 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 3190 3747 gene locus_tag LOCUS_01680 3190 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 5066 3744 gene locus_tag LOCUS_01690 5066 3744 CDS product bifunctional cytidylyltransferase/SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107920.1 protein_id gnl|my_center|LOCUS_01690 6240 5155 gene locus_tag LOCUS_01700 6240 5155 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235007.1 protein_id gnl|my_center|LOCUS_01700 6739 6224 gene locus_tag LOCUS_01710 6739 6224 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421255.1 protein_id gnl|my_center|LOCUS_01710 6912 7295 gene locus_tag LOCUS_01720 6912 7295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 7323 7670 gene locus_tag LOCUS_01730 7323 7670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 8731 7715 gene locus_tag LOCUS_01740 8731 7715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 9766 8867 gene locus_tag LOCUS_01750 9766 8867 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021845.1 protein_id gnl|my_center|LOCUS_01750 9829 10596 gene locus_tag LOCUS_01760 9829 10596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 11695 10631 gene locus_tag LOCUS_01770 11695 10631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 12137 13381 gene locus_tag LOCUS_01780 12137 13381 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816897.1 protein_id gnl|my_center|LOCUS_01780 13920 13378 gene locus_tag LOCUS_01790 13920 13378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 14012 15451 gene locus_tag LOCUS_01800 gene trxB 14012 15451 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909042.1 protein_id gnl|my_center|LOCUS_01800 16194 15436 gene locus_tag LOCUS_01810 16194 15436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 16277 17179 gene locus_tag LOCUS_01820 16277 17179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 17255 18076 gene locus_tag LOCUS_01830 17255 18076 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086433.1 protein_id gnl|my_center|LOCUS_01830 18079 18813 gene locus_tag LOCUS_01840 18079 18813 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702850.1 protein_id gnl|my_center|LOCUS_01840 18871 19902 gene locus_tag LOCUS_01850 18871 19902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 20016 21158 gene locus_tag LOCUS_01860 20016 21158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 21183 22373 gene locus_tag LOCUS_01870 21183 22373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 22375 23160 gene locus_tag LOCUS_01880 gene rfbF 22375 23160 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859505.1 protein_id gnl|my_center|LOCUS_01880 23162 24166 gene locus_tag LOCUS_01890 23162 24166 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244102.1 protein_id gnl|my_center|LOCUS_01890 24163 25404 gene locus_tag LOCUS_01900 24163 25404 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987007.1 protein_id gnl|my_center|LOCUS_01900 25401 25928 gene locus_tag LOCUS_01910 gene rfbC 25401 25928 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987006.1 protein_id gnl|my_center|LOCUS_01910 25925 26827 gene locus_tag LOCUS_01920 25925 26827 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987005.1 protein_id gnl|my_center|LOCUS_01920 26827 27846 gene locus_tag LOCUS_01930 26827 27846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 27843 28895 gene locus_tag LOCUS_01940 27843 28895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 29790 29077 gene locus_tag LOCUS_01950 29790 29077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 30735 29806 gene locus_tag LOCUS_01960 30735 29806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 31991 30975 gene locus_tag LOCUS_01970 31991 30975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444587.1 protein_id gnl|my_center|LOCUS_01970 33334 32135 gene locus_tag LOCUS_01980 33334 32135 CDS product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883602.1 protein_id gnl|my_center|LOCUS_01980 33737 35686 gene locus_tag LOCUS_01990 33737 35686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 35850 36383 gene locus_tag LOCUS_02000 gene rfbC 35850 36383 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_02000 36380 37231 gene locus_tag LOCUS_02010 gene rfbD 36380 37231 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931999.1 protein_id gnl|my_center|LOCUS_02010 37221 38213 gene locus_tag LOCUS_02020 gene rfbB 37221 38213 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387761.1 protein_id gnl|my_center|LOCUS_02020 38210 38965 gene locus_tag LOCUS_02030 gene kdsB 38210 38965 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545187.1 protein_id gnl|my_center|LOCUS_02030 39019 40458 gene locus_tag LOCUS_02040 gene sufB 39019 40458 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056341.1 protein_id gnl|my_center|LOCUS_02040 40484 41227 gene locus_tag LOCUS_02050 gene sufC 40484 41227 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763669.1 protein_id gnl|my_center|LOCUS_02050 41231 42544 gene locus_tag LOCUS_02060 gene sufD 41231 42544 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946340.1 protein_id gnl|my_center|LOCUS_02060 42650 43897 gene locus_tag LOCUS_02070 42650 43897 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_02070 44757 44071 gene locus_tag LOCUS_02080 44757 44071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 46172 45054 gene locus_tag LOCUS_02090 46172 45054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 47483 46383 gene locus_tag LOCUS_02100 47483 46383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 48055 47693 gene locus_tag LOCUS_02110 48055 47693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 48802 48065 gene locus_tag LOCUS_02120 48802 48065 CDS product EscT/YscT/HrcT family type III secretion system export apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883460.1 protein_id gnl|my_center|LOCUS_02120 49168 48899 gene locus_tag LOCUS_02130 49168 48899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 49989 49174 gene locus_tag LOCUS_02140 gene cdsR 49989 49174 CDS product SctR family type III secretion system export apparatus subunit CdsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871927.1 protein_id gnl|my_center|LOCUS_02140 50731 50096 gene locus_tag LOCUS_02150 50731 50096 CDS product HrpE/YscL family type III secretion apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883463.1 protein_id gnl|my_center|LOCUS_02150 51600 50728 gene locus_tag LOCUS_02160 51600 50728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 52470 51610 gene locus_tag LOCUS_02170 gene sctJ 52470 51610 CDS product type III secretion inner membrane ring lipoprotein SctJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883465.1 protein_id gnl|my_center|LOCUS_02170 53787 52783 gene locus_tag LOCUS_02180 53787 52783 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_02180 54538 53759 gene locus_tag LOCUS_02190 54538 53759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 55151 54549 gene locus_tag LOCUS_02200 55151 54549 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883246.1 protein_id gnl|my_center|LOCUS_02200 56257 55148 gene locus_tag LOCUS_02210 56257 55148 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068709.1 protein_id gnl|my_center|LOCUS_02210 57461 56241 gene locus_tag LOCUS_02220 57461 56241 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929354.1 protein_id gnl|my_center|LOCUS_02220 57919 57458 gene locus_tag LOCUS_02230 gene pyrI 57919 57458 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032502.1 protein_id gnl|my_center|LOCUS_02230 58173 57913 gene locus_tag LOCUS_02240 58173 57913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 58317 59318 gene locus_tag LOCUS_02250 58317 59318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 59835 59416 gene locus_tag LOCUS_02260 59835 59416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 >Feature sequence05 2137 713 gene locus_tag LOCUS_02270 2137 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 3790 2462 gene locus_tag LOCUS_02280 gene rho 3790 2462 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883248.1 protein_id gnl|my_center|LOCUS_02280 4469 3864 gene locus_tag LOCUS_02290 gene coaE 4469 3864 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883249.1 protein_id gnl|my_center|LOCUS_02290 7138 4463 gene locus_tag LOCUS_02300 gene polA 7138 4463 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945860.1 protein_id gnl|my_center|LOCUS_02300 8229 7186 gene locus_tag LOCUS_02310 8229 7186 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883251.1 protein_id gnl|my_center|LOCUS_02310 8334 9233 gene locus_tag LOCUS_02320 gene menC 8334 9233 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838743.1 protein_id gnl|my_center|LOCUS_02320 10113 9220 gene locus_tag LOCUS_02330 10113 9220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 11361 10120 gene locus_tag LOCUS_02340 11361 10120 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873308.1 protein_id gnl|my_center|LOCUS_02340 11409 13145 gene locus_tag LOCUS_02350 gene mutL 11409 13145 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957996.1 protein_id gnl|my_center|LOCUS_02350 13129 14199 gene locus_tag LOCUS_02360 13129 14199 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883450.1 protein_id gnl|my_center|LOCUS_02360 14829 14179 gene locus_tag LOCUS_02370 14829 14179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 15058 17511 gene locus_tag LOCUS_02380 15058 17511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 17508 19292 gene locus_tag LOCUS_02390 17508 19292 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986853.1 protein_id gnl|my_center|LOCUS_02390 21605 19293 gene locus_tag LOCUS_02400 21605 19293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 22575 21688 gene locus_tag LOCUS_02410 22575 21688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 23162 22572 gene locus_tag LOCUS_02420 23162 22572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 25071 23206 gene locus_tag LOCUS_02430 25071 23206 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986707.1 protein_id gnl|my_center|LOCUS_02430 25641 25129 gene locus_tag LOCUS_02440 25641 25129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 25883 26872 gene locus_tag LOCUS_02450 25883 26872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 30006 26884 gene locus_tag LOCUS_02460 30006 26884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 30884 30129 gene locus_tag LOCUS_02470 30884 30129 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871850.1 protein_id gnl|my_center|LOCUS_02470 32112 30898 gene locus_tag LOCUS_02480 gene glgC 32112 30898 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883245.1 protein_id gnl|my_center|LOCUS_02480 33084 32182 gene locus_tag LOCUS_02490 33084 32182 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_02490 34043 33081 gene locus_tag LOCUS_02500 gene lipA 34043 33081 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883469.1 protein_id gnl|my_center|LOCUS_02500 35437 34040 gene locus_tag LOCUS_02510 gene lpdA 35437 34040 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883470.1 protein_id gnl|my_center|LOCUS_02510 35615 36139 gene locus_tag LOCUS_02520 35615 36139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 36353 37258 gene locus_tag LOCUS_02530 36353 37258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 38032 37571 gene locus_tag LOCUS_02540 38032 37571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 39088 38042 gene locus_tag LOCUS_02550 39088 38042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 42172 39203 gene locus_tag LOCUS_02560 gene secA 42172 39203 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873306.1 protein_id gnl|my_center|LOCUS_02560 42616 43023 gene locus_tag LOCUS_02570 42616 43023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 43020 43928 gene locus_tag LOCUS_02580 43020 43928 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922152.1 protein_id gnl|my_center|LOCUS_02580 44530 43925 gene locus_tag LOCUS_02590 gene nth 44530 43925 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778932.1 protein_id gnl|my_center|LOCUS_02590 45903 44527 gene locus_tag LOCUS_02600 gene mnmE 45903 44527 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546495.1 protein_id gnl|my_center|LOCUS_02600 46027 48675 gene locus_tag LOCUS_02610 46027 48675 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_02610 49274 48672 gene locus_tag LOCUS_02620 gene ruvA 49274 48672 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072405.1 protein_id gnl|my_center|LOCUS_02620 49825 49247 gene locus_tag LOCUS_02630 gene ruvC 49825 49247 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_02630 49980 51062 gene locus_tag LOCUS_02640 gene fic 49980 51062 CDS product adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073937.1 protein_id gnl|my_center|LOCUS_02640 51421 52488 gene locus_tag LOCUS_02650 gene waaF 51421 52488 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_02650 52492 53400 gene locus_tag LOCUS_02660 52492 53400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 53402 54583 gene locus_tag LOCUS_02670 53402 54583 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883491.1 protein_id gnl|my_center|LOCUS_02670 55454 54606 gene locus_tag LOCUS_02680 55454 54606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 >Feature sequence06 1077 121 gene locus_tag LOCUS_02690 1077 121 CDS product small ribosomal subunit Rsm22 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532524.1 protein_id gnl|my_center|LOCUS_02690 1899 1198 gene locus_tag LOCUS_02700 gene ung 1899 1198 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873171.1 protein_id gnl|my_center|LOCUS_02700 2672 1917 gene locus_tag LOCUS_02710 2672 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 2950 3204 gene locus_tag LOCUS_02720 2950 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872000.1 protein_id gnl|my_center|LOCUS_02720 3211 3287 gene locus_tag LOCUS_t00060 3211 3287 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4099 3278 gene locus_tag LOCUS_02730 4099 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 4699 5379 gene locus_tag LOCUS_02740 4699 5379 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_02740 5384 6322 gene locus_tag LOCUS_02750 5384 6322 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871997.1 protein_id gnl|my_center|LOCUS_02750 6555 7214 gene locus_tag LOCUS_02760 6555 7214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 8292 7237 gene locus_tag LOCUS_02770 gene recA 8292 7237 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883399.1 protein_id gnl|my_center|LOCUS_02770 8409 9308 gene locus_tag LOCUS_02780 8409 9308 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141161.1 protein_id gnl|my_center|LOCUS_02780 10690 9305 gene locus_tag LOCUS_02790 10690 9305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 12254 10734 gene locus_tag LOCUS_02800 12254 10734 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141163.1 protein_id gnl|my_center|LOCUS_02800 13710 12343 gene locus_tag LOCUS_02810 13710 12343 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946170.1 protein_id gnl|my_center|LOCUS_02810 13826 14800 gene locus_tag LOCUS_02820 gene glk 13826 14800 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141169.1 protein_id gnl|my_center|LOCUS_02820 14878 15048 gene locus_tag LOCUS_02830 14878 15048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 15734 15045 gene locus_tag LOCUS_02840 15734 15045 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944036.1 protein_id gnl|my_center|LOCUS_02840 16037 17575 gene locus_tag LOCUS_02850 gene oppA 16037 17575 CDS product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232957.1 protein_id gnl|my_center|LOCUS_02850 17578 17949 gene locus_tag LOCUS_02860 17578 17949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 17953 18399 gene locus_tag LOCUS_02870 17953 18399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 19244 18687 gene locus_tag LOCUS_02880 19244 18687 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873265.1 protein_id gnl|my_center|LOCUS_02880 20430 19228 gene locus_tag LOCUS_02890 20430 19228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873264.1 protein_id gnl|my_center|LOCUS_02890 21152 20517 gene locus_tag LOCUS_02900 21152 20517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 22567 21149 gene locus_tag LOCUS_02910 22567 21149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 22717 22989 gene locus_tag LOCUS_02920 22717 22989 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056384.1 protein_id gnl|my_center|LOCUS_02920 22983 24020 gene locus_tag LOCUS_02930 gene dusB 22983 24020 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873261.1 protein_id gnl|my_center|LOCUS_02930 23999 24268 gene locus_tag LOCUS_02940 23999 24268 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631905.1 protein_id gnl|my_center|LOCUS_02940 26579 24564 gene locus_tag LOCUS_02950 26579 24564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 27167 26661 gene locus_tag LOCUS_02960 27167 26661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 27771 27151 gene locus_tag LOCUS_02970 27771 27151 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873939.1 protein_id gnl|my_center|LOCUS_02970 30083 27924 gene locus_tag LOCUS_02980 gene greA 30083 27924 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883379.1 protein_id gnl|my_center|LOCUS_02980 30493 32658 gene locus_tag LOCUS_02990 30493 32658 CDS product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261015.1 protein_id gnl|my_center|LOCUS_02990 32800 34452 gene locus_tag LOCUS_03000 32800 34452 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883384.1 protein_id gnl|my_center|LOCUS_03000 34445 35665 gene locus_tag LOCUS_03010 34445 35665 CDS product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958287.1 protein_id gnl|my_center|LOCUS_03010 35678 37672 gene locus_tag LOCUS_03020 gene uvrB 35678 37672 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_03020 37669 39117 gene locus_tag LOCUS_03030 37669 39117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 39830 39063 gene locus_tag LOCUS_03040 39830 39063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 40018 41259 gene locus_tag LOCUS_03050 40018 41259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 41256 42296 gene locus_tag LOCUS_03060 gene gmd 41256 42296 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709513.1 protein_id gnl|my_center|LOCUS_03060 42293 43408 gene locus_tag LOCUS_03070 42293 43408 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583291.1 protein_id gnl|my_center|LOCUS_03070 43380 44765 gene locus_tag LOCUS_03080 43380 44765 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546227.1 protein_id gnl|my_center|LOCUS_03080 44767 46074 gene locus_tag LOCUS_03090 44767 46074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 47405 46242 gene locus_tag LOCUS_03100 47405 46242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 50218 47645 gene locus_tag LOCUS_03110 gene topA 50218 47645 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725288.1 protein_id gnl|my_center|LOCUS_03110 50559 51488 gene locus_tag LOCUS_03120 50559 51488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 51485 52564 gene locus_tag LOCUS_03130 51485 52564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 >Feature sequence07 494 147 gene locus_tag LOCUS_03140 494 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 1873 491 gene locus_tag LOCUS_03150 1873 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 1940 2944 gene locus_tag LOCUS_03160 gene trpS 1940 2944 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567794.1 protein_id gnl|my_center|LOCUS_03160 2956 4491 gene locus_tag LOCUS_03170 2956 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 6434 4473 gene locus_tag LOCUS_03180 6434 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 6989 6624 gene locus_tag LOCUS_03190 6989 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 12781 7088 gene locus_tag LOCUS_03200 gene uvrA 12781 7088 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121648.1 protein_id gnl|my_center|LOCUS_03200 12846 13922 gene locus_tag LOCUS_03210 gene galE 12846 13922 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393314.1 protein_id gnl|my_center|LOCUS_03210 14164 15966 gene locus_tag LOCUS_03220 gene pyk 14164 15966 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_03220 16462 16136 gene locus_tag LOCUS_03230 16462 16136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 17266 16553 gene locus_tag LOCUS_03240 17266 16553 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106127.1 protein_id gnl|my_center|LOCUS_03240 18453 17266 gene locus_tag LOCUS_03250 18453 17266 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873487.1 protein_id gnl|my_center|LOCUS_03250 18871 20028 gene locus_tag LOCUS_03260 18871 20028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 21171 20017 gene locus_tag LOCUS_03270 21171 20017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 22448 21168 gene locus_tag LOCUS_03280 22448 21168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871357.1 protein_id gnl|my_center|LOCUS_03280 23233 22433 gene locus_tag LOCUS_03290 gene cdaA 23233 22433 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882751.1 protein_id gnl|my_center|LOCUS_03290 23563 24954 gene locus_tag LOCUS_03300 23563 24954 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882752.1 protein_id gnl|my_center|LOCUS_03300 24951 25979 gene locus_tag LOCUS_03310 gene cydB 24951 25979 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_03310 26563 25973 gene locus_tag LOCUS_03320 26563 25973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 26869 27333 gene locus_tag LOCUS_03330 26869 27333 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086103.1 protein_id gnl|my_center|LOCUS_03330 27663 28091 gene locus_tag LOCUS_03340 gene nusB 27663 28091 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933372.1 protein_id gnl|my_center|LOCUS_03340 28173 29075 gene locus_tag LOCUS_03350 gene murB 28173 29075 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873442.1 protein_id gnl|my_center|LOCUS_03350 29062 29868 gene locus_tag LOCUS_03360 29062 29868 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459951.1 protein_id gnl|my_center|LOCUS_03360 29868 31082 gene locus_tag LOCUS_03370 29868 31082 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_03370 31867 31022 gene locus_tag LOCUS_03380 31867 31022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 34457 32352 gene locus_tag LOCUS_03390 34457 32352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 35008 34580 gene locus_tag LOCUS_03400 35008 34580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 35194 35808 gene locus_tag LOCUS_03410 35194 35808 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396292.1 protein_id gnl|my_center|LOCUS_03410 36643 36032 gene locus_tag LOCUS_03420 36643 36032 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873441.1 protein_id gnl|my_center|LOCUS_03420 38533 36749 gene locus_tag LOCUS_03430 38533 36749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 38892 38965 gene locus_tag LOCUS_t00070 38892 38965 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 38970 40547 gene locus_tag LOCUS_03440 gene thrS 38970 40547 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_03440 40609 41055 gene locus_tag LOCUS_03450 gene infC 40609 41055 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873444.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03450 41069 41266 gene locus_tag LOCUS_03460 gene rpmI 41069 41266 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872221.1 protein_id gnl|my_center|LOCUS_03460 41322 41678 gene locus_tag LOCUS_03470 gene rplT 41322 41678 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872966.1 protein_id gnl|my_center|LOCUS_03470 41739 42761 gene locus_tag LOCUS_03480 gene pheS 41739 42761 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367019.1 protein_id gnl|my_center|LOCUS_03480 42802 42889 gene locus_tag LOCUS_t00080 42802 42889 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 43328 42930 gene locus_tag LOCUS_03490 43328 42930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 44541 43339 gene locus_tag LOCUS_03500 44541 43339 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640538.1 protein_id gnl|my_center|LOCUS_03500 45869 44601 gene locus_tag LOCUS_03510 45869 44601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 47055 45886 gene locus_tag LOCUS_03520 47055 45886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 47252 48148 gene locus_tag LOCUS_03530 47252 48148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 48862 48257 gene locus_tag LOCUS_03540 48862 48257 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338369.1 protein_id gnl|my_center|LOCUS_03540 49673 49059 gene locus_tag LOCUS_03550 49673 49059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 >Feature sequence08 1241 144 gene locus_tag LOCUS_03560 1241 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 1439 4231 gene locus_tag LOCUS_03570 gene pknD 1439 4231 CDS product serine/threonine-protein kinase PknD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882745.1 protein_id gnl|my_center|LOCUS_03570 4228 4785 gene locus_tag LOCUS_03580 4228 4785 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228251.1 protein_id gnl|my_center|LOCUS_03580 5893 4865 gene locus_tag LOCUS_03590 5893 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 6082 8919 gene locus_tag LOCUS_03600 6082 8919 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873710.1 protein_id gnl|my_center|LOCUS_03600 8932 10260 gene locus_tag LOCUS_03610 8932 10260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 10612 10301 gene locus_tag LOCUS_03620 10612 10301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 11654 12538 gene locus_tag LOCUS_03630 11654 12538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 12632 13672 gene locus_tag LOCUS_03640 12632 13672 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942928.1 protein_id gnl|my_center|LOCUS_03640 14161 13637 gene locus_tag LOCUS_03650 14161 13637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 14164 14706 gene locus_tag LOCUS_03660 14164 14706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 16096 14696 gene locus_tag LOCUS_03670 gene fumC 16096 14696 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958006.1 protein_id gnl|my_center|LOCUS_03670 16639 16217 gene locus_tag LOCUS_03680 16639 16217 CDS product ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882742.1 protein_id gnl|my_center|LOCUS_03680 17303 16881 gene locus_tag LOCUS_03690 17303 16881 CDS product ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882742.1 protein_id gnl|my_center|LOCUS_03690 19317 17386 gene locus_tag LOCUS_03700 19317 17386 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882741.1 protein_id gnl|my_center|LOCUS_03700 19931 19314 gene locus_tag LOCUS_03710 19931 19314 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882740.1 protein_id gnl|my_center|LOCUS_03710 21234 19924 gene locus_tag LOCUS_03720 21234 19924 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882739.1 protein_id gnl|my_center|LOCUS_03720 23000 21231 gene locus_tag LOCUS_03730 23000 21231 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871655.1 protein_id gnl|my_center|LOCUS_03730 23786 23013 gene locus_tag LOCUS_03740 23786 23013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 24530 23901 gene locus_tag LOCUS_03750 24530 23901 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882736.1 protein_id gnl|my_center|LOCUS_03750 24801 25049 gene locus_tag LOCUS_03760 24801 25049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 25055 26101 gene locus_tag LOCUS_03770 25055 26101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 26101 26493 gene locus_tag LOCUS_03780 26101 26493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 26548 27039 gene locus_tag LOCUS_03790 26548 27039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 27202 28167 gene locus_tag LOCUS_03800 27202 28167 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056320.1 protein_id gnl|my_center|LOCUS_03800 28557 28279 gene locus_tag LOCUS_03810 28557 28279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 32862 28702 gene locus_tag LOCUS_03820 gene rpoC 32862 28702 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895278.1 protein_id gnl|my_center|LOCUS_03820 36641 32880 gene locus_tag LOCUS_03830 gene rpoB 36641 32880 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882731.1 protein_id gnl|my_center|LOCUS_03830 37197 36808 gene locus_tag LOCUS_03840 gene rplL 37197 36808 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882730.1 protein_id gnl|my_center|LOCUS_03840 37749 37231 gene locus_tag LOCUS_03850 gene rplJ 37749 37231 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924917.1 protein_id gnl|my_center|LOCUS_03850 38461 37751 gene locus_tag LOCUS_03860 gene rplA 38461 37751 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882728.1 protein_id gnl|my_center|LOCUS_03860 39189 38761 gene locus_tag LOCUS_03870 gene rplK 39189 38761 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882727.1 protein_id gnl|my_center|LOCUS_03870 39847 39299 gene locus_tag LOCUS_03880 gene nusG 39847 39299 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010892148.1 protein_id gnl|my_center|LOCUS_03880 40139 39864 gene locus_tag LOCUS_03890 40139 39864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 40396 40322 gene locus_tag LOCUS_t00090 40396 40322 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 41631 40447 gene locus_tag LOCUS_03900 gene tuf 41631 40447 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873724.1 protein_id gnl|my_center|LOCUS_03900 41750 41679 gene locus_tag LOCUS_t00100 41750 41679 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 42218 42000 gene locus_tag LOCUS_03910 gene infA 42218 42000 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882723.1 protein_id gnl|my_center|LOCUS_03910 42332 42787 gene locus_tag LOCUS_03920 42332 42787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 42850 43758 gene locus_tag LOCUS_03930 42850 43758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 44030 44896 gene locus_tag LOCUS_03940 44030 44896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 44908 45318 gene locus_tag LOCUS_03950 44908 45318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 >Feature sequence09 1065 214 gene locus_tag LOCUS_03960 1065 214 CDS product DUF2608 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599414.1 protein_id gnl|my_center|LOCUS_03960 1433 1744 gene locus_tag LOCUS_03970 1433 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 1665 1991 gene locus_tag LOCUS_03980 1665 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 3242 2016 gene locus_tag LOCUS_03990 3242 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 3381 3196 gene locus_tag LOCUS_04000 3381 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 3848 3513 gene locus_tag LOCUS_04010 3848 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 4118 4037 gene locus_tag LOCUS_t00110 4118 4037 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 4207 4136 gene locus_tag LOCUS_t00120 4207 4136 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4486 4262 gene locus_tag LOCUS_04020 4486 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 4632 5387 gene locus_tag LOCUS_04030 4632 5387 CDS product tRNA 2-thiocytidine biosynthesis TtcA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873646.1 protein_id gnl|my_center|LOCUS_04030 5626 7065 gene locus_tag LOCUS_04040 gene putP 5626 7065 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687602.1 protein_id gnl|my_center|LOCUS_04040 7097 7885 gene locus_tag LOCUS_04050 gene surE 7097 7885 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964421.1 protein_id gnl|my_center|LOCUS_04050 8194 7874 gene locus_tag LOCUS_04060 8194 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 11080 8381 gene locus_tag LOCUS_04070 11080 8381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 11393 11465 gene locus_tag LOCUS_t00130 11393 11465 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11481 11556 gene locus_tag LOCUS_t00140 11481 11556 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 11749 12648 gene locus_tag LOCUS_04080 11749 12648 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871567.1 protein_id gnl|my_center|LOCUS_04080 13717 12821 gene locus_tag LOCUS_04090 gene rfbA 13717 12821 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676152.1 protein_id gnl|my_center|LOCUS_04090 14308 13790 gene locus_tag LOCUS_04100 gene hpt 14308 13790 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016283.1 protein_id gnl|my_center|LOCUS_04100 15816 14446 gene locus_tag LOCUS_04110 gene accC 15816 14446 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882833.1 protein_id gnl|my_center|LOCUS_04110 16325 15825 gene locus_tag LOCUS_04120 gene accB 16325 15825 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871470.1 protein_id gnl|my_center|LOCUS_04120 17218 16661 gene locus_tag LOCUS_04130 17218 16661 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882835.1 protein_id gnl|my_center|LOCUS_04130 18441 17758 gene locus_tag LOCUS_04140 18441 17758 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870955.1 protein_id gnl|my_center|LOCUS_04140 19393 18425 gene locus_tag LOCUS_04150 19393 18425 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891913.1 protein_id gnl|my_center|LOCUS_04150 20121 19390 gene locus_tag LOCUS_04160 gene rpe 20121 19390 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882836.1 protein_id gnl|my_center|LOCUS_04160 21079 20273 gene locus_tag LOCUS_04170 21079 20273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 21356 23104 gene locus_tag LOCUS_04180 gene rpsA 21356 23104 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882963.1 protein_id gnl|my_center|LOCUS_04180 23328 24614 gene locus_tag LOCUS_04190 gene nusA 23328 24614 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873553.1 protein_id gnl|my_center|LOCUS_04190 24952 25521 gene locus_tag LOCUS_04200 24952 25521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 25404 27398 gene locus_tag LOCUS_04210 25404 27398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 27398 27775 gene locus_tag LOCUS_04220 gene rbfA 27398 27775 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719600.1 protein_id gnl|my_center|LOCUS_04220 27776 28492 gene locus_tag LOCUS_04230 gene truB 27776 28492 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872371.1 protein_id gnl|my_center|LOCUS_04230 28476 29252 gene locus_tag LOCUS_04240 28476 29252 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438310.1 protein_id gnl|my_center|LOCUS_04240 29316 29918 gene locus_tag LOCUS_04250 29316 29918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 30500 30285 gene locus_tag LOCUS_04260 30500 30285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 30637 31002 gene locus_tag LOCUS_04270 30637 31002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 31280 32377 gene locus_tag LOCUS_04280 gene ychF 31280 32377 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872268.1 protein_id gnl|my_center|LOCUS_04280 32389 33498 gene locus_tag LOCUS_04290 32389 33498 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_04290 33600 34673 gene locus_tag LOCUS_04300 gene cdsU 33600 34673 CDS product SctU family type III secretion system export apparatus subunit CdsU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873043.1 protein_id gnl|my_center|LOCUS_04300 34670 36802 gene locus_tag LOCUS_04310 gene sctV 34670 36802 CDS product type III secretion system export apparatus subunit SctV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882971.1 protein_id gnl|my_center|LOCUS_04310 36923 38017 gene locus_tag LOCUS_04320 36923 38017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 38010 38429 gene locus_tag LOCUS_04330 38010 38429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 38535 40145 gene locus_tag LOCUS_04340 38535 40145 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882974.1 protein_id gnl|my_center|LOCUS_04340 40228 41130 gene locus_tag LOCUS_04350 40228 41130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 41201 42811 gene locus_tag LOCUS_04360 41201 42811 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010892125.1 protein_id gnl|my_center|LOCUS_04360 43096 44169 gene locus_tag LOCUS_04370 43096 44169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 44363 44836 gene locus_tag LOCUS_04380 44363 44836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 >Feature sequence10 2105 144 gene locus_tag LOCUS_04390 2105 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 2312 3421 gene locus_tag LOCUS_04400 2312 3421 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883306.1 protein_id gnl|my_center|LOCUS_04400 3502 4050 gene locus_tag LOCUS_04410 3502 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 4649 4215 gene locus_tag LOCUS_04420 4649 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 5079 6377 gene locus_tag LOCUS_04430 5079 6377 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873891.1 protein_id gnl|my_center|LOCUS_04430 7216 6374 gene locus_tag LOCUS_04440 gene rsmA 7216 6374 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883692.1 protein_id gnl|my_center|LOCUS_04440 8398 7352 gene locus_tag LOCUS_04450 8398 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 9636 8500 gene locus_tag LOCUS_04460 9636 8500 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186079.1 protein_id gnl|my_center|LOCUS_04460 9904 10386 gene locus_tag LOCUS_04470 9904 10386 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305234.1 protein_id gnl|my_center|LOCUS_04470 10601 12316 gene locus_tag LOCUS_04480 gene lnt 10601 12316 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883291.1 protein_id gnl|my_center|LOCUS_04480 12590 13486 gene locus_tag LOCUS_04490 gene lpxC 12590 13486 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883290.1 protein_id gnl|my_center|LOCUS_04490 13486 13953 gene locus_tag LOCUS_04500 gene fabZ 13486 13953 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883289.1 protein_id gnl|my_center|LOCUS_04500 13978 14832 gene locus_tag LOCUS_04510 gene lpxA 13978 14832 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883288.1 protein_id gnl|my_center|LOCUS_04510 14960 15784 gene locus_tag LOCUS_04520 gene fmt 14960 15784 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392417.1 protein_id gnl|my_center|LOCUS_04520 15922 16731 gene locus_tag LOCUS_04530 15922 16731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 16789 17640 gene locus_tag LOCUS_04540 16789 17640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 18119 18955 gene locus_tag LOCUS_04550 18119 18955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 19058 19810 gene locus_tag LOCUS_04560 19058 19810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 20244 20909 gene locus_tag LOCUS_04570 gene rplC 20244 20909 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883285.1 protein_id gnl|my_center|LOCUS_04570 20925 21611 gene locus_tag LOCUS_04580 gene rplD 20925 21611 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883284.1 protein_id gnl|my_center|LOCUS_04580 21614 21952 gene locus_tag LOCUS_04590 21614 21952 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883283.1 protein_id gnl|my_center|LOCUS_04590 21972 22814 gene locus_tag LOCUS_04600 gene rplB 21972 22814 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871889.1 protein_id gnl|my_center|LOCUS_04600 22826 23158 gene locus_tag LOCUS_04610 gene rpsS 22826 23158 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891970.1 protein_id gnl|my_center|LOCUS_04610 23165 23500 gene locus_tag LOCUS_04620 gene rplV 23165 23500 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873874.1 protein_id gnl|my_center|LOCUS_04620 23516 24163 gene locus_tag LOCUS_04630 gene rpsC 23516 24163 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873873.1 protein_id gnl|my_center|LOCUS_04630 24168 24587 gene locus_tag LOCUS_04640 gene rplP 24168 24587 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883278.1 protein_id gnl|my_center|LOCUS_04640 24596 24802 gene locus_tag LOCUS_04650 24596 24802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 24810 25055 gene locus_tag LOCUS_04660 gene rpsQ 24810 25055 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459100.1 protein_id gnl|my_center|LOCUS_04660 25096 25464 gene locus_tag LOCUS_04670 gene rplN 25096 25464 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873871.1 protein_id gnl|my_center|LOCUS_04670 25475 25807 gene locus_tag LOCUS_04680 25475 25807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 25822 26370 gene locus_tag LOCUS_04690 gene rplE 25822 26370 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883273.1 protein_id gnl|my_center|LOCUS_04690 26384 26773 gene locus_tag LOCUS_04700 gene rpsH 26384 26773 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871879.1 protein_id gnl|my_center|LOCUS_04700 26793 27341 gene locus_tag LOCUS_04710 gene rplF 26793 27341 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_04710 27344 27715 gene locus_tag LOCUS_04720 gene rplR 27344 27715 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871877.1 protein_id gnl|my_center|LOCUS_04720 27730 28236 gene locus_tag LOCUS_04730 gene rpsE 27730 28236 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883269.1 protein_id gnl|my_center|LOCUS_04730 28286 28684 gene locus_tag LOCUS_04740 gene rplO 28286 28684 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326814.1 protein_id gnl|my_center|LOCUS_04740 28727 30097 gene locus_tag LOCUS_04750 gene secY 28727 30097 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873867.1 protein_id gnl|my_center|LOCUS_04750 30329 30697 gene locus_tag LOCUS_04760 gene rpsM 30329 30697 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871873.1 protein_id gnl|my_center|LOCUS_04760 30711 31133 gene locus_tag LOCUS_04770 gene rpsK 30711 31133 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871872.1 protein_id gnl|my_center|LOCUS_04770 31340 32437 gene locus_tag LOCUS_04780 31340 32437 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895349.1 protein_id gnl|my_center|LOCUS_04780 32434 32862 gene locus_tag LOCUS_04790 gene rplQ 32434 32862 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871870.1 protein_id gnl|my_center|LOCUS_04790 33006 34019 gene locus_tag LOCUS_04800 gene gap 33006 34019 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883262.1 protein_id gnl|my_center|LOCUS_04800 34118 34267 gene locus_tag LOCUS_04810 34118 34267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 34292 34543 gene locus_tag LOCUS_04820 34292 34543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 34540 35418 gene locus_tag LOCUS_04830 34540 35418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 35496 35580 gene locus_tag LOCUS_t00150 35496 35580 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 35689 36282 gene locus_tag LOCUS_04840 35689 36282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 36557 38245 gene locus_tag LOCUS_04850 36557 38245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 38348 38914 gene locus_tag LOCUS_04860 38348 38914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 41455 38924 gene locus_tag LOCUS_04870 gene mgtA 41455 38924 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402038.1 protein_id gnl|my_center|LOCUS_04870 42240 41494 gene locus_tag LOCUS_04880 42240 41494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 43480 42224 gene locus_tag LOCUS_04890 43480 42224 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886387.1 protein_id gnl|my_center|LOCUS_04890 >Feature sequence11 258 1661 gene locus_tag LOCUS_04900 gene vceC 258 1661 CDS product multidrug efflux MFS transporter outer membrane subunit VceC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798631.1 protein_id gnl|my_center|LOCUS_04900 1658 2845 gene locus_tag LOCUS_04910 1658 2845 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112616.1 protein_id gnl|my_center|LOCUS_04910 2842 4386 gene locus_tag LOCUS_04920 2842 4386 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112615.1 protein_id gnl|my_center|LOCUS_04920 4528 5496 gene locus_tag LOCUS_04930 4528 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 5572 6765 gene locus_tag LOCUS_04940 5572 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 8010 6868 gene locus_tag LOCUS_04950 8010 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 8189 9787 gene locus_tag LOCUS_04960 8189 9787 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125181.1 protein_id gnl|my_center|LOCUS_04960 16306 9797 gene locus_tag LOCUS_04970 16306 9797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 17542 16436 gene locus_tag LOCUS_04980 17542 16436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 17728 18144 gene locus_tag LOCUS_04990 17728 18144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 19499 18300 gene locus_tag LOCUS_05000 19499 18300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 20801 19503 gene locus_tag LOCUS_05010 20801 19503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 21548 20976 gene locus_tag LOCUS_05020 21548 20976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 21624 21968 gene locus_tag LOCUS_05030 21624 21968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 22657 21965 gene locus_tag LOCUS_05040 22657 21965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 23561 22722 gene locus_tag LOCUS_05050 23561 22722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 23668 23817 gene locus_tag LOCUS_05060 23668 23817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007609497.1 protein_id gnl|my_center|LOCUS_05060 24181 23975 gene locus_tag LOCUS_05070 24181 23975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 24983 24153 gene locus_tag LOCUS_05080 24983 24153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 25980 24997 gene locus_tag LOCUS_05090 25980 24997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 26924 25998 gene locus_tag LOCUS_05100 26924 25998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 27634 26981 gene locus_tag LOCUS_05110 27634 26981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 29189 27792 gene locus_tag LOCUS_05120 29189 27792 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947634.1 protein_id gnl|my_center|LOCUS_05120 29970 29182 gene locus_tag LOCUS_05130 gene dapF 29970 29182 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081881.1 protein_id gnl|my_center|LOCUS_05130 30797 29967 gene locus_tag LOCUS_05140 30797 29967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 31522 31052 gene locus_tag LOCUS_05150 gene argR 31522 31052 CDS product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771305.1 protein_id gnl|my_center|LOCUS_05150 32139 31519 gene locus_tag LOCUS_05160 32139 31519 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522757.1 protein_id gnl|my_center|LOCUS_05160 32753 32100 gene locus_tag LOCUS_05170 32753 32100 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526170.1 protein_id gnl|my_center|LOCUS_05170 33181 32765 gene locus_tag LOCUS_05180 33181 32765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 33325 34137 gene locus_tag LOCUS_05190 33325 34137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 34130 35572 gene locus_tag LOCUS_05200 34130 35572 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 protein_id gnl|my_center|LOCUS_05200 35660 36637 gene locus_tag LOCUS_05210 35660 36637 CDS product threo-3-hydroxy-L-aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090528.1 protein_id gnl|my_center|LOCUS_05210 36660 37658 gene locus_tag LOCUS_05220 gene eutC 36660 37658 CDS product ectoine utilization protein EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974132.1 protein_id gnl|my_center|LOCUS_05220 38457 37621 gene locus_tag LOCUS_05230 38457 37621 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267764.1 protein_id gnl|my_center|LOCUS_05230 38675 38962 gene locus_tag LOCUS_05240 38675 38962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 39202 39117 gene locus_tag LOCUS_t00160 39202 39117 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 39629 39318 gene locus_tag LOCUS_05250 39629 39318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 39806 40072 gene locus_tag LOCUS_05260 39806 40072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 40731 40132 gene locus_tag LOCUS_05270 40731 40132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 40971 40798 gene locus_tag LOCUS_05280 40971 40798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 41897 41028 gene locus_tag LOCUS_05290 41897 41028 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037585.1 protein_id gnl|my_center|LOCUS_05290 42929 42243 gene locus_tag LOCUS_05300 42929 42243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 >Feature sequence12 1220 378 gene locus_tag LOCUS_05310 1220 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 1438 2925 gene locus_tag LOCUS_05320 1438 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 2926 3789 gene locus_tag LOCUS_05330 2926 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 3928 4695 gene locus_tag LOCUS_05340 3928 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 5065 4772 gene locus_tag LOCUS_05350 gene rpsT 5065 4772 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008362910.1 protein_id gnl|my_center|LOCUS_05350 5271 5693 gene locus_tag LOCUS_05360 5271 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 6588 5740 gene locus_tag LOCUS_05370 6588 5740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 6699 8363 gene locus_tag LOCUS_05380 6699 8363 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883393.1 protein_id gnl|my_center|LOCUS_05380 8425 10593 gene locus_tag LOCUS_05390 8425 10593 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941031.1 protein_id gnl|my_center|LOCUS_05390 11564 10590 gene locus_tag LOCUS_05400 11564 10590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 12377 11571 gene locus_tag LOCUS_05410 12377 11571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 12503 14320 gene locus_tag LOCUS_05420 12503 14320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 14412 14340 gene locus_tag LOCUS_t00170 14412 14340 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 14515 15708 gene locus_tag LOCUS_05430 14515 15708 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483272.1 protein_id gnl|my_center|LOCUS_05430 15934 16890 gene locus_tag LOCUS_05440 15934 16890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 16987 17502 gene locus_tag LOCUS_05450 16987 17502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 17560 18609 gene locus_tag LOCUS_05460 17560 18609 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728257.1 protein_id gnl|my_center|LOCUS_05460 19205 18840 gene locus_tag LOCUS_05470 19205 18840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 19264 19467 gene locus_tag LOCUS_05480 19264 19467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 20513 19473 gene locus_tag LOCUS_05490 20513 19473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 21633 20521 gene locus_tag LOCUS_05500 21633 20521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 22172 21678 gene locus_tag LOCUS_05510 22172 21678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 22362 23396 gene locus_tag LOCUS_05520 gene mutY 22362 23396 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873046.1 protein_id gnl|my_center|LOCUS_05520 23454 24548 gene locus_tag LOCUS_05530 23454 24548 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_05530 24636 26750 gene locus_tag LOCUS_05540 24636 26750 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003185.1 protein_id gnl|my_center|LOCUS_05540 26763 27545 gene locus_tag LOCUS_05550 26763 27545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 27929 27546 gene locus_tag LOCUS_05560 27929 27546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 28114 29397 gene locus_tag LOCUS_05570 28114 29397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 29394 31709 gene locus_tag LOCUS_05580 29394 31709 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883452.1 protein_id gnl|my_center|LOCUS_05580 31702 33396 gene locus_tag LOCUS_05590 31702 33396 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883453.1 protein_id gnl|my_center|LOCUS_05590 33421 34608 gene locus_tag LOCUS_05600 33421 34608 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883454.1 protein_id gnl|my_center|LOCUS_05600 34819 35208 gene locus_tag LOCUS_05610 34819 35208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 35215 35715 gene locus_tag LOCUS_05620 35215 35715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 35719 36177 gene locus_tag LOCUS_05630 35719 36177 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872113.1 protein_id gnl|my_center|LOCUS_05630 36368 36748 gene locus_tag LOCUS_05640 36368 36748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 36962 39598 gene locus_tag LOCUS_05650 36962 39598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071268.1 protein_id gnl|my_center|LOCUS_05650 40039 39641 gene locus_tag LOCUS_05660 40039 39641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 41468 40269 gene locus_tag LOCUS_05670 41468 40269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 >Feature sequence13 321 88 gene locus_tag LOCUS_05680 321 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 647 904 gene locus_tag LOCUS_05690 647 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 1828 920 gene locus_tag LOCUS_05700 1828 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 2646 2026 gene locus_tag LOCUS_05710 gene rpsD 2646 2026 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725281.1 protein_id gnl|my_center|LOCUS_05710 3132 2782 gene locus_tag LOCUS_05720 gene cyoD 3132 2782 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809222.1 protein_id gnl|my_center|LOCUS_05720 3731 3129 gene locus_tag LOCUS_05730 3731 3129 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208651.1 protein_id gnl|my_center|LOCUS_05730 5677 3728 gene locus_tag LOCUS_05740 gene cyoB 5677 3728 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163523.1 protein_id gnl|my_center|LOCUS_05740 6543 5662 gene locus_tag LOCUS_05750 gene cyoA 6543 5662 CDS product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266850.1 protein_id gnl|my_center|LOCUS_05750 6658 6891 gene locus_tag LOCUS_05760 6658 6891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 7858 7196 gene locus_tag LOCUS_05770 7858 7196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 8226 7924 gene locus_tag LOCUS_05780 8226 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 8321 9289 gene locus_tag LOCUS_05790 8321 9289 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873959.1 protein_id gnl|my_center|LOCUS_05790 10088 9267 gene locus_tag LOCUS_05800 10088 9267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883362.1 protein_id gnl|my_center|LOCUS_05800 10107 12740 gene locus_tag LOCUS_05810 10107 12740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 12922 12737 gene locus_tag LOCUS_05820 12922 12737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 13082 13300 gene locus_tag LOCUS_05830 13082 13300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 14568 13597 gene locus_tag LOCUS_05840 14568 13597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 14955 14737 gene locus_tag LOCUS_05850 14955 14737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 15228 14956 gene locus_tag LOCUS_05860 15228 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 16166 15456 gene locus_tag LOCUS_05870 16166 15456 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958017.1 protein_id gnl|my_center|LOCUS_05870 16321 16854 gene locus_tag LOCUS_05880 16321 16854 CDS product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965776.1 protein_id gnl|my_center|LOCUS_05880 17500 17111 gene locus_tag LOCUS_05890 17500 17111 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986773.1 protein_id gnl|my_center|LOCUS_05890 18624 17623 gene locus_tag LOCUS_05900 18624 17623 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883233.1 protein_id gnl|my_center|LOCUS_05900 21019 18638 gene locus_tag LOCUS_05910 gene pheT 21019 18638 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_05910 21111 22352 gene locus_tag LOCUS_05920 21111 22352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 22916 23902 gene locus_tag LOCUS_05930 22916 23902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 25014 24433 gene locus_tag LOCUS_05940 25014 24433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 25996 24986 gene locus_tag LOCUS_05950 25996 24986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 28070 26259 gene locus_tag LOCUS_05960 28070 26259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 28421 28161 gene locus_tag LOCUS_05970 gene yidD 28421 28161 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106504.1 protein_id gnl|my_center|LOCUS_05970 28503 30245 gene locus_tag LOCUS_05980 28503 30245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 30272 30772 gene locus_tag LOCUS_05990 30272 30772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 31371 31117 gene locus_tag LOCUS_06000 31371 31117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 31900 32322 gene locus_tag LOCUS_06010 31900 32322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 33621 32356 gene locus_tag LOCUS_06020 33621 32356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 34859 33624 gene locus_tag LOCUS_06030 34859 33624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 35117 35302 gene locus_tag LOCUS_06040 35117 35302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 35385 36650 gene locus_tag LOCUS_06050 35385 36650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 36643 37896 gene locus_tag LOCUS_06060 36643 37896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 39147 37903 gene locus_tag LOCUS_06070 39147 37903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 39558 39893 gene locus_tag LOCUS_06080 39558 39893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 39890 40174 gene locus_tag LOCUS_06090 39890 40174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 40131 40361 gene locus_tag LOCUS_06100 40131 40361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 40574 40834 gene locus_tag LOCUS_06110 40574 40834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 >Feature sequence14 380 679 gene locus_tag LOCUS_06120 380 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 978 745 gene locus_tag LOCUS_06130 gene acpP 978 745 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882943.1 protein_id gnl|my_center|LOCUS_06130 1965 1210 gene locus_tag LOCUS_06140 gene fabG 1965 1210 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872488.1 protein_id gnl|my_center|LOCUS_06140 2908 1946 gene locus_tag LOCUS_06150 gene fabD 2908 1946 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_06150 3911 2901 gene locus_tag LOCUS_06160 3911 2901 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882946.1 protein_id gnl|my_center|LOCUS_06160 4087 4686 gene locus_tag LOCUS_06170 gene recR 4087 4686 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882947.1 protein_id gnl|my_center|LOCUS_06170 5009 7378 gene locus_tag LOCUS_06180 gene bamA 5009 7378 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725132.1 protein_id gnl|my_center|LOCUS_06180 7574 8140 gene locus_tag LOCUS_06190 7574 8140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 8168 9229 gene locus_tag LOCUS_06200 gene lpxD 8168 9229 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882950.1 protein_id gnl|my_center|LOCUS_06200 9315 10241 gene locus_tag LOCUS_06210 9315 10241 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932389.1 protein_id gnl|my_center|LOCUS_06210 11416 10385 gene locus_tag LOCUS_06220 11416 10385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 12735 11434 gene locus_tag LOCUS_06230 12735 11434 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873669.1 protein_id gnl|my_center|LOCUS_06230 13726 12746 gene locus_tag LOCUS_06240 13726 12746 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882953.1 protein_id gnl|my_center|LOCUS_06240 14791 13745 gene locus_tag LOCUS_06250 gene pdhA 14791 13745 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725133.1 protein_id gnl|my_center|LOCUS_06250 15108 14851 gene locus_tag LOCUS_06260 15108 14851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 15291 16691 gene locus_tag LOCUS_06270 15291 16691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 17060 18526 gene locus_tag LOCUS_06280 17060 18526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 19153 18494 gene locus_tag LOCUS_06290 gene pld 19153 18494 CDS product phospholipase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596866.1 protein_id gnl|my_center|LOCUS_06290 19209 19907 gene locus_tag LOCUS_06300 19209 19907 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126135.1 protein_id gnl|my_center|LOCUS_06300 19907 20242 gene locus_tag LOCUS_06310 19907 20242 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537521.1 protein_id gnl|my_center|LOCUS_06310 22200 20239 gene locus_tag LOCUS_06320 22200 20239 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883056.1 protein_id gnl|my_center|LOCUS_06320 23217 22246 gene locus_tag LOCUS_06330 23217 22246 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873685.1 protein_id gnl|my_center|LOCUS_06330 24315 23239 gene locus_tag LOCUS_06340 24315 23239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 24950 24636 gene locus_tag LOCUS_06350 24950 24636 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871614.1 protein_id gnl|my_center|LOCUS_06350 26429 25155 gene locus_tag LOCUS_06360 gene tyrS 26429 25155 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873530.1 protein_id gnl|my_center|LOCUS_06360 26853 26509 gene locus_tag LOCUS_06370 26853 26509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 28016 27273 gene locus_tag LOCUS_06380 28016 27273 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882787.1 protein_id gnl|my_center|LOCUS_06380 28074 28751 gene locus_tag LOCUS_06390 gene rpiA 28074 28751 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873074.1 protein_id gnl|my_center|LOCUS_06390 28763 29176 gene locus_tag LOCUS_06400 28763 29176 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882790.1 protein_id gnl|my_center|LOCUS_06400 29465 29187 gene locus_tag LOCUS_06410 29465 29187 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918130.1 protein_id gnl|my_center|LOCUS_06410 31313 29472 gene locus_tag LOCUS_06420 gene pepF 31313 29472 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725063.1 protein_id gnl|my_center|LOCUS_06420 31650 31961 gene locus_tag LOCUS_06430 31650 31961 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882785.1 protein_id gnl|my_center|LOCUS_06430 31982 33604 gene locus_tag LOCUS_06440 gene groL 31982 33604 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882784.1 protein_id gnl|my_center|LOCUS_06440 33731 34531 gene locus_tag LOCUS_06450 33731 34531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 34893 34528 gene locus_tag LOCUS_06460 34893 34528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 36585 35119 gene locus_tag LOCUS_06470 36585 35119 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957619.1 protein_id gnl|my_center|LOCUS_06470 36844 38082 gene locus_tag LOCUS_06480 36844 38082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 >Feature sequence15 1061 1765 gene locus_tag LOCUS_06490 1061 1765 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941819.1 protein_id gnl|my_center|LOCUS_06490 1784 2725 gene locus_tag LOCUS_06500 1784 2725 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877489.1 protein_id gnl|my_center|LOCUS_06500 2722 3408 gene locus_tag LOCUS_06510 2722 3408 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928634.1 protein_id gnl|my_center|LOCUS_06510 3705 3376 gene locus_tag LOCUS_06520 3705 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 3997 4584 gene locus_tag LOCUS_06530 3997 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 4593 5546 gene locus_tag LOCUS_06540 4593 5546 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249899.1 protein_id gnl|my_center|LOCUS_06540 6763 5558 gene locus_tag LOCUS_06550 6763 5558 CDS product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872202.1 protein_id gnl|my_center|LOCUS_06550 7423 7097 gene locus_tag LOCUS_06560 7423 7097 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102734.1 protein_id gnl|my_center|LOCUS_06560 8268 7648 gene locus_tag LOCUS_06570 8268 7648 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872114.1 protein_id gnl|my_center|LOCUS_06570 9024 8296 gene locus_tag LOCUS_06580 9024 8296 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081684.1 protein_id gnl|my_center|LOCUS_06580 9116 10618 gene locus_tag LOCUS_06590 gene glpK 9116 10618 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943390.1 protein_id gnl|my_center|LOCUS_06590 10615 12171 gene locus_tag LOCUS_06600 10615 12171 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_06600 12168 12731 gene locus_tag LOCUS_06610 12168 12731 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067204.1 protein_id gnl|my_center|LOCUS_06610 12997 16248 gene locus_tag LOCUS_06620 12997 16248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 16937 16311 gene locus_tag LOCUS_06630 gene mip 16937 16311 CDS product macrophage infectivity potentiator Mip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213317.1 protein_id gnl|my_center|LOCUS_06630 17124 17972 gene locus_tag LOCUS_06640 17124 17972 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788072.1 protein_id gnl|my_center|LOCUS_06640 18092 18382 gene locus_tag LOCUS_06650 gene trpR 18092 18382 CDS product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871513.1 protein_id gnl|my_center|LOCUS_06650 18414 19874 gene locus_tag LOCUS_06660 18414 19874 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958040.1 protein_id gnl|my_center|LOCUS_06660 19871 20446 gene locus_tag LOCUS_06670 19871 20446 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966439.1 protein_id gnl|my_center|LOCUS_06670 20440 21435 gene locus_tag LOCUS_06680 gene trpD 20440 21435 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869732.1 protein_id gnl|my_center|LOCUS_06680 21428 22162 gene locus_tag LOCUS_06690 gene trpC 21428 22162 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958041.1 protein_id gnl|my_center|LOCUS_06690 22152 22721 gene locus_tag LOCUS_06700 22152 22721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06700 22714 23874 gene locus_tag LOCUS_06710 22714 23874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06710 23871 24611 gene locus_tag LOCUS_06720 gene trpA 23871 24611 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958043.1 protein_id gnl|my_center|LOCUS_06720 24608 25627 gene locus_tag LOCUS_06730 gene aroF 24608 25627 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545770.1 protein_id gnl|my_center|LOCUS_06730 25692 26900 gene locus_tag LOCUS_06740 25692 26900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 27077 28168 gene locus_tag LOCUS_06750 27077 28168 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_06750 28188 28589 gene locus_tag LOCUS_06760 28188 28589 CDS product peptide chain release factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945928.1 protein_id gnl|my_center|LOCUS_06760 29874 28621 gene locus_tag LOCUS_06770 29874 28621 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941159.1 protein_id gnl|my_center|LOCUS_06770 30275 31462 gene locus_tag LOCUS_06780 30275 31462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 31547 32602 gene locus_tag LOCUS_06790 31547 32602 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_06790 34311 32632 gene locus_tag LOCUS_06800 34311 32632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 36533 34308 gene locus_tag LOCUS_06810 36533 34308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 36972 36538 gene locus_tag LOCUS_06820 36972 36538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 38171 37137 gene locus_tag LOCUS_06830 38171 37137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 >Feature sequence16 1845 340 gene locus_tag LOCUS_06840 1845 340 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031209.1 protein_id gnl|my_center|LOCUS_06840 2137 2054 gene locus_tag LOCUS_t00180 2137 2054 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4718 2208 gene locus_tag LOCUS_06850 4718 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 4844 6466 gene locus_tag LOCUS_06860 4844 6466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 6475 8202 gene locus_tag LOCUS_06870 6475 8202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 8721 8242 gene locus_tag LOCUS_06880 8721 8242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 9951 8725 gene locus_tag LOCUS_06890 9951 8725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 10159 10794 gene locus_tag LOCUS_06900 10159 10794 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872215.1 protein_id gnl|my_center|LOCUS_06900 10791 11780 gene locus_tag LOCUS_06910 10791 11780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 12198 11767 gene locus_tag LOCUS_06920 12198 11767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 12356 12280 gene locus_tag LOCUS_t00190 12356 12280 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13111 12422 gene locus_tag LOCUS_06930 13111 12422 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036036.1 protein_id gnl|my_center|LOCUS_06930 13222 14814 gene locus_tag LOCUS_06940 13222 14814 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895403.1 protein_id gnl|my_center|LOCUS_06940 15928 14837 gene locus_tag LOCUS_06950 gene recF 15928 14837 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871423.1 protein_id gnl|my_center|LOCUS_06950 17036 15936 gene locus_tag LOCUS_06960 gene dnaN 17036 15936 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725022.1 protein_id gnl|my_center|LOCUS_06960 17764 17294 gene locus_tag LOCUS_06970 gene smpB 17764 17294 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882985.1 protein_id gnl|my_center|LOCUS_06970 19200 17764 gene locus_tag LOCUS_06980 19200 17764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 19622 22165 gene locus_tag LOCUS_06990 gene leuS 19622 22165 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873640.1 protein_id gnl|my_center|LOCUS_06990 22158 23426 gene locus_tag LOCUS_07000 22158 23426 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_07000 23488 23562 gene locus_tag LOCUS_t00200 23488 23562 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 23580 23658 gene locus_tag LOCUS_t00210 23580 23658 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 24316 23786 gene locus_tag LOCUS_07010 24316 23786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 24652 24317 gene locus_tag LOCUS_07020 24652 24317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 24833 25249 gene locus_tag LOCUS_07030 24833 25249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 26179 25274 gene locus_tag LOCUS_07040 26179 25274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 26536 27354 gene locus_tag LOCUS_07050 26536 27354 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403347.1 protein_id gnl|my_center|LOCUS_07050 28197 27361 gene locus_tag LOCUS_07060 28197 27361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 28558 29625 gene locus_tag LOCUS_07070 28558 29625 CDS product proton-gated ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144181.1 protein_id gnl|my_center|LOCUS_07070 29711 30169 gene locus_tag LOCUS_07080 29711 30169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 30940 30176 gene locus_tag LOCUS_07090 30940 30176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 31174 32196 gene locus_tag LOCUS_07100 31174 32196 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183240.1 protein_id gnl|my_center|LOCUS_07100 32199 33491 gene locus_tag LOCUS_07110 32199 33491 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881249.1 protein_id gnl|my_center|LOCUS_07110 33482 34768 gene locus_tag LOCUS_07120 33482 34768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 34927 36615 gene locus_tag LOCUS_07130 34927 36615 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948656.1 protein_id gnl|my_center|LOCUS_07130 37254 36745 gene locus_tag LOCUS_07140 gene tpx 37254 36745 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089950.1 protein_id gnl|my_center|LOCUS_07140 >Feature sequence17 1293 100 gene locus_tag LOCUS_07150 1293 100 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 protein_id gnl|my_center|LOCUS_07150 3072 1312 gene locus_tag LOCUS_07160 3072 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 3412 3077 gene locus_tag LOCUS_07170 3412 3077 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883126.1 protein_id gnl|my_center|LOCUS_07170 4427 3561 gene locus_tag LOCUS_07180 4427 3561 CDS product MYG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895332.1 protein_id gnl|my_center|LOCUS_07180 4615 6735 gene locus_tag LOCUS_07190 4615 6735 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883128.1 protein_id gnl|my_center|LOCUS_07190 8442 6820 gene locus_tag LOCUS_07200 8442 6820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 9633 8551 gene locus_tag LOCUS_07210 9633 8551 CDS product DUF1207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873776.1 protein_id gnl|my_center|LOCUS_07210 9875 9949 gene locus_tag LOCUS_t00220 9875 9949 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10202 10008 gene locus_tag LOCUS_07220 10202 10008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 10623 11264 gene locus_tag LOCUS_07230 10623 11264 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742191.1 protein_id gnl|my_center|LOCUS_07230 11274 11684 gene locus_tag LOCUS_07240 11274 11684 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964388.1 protein_id gnl|my_center|LOCUS_07240 11921 11724 gene locus_tag LOCUS_07250 11921 11724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 11894 12586 gene locus_tag LOCUS_07260 11894 12586 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444790.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07260 13231 12590 gene locus_tag LOCUS_07270 13231 12590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 13289 13657 gene locus_tag LOCUS_07280 13289 13657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 14341 15774 gene locus_tag LOCUS_07290 14341 15774 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 protein_id gnl|my_center|LOCUS_07290 15941 16108 gene locus_tag LOCUS_07300 15941 16108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 16154 16732 gene locus_tag LOCUS_07310 16154 16732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 17365 16700 gene locus_tag LOCUS_07320 17365 16700 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266861.1 protein_id gnl|my_center|LOCUS_07320 17661 17434 gene locus_tag LOCUS_07330 17661 17434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 18136 18390 gene locus_tag LOCUS_07340 18136 18390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 18587 19387 gene locus_tag LOCUS_07350 18587 19387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 20432 19596 gene locus_tag LOCUS_07360 20432 19596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 21175 24003 gene locus_tag LOCUS_07370 21175 24003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 24685 24158 gene locus_tag LOCUS_07380 24685 24158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 25453 26022 gene locus_tag LOCUS_07390 25453 26022 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946355.1 protein_id gnl|my_center|LOCUS_07390 26353 26955 gene locus_tag LOCUS_07400 26353 26955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 27336 28340 gene locus_tag LOCUS_07410 27336 28340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 28337 29407 gene locus_tag LOCUS_07420 28337 29407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 29408 29776 gene locus_tag LOCUS_07430 29408 29776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 30657 30370 gene locus_tag LOCUS_07440 30657 30370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 30901 31215 gene locus_tag LOCUS_07450 30901 31215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 31240 31701 gene locus_tag LOCUS_07460 31240 31701 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928801.1 protein_id gnl|my_center|LOCUS_07460 31820 32965 gene locus_tag LOCUS_07470 31820 32965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088844313.1 protein_id gnl|my_center|LOCUS_07470 35341 33284 gene locus_tag LOCUS_07480 35341 33284 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389110.1 protein_id gnl|my_center|LOCUS_07480 35663 36466 gene locus_tag LOCUS_07490 gene blaOXA 35663 36466 CDS product class D beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444455.1 protein_id gnl|my_center|LOCUS_07490 >Feature sequence18 560 381 gene locus_tag LOCUS_07500 560 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 551 3589 gene locus_tag LOCUS_07510 551 3589 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010892217.1 protein_id gnl|my_center|LOCUS_07510 3590 4579 gene locus_tag LOCUS_07520 3590 4579 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873588.1 protein_id gnl|my_center|LOCUS_07520 4639 5118 gene locus_tag LOCUS_07530 4639 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263939.1 protein_id gnl|my_center|LOCUS_07530 5306 5124 gene locus_tag LOCUS_07540 5306 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 6617 5706 gene locus_tag LOCUS_07550 6617 5706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 7959 6607 gene locus_tag LOCUS_07560 7959 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 9059 7956 gene locus_tag LOCUS_07570 gene murG 9059 7956 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883539.1 protein_id gnl|my_center|LOCUS_07570 10149 9046 gene locus_tag LOCUS_07580 gene ftsW 10149 9046 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883538.1 protein_id gnl|my_center|LOCUS_07580 10930 10157 gene locus_tag LOCUS_07590 10930 10157 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883537.1 protein_id gnl|my_center|LOCUS_07590 12330 11023 gene locus_tag LOCUS_07600 gene murD 12330 11023 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883536.1 protein_id gnl|my_center|LOCUS_07600 13596 12334 gene locus_tag LOCUS_07610 gene mraY 13596 12334 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116751.1 protein_id gnl|my_center|LOCUS_07610 15113 13710 gene locus_tag LOCUS_07620 15113 13710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 16746 15352 gene locus_tag LOCUS_07630 16746 15352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 18103 16772 gene locus_tag LOCUS_07640 18103 16772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 19547 18213 gene locus_tag LOCUS_07650 19547 18213 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883534.1 protein_id gnl|my_center|LOCUS_07650 20281 19610 gene locus_tag LOCUS_07660 20281 19610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 20421 21443 gene locus_tag LOCUS_07670 20421 21443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 21598 21672 gene locus_tag LOCUS_t00230 21598 21672 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 21689 22522 gene locus_tag LOCUS_07680 gene rsmI 21689 22522 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989365.1 protein_id gnl|my_center|LOCUS_07680 22758 23519 gene locus_tag LOCUS_07690 22758 23519 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723743.1 protein_id gnl|my_center|LOCUS_07690 23524 25113 gene locus_tag LOCUS_07700 gene groL 23524 25113 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932217.1 protein_id gnl|my_center|LOCUS_07700 25392 26282 gene locus_tag LOCUS_07710 25392 26282 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814057.1 protein_id gnl|my_center|LOCUS_07710 27243 26299 gene locus_tag LOCUS_07720 27243 26299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 27443 27802 gene locus_tag LOCUS_07730 27443 27802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 27828 28778 gene locus_tag LOCUS_07740 27828 28778 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883532.1 protein_id gnl|my_center|LOCUS_07740 28781 29200 gene locus_tag LOCUS_07750 28781 29200 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328825.1 protein_id gnl|my_center|LOCUS_07750 29237 30994 gene locus_tag LOCUS_07760 29237 30994 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786230.1 protein_id gnl|my_center|LOCUS_07760 30988 31788 gene locus_tag LOCUS_07770 30988 31788 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207902.1 protein_id gnl|my_center|LOCUS_07770 32497 31757 gene locus_tag LOCUS_07780 32497 31757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 34715 32580 gene locus_tag LOCUS_07790 34715 32580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 >Feature sequence19 1177 767 gene locus_tag LOCUS_07800 1177 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 1424 2425 gene locus_tag LOCUS_07810 1424 2425 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948507.1 protein_id gnl|my_center|LOCUS_07810 3908 2484 gene locus_tag LOCUS_07820 3908 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 4192 4461 gene locus_tag LOCUS_07830 4192 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 4483 6201 gene locus_tag LOCUS_07840 4483 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 6277 6795 gene locus_tag LOCUS_07850 6277 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 6831 8321 gene locus_tag LOCUS_07860 6831 8321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 8656 8289 gene locus_tag LOCUS_tm00010 8656 8289 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 8841 9626 gene locus_tag LOCUS_07870 8841 9626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 9923 13042 gene locus_tag LOCUS_07880 gene ileS 9923 13042 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873497.1 protein_id gnl|my_center|LOCUS_07880 14354 13263 gene locus_tag LOCUS_07890 14354 13263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 14275 14547 gene locus_tag LOCUS_07900 14275 14547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 16516 14876 gene locus_tag LOCUS_07910 16516 14876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 17587 16550 gene locus_tag LOCUS_07920 17587 16550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 18654 17590 gene locus_tag LOCUS_07930 18654 17590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 19164 18676 gene locus_tag LOCUS_07940 19164 18676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 19926 19168 gene locus_tag LOCUS_07950 19926 19168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 21062 19923 gene locus_tag LOCUS_07960 21062 19923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 22153 21059 gene locus_tag LOCUS_07970 22153 21059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 23244 22150 gene locus_tag LOCUS_07980 23244 22150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 24423 23302 gene locus_tag LOCUS_07990 24423 23302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 25460 24423 gene locus_tag LOCUS_08000 25460 24423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 25815 25627 gene locus_tag LOCUS_08010 25815 25627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 27704 25812 gene locus_tag LOCUS_08020 gene lepB 27704 25812 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882760.1 protein_id gnl|my_center|LOCUS_08020 28398 27742 gene locus_tag LOCUS_08030 28398 27742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 29306 28395 gene locus_tag LOCUS_08040 29306 28395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 30513 29581 gene locus_tag LOCUS_08050 30513 29581 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887745.1 protein_id gnl|my_center|LOCUS_08050 30726 30989 gene locus_tag LOCUS_08060 30726 30989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 30967 32442 gene locus_tag LOCUS_08070 30967 32442 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_08070 32439 33050 gene locus_tag LOCUS_08080 gene pncA 32439 33050 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030361.1 protein_id gnl|my_center|LOCUS_08080 34140 33037 gene locus_tag LOCUS_08090 34140 33037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692293.1 protein_id gnl|my_center|LOCUS_08090 >Feature sequence20 210 1493 gene locus_tag LOCUS_08100 210 1493 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285177.1 protein_id gnl|my_center|LOCUS_08100 1494 2237 gene locus_tag LOCUS_08110 1494 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 2234 4204 gene locus_tag LOCUS_08120 2234 4204 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883503.1 protein_id gnl|my_center|LOCUS_08120 4538 4191 gene locus_tag LOCUS_08130 4538 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 7339 4532 gene locus_tag LOCUS_08140 7339 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 9540 7417 gene locus_tag LOCUS_08150 9540 7417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 10184 13267 gene locus_tag LOCUS_08160 10184 13267 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942209.1 protein_id gnl|my_center|LOCUS_08160 13385 14569 gene locus_tag LOCUS_08170 gene hrcA 13385 14569 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883139.1 protein_id gnl|my_center|LOCUS_08170 14566 15126 gene locus_tag LOCUS_08180 14566 15126 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883140.1 protein_id gnl|my_center|LOCUS_08180 15130 17043 gene locus_tag LOCUS_08190 gene dnaK 15130 17043 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871748.1 protein_id gnl|my_center|LOCUS_08190 17990 17262 gene locus_tag LOCUS_08200 17990 17262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 18442 18137 gene locus_tag LOCUS_08210 18442 18137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 19704 18703 gene locus_tag LOCUS_08220 19704 18703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 19932 21164 gene locus_tag LOCUS_08230 gene pcnB 19932 21164 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883599.1 protein_id gnl|my_center|LOCUS_08230 21161 21943 gene locus_tag LOCUS_08240 21161 21943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 21933 23069 gene locus_tag LOCUS_08250 21933 23069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 23138 23599 gene locus_tag LOCUS_08260 23138 23599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 23958 24986 gene locus_tag LOCUS_08270 gene plsX 23958 24986 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883595.1 protein_id gnl|my_center|LOCUS_08270 25154 26698 gene locus_tag LOCUS_08280 25154 26698 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873419.1 protein_id gnl|my_center|LOCUS_08280 26676 27689 gene locus_tag LOCUS_08290 26676 27689 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872190.1 protein_id gnl|my_center|LOCUS_08290 27701 28837 gene locus_tag LOCUS_08300 27701 28837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 28925 31819 gene locus_tag LOCUS_08310 28925 31819 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873417.1 protein_id gnl|my_center|LOCUS_08310 31816 32532 gene locus_tag LOCUS_08320 31816 32532 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941968.1 protein_id gnl|my_center|LOCUS_08320 33122 32529 gene locus_tag LOCUS_08330 33122 32529 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073951.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence21 1542 256 gene locus_tag LOCUS_08340 gene nhaD 1542 256 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_08340 2584 1625 gene locus_tag LOCUS_08350 2584 1625 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544949.1 protein_id gnl|my_center|LOCUS_08350 2704 4152 gene locus_tag LOCUS_08360 2704 4152 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_08360 4235 5236 gene locus_tag LOCUS_08370 4235 5236 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140793.1 protein_id gnl|my_center|LOCUS_08370 6494 5277 gene locus_tag LOCUS_08380 6494 5277 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041466979.1 protein_id gnl|my_center|LOCUS_08380 7540 6491 gene locus_tag LOCUS_08390 gene lpxK 7540 6491 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883167.1 protein_id gnl|my_center|LOCUS_08390 8222 7614 gene locus_tag LOCUS_08400 gene lpcA 8222 7614 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284050.1 protein_id gnl|my_center|LOCUS_08400 8335 9345 gene locus_tag LOCUS_08410 8335 9345 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087456.1 protein_id gnl|my_center|LOCUS_08410 9345 10874 gene locus_tag LOCUS_08420 9345 10874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 11924 10887 gene locus_tag LOCUS_08430 11924 10887 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940843.1 protein_id gnl|my_center|LOCUS_08430 12795 12178 gene locus_tag LOCUS_08440 12795 12178 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_08440 13619 12795 gene locus_tag LOCUS_08450 13619 12795 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887660.1 protein_id gnl|my_center|LOCUS_08450 14443 13607 gene locus_tag LOCUS_08460 14443 13607 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_08460 14738 15502 gene locus_tag LOCUS_08470 14738 15502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 16328 15504 gene locus_tag LOCUS_08480 16328 15504 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133827.1 protein_id gnl|my_center|LOCUS_08480 17577 16333 gene locus_tag LOCUS_08490 17577 16333 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081038.1 protein_id gnl|my_center|LOCUS_08490 18287 17574 gene locus_tag LOCUS_08500 18287 17574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 19895 18390 gene locus_tag LOCUS_08510 19895 18390 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220208744.1 protein_id gnl|my_center|LOCUS_08510 20899 20357 gene locus_tag LOCUS_08520 20899 20357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 21270 20905 gene locus_tag LOCUS_08530 21270 20905 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883172.1 protein_id gnl|my_center|LOCUS_08530 21757 21284 gene locus_tag LOCUS_08540 gene nrdR 21757 21284 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883171.1 protein_id gnl|my_center|LOCUS_08540 23102 21942 gene locus_tag LOCUS_08550 23102 21942 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015579.1 protein_id gnl|my_center|LOCUS_08550 23552 23464 gene locus_tag LOCUS_t00240 23552 23464 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 24041 23607 gene locus_tag LOCUS_08560 24041 23607 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764906.1 protein_id gnl|my_center|LOCUS_08560 24746 24045 gene locus_tag LOCUS_08570 24746 24045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 24893 25759 gene locus_tag LOCUS_08580 24893 25759 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883179.1 protein_id gnl|my_center|LOCUS_08580 25756 26496 gene locus_tag LOCUS_08590 25756 26496 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933759.1 protein_id gnl|my_center|LOCUS_08590 26489 27325 gene locus_tag LOCUS_08600 26489 27325 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725195.1 protein_id gnl|my_center|LOCUS_08600 27633 27472 gene locus_tag LOCUS_08610 27633 27472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 28008 28319 gene locus_tag LOCUS_08620 gene rplU 28008 28319 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883184.1 protein_id gnl|my_center|LOCUS_08620 28333 28584 gene locus_tag LOCUS_08630 gene rpmA 28333 28584 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883183.1 protein_id gnl|my_center|LOCUS_08630 28660 29673 gene locus_tag LOCUS_08640 gene cgtA 28660 29673 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873797.1 protein_id gnl|my_center|LOCUS_08640 31015 29729 gene locus_tag LOCUS_08650 31015 29729 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704387.1 protein_id gnl|my_center|LOCUS_08650 31276 32232 gene locus_tag LOCUS_08660 31276 32232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 32222 32605 gene locus_tag LOCUS_08670 32222 32605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence22 276 1895 gene locus_tag LOCUS_08680 276 1895 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669835.1 protein_id gnl|my_center|LOCUS_08680 3982 1961 gene locus_tag LOCUS_08690 3982 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 4700 6025 gene locus_tag LOCUS_08700 4700 6025 CDS product 7-dehydrocholesterol reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958044.1 protein_id gnl|my_center|LOCUS_08700 6207 6917 gene locus_tag LOCUS_08710 6207 6917 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_08710 7030 7434 gene locus_tag LOCUS_08720 7030 7434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 10203 7534 gene locus_tag LOCUS_08730 10203 7534 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_08730 10287 11483 gene locus_tag LOCUS_08740 10287 11483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 12417 11506 gene locus_tag LOCUS_08750 12417 11506 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132828.1 protein_id gnl|my_center|LOCUS_08750 13337 12414 gene locus_tag LOCUS_08760 13337 12414 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970198.1 protein_id gnl|my_center|LOCUS_08760 13645 14226 gene locus_tag LOCUS_08770 13645 14226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 14238 15011 gene locus_tag LOCUS_08780 gene ydfG 14238 15011 CDS product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185593.1 protein_id gnl|my_center|LOCUS_08780 15100 16395 gene locus_tag LOCUS_08790 15100 16395 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947610.1 protein_id gnl|my_center|LOCUS_08790 18366 16567 gene locus_tag LOCUS_08800 18366 16567 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590871.1 protein_id gnl|my_center|LOCUS_08800 19247 18363 gene locus_tag LOCUS_08810 19247 18363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 20199 19408 gene locus_tag LOCUS_08820 20199 19408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 21564 20566 gene locus_tag LOCUS_08830 gene hemB 21564 20566 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958218.1 protein_id gnl|my_center|LOCUS_08830 21642 22160 gene locus_tag LOCUS_08840 21642 22160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 22217 24802 gene locus_tag LOCUS_08850 22217 24802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 25024 26979 gene locus_tag LOCUS_08860 25024 26979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 27118 28116 gene locus_tag LOCUS_08870 27118 28116 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258144.1 protein_id gnl|my_center|LOCUS_08870 29548 28097 gene locus_tag LOCUS_08880 29548 28097 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932680.1 protein_id gnl|my_center|LOCUS_08880 30876 29563 gene locus_tag LOCUS_08890 30876 29563 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882756.1 protein_id gnl|my_center|LOCUS_08890 31089 31811 gene locus_tag LOCUS_08900 31089 31811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010724984.1 protein_id gnl|my_center|LOCUS_08900 >Feature sequence23 200 1348 gene locus_tag LOCUS_08910 200 1348 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883490.1 protein_id gnl|my_center|LOCUS_08910 1362 2894 gene locus_tag LOCUS_08920 1362 2894 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_08920 3390 2827 gene locus_tag LOCUS_08930 3390 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 3901 3368 gene locus_tag LOCUS_08940 3901 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 4831 4334 gene locus_tag LOCUS_08950 4831 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 5499 4906 gene locus_tag LOCUS_08960 5499 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 6747 7802 gene locus_tag LOCUS_08970 6747 7802 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121884.1 protein_id gnl|my_center|LOCUS_08970 8355 9536 gene locus_tag LOCUS_08980 8355 9536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 10472 9519 gene locus_tag LOCUS_08990 10472 9519 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141070.1 protein_id gnl|my_center|LOCUS_08990 10562 11614 gene locus_tag LOCUS_09000 gene wza 10562 11614 CDS product polysaccharide export protein Wza inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978097.1 protein_id gnl|my_center|LOCUS_09000 11611 14280 gene locus_tag LOCUS_09010 11611 14280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 14283 15242 gene locus_tag LOCUS_09020 14283 15242 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_09020 15309 15755 gene locus_tag LOCUS_09030 15309 15755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 19174 15794 gene locus_tag LOCUS_09040 19174 15794 CDS product PBP2-transglycosylase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883332.1 protein_id gnl|my_center|LOCUS_09040 19382 23917 gene locus_tag LOCUS_09050 19382 23917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 24018 24088 gene locus_tag LOCUS_t00250 24018 24088 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 24262 25050 gene locus_tag LOCUS_09060 gene rpsB 24262 25050 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883334.1 protein_id gnl|my_center|LOCUS_09060 25047 25898 gene locus_tag LOCUS_09070 gene tsf 25047 25898 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883335.1 protein_id gnl|my_center|LOCUS_09070 25900 26628 gene locus_tag LOCUS_09080 gene pyrH 25900 26628 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_09080 26632 27183 gene locus_tag LOCUS_09090 gene frr 26632 27183 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883337.1 protein_id gnl|my_center|LOCUS_09090 27300 27375 gene locus_tag LOCUS_t00260 27300 27375 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 27413 27485 gene locus_tag LOCUS_t00270 27413 27485 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 27646 27945 gene locus_tag LOCUS_09100 27646 27945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 30802 28586 gene locus_tag LOCUS_09110 30802 28586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence24 310 110 gene locus_tag LOCUS_09120 310 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 576 1415 gene locus_tag LOCUS_09130 576 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 1466 2734 gene locus_tag LOCUS_09140 gene rlmD 1466 2734 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722228.1 protein_id gnl|my_center|LOCUS_09140 4456 2663 gene locus_tag LOCUS_09150 4456 2663 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990142.1 protein_id gnl|my_center|LOCUS_09150 5731 4619 gene locus_tag LOCUS_09160 5731 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 5890 6726 gene locus_tag LOCUS_09170 5890 6726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 6876 7853 gene locus_tag LOCUS_09180 6876 7853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 7846 9729 gene locus_tag LOCUS_09190 7846 9729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 9726 11609 gene locus_tag LOCUS_09200 9726 11609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 11620 12798 gene locus_tag LOCUS_09210 11620 12798 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526219.1 protein_id gnl|my_center|LOCUS_09210 13079 14656 gene locus_tag LOCUS_09220 13079 14656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 14861 14667 gene locus_tag LOCUS_09230 14861 14667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 15350 14946 gene locus_tag LOCUS_09240 15350 14946 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528752.1 protein_id gnl|my_center|LOCUS_09240 15911 17202 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtccagtagctcccgttgg 18974 18039 gene locus_tag LOCUS_09250 18974 18039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 19968 19084 gene locus_tag LOCUS_09260 19968 19084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 21291 20851 gene locus_tag LOCUS_09270 21291 20851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 22024 21572 gene locus_tag LOCUS_09280 22024 21572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 22657 24603 gene locus_tag LOCUS_09290 22657 24603 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126182.1 protein_id gnl|my_center|LOCUS_09290 24692 26227 gene locus_tag LOCUS_09300 gene gltX 24692 26227 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883198.1 protein_id gnl|my_center|LOCUS_09300 26525 27697 gene locus_tag LOCUS_09310 26525 27697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 28035 27703 gene locus_tag LOCUS_09320 28035 27703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 28114 29139 gene locus_tag LOCUS_09330 28114 29139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444587.1 protein_id gnl|my_center|LOCUS_09330 29256 29543 gene locus_tag LOCUS_09340 29256 29543 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_09340 29553 29867 gene locus_tag LOCUS_09350 29553 29867 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806442.1 protein_id gnl|my_center|LOCUS_09350 30253 30002 gene locus_tag LOCUS_09360 30253 30002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence25 158 1156 gene locus_tag LOCUS_09370 158 1156 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941057.1 protein_id gnl|my_center|LOCUS_09370 1266 3404 gene locus_tag LOCUS_09380 1266 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725363.1 protein_id gnl|my_center|LOCUS_09380 4669 3455 gene locus_tag LOCUS_09390 4669 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 5688 4666 gene locus_tag LOCUS_09400 gene ruvB 5688 4666 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964224.1 protein_id gnl|my_center|LOCUS_09400 5895 6461 gene locus_tag LOCUS_09410 gene dcd 5895 6461 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192666.1 protein_id gnl|my_center|LOCUS_09410 6838 7182 gene locus_tag LOCUS_09420 6838 7182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 7461 8630 gene locus_tag LOCUS_09430 7461 8630 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883037.1 protein_id gnl|my_center|LOCUS_09430 8627 9871 gene locus_tag LOCUS_09440 8627 9871 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883038.1 protein_id gnl|my_center|LOCUS_09440 11074 9944 gene locus_tag LOCUS_09450 gene nifS 11074 9944 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_09450 11845 11114 gene locus_tag LOCUS_09460 11845 11114 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871606.1 protein_id gnl|my_center|LOCUS_09460 13044 11842 gene locus_tag LOCUS_09470 13044 11842 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_09470 13931 13065 gene locus_tag LOCUS_09480 13931 13065 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871601.1 protein_id gnl|my_center|LOCUS_09480 14782 14114 gene locus_tag LOCUS_09490 14782 14114 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871600.1 protein_id gnl|my_center|LOCUS_09490 16842 14836 gene locus_tag LOCUS_09500 gene glgX 16842 14836 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706229.1 protein_id gnl|my_center|LOCUS_09500 17358 17870 gene locus_tag LOCUS_09510 17358 17870 CDS product type III secretion chaperone Slc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883030.1 protein_id gnl|my_center|LOCUS_09510 19286 18051 gene locus_tag LOCUS_09520 19286 18051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 20751 19399 gene locus_tag LOCUS_09530 gene dnaA 20751 19399 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882957.1 protein_id gnl|my_center|LOCUS_09530 22693 20798 gene locus_tag LOCUS_09540 22693 20798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 25001 22941 gene locus_tag LOCUS_09550 25001 22941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 25296 25853 gene locus_tag LOCUS_09560 25296 25853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 25843 27012 gene locus_tag LOCUS_09570 25843 27012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 27616 27059 gene locus_tag LOCUS_09580 27616 27059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 28583 27627 gene locus_tag LOCUS_09590 28583 27627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 29010 28570 gene locus_tag LOCUS_09600 29010 28570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 29596 29015 gene locus_tag LOCUS_09610 29596 29015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 >Feature sequence26 1892 162 gene locus_tag LOCUS_09620 gene recJ 1892 162 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883201.1 protein_id gnl|my_center|LOCUS_09620 6669 2101 gene locus_tag LOCUS_09630 gene secD 6669 2101 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873817.1 protein_id gnl|my_center|LOCUS_09630 6928 8223 gene locus_tag LOCUS_09640 6928 8223 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056381.1 protein_id gnl|my_center|LOCUS_09640 8231 9076 gene locus_tag LOCUS_09650 8231 9076 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424529.1 protein_id gnl|my_center|LOCUS_09650 9073 9945 gene locus_tag LOCUS_09660 9073 9945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 9960 10637 gene locus_tag LOCUS_09670 gene cmk 9960 10637 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254302.1 protein_id gnl|my_center|LOCUS_09670 10634 11311 gene locus_tag LOCUS_09680 10634 11311 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100934564.1 protein_id gnl|my_center|LOCUS_09680 11931 11308 gene locus_tag LOCUS_09690 11931 11308 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258927.1 protein_id gnl|my_center|LOCUS_09690 12035 11952 gene locus_tag LOCUS_t00280 12035 11952 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12501 12139 gene locus_tag LOCUS_09700 12501 12139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 12707 13030 gene locus_tag LOCUS_09710 gene trxA 12707 13030 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883297.1 protein_id gnl|my_center|LOCUS_09710 14657 13068 gene locus_tag LOCUS_09720 14657 13068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 14927 15337 gene locus_tag LOCUS_09730 14927 15337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 17462 15306 gene locus_tag LOCUS_09740 17462 15306 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020540.1 protein_id gnl|my_center|LOCUS_09740 18345 17572 gene locus_tag LOCUS_09750 18345 17572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 20182 18392 gene locus_tag LOCUS_09760 gene aspS 20182 18392 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883300.1 protein_id gnl|my_center|LOCUS_09760 21473 20175 gene locus_tag LOCUS_09770 gene hisS 21473 20175 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460333.1 protein_id gnl|my_center|LOCUS_09770 22249 21617 gene locus_tag LOCUS_09780 22249 21617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 22415 23890 gene locus_tag LOCUS_09790 22415 23890 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883303.1 protein_id gnl|my_center|LOCUS_09790 23963 27712 gene locus_tag LOCUS_09800 gene dnaE 23963 27712 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883304.1 protein_id gnl|my_center|LOCUS_09800 29806 27920 gene locus_tag LOCUS_09810 29806 27920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 >Feature sequence27 455 1015 gene locus_tag LOCUS_09820 455 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1770 1012 gene locus_tag LOCUS_09830 1770 1012 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957522.1 protein_id gnl|my_center|LOCUS_09830 2255 1746 gene locus_tag LOCUS_09840 2255 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 3391 2252 gene locus_tag LOCUS_09850 3391 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 4205 3408 gene locus_tag LOCUS_09860 4205 3408 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205929.1 protein_id gnl|my_center|LOCUS_09860 4573 5127 gene locus_tag LOCUS_09870 4573 5127 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957823.1 protein_id gnl|my_center|LOCUS_09870 5151 5333 gene locus_tag LOCUS_09880 5151 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 7051 5417 gene locus_tag LOCUS_09890 7051 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 8140 7361 gene locus_tag LOCUS_09900 8140 7361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 8444 9304 gene locus_tag LOCUS_09910 gene cyoA 8444 9304 CDS product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082702.1 protein_id gnl|my_center|LOCUS_09910 9351 11306 gene locus_tag LOCUS_09920 gene cyoB 9351 11306 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931208.1 protein_id gnl|my_center|LOCUS_09920 11303 11914 gene locus_tag LOCUS_09930 gene cyoC 11303 11914 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086858.1 protein_id gnl|my_center|LOCUS_09930 11916 12245 gene locus_tag LOCUS_09940 11916 12245 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094534.1 protein_id gnl|my_center|LOCUS_09940 12245 13126 gene locus_tag LOCUS_09950 gene cyoE 12245 13126 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208653.1 protein_id gnl|my_center|LOCUS_09950 13238 14518 gene locus_tag LOCUS_09960 gene ugpB 13238 14518 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930288.1 protein_id gnl|my_center|LOCUS_09960 15024 15938 gene locus_tag LOCUS_09970 15024 15938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 15969 24713 gene locus_tag LOCUS_09980 15969 24713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 24899 29761 gene locus_tag LOCUS_09990 24899 29761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 >Feature sequence28 311 2059 gene locus_tag LOCUS_10000 gene dnaX 311 2059 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882690.1 protein_id gnl|my_center|LOCUS_10000 2052 2363 gene locus_tag LOCUS_10010 2052 2363 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871685.1 protein_id gnl|my_center|LOCUS_10010 2526 2900 gene locus_tag LOCUS_10020 2526 2900 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497752.1 protein_id gnl|my_center|LOCUS_10020 2875 3258 gene locus_tag LOCUS_10030 2875 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 3304 4620 gene locus_tag LOCUS_10040 3304 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 6377 4617 gene locus_tag LOCUS_10050 gene ptsP 6377 4617 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152804487.1 protein_id gnl|my_center|LOCUS_10050 6652 6386 gene locus_tag LOCUS_10060 6652 6386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 7598 6624 gene locus_tag LOCUS_10070 gene hprK 7598 6624 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228097.1 protein_id gnl|my_center|LOCUS_10070 7767 9035 gene locus_tag LOCUS_10080 7767 9035 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503612.1 protein_id gnl|my_center|LOCUS_10080 9032 10528 gene locus_tag LOCUS_10090 9032 10528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 10581 11645 gene locus_tag LOCUS_10100 10581 11645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 11658 12704 gene locus_tag LOCUS_10110 11658 12704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 12694 13218 gene locus_tag LOCUS_10120 12694 13218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 13375 13809 gene locus_tag LOCUS_10130 13375 13809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 13975 14277 gene locus_tag LOCUS_10140 13975 14277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 14301 14375 gene locus_tag LOCUS_t00290 14301 14375 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 14495 15292 gene locus_tag LOCUS_10150 14495 15292 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104295.1 protein_id gnl|my_center|LOCUS_10150 15294 17693 gene locus_tag LOCUS_10160 15294 17693 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873339.1 protein_id gnl|my_center|LOCUS_10160 17686 18033 gene locus_tag LOCUS_10170 17686 18033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 18038 19363 gene locus_tag LOCUS_10180 18038 19363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 20404 19505 gene locus_tag LOCUS_10190 20404 19505 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883514.1 protein_id gnl|my_center|LOCUS_10190 22632 20476 gene locus_tag LOCUS_10200 22632 20476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 23166 24218 gene locus_tag LOCUS_10210 23166 24218 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234111.1 protein_id gnl|my_center|LOCUS_10210 26264 24219 gene locus_tag LOCUS_10220 26264 24219 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882683.1 protein_id gnl|my_center|LOCUS_10220 27379 26267 gene locus_tag LOCUS_10230 27379 26267 CDS product UPF0158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883156.1 protein_id gnl|my_center|LOCUS_10230 27528 28823 gene locus_tag LOCUS_10240 gene serS 27528 28823 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883505.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence29 368 1537 gene locus_tag LOCUS_10250 368 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 5227 1919 gene locus_tag LOCUS_10260 gene mfd 5227 1919 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172643918.1 protein_id gnl|my_center|LOCUS_10260 7839 5206 gene locus_tag LOCUS_10270 gene alaS 7839 5206 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725333.1 protein_id gnl|my_center|LOCUS_10270 8032 9102 gene locus_tag LOCUS_10280 8032 9102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 9423 10487 gene locus_tag LOCUS_10290 9423 10487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 10685 12673 gene locus_tag LOCUS_10300 gene tkt 10685 12673 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883528.1 protein_id gnl|my_center|LOCUS_10300 12732 13880 gene locus_tag LOCUS_10310 12732 13880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 13877 14890 gene locus_tag LOCUS_10320 gene hemE 13877 14890 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228059.1 protein_id gnl|my_center|LOCUS_10320 15083 15589 gene locus_tag LOCUS_10330 15083 15589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 16695 15631 gene locus_tag LOCUS_10340 16695 15631 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198300.1 protein_id gnl|my_center|LOCUS_10340 17733 16750 gene locus_tag LOCUS_10350 gene hemF 17733 16750 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958399.1 protein_id gnl|my_center|LOCUS_10350 17769 19136 gene locus_tag LOCUS_10360 gene hemG 17769 19136 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545161.1 protein_id gnl|my_center|LOCUS_10360 19240 19587 gene locus_tag LOCUS_10370 19240 19587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 19598 20143 gene locus_tag LOCUS_10380 19598 20143 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038765.1 protein_id gnl|my_center|LOCUS_10380 20224 21420 gene locus_tag LOCUS_10390 20224 21420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 22286 21609 gene locus_tag LOCUS_10400 22286 21609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 23474 22287 gene locus_tag LOCUS_10410 23474 22287 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284165.1 protein_id gnl|my_center|LOCUS_10410 23761 24480 gene locus_tag LOCUS_10420 gene rnc 23761 24480 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557292.1 protein_id gnl|my_center|LOCUS_10420 24470 25843 gene locus_tag LOCUS_10430 gene radA 24470 25843 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871646.1 protein_id gnl|my_center|LOCUS_10430 25827 26495 gene locus_tag LOCUS_10440 25827 26495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 26492 27139 gene locus_tag LOCUS_10450 26492 27139 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883160.1 protein_id gnl|my_center|LOCUS_10450 27518 27099 gene locus_tag LOCUS_10460 27518 27099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 >Feature sequence30 217 618 gene locus_tag LOCUS_10470 217 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 978 673 gene locus_tag LOCUS_10480 gene rpsN 978 673 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883572.1 protein_id gnl|my_center|LOCUS_10480 1128 991 gene locus_tag LOCUS_10490 gene rpmJ 1128 991 CDS product 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883571.1 protein_id gnl|my_center|LOCUS_10490 1532 1945 gene locus_tag LOCUS_10500 1532 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1987 4023 gene locus_tag LOCUS_10510 1987 4023 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941556.1 protein_id gnl|my_center|LOCUS_10510 4856 4020 gene locus_tag LOCUS_10520 4856 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 5712 4867 gene locus_tag LOCUS_10530 5712 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 5939 6385 gene locus_tag LOCUS_10540 5939 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 7999 6332 gene locus_tag LOCUS_10550 7999 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 8029 10488 gene locus_tag LOCUS_10560 8029 10488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 12389 10446 gene locus_tag LOCUS_10570 12389 10446 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010892060.1 protein_id gnl|my_center|LOCUS_10570 13493 12498 gene locus_tag LOCUS_10580 13493 12498 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873536.1 protein_id gnl|my_center|LOCUS_10580 14824 13490 gene locus_tag LOCUS_10590 14824 13490 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882990.1 protein_id gnl|my_center|LOCUS_10590 15600 14827 gene locus_tag LOCUS_10600 15600 14827 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678718.1 protein_id gnl|my_center|LOCUS_10600 16637 15600 gene locus_tag LOCUS_10610 16637 15600 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873533.1 protein_id gnl|my_center|LOCUS_10610 17730 16891 gene locus_tag LOCUS_10620 17730 16891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 18327 18872 gene locus_tag LOCUS_10630 18327 18872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871415.1 protein_id gnl|my_center|LOCUS_10630 19038 18874 gene locus_tag LOCUS_10640 19038 18874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 19130 20728 gene locus_tag LOCUS_10650 gene npt1 19130 20728 CDS product NTP/NDP exchange transporter Npt1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882994.1 protein_id gnl|my_center|LOCUS_10650 20915 22723 gene locus_tag LOCUS_10660 gene lepA 20915 22723 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883002.1 protein_id gnl|my_center|LOCUS_10660 23326 23081 gene locus_tag LOCUS_10670 23326 23081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 23596 23360 gene locus_tag LOCUS_10680 23596 23360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 24129 23947 gene locus_tag LOCUS_10690 24129 23947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 25352 24318 gene locus_tag LOCUS_10700 25352 24318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 25782 25648 gene locus_tag LOCUS_10710 25782 25648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 26076 26948 gene locus_tag LOCUS_10720 26076 26948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 >Feature sequence31 719 204 gene locus_tag LOCUS_10730 719 204 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041466983.1 protein_id gnl|my_center|LOCUS_10730 1410 727 gene locus_tag LOCUS_10740 1410 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1749 2018 gene locus_tag LOCUS_10750 gene rpsO 1749 2018 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883633.1 protein_id gnl|my_center|LOCUS_10750 2344 4449 gene locus_tag LOCUS_10760 gene pnp 2344 4449 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883632.1 protein_id gnl|my_center|LOCUS_10760 5775 4543 gene locus_tag LOCUS_10770 5775 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 6019 6642 gene locus_tag LOCUS_10780 6019 6642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 9492 6727 gene locus_tag LOCUS_10790 gene ftsH 9492 6727 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873450.1 protein_id gnl|my_center|LOCUS_10790 10814 9837 gene locus_tag LOCUS_10800 gene tilS 10814 9837 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883630.1 protein_id gnl|my_center|LOCUS_10800 11166 10996 gene locus_tag LOCUS_10810 11166 10996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 11362 12015 gene locus_tag LOCUS_10820 11362 12015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 12012 13094 gene locus_tag LOCUS_10830 12012 13094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 13103 13870 gene locus_tag LOCUS_10840 13103 13870 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208820.1 protein_id gnl|my_center|LOCUS_10840 13986 15503 gene locus_tag LOCUS_10850 13986 15503 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_10850 15953 15567 gene locus_tag LOCUS_10860 gene rpsI 15953 15567 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882898.1 protein_id gnl|my_center|LOCUS_10860 16425 15979 gene locus_tag LOCUS_10870 gene rplM 16425 15979 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882899.1 protein_id gnl|my_center|LOCUS_10870 16687 18045 gene locus_tag LOCUS_10880 gene miaB 16687 18045 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_10880 18662 18099 gene locus_tag LOCUS_10890 18662 18099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 18932 21157 gene locus_tag LOCUS_10900 18932 21157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 23363 21342 gene locus_tag LOCUS_10910 gene ligA 23363 21342 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882799.1 protein_id gnl|my_center|LOCUS_10910 25515 23353 gene locus_tag LOCUS_10920 gene glgB 25515 23353 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883113.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence32 192 896 gene locus_tag LOCUS_10930 192 896 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883256.1 protein_id gnl|my_center|LOCUS_10930 2579 1656 gene locus_tag LOCUS_10940 2579 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 2981 2592 gene locus_tag LOCUS_10950 2981 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 3840 3064 gene locus_tag LOCUS_10960 gene sdhB 3840 3064 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126226.1 protein_id gnl|my_center|LOCUS_10960 5744 3846 gene locus_tag LOCUS_10970 gene sdhA 5744 3846 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883426.1 protein_id gnl|my_center|LOCUS_10970 6768 5749 gene locus_tag LOCUS_10980 6768 5749 CDS product succinate dehydrogenase cytochrome b558 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883425.1 protein_id gnl|my_center|LOCUS_10980 7607 6837 gene locus_tag LOCUS_10990 7607 6837 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873928.1 protein_id gnl|my_center|LOCUS_10990 7694 8452 gene locus_tag LOCUS_11000 7694 8452 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883422.1 protein_id gnl|my_center|LOCUS_11000 8452 8886 gene locus_tag LOCUS_11010 8452 8886 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883421.1 protein_id gnl|my_center|LOCUS_11010 8889 9677 gene locus_tag LOCUS_11020 8889 9677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 9680 11050 gene locus_tag LOCUS_11030 gene tolB 9680 11050 CDS product Tol-Pal system protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883419.1 protein_id gnl|my_center|LOCUS_11030 11075 11746 gene locus_tag LOCUS_11040 11075 11746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 11762 12391 gene locus_tag LOCUS_11050 11762 12391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 12378 13190 gene locus_tag LOCUS_11060 gene murI 12378 13190 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_11060 13266 13982 gene locus_tag LOCUS_11070 13266 13982 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986854.1 protein_id gnl|my_center|LOCUS_11070 13985 15238 gene locus_tag LOCUS_11080 13985 15238 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957472.1 protein_id gnl|my_center|LOCUS_11080 15213 15545 gene locus_tag LOCUS_11090 15213 15545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 15577 16620 gene locus_tag LOCUS_11100 15577 16620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883240.1 protein_id gnl|my_center|LOCUS_11100 18587 16665 gene locus_tag LOCUS_11110 18587 16665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 19672 18752 gene locus_tag LOCUS_11120 19672 18752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 19951 22662 gene locus_tag LOCUS_11130 19951 22662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 22659 24557 gene locus_tag LOCUS_11140 22659 24557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 24554 25132 gene locus_tag LOCUS_11150 gene rsmD 24554 25132 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871849.1 protein_id gnl|my_center|LOCUS_11150 25129 25611 gene locus_tag LOCUS_11160 gene coaD 25129 25611 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388467.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence33 564 1415 gene locus_tag LOCUS_11170 564 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1477 3099 gene locus_tag LOCUS_11180 1477 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 3100 4758 gene locus_tag LOCUS_11190 3100 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 4936 4679 gene locus_tag LOCUS_11200 4936 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 6400 5000 gene locus_tag LOCUS_11210 6400 5000 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883224.1 protein_id gnl|my_center|LOCUS_11210 6555 7337 gene locus_tag LOCUS_11220 6555 7337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 7773 7375 gene locus_tag LOCUS_11230 7773 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 8068 10908 gene locus_tag LOCUS_11240 gene acnA 8068 10908 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244335.1 protein_id gnl|my_center|LOCUS_11240 11020 11334 gene locus_tag LOCUS_11250 11020 11334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 11487 11571 gene locus_tag LOCUS_t00300 11487 11571 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11733 12476 gene locus_tag LOCUS_11260 11733 12476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 13437 12421 gene locus_tag LOCUS_11270 13437 12421 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226288.1 protein_id gnl|my_center|LOCUS_11270 13496 14173 gene locus_tag LOCUS_11280 13496 14173 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725205.1 protein_id gnl|my_center|LOCUS_11280 14910 14131 gene locus_tag LOCUS_11290 gene truA 14910 14131 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288727.1 protein_id gnl|my_center|LOCUS_11290 15222 14959 gene locus_tag LOCUS_11300 15222 14959 CDS product SWIB/MDM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873828.1 protein_id gnl|my_center|LOCUS_11300 15581 17881 gene locus_tag LOCUS_11310 15581 17881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 18356 18060 gene locus_tag LOCUS_11320 18356 18060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 18920 19900 gene locus_tag LOCUS_11330 gene prfB 18920 19900 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725203.1 protein_id gnl|my_center|LOCUS_11330 19903 20400 gene locus_tag LOCUS_11340 19903 20400 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883213.1 protein_id gnl|my_center|LOCUS_11340 20408 20905 gene locus_tag LOCUS_11350 20408 20905 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883213.1 protein_id gnl|my_center|LOCUS_11350 20902 21390 gene locus_tag LOCUS_11360 20902 21390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 21404 22123 gene locus_tag LOCUS_11370 21404 22123 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883211.1 protein_id gnl|my_center|LOCUS_11370 23184 22150 gene locus_tag LOCUS_11380 23184 22150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 23367 24839 gene locus_tag LOCUS_11390 23367 24839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 >Feature sequence34 1759 734 gene locus_tag LOCUS_11400 gene tsaD 1759 734 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872452.1 protein_id gnl|my_center|LOCUS_11400 1874 2788 gene locus_tag LOCUS_11410 1874 2788 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 protein_id gnl|my_center|LOCUS_11410 3683 2907 gene locus_tag LOCUS_11420 gene pgl 3683 2907 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882891.1 protein_id gnl|my_center|LOCUS_11420 4777 3677 gene locus_tag LOCUS_11430 4777 3677 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143171.1 protein_id gnl|my_center|LOCUS_11430 6321 4777 gene locus_tag LOCUS_11440 gene zwf 6321 4777 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_11440 7410 6610 gene locus_tag LOCUS_11450 7410 6610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 8383 7445 gene locus_tag LOCUS_11460 8383 7445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 8927 8496 gene locus_tag LOCUS_11470 gene ruvX 8927 8496 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229795.1 protein_id gnl|my_center|LOCUS_11470 10551 8932 gene locus_tag LOCUS_11480 10551 8932 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010892089.1 protein_id gnl|my_center|LOCUS_11480 10684 12303 gene locus_tag LOCUS_11490 10684 12303 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956991.1 protein_id gnl|my_center|LOCUS_11490 12303 12962 gene locus_tag LOCUS_11500 12303 12962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 13758 13021 gene locus_tag LOCUS_11510 13758 13021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 15883 14618 gene locus_tag LOCUS_11520 15883 14618 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971955.1 protein_id gnl|my_center|LOCUS_11520 17433 15994 gene locus_tag LOCUS_11530 17433 15994 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946153.1 protein_id gnl|my_center|LOCUS_11530 18022 17648 gene locus_tag LOCUS_11540 18022 17648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 18341 18829 gene locus_tag LOCUS_11550 18341 18829 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_11550 19211 19381 gene locus_tag LOCUS_11560 19211 19381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 20080 19475 gene locus_tag LOCUS_11570 20080 19475 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267101.1 protein_id gnl|my_center|LOCUS_11570 20723 20064 gene locus_tag LOCUS_11580 20723 20064 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444701.1 protein_id gnl|my_center|LOCUS_11580 20839 21555 gene locus_tag LOCUS_11590 20839 21555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 21724 22512 gene locus_tag LOCUS_11600 gene proC 21724 22512 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081281.1 protein_id gnl|my_center|LOCUS_11600 22835 23785 gene locus_tag LOCUS_11610 22835 23785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 >Feature sequence35 1031 210 gene locus_tag LOCUS_11620 1031 210 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883529.1 protein_id gnl|my_center|LOCUS_11620 1170 2144 gene locus_tag LOCUS_11630 1170 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 2236 2802 gene locus_tag LOCUS_11640 gene efp 2236 2802 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872132.1 protein_id gnl|my_center|LOCUS_11640 2780 3751 gene locus_tag LOCUS_11650 gene epmA 2780 3751 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648321.1 protein_id gnl|my_center|LOCUS_11650 3736 4482 gene locus_tag LOCUS_11660 3736 4482 CDS product type-5 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173217.1 protein_id gnl|my_center|LOCUS_11660 5416 4418 gene locus_tag LOCUS_11670 5416 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 7208 5574 gene locus_tag LOCUS_11680 7208 5574 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057022.1 protein_id gnl|my_center|LOCUS_11680 7536 8537 gene locus_tag LOCUS_11690 7536 8537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 8674 9360 gene locus_tag LOCUS_11700 8674 9360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 9796 11607 gene locus_tag LOCUS_11710 gene htpG 9796 11607 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141812.1 protein_id gnl|my_center|LOCUS_11710 11704 13017 gene locus_tag LOCUS_11720 11704 13017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 13327 14541 gene locus_tag LOCUS_11730 13327 14541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 15779 14577 gene locus_tag LOCUS_11740 15779 14577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 16341 15952 gene locus_tag LOCUS_11750 gene yajC 16341 15952 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883519.1 protein_id gnl|my_center|LOCUS_11750 16543 19119 gene locus_tag LOCUS_11760 16543 19119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 20528 19107 gene locus_tag LOCUS_11770 gene rlmD 20528 19107 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873343.1 protein_id gnl|my_center|LOCUS_11770 20836 20618 gene locus_tag LOCUS_11780 20836 20618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 21155 22036 gene locus_tag LOCUS_11790 gene ilvE 21155 22036 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_11790 22302 22652 gene locus_tag LOCUS_11800 22302 22652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 22746 22540 gene locus_tag LOCUS_11810 22746 22540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 23050 23853 gene locus_tag LOCUS_11820 23050 23853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 >Feature sequence36 852 121 gene locus_tag LOCUS_11830 852 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1240 989 gene locus_tag LOCUS_11840 1240 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1140 2270 gene locus_tag LOCUS_11850 1140 2270 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728453.1 protein_id gnl|my_center|LOCUS_11850 2748 3473 gene locus_tag LOCUS_11860 2748 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 3746 7198 gene locus_tag LOCUS_11870 3746 7198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 8300 7398 gene locus_tag LOCUS_11880 8300 7398 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461744.1 protein_id gnl|my_center|LOCUS_11880 9472 8639 gene locus_tag LOCUS_11890 9472 8639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 10080 9694 gene locus_tag LOCUS_11900 10080 9694 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413574.1 protein_id gnl|my_center|LOCUS_11900 10370 11416 gene locus_tag LOCUS_11910 10370 11416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 12183 11686 gene locus_tag LOCUS_11920 12183 11686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 12906 12262 gene locus_tag LOCUS_11930 12906 12262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 13256 12915 gene locus_tag LOCUS_11940 13256 12915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 13845 13486 gene locus_tag LOCUS_11950 13845 13486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 15039 13981 gene locus_tag LOCUS_11960 15039 13981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 15487 15128 gene locus_tag LOCUS_11970 15487 15128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 16106 15468 gene locus_tag LOCUS_11980 16106 15468 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921580.1 protein_id gnl|my_center|LOCUS_11980 16222 17217 gene locus_tag LOCUS_11990 16222 17217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 18048 17236 gene locus_tag LOCUS_12000 18048 17236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 18612 18058 gene locus_tag LOCUS_12010 18612 18058 CDS product DUF1543 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020320.1 protein_id gnl|my_center|LOCUS_12010 19830 18718 gene locus_tag LOCUS_12020 19830 18718 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_12020 20033 21826 gene locus_tag LOCUS_12030 20033 21826 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783199.1 protein_id gnl|my_center|LOCUS_12030 22298 21942 gene locus_tag LOCUS_12040 22298 21942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 >Feature sequence37 2691 1591 gene locus_tag LOCUS_12050 2691 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 4619 2688 gene locus_tag LOCUS_12060 4619 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 4962 7460 gene locus_tag LOCUS_12070 4962 7460 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268140.1 protein_id gnl|my_center|LOCUS_12070 9329 7623 gene locus_tag LOCUS_12080 9329 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 9612 10007 gene locus_tag LOCUS_12090 9612 10007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871969.1 protein_id gnl|my_center|LOCUS_12090 10695 10108 gene locus_tag LOCUS_12100 10695 10108 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933158.1 protein_id gnl|my_center|LOCUS_12100 11339 10707 gene locus_tag LOCUS_12110 11339 10707 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_12110 11478 11403 gene locus_tag LOCUS_t00310 11478 11403 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11608 12393 gene locus_tag LOCUS_12120 11608 12393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 12507 13205 gene locus_tag LOCUS_12130 12507 13205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 14985 13285 gene locus_tag LOCUS_12140 gene groL 14985 13285 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_12140 15322 15020 gene locus_tag LOCUS_12150 gene groES 15322 15020 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918572.1 protein_id gnl|my_center|LOCUS_12150 16667 15420 gene locus_tag LOCUS_12160 16667 15420 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873937.1 protein_id gnl|my_center|LOCUS_12160 16786 20409 gene locus_tag LOCUS_12170 16786 20409 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121781.1 protein_id gnl|my_center|LOCUS_12170 21110 20499 gene locus_tag LOCUS_12180 21110 20499 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114384.1 protein_id gnl|my_center|LOCUS_12180 >Feature sequence38 1097 177 gene locus_tag LOCUS_12190 1097 177 CDS product enoyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873559.1 protein_id gnl|my_center|LOCUS_12190 1147 1395 gene locus_tag LOCUS_12200 1147 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1443 1853 gene locus_tag LOCUS_12210 1443 1853 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_12210 1854 2873 gene locus_tag LOCUS_12220 1854 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 2879 3613 gene locus_tag LOCUS_12230 2879 3613 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 protein_id gnl|my_center|LOCUS_12230 5311 4004 gene locus_tag LOCUS_12240 5311 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 7431 5329 gene locus_tag LOCUS_12250 7431 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 7732 7941 gene locus_tag LOCUS_12260 7732 7941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 8097 8360 gene locus_tag LOCUS_12270 8097 8360 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883007.1 protein_id gnl|my_center|LOCUS_12270 8375 8947 gene locus_tag LOCUS_12280 8375 8947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 10348 8948 gene locus_tag LOCUS_12290 gene lpdA 10348 8948 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388970.1 protein_id gnl|my_center|LOCUS_12290 11506 10358 gene locus_tag LOCUS_12300 gene odhB 11506 10358 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918229.1 protein_id gnl|my_center|LOCUS_12300 14211 11503 gene locus_tag LOCUS_12310 14211 11503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 14585 15049 gene locus_tag LOCUS_12320 14585 15049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872349.1 protein_id gnl|my_center|LOCUS_12320 15033 16193 gene locus_tag LOCUS_12330 gene hemW 15033 16193 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725009.1 protein_id gnl|my_center|LOCUS_12330 17553 16291 gene locus_tag LOCUS_12340 17553 16291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 18055 20229 gene locus_tag LOCUS_12350 18055 20229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 >Feature sequence39 765 1592 gene locus_tag LOCUS_12360 765 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 1647 3578 gene locus_tag LOCUS_12370 1647 3578 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883150.1 protein_id gnl|my_center|LOCUS_12370 4333 3911 gene locus_tag LOCUS_12380 4333 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 5285 5872 gene locus_tag LOCUS_12390 5285 5872 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882672.1 protein_id gnl|my_center|LOCUS_12390 5886 7847 gene locus_tag LOCUS_12400 5886 7847 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882671.1 protein_id gnl|my_center|LOCUS_12400 8217 10499 gene locus_tag LOCUS_12410 8217 10499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882670.1 protein_id gnl|my_center|LOCUS_12410 10509 11345 gene locus_tag LOCUS_12420 10509 11345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 12024 11497 gene locus_tag LOCUS_12430 gene def 12024 11497 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883700.1 protein_id gnl|my_center|LOCUS_12430 12318 12028 gene locus_tag LOCUS_12440 gene secG 12318 12028 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041466975.1 protein_id gnl|my_center|LOCUS_12440 13093 12329 gene locus_tag LOCUS_12450 gene tpiA 13093 12329 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391808.1 protein_id gnl|my_center|LOCUS_12450 13177 14580 gene locus_tag LOCUS_12460 gene xseA 13177 14580 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_12460 14577 14855 gene locus_tag LOCUS_12470 14577 14855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 14876 15715 gene locus_tag LOCUS_12480 14876 15715 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_12480 16211 15651 gene locus_tag LOCUS_12490 gene idi 16211 15651 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_12490 16414 17943 gene locus_tag LOCUS_12500 gene npt1 16414 17943 CDS product NTP/NDP exchange transporter Npt1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873532.1 protein_id gnl|my_center|LOCUS_12500 17951 18649 gene locus_tag LOCUS_12510 17951 18649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 18858 19016 gene locus_tag LOCUS_12520 18858 19016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 >Feature sequence40 827 165 gene locus_tag LOCUS_12530 827 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 3136 1571 gene locus_tag LOCUS_12540 gene npt1 3136 1571 CDS product NTP/NDP exchange transporter Npt1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882994.1 protein_id gnl|my_center|LOCUS_12540 4525 3323 gene locus_tag LOCUS_12550 4525 3323 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_12550 5324 4575 gene locus_tag LOCUS_12560 5324 4575 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883293.1 protein_id gnl|my_center|LOCUS_12560 5877 5311 gene locus_tag LOCUS_12570 gene yihA 5877 5311 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965924.1 protein_id gnl|my_center|LOCUS_12570 6407 5943 gene locus_tag LOCUS_12580 gene tsaE 6407 5943 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044854.1 protein_id gnl|my_center|LOCUS_12580 7159 6413 gene locus_tag LOCUS_12590 7159 6413 CDS product DUF2709 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873883.1 protein_id gnl|my_center|LOCUS_12590 7691 8797 gene locus_tag LOCUS_12600 7691 8797 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162675.1 protein_id gnl|my_center|LOCUS_12600 8847 10613 gene locus_tag LOCUS_12610 gene argS 8847 10613 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873823.1 protein_id gnl|my_center|LOCUS_12610 11672 10623 gene locus_tag LOCUS_12620 11672 10623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 12753 11779 gene locus_tag LOCUS_12630 gene epmB 12753 11779 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_12630 14219 12822 gene locus_tag LOCUS_12640 gene murA 14219 12822 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883209.1 protein_id gnl|my_center|LOCUS_12640 15408 14212 gene locus_tag LOCUS_12650 15408 14212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 15533 16642 gene locus_tag LOCUS_12660 gene ddlA 15533 16642 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704541.1 protein_id gnl|my_center|LOCUS_12660 16717 17214 gene locus_tag LOCUS_12670 gene ispF 16717 17214 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883185.1 protein_id gnl|my_center|LOCUS_12670 17314 17883 gene locus_tag LOCUS_12680 17314 17883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence41 183 1622 gene locus_tag LOCUS_12690 183 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 2160 1657 gene locus_tag LOCUS_12700 2160 1657 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939219.1 protein_id gnl|my_center|LOCUS_12700 2239 3858 gene locus_tag LOCUS_12710 gene oppA 2239 3858 CDS product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232957.1 protein_id gnl|my_center|LOCUS_12710 4000 6198 gene locus_tag LOCUS_12720 4000 6198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 6948 6205 gene locus_tag LOCUS_12730 6948 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 7193 8026 gene locus_tag LOCUS_12740 7193 8026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 8276 8992 gene locus_tag LOCUS_12750 8276 8992 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804764.1 protein_id gnl|my_center|LOCUS_12750 10064 8982 gene locus_tag LOCUS_12760 10064 8982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 10230 10051 gene locus_tag LOCUS_12770 10230 10051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 10605 10696 gene locus_tag LOCUS_t00320 10605 10696 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10798 13536 gene locus_tag LOCUS_12780 10798 13536 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400547.1 protein_id gnl|my_center|LOCUS_12780 14791 13550 gene locus_tag LOCUS_12790 14791 13550 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982317.1 protein_id gnl|my_center|LOCUS_12790 14916 15089 gene locus_tag LOCUS_12800 14916 15089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 15345 17168 gene locus_tag LOCUS_12810 gene mnmG 15345 17168 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873860.1 protein_id gnl|my_center|LOCUS_12810 17190 17561 gene locus_tag LOCUS_12820 17190 17561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 17839 17603 gene locus_tag LOCUS_12830 17839 17603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence42 900 1940 gene locus_tag LOCUS_12840 900 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 1957 3096 gene locus_tag LOCUS_12850 1957 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 3217 3951 gene locus_tag LOCUS_12860 gene ubiE 3217 3951 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941531.1 protein_id gnl|my_center|LOCUS_12860 3932 5170 gene locus_tag LOCUS_12870 3932 5170 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074299.1 protein_id gnl|my_center|LOCUS_12870 5180 6904 gene locus_tag LOCUS_12880 gene menD 5180 6904 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404103.1 protein_id gnl|my_center|LOCUS_12880 6859 8391 gene locus_tag LOCUS_12890 6859 8391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 8406 9275 gene locus_tag LOCUS_12900 8406 9275 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404105.1 protein_id gnl|my_center|LOCUS_12900 9263 10639 gene locus_tag LOCUS_12910 gene menE 9263 10639 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933507.1 protein_id gnl|my_center|LOCUS_12910 10997 10572 gene locus_tag LOCUS_12920 10997 10572 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124353.1 protein_id gnl|my_center|LOCUS_12920 12471 11086 gene locus_tag LOCUS_12930 12471 11086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 12685 13506 gene locus_tag LOCUS_12940 12685 13506 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_12940 13503 14285 gene locus_tag LOCUS_12950 13503 14285 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_12950 14278 15477 gene locus_tag LOCUS_12960 14278 15477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 15477 16046 gene locus_tag LOCUS_12970 15477 16046 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041466948.1 protein_id gnl|my_center|LOCUS_12970 17515 16043 gene locus_tag LOCUS_12980 17515 16043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence43 1371 292 gene locus_tag LOCUS_12990 1371 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872255.1 protein_id gnl|my_center|LOCUS_12990 2681 1368 gene locus_tag LOCUS_13000 gene mtaB 2681 1368 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010892011.1 protein_id gnl|my_center|LOCUS_13000 3518 4132 gene locus_tag LOCUS_13010 3518 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 5221 4202 gene locus_tag LOCUS_13020 5221 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 5376 6158 gene locus_tag LOCUS_13030 5376 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 6867 6163 gene locus_tag LOCUS_13040 gene radC 6867 6163 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246034.1 protein_id gnl|my_center|LOCUS_13040 8188 6881 gene locus_tag LOCUS_13050 gene hflX 8188 6881 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883116.1 protein_id gnl|my_center|LOCUS_13050 8975 8178 gene locus_tag LOCUS_13060 8975 8178 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883117.1 protein_id gnl|my_center|LOCUS_13060 10158 9043 gene locus_tag LOCUS_13070 10158 9043 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883663.1 protein_id gnl|my_center|LOCUS_13070 10979 10140 gene locus_tag LOCUS_13080 10979 10140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 12188 11055 gene locus_tag LOCUS_13090 12188 11055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 13551 12391 gene locus_tag LOCUS_13100 13551 12391 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_13100 14548 13556 gene locus_tag LOCUS_13110 14548 13556 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958098.1 protein_id gnl|my_center|LOCUS_13110 14803 15624 gene locus_tag LOCUS_13120 14803 15624 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883444.1 protein_id gnl|my_center|LOCUS_13120 17286 15724 gene locus_tag LOCUS_13130 17286 15724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 17603 17494 gene locus_tag LOCUS_r00010 17603 17494 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence44 524 1027 gene locus_tag LOCUS_13140 524 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 1030 2115 gene locus_tag LOCUS_13150 1030 2115 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444538.1 protein_id gnl|my_center|LOCUS_13150 3227 2151 gene locus_tag LOCUS_13160 3227 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 3878 5176 gene locus_tag LOCUS_13170 gene gltP 3878 5176 CDS product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401762.1 protein_id gnl|my_center|LOCUS_13170 6116 5304 gene locus_tag LOCUS_13180 6116 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 7604 6126 gene locus_tag LOCUS_13190 7604 6126 CDS product bifunctional 3-dehydroquinate dehydratase/shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883668.1 protein_id gnl|my_center|LOCUS_13190 7954 8964 gene locus_tag LOCUS_13200 gene aroF 7954 8964 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583420.1 protein_id gnl|my_center|LOCUS_13200 8961 9260 gene locus_tag LOCUS_13210 8961 9260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 9229 10047 gene locus_tag LOCUS_13220 gene pheA 9229 10047 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038038884.1 protein_id gnl|my_center|LOCUS_13220 10031 10807 gene locus_tag LOCUS_13230 10031 10807 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_13230 10804 11940 gene locus_tag LOCUS_13240 10804 11940 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948234.1 protein_id gnl|my_center|LOCUS_13240 11937 13055 gene locus_tag LOCUS_13250 gene aroB 11937 13055 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404274.1 protein_id gnl|my_center|LOCUS_13250 13052 14338 gene locus_tag LOCUS_13260 gene aroA 13052 14338 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883672.1 protein_id gnl|my_center|LOCUS_13260 14335 14874 gene locus_tag LOCUS_13270 gene aroK 14335 14874 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003018629.1 protein_id gnl|my_center|LOCUS_13270 14867 15964 gene locus_tag LOCUS_13280 gene aroC 14867 15964 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_13280 16972 15938 gene locus_tag LOCUS_13290 16972 15938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence45 435 1232 gene locus_tag LOCUS_13300 435 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 2126 1218 gene locus_tag LOCUS_13310 gene pyrB 2126 1218 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352301.1 protein_id gnl|my_center|LOCUS_13310 3205 2123 gene locus_tag LOCUS_13320 3205 2123 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546260.1 protein_id gnl|my_center|LOCUS_13320 6411 3202 gene locus_tag LOCUS_13330 gene carB 6411 3202 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788239.1 protein_id gnl|my_center|LOCUS_13330 7472 6408 gene locus_tag LOCUS_13340 gene carA 7472 6408 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788241.1 protein_id gnl|my_center|LOCUS_13340 8962 7556 gene locus_tag LOCUS_13350 gene sthA 8962 7556 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971781.1 protein_id gnl|my_center|LOCUS_13350 9064 11607 gene locus_tag LOCUS_13360 9064 11607 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_13360 11791 12501 gene locus_tag LOCUS_13370 11791 12501 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872100.1 protein_id gnl|my_center|LOCUS_13370 12578 13252 gene locus_tag LOCUS_13380 12578 13252 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883319.1 protein_id gnl|my_center|LOCUS_13380 13259 14683 gene locus_tag LOCUS_13390 13259 14683 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883318.1 protein_id gnl|my_center|LOCUS_13390 15653 14670 gene locus_tag LOCUS_13400 gene hemH 15653 14670 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883241.1 protein_id gnl|my_center|LOCUS_13400 15746 16483 gene locus_tag LOCUS_13410 15746 16483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 >Feature sequence46 146 352 gene locus_tag LOCUS_13420 146 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 559 1194 gene locus_tag LOCUS_13430 559 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1219 1812 gene locus_tag LOCUS_13440 1219 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 2767 1871 gene locus_tag LOCUS_13450 2767 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 4586 2958 gene locus_tag LOCUS_13460 gene recN 4586 2958 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393016.1 protein_id gnl|my_center|LOCUS_13460 5481 4561 gene locus_tag LOCUS_13470 gene rnhC 5481 4561 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883701.1 protein_id gnl|my_center|LOCUS_13470 5822 6229 gene locus_tag LOCUS_13480 5822 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 6264 8330 gene locus_tag LOCUS_13490 6264 8330 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460118.1 protein_id gnl|my_center|LOCUS_13490 8343 10172 gene locus_tag LOCUS_13500 8343 10172 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873593.1 protein_id gnl|my_center|LOCUS_13500 11059 10292 gene locus_tag LOCUS_13510 11059 10292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 11370 13520 gene locus_tag LOCUS_13520 11370 13520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 13572 15437 gene locus_tag LOCUS_13530 13572 15437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence47 1452 190 gene locus_tag LOCUS_13540 1452 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 2290 1442 gene locus_tag LOCUS_13550 2290 1442 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883050.1 protein_id gnl|my_center|LOCUS_13550 2366 2827 gene locus_tag LOCUS_13560 2366 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 3614 2829 gene locus_tag LOCUS_13570 3614 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 3944 3627 gene locus_tag LOCUS_13580 3944 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 4972 3944 gene locus_tag LOCUS_13590 gene floA 4972 3944 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 protein_id gnl|my_center|LOCUS_13590 5485 4988 gene locus_tag LOCUS_13600 5485 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 7026 5533 gene locus_tag LOCUS_13610 7026 5533 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230024.1 protein_id gnl|my_center|LOCUS_13610 8309 7023 gene locus_tag LOCUS_13620 gene hemL 8309 7023 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880497.1 protein_id gnl|my_center|LOCUS_13620 8564 10258 gene locus_tag LOCUS_13630 8564 10258 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626303.1 protein_id gnl|my_center|LOCUS_13630 10269 13823 gene locus_tag LOCUS_13640 10269 13823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 15916 14408 gene locus_tag LOCUS_13650 15916 14408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 >Feature sequence48 198 791 gene locus_tag LOCUS_13660 198 791 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287847.1 protein_id gnl|my_center|LOCUS_13660 1542 865 gene locus_tag LOCUS_13670 gene udk 1542 865 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963257.1 protein_id gnl|my_center|LOCUS_13670 2770 1598 gene locus_tag LOCUS_13680 gene tgt 2770 1598 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873629.1 protein_id gnl|my_center|LOCUS_13680 3428 2757 gene locus_tag LOCUS_13690 3428 2757 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873589.1 protein_id gnl|my_center|LOCUS_13690 3516 4154 gene locus_tag LOCUS_13700 3516 4154 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190428.1 protein_id gnl|my_center|LOCUS_13700 5039 4125 gene locus_tag LOCUS_13710 5039 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 5917 5036 gene locus_tag LOCUS_13720 5917 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 6872 5907 gene locus_tag LOCUS_13730 6872 5907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 7771 6875 gene locus_tag LOCUS_13740 7771 6875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 8648 7749 gene locus_tag LOCUS_13750 8648 7749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 9534 8641 gene locus_tag LOCUS_13760 9534 8641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 10433 9531 gene locus_tag LOCUS_13770 10433 9531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 10708 10448 gene locus_tag LOCUS_13780 10708 10448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 11814 11488 gene locus_tag LOCUS_13790 11814 11488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 12206 12991 gene locus_tag LOCUS_13800 12206 12991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 12963 13214 gene locus_tag LOCUS_13810 12963 13214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 14062 13151 gene locus_tag LOCUS_13820 14062 13151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 14177 15940 gene locus_tag LOCUS_13830 14177 15940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 >Feature sequence49 4131 115 gene locus_tag LOCUS_13840 4131 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 5623 4169 gene locus_tag LOCUS_13850 5623 4169 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946864.1 protein_id gnl|my_center|LOCUS_13850 7242 5683 gene locus_tag LOCUS_13860 7242 5683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 9208 7376 gene locus_tag LOCUS_13870 gene glmS 9208 7376 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228994.1 protein_id gnl|my_center|LOCUS_13870 9327 9833 gene locus_tag LOCUS_13880 9327 9833 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770846.1 protein_id gnl|my_center|LOCUS_13880 10597 9830 gene locus_tag LOCUS_13890 10597 9830 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871480.1 protein_id gnl|my_center|LOCUS_13890 12027 10603 gene locus_tag LOCUS_13900 12027 10603 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946153.1 protein_id gnl|my_center|LOCUS_13900 12100 13404 gene locus_tag LOCUS_13910 12100 13404 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258527.1 protein_id gnl|my_center|LOCUS_13910 13669 13484 gene locus_tag LOCUS_13920 13669 13484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 14511 13951 gene locus_tag LOCUS_13930 14511 13951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 15332 14526 gene locus_tag LOCUS_13940 15332 14526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence50 482 93 gene locus_tag LOCUS_13950 482 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 916 743 gene locus_tag LOCUS_13960 916 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1901 1242 gene locus_tag LOCUS_13970 1901 1242 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017188.1 protein_id gnl|my_center|LOCUS_13970 2664 2002 gene locus_tag LOCUS_13980 2664 2002 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872644.1 protein_id gnl|my_center|LOCUS_13980 5026 2666 gene locus_tag LOCUS_13990 5026 2666 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883142.1 protein_id gnl|my_center|LOCUS_13990 5629 5033 gene locus_tag LOCUS_14000 gene yihX 5629 5033 CDS product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099365.1 protein_id gnl|my_center|LOCUS_14000 6555 5686 gene locus_tag LOCUS_14010 gene folD 6555 5686 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882983.1 protein_id gnl|my_center|LOCUS_14010 7361 6573 gene locus_tag LOCUS_14020 7361 6573 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_14020 7924 7361 gene locus_tag LOCUS_14030 7924 7361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 8619 7927 gene locus_tag LOCUS_14040 8619 7927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 9594 8674 gene locus_tag LOCUS_14050 9594 8674 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125281.1 protein_id gnl|my_center|LOCUS_14050 11108 9687 gene locus_tag LOCUS_14060 11108 9687 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_14060 11828 11157 gene locus_tag LOCUS_14070 11828 11157 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871498.1 protein_id gnl|my_center|LOCUS_14070 13888 11825 gene locus_tag LOCUS_14080 13888 11825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 14143 13985 gene locus_tag LOCUS_14090 gene rpmG 14143 13985 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871496.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence51 908 471 gene locus_tag LOCUS_14100 908 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14100 1363 908 gene locus_tag LOCUS_14110 1363 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14110 1977 1360 gene locus_tag LOCUS_14120 1977 1360 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948262.1 protein_id gnl|my_center|LOCUS_14120 2999 2025 gene locus_tag LOCUS_14130 gene holB 2999 2025 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_14130 3612 2971 gene locus_tag LOCUS_14140 gene tmk 3612 2971 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715592.1 protein_id gnl|my_center|LOCUS_14140 6211 3668 gene locus_tag LOCUS_14150 gene gyrA 6211 3668 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873626.1 protein_id gnl|my_center|LOCUS_14150 8711 6228 gene locus_tag LOCUS_14160 gene gyrB 8711 6228 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871536.1 protein_id gnl|my_center|LOCUS_14160 9150 8758 gene locus_tag LOCUS_14170 9150 8758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 10694 9222 gene locus_tag LOCUS_14180 gene mgtE 10694 9222 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882934.1 protein_id gnl|my_center|LOCUS_14180 10841 12667 gene locus_tag LOCUS_14190 gene typA 10841 12667 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941168.1 protein_id gnl|my_center|LOCUS_14190 12911 13672 gene locus_tag LOCUS_14200 12911 13672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 14040 14750 gene locus_tag LOCUS_14210 14040 14750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence52 285 797 gene locus_tag LOCUS_14220 285 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 2430 895 gene locus_tag LOCUS_14230 gene dacB 2430 895 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279147.1 protein_id gnl|my_center|LOCUS_14230 2538 3779 gene locus_tag LOCUS_14240 2538 3779 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_14240 5660 3756 gene locus_tag LOCUS_14250 5660 3756 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_14250 7461 5653 gene locus_tag LOCUS_14260 7461 5653 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667902.1 protein_id gnl|my_center|LOCUS_14260 8305 7517 gene locus_tag LOCUS_14270 8305 7517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 8493 9458 gene locus_tag LOCUS_14280 gene bioB 8493 9458 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883677.1 protein_id gnl|my_center|LOCUS_14280 9445 10527 gene locus_tag LOCUS_14290 9445 10527 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883676.1 protein_id gnl|my_center|LOCUS_14290 10524 11150 gene locus_tag LOCUS_14300 gene bioD 10524 11150 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883675.1 protein_id gnl|my_center|LOCUS_14300 11072 12385 gene locus_tag LOCUS_14310 gene bioA 11072 12385 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883674.1 protein_id gnl|my_center|LOCUS_14310 12382 13092 gene locus_tag LOCUS_14320 12382 13092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883673.1 protein_id gnl|my_center|LOCUS_14320 13176 13718 gene locus_tag LOCUS_14330 13176 13718 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443401.1 protein_id gnl|my_center|LOCUS_14330 13821 14123 gene locus_tag LOCUS_14340 13821 14123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 14127 14447 gene locus_tag LOCUS_14350 14127 14447 CDS product CHY zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829567.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence53 4119 223 gene locus_tag LOCUS_14360 4119 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 4274 4429 gene locus_tag LOCUS_14370 4274 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 4537 5169 gene locus_tag LOCUS_14380 gene mazG 4537 5169 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210450.1 protein_id gnl|my_center|LOCUS_14380 9498 5170 gene locus_tag LOCUS_14390 9498 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 9864 10859 gene locus_tag LOCUS_14400 9864 10859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 11097 11630 gene locus_tag LOCUS_14410 11097 11630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 11627 12142 gene locus_tag LOCUS_14420 11627 12142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 12151 14238 gene locus_tag LOCUS_14430 12151 14238 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444553.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence54 197 21 gene locus_tag LOCUS_14440 197 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1326 169 gene locus_tag LOCUS_14450 1326 169 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349486.1 protein_id gnl|my_center|LOCUS_14450 1606 2121 gene locus_tag LOCUS_14460 1606 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 2317 2126 gene locus_tag LOCUS_14470 2317 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 5277 2389 gene locus_tag LOCUS_14480 5277 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041466968.1 protein_id gnl|my_center|LOCUS_14480 5414 7411 gene locus_tag LOCUS_14490 gene thrS 5414 7411 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873916.1 protein_id gnl|my_center|LOCUS_14490 7392 8156 gene locus_tag LOCUS_14500 7392 8156 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871948.1 protein_id gnl|my_center|LOCUS_14500 8176 8967 gene locus_tag LOCUS_14510 8176 8967 CDS product pGP6-D family virulence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873917.1 protein_id gnl|my_center|LOCUS_14510 8964 10400 gene locus_tag LOCUS_14520 gene purB 8964 10400 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016341.1 protein_id gnl|my_center|LOCUS_14520 11276 10383 gene locus_tag LOCUS_14530 gene dapA 11276 10383 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_14530 11480 12595 gene locus_tag LOCUS_14540 11480 12595 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921037.1 protein_id gnl|my_center|LOCUS_14540 12959 12588 gene locus_tag LOCUS_14550 12959 12588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 >Feature sequence55 1755 295 gene locus_tag LOCUS_14560 1755 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 3947 1908 gene locus_tag LOCUS_14570 gene metG 3947 1908 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010892134.1 protein_id gnl|my_center|LOCUS_14570 4189 3953 gene locus_tag LOCUS_14580 4189 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 4794 4198 gene locus_tag LOCUS_14590 gene gmk 4794 4198 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871377.1 protein_id gnl|my_center|LOCUS_14590 5688 4801 gene locus_tag LOCUS_14600 5688 4801 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625866.1 protein_id gnl|my_center|LOCUS_14600 6370 5681 gene locus_tag LOCUS_14610 6370 5681 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_14610 6912 6496 gene locus_tag LOCUS_14620 gene rplS 6912 6496 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545830.1 protein_id gnl|my_center|LOCUS_14620 7610 6927 gene locus_tag LOCUS_14630 7610 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 8012 7611 gene locus_tag LOCUS_14640 8012 7611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 9415 8048 gene locus_tag LOCUS_14650 gene ffh 9415 8048 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_14650 10350 9502 gene locus_tag LOCUS_14660 gene prmC 10350 9502 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871371.1 protein_id gnl|my_center|LOCUS_14660 11429 10347 gene locus_tag LOCUS_14670 gene prfA 11429 10347 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882763.1 protein_id gnl|my_center|LOCUS_14670 12220 11894 gene locus_tag LOCUS_14680 12220 11894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 12583 12353 gene locus_tag LOCUS_14690 12583 12353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883635.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence56 2233 407 gene locus_tag LOCUS_14700 2233 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 3053 2208 gene locus_tag LOCUS_14710 3053 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 4609 3050 gene locus_tag LOCUS_14720 4609 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 5070 4579 gene locus_tag LOCUS_14730 5070 4579 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883226.1 protein_id gnl|my_center|LOCUS_14730 5671 5039 gene locus_tag LOCUS_14740 gene raiA 5671 5039 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_14740 6874 5696 gene locus_tag LOCUS_14750 6874 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 7975 6887 gene locus_tag LOCUS_14760 7975 6887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 9072 8047 gene locus_tag LOCUS_14770 9072 8047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 9212 9138 gene locus_tag LOCUS_t00330 9212 9138 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9308 9982 gene locus_tag LOCUS_14780 gene recO 9308 9982 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883227.1 protein_id gnl|my_center|LOCUS_14780 10118 10035 gene locus_tag LOCUS_t00340 10118 10035 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10228 11022 gene locus_tag LOCUS_14790 10228 11022 CDS product RMD1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873837.1 protein_id gnl|my_center|LOCUS_14790 11275 12171 gene locus_tag LOCUS_14800 11275 12171 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948045.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence57 790 1755 gene locus_tag LOCUS_14810 790 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 2161 3447 gene locus_tag LOCUS_14820 2161 3447 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729232.1 protein_id gnl|my_center|LOCUS_14820 3947 4711 gene locus_tag LOCUS_14830 3947 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 6011 4698 gene locus_tag LOCUS_14840 6011 4698 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 protein_id gnl|my_center|LOCUS_14840 7194 6043 gene locus_tag LOCUS_14850 7194 6043 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727834.1 protein_id gnl|my_center|LOCUS_14850 8121 7195 gene locus_tag LOCUS_14860 8121 7195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 8326 9804 gene locus_tag LOCUS_14870 8326 9804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 10352 9873 gene locus_tag LOCUS_14880 10352 9873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 11771 10542 gene locus_tag LOCUS_14890 11771 10542 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862417.1 protein_id gnl|my_center|LOCUS_14890 12332 11982 gene locus_tag LOCUS_14900 12332 11982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 >Feature sequence58 597 193 gene locus_tag LOCUS_14910 597 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 683 1933 gene locus_tag LOCUS_14920 683 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 2879 2289 gene locus_tag LOCUS_14930 2879 2289 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038765.1 protein_id gnl|my_center|LOCUS_14930 3004 3717 gene locus_tag LOCUS_14940 gene nfi 3004 3717 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172477.1 protein_id gnl|my_center|LOCUS_14940 3857 4114 gene locus_tag LOCUS_14950 3857 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 4209 4655 gene locus_tag LOCUS_14960 4209 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 4728 4916 gene locus_tag LOCUS_14970 4728 4916 CDS product DUF6496 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958549.1 protein_id gnl|my_center|LOCUS_14970 6063 5155 gene locus_tag LOCUS_14980 gene ligD 6063 5155 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090754.1 protein_id gnl|my_center|LOCUS_14980 6854 6060 gene locus_tag LOCUS_14990 6854 6060 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064443.1 protein_id gnl|my_center|LOCUS_14990 8252 6867 gene locus_tag LOCUS_15000 8252 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 8577 8275 gene locus_tag LOCUS_15010 8577 8275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 8876 8586 gene locus_tag LOCUS_15020 8876 8586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 9240 8881 gene locus_tag LOCUS_15030 9240 8881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 10647 9502 gene locus_tag LOCUS_15040 10647 9502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 10830 12191 gene locus_tag LOCUS_15050 10830 12191 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978886.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence59 291 671 gene locus_tag LOCUS_15060 291 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 1557 676 gene locus_tag LOCUS_15070 1557 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 2127 2342 gene locus_tag LOCUS_15080 2127 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 2893 3195 gene locus_tag LOCUS_15090 gene gatC 2893 3195 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719430.1 protein_id gnl|my_center|LOCUS_15090 3212 4684 gene locus_tag LOCUS_15100 gene gatA 3212 4684 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882658.1 protein_id gnl|my_center|LOCUS_15100 4681 6144 gene locus_tag LOCUS_15110 gene gatB 4681 6144 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882659.1 protein_id gnl|my_center|LOCUS_15110 6208 7761 gene locus_tag LOCUS_15120 6208 7761 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815451.1 protein_id gnl|my_center|LOCUS_15120 7751 8857 gene locus_tag LOCUS_15130 7751 8857 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546440.1 protein_id gnl|my_center|LOCUS_15130 8928 12035 gene locus_tag LOCUS_15140 8928 12035 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544954.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence60 399 1889 gene locus_tag LOCUS_15150 399 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 2377 1997 gene locus_tag LOCUS_15160 2377 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 2799 2353 gene locus_tag LOCUS_15170 2799 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 3996 2860 gene locus_tag LOCUS_15180 3996 2860 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010892245.1 protein_id gnl|my_center|LOCUS_15180 4358 5098 gene locus_tag LOCUS_15190 4358 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 7084 5951 gene locus_tag LOCUS_15200 7084 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 7497 7727 gene locus_tag LOCUS_15210 7497 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 8465 7683 gene locus_tag LOCUS_15220 gene nifU 8465 7683 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_15220 9607 8462 gene locus_tag LOCUS_15230 9607 8462 CDS product NifS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858709.1 protein_id gnl|my_center|LOCUS_15230 10289 9600 gene locus_tag LOCUS_15240 10289 9600 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873325.1 protein_id gnl|my_center|LOCUS_15240 10459 12150 gene locus_tag LOCUS_15250 10459 12150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence61 1830 121 gene locus_tag LOCUS_15260 1830 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1865 5011 gene locus_tag LOCUS_15270 gene recC 1865 5011 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703323.1 protein_id gnl|my_center|LOCUS_15270 5001 8357 gene locus_tag LOCUS_15280 gene recB 5001 8357 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261335.1 protein_id gnl|my_center|LOCUS_15280 8354 10531 gene locus_tag LOCUS_15290 8354 10531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 10834 11166 gene locus_tag LOCUS_15300 10834 11166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 11628 11236 gene locus_tag LOCUS_15310 11628 11236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence62 1253 177 gene locus_tag LOCUS_15320 1253 177 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257556.1 protein_id gnl|my_center|LOCUS_15320 2061 1270 gene locus_tag LOCUS_15330 2061 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15330 2932 2054 gene locus_tag LOCUS_15340 gene potB 2932 2054 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001911544.1 protein_id gnl|my_center|LOCUS_15340 4020 2929 gene locus_tag LOCUS_15350 4020 2929 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081574.1 protein_id gnl|my_center|LOCUS_15350 4451 5398 gene locus_tag LOCUS_15360 gene trxB 4451 5398 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882962.1 protein_id gnl|my_center|LOCUS_15360 5400 6212 gene locus_tag LOCUS_15370 5400 6212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 6601 6209 gene locus_tag LOCUS_15380 gene acpS 6601 6209 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882961.1 protein_id gnl|my_center|LOCUS_15380 7673 6588 gene locus_tag LOCUS_15390 7673 6588 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338937.1 protein_id gnl|my_center|LOCUS_15390 7825 8319 gene locus_tag LOCUS_15400 7825 8319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 8785 8324 gene locus_tag LOCUS_15410 gene rlmH 8785 8324 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329688.1 protein_id gnl|my_center|LOCUS_15410 8860 9111 gene locus_tag LOCUS_15420 8860 9111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 9165 10007 gene locus_tag LOCUS_15430 gene lgt 9165 10007 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403744.1 protein_id gnl|my_center|LOCUS_15430 10207 11070 gene locus_tag LOCUS_15440 10207 11070 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966101.1 protein_id gnl|my_center|LOCUS_15440 11071 11712 gene locus_tag LOCUS_15450 11071 11712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 >Feature sequence63 152 1375 gene locus_tag LOCUS_15460 152 1375 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055994.1 protein_id gnl|my_center|LOCUS_15460 2411 1368 gene locus_tag LOCUS_15470 2411 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 4270 2666 gene locus_tag LOCUS_15480 4270 2666 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028566.1 protein_id gnl|my_center|LOCUS_15480 5190 4360 gene locus_tag LOCUS_15490 5190 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 5506 8154 gene locus_tag LOCUS_15500 5506 8154 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_15500 8170 9012 gene locus_tag LOCUS_15510 8170 9012 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 protein_id gnl|my_center|LOCUS_15510 9135 9887 gene locus_tag LOCUS_15520 9135 9887 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475684.1 protein_id gnl|my_center|LOCUS_15520 9960 11138 gene locus_tag LOCUS_15530 9960 11138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence64 147 1202 gene locus_tag LOCUS_15540 gene rlmN 147 1202 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626897.1 protein_id gnl|my_center|LOCUS_15540 1300 1890 gene locus_tag LOCUS_15550 gene pgsA 1300 1890 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883582.1 protein_id gnl|my_center|LOCUS_15550 3427 1910 gene locus_tag LOCUS_15560 gene glgA 3427 1910 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246015.1 protein_id gnl|my_center|LOCUS_15560 3500 4114 gene locus_tag LOCUS_15570 3500 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 4231 4304 gene locus_tag LOCUS_t00350 4231 4304 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4384 5331 gene locus_tag LOCUS_15580 4384 5331 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583149.1 protein_id gnl|my_center|LOCUS_15580 5414 5971 gene locus_tag LOCUS_15590 5414 5971 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873414.1 protein_id gnl|my_center|LOCUS_15590 5981 6589 gene locus_tag LOCUS_15600 gene pth 5981 6589 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_15600 6582 6923 gene locus_tag LOCUS_15610 gene rpsF 6582 6923 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883586.1 protein_id gnl|my_center|LOCUS_15610 6931 7203 gene locus_tag LOCUS_15620 6931 7203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 7222 7719 gene locus_tag LOCUS_15630 gene rplI 7222 7719 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872185.1 protein_id gnl|my_center|LOCUS_15630 7787 8782 gene locus_tag LOCUS_15640 gene rfaD 7787 8782 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546025.1 protein_id gnl|my_center|LOCUS_15640 8776 10140 gene locus_tag LOCUS_15650 8776 10140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence65 1311 136 gene locus_tag LOCUS_15660 1311 136 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186581.1 protein_id gnl|my_center|LOCUS_15660 2705 1308 gene locus_tag LOCUS_15670 gene rimO 2705 1308 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041466977.1 protein_id gnl|my_center|LOCUS_15670 2883 4484 gene locus_tag LOCUS_15680 gene oppA 2883 4484 CDS product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232957.1 protein_id gnl|my_center|LOCUS_15680 4465 5400 gene locus_tag LOCUS_15690 gene oppB 4465 5400 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245554.1 protein_id gnl|my_center|LOCUS_15690 5390 6313 gene locus_tag LOCUS_15700 gene oppC 5390 6313 CDS product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232954.1 protein_id gnl|my_center|LOCUS_15700 6310 7299 gene locus_tag LOCUS_15710 6310 7299 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722316.1 protein_id gnl|my_center|LOCUS_15710 7292 8260 gene locus_tag LOCUS_15720 7292 8260 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966891.1 protein_id gnl|my_center|LOCUS_15720 9359 8253 gene locus_tag LOCUS_15730 9359 8253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 >Feature sequence66 197 379 gene locus_tag LOCUS_15740 197 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 1226 465 gene locus_tag LOCUS_15750 1226 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1658 3781 gene locus_tag LOCUS_15760 1658 3781 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883409.1 protein_id gnl|my_center|LOCUS_15760 5485 3851 gene locus_tag LOCUS_15770 5485 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 5641 5850 gene locus_tag LOCUS_15780 5641 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 7024 6098 gene locus_tag LOCUS_15790 7024 6098 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814057.1 protein_id gnl|my_center|LOCUS_15790 7157 8521 gene locus_tag LOCUS_15800 gene rpoN 7157 8521 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546561.1 protein_id gnl|my_center|LOCUS_15800 9225 8518 gene locus_tag LOCUS_15810 9225 8518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725287.1 protein_id gnl|my_center|LOCUS_15810 >Feature sequence67 191 1318 gene locus_tag LOCUS_15820 191 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 2443 1394 gene locus_tag LOCUS_15830 2443 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 3588 2446 gene locus_tag LOCUS_15840 3588 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 4832 3594 gene locus_tag LOCUS_15850 4832 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 6326 5427 gene locus_tag LOCUS_15860 gene map 6326 5427 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020270.1 protein_id gnl|my_center|LOCUS_15860 6684 6310 gene locus_tag LOCUS_15870 6684 6310 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771057.1 protein_id gnl|my_center|LOCUS_15870 6848 6708 gene locus_tag LOCUS_15880 6848 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 8112 7111 gene locus_tag LOCUS_15890 8112 7111 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267343.1 protein_id gnl|my_center|LOCUS_15890 9151 8105 gene locus_tag LOCUS_15900 9151 8105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 >Feature sequence68 2498 1044 gene locus_tag LOCUS_15910 gene der 2498 1044 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426959.1 protein_id gnl|my_center|LOCUS_15910 6399 2659 gene locus_tag LOCUS_15920 6399 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 7630 6872 gene locus_tag LOCUS_15930 7630 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 7942 7649 gene locus_tag LOCUS_15940 7942 7649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 8402 8151 gene locus_tag LOCUS_15950 8402 8151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence69 435 917 gene locus_tag LOCUS_15960 435 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 1133 924 gene locus_tag LOCUS_15970 1133 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 1448 1146 gene locus_tag LOCUS_15980 1448 1146 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057517.1 protein_id gnl|my_center|LOCUS_15980 1776 1435 gene locus_tag LOCUS_15990 1776 1435 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388216.1 protein_id gnl|my_center|LOCUS_15990 2112 2654 gene locus_tag LOCUS_16000 2112 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 3135 4031 gene locus_tag LOCUS_16010 3135 4031 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444790.1 protein_id gnl|my_center|LOCUS_16010 4228 4067 gene locus_tag LOCUS_16020 4228 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 5425 5060 gene locus_tag LOCUS_16030 5425 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 6005 5592 gene locus_tag LOCUS_16040 6005 5592 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083011.1 protein_id gnl|my_center|LOCUS_16040 7045 6002 gene locus_tag LOCUS_16050 7045 6002 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013448020.1 protein_id gnl|my_center|LOCUS_16050 7656 7042 gene locus_tag LOCUS_16060 7656 7042 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974802.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence70 173 445 gene locus_tag LOCUS_16070 173 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 516 1172 gene locus_tag LOCUS_16080 516 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 2690 1425 gene locus_tag LOCUS_16090 2690 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 3269 2838 gene locus_tag LOCUS_16100 gene mntR 3269 2838 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037316.1 protein_id gnl|my_center|LOCUS_16100 3467 4132 gene locus_tag LOCUS_16110 3467 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 4401 5276 gene locus_tag LOCUS_16120 4401 5276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 5417 6055 gene locus_tag LOCUS_16130 gene can 5417 6055 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_16130 7709 6129 gene locus_tag LOCUS_16140 7709 6129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 >Feature sequence71 1786 410 gene locus_tag LOCUS_16150 1786 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 2042 2500 gene locus_tag LOCUS_16160 2042 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 2519 4003 gene locus_tag LOCUS_16170 2519 4003 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883028.1 protein_id gnl|my_center|LOCUS_16170 3996 4883 gene locus_tag LOCUS_16180 3996 4883 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943100.1 protein_id gnl|my_center|LOCUS_16180 6176 4878 gene locus_tag LOCUS_16190 6176 4878 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707249.1 protein_id gnl|my_center|LOCUS_16190 6253 7317 gene locus_tag LOCUS_16200 gene waaC 6253 7317 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942882.1 protein_id gnl|my_center|LOCUS_16200 7754 7275 gene locus_tag LOCUS_16210 7754 7275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 >Feature sequence72 603 406 gene locus_tag LOCUS_16220 603 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 728 1312 gene locus_tag LOCUS_16230 728 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 1363 2367 gene locus_tag LOCUS_16240 1363 2367 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883352.1 protein_id gnl|my_center|LOCUS_16240 2358 3509 gene locus_tag LOCUS_16250 2358 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 4891 3506 gene locus_tag LOCUS_16260 gene asnS 4891 3506 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058304.1 protein_id gnl|my_center|LOCUS_16260 5754 4888 gene locus_tag LOCUS_16270 5754 4888 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883370.1 protein_id gnl|my_center|LOCUS_16270 5931 7451 gene locus_tag LOCUS_16280 5931 7451 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873955.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence73 703 206 gene locus_tag LOCUS_16290 703 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 1288 1563 gene locus_tag LOCUS_16300 gene rpmB 1288 1563 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871434.1 protein_id gnl|my_center|LOCUS_16300 1596 2582 gene locus_tag LOCUS_16310 1596 2582 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725097.1 protein_id gnl|my_center|LOCUS_16310 2950 3564 gene locus_tag LOCUS_16320 gene yhgN 2950 3564 CDS product NAAT family transporter YhgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861574.1 protein_id gnl|my_center|LOCUS_16320 4512 3772 gene locus_tag LOCUS_16330 4512 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 5694 4846 gene locus_tag LOCUS_16340 5694 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 6154 7371 gene locus_tag LOCUS_16350 6154 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence74 566 2041 gene locus_tag LOCUS_16360 gene npt1 566 2041 CDS product NTP/NDP exchange transporter Npt1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873532.1 protein_id gnl|my_center|LOCUS_16360 2141 3250 gene locus_tag LOCUS_16370 2141 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 3916 3263 gene locus_tag LOCUS_16380 3916 3263 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994186.1 protein_id gnl|my_center|LOCUS_16380 4001 5083 gene locus_tag LOCUS_16390 4001 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 5085 6347 gene locus_tag LOCUS_16400 5085 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 >Feature sequence75 941 39 gene locus_tag LOCUS_16410 941 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1655 1580 gene locus_tag LOCUS_t00360 1655 1580 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1786 3966 gene locus_tag LOCUS_16420 1786 3966 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_16420 5730 4138 gene locus_tag LOCUS_16430 5730 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 >Feature sequence76 151 981 gene locus_tag LOCUS_16440 151 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 2431 1307 gene locus_tag LOCUS_16450 2431 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 2729 3742 gene locus_tag LOCUS_16460 2729 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 3779 4315 gene locus_tag LOCUS_16470 3779 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 5692 4559 gene locus_tag LOCUS_16480 5692 4559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence77 892 2139 gene locus_tag LOCUS_16490 892 2139 CDS product BBP7 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921355.1 protein_id gnl|my_center|LOCUS_16490 3163 2267 gene locus_tag LOCUS_16500 3163 2267 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948665.1 protein_id gnl|my_center|LOCUS_16500 4406 3348 gene locus_tag LOCUS_16510 4406 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 4575 5264 gene locus_tag LOCUS_16520 4575 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 >Feature sequence78 1066 1974 gene locus_tag LOCUS_16530 gene htpX 1066 1974 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264281.1 protein_id gnl|my_center|LOCUS_16530 3023 2226 gene locus_tag LOCUS_16540 3023 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 4036 3164 gene locus_tag LOCUS_16550 4036 3164 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883642.1 protein_id gnl|my_center|LOCUS_16550 5045 4020 gene locus_tag LOCUS_16560 gene truA 5045 4020 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048349.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence79 298 1692 gene locus_tag LOCUS_16570 298 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 2960 1674 gene locus_tag LOCUS_16580 gene eno 2960 1674 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018115.1 protein_id gnl|my_center|LOCUS_16580 4112 2979 gene locus_tag LOCUS_16590 gene rsgA 4112 2979 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119119.1 protein_id gnl|my_center|LOCUS_16590 4857 4105 gene locus_tag LOCUS_16600 4857 4105 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990984.1 protein_id gnl|my_center|LOCUS_16600 >Feature sequence80 1481 903 gene locus_tag LOCUS_16610 gene cyoC 1481 903 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021685.1 protein_id gnl|my_center|LOCUS_16610 3448 1466 gene locus_tag LOCUS_16620 gene cyoB 3448 1466 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163523.1 protein_id gnl|my_center|LOCUS_16620 4314 3445 gene locus_tag LOCUS_16630 gene cyoA 4314 3445 CDS product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021692.1 protein_id gnl|my_center|LOCUS_16630 4733 4314 gene locus_tag LOCUS_16640 4733 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 >Feature sequence81 169 795 gene locus_tag LOCUS_16650 169 795 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657683.1 protein_id gnl|my_center|LOCUS_16650 877 1353 gene locus_tag LOCUS_16660 877 1353 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883253.1 protein_id gnl|my_center|LOCUS_16660 2668 1571 gene locus_tag LOCUS_16670 2668 1571 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263282.1 protein_id gnl|my_center|LOCUS_16670 3687 2833 gene locus_tag LOCUS_16680 3687 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 >Feature sequence82 507 2309 gene locus_tag LOCUS_16690 507 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 4018 3909 gene locus_tag LOCUS_r00020 4018 3909 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence83 1189 131 gene locus_tag LOCUS_16700 1189 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 2606 1236 gene locus_tag LOCUS_16710 2606 1236 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_16710 3171 2929 gene locus_tag LOCUS_16720 3171 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence84 196 990 gene locus_tag LOCUS_16730 196 990 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883333.1 protein_id gnl|my_center|LOCUS_16730 1180 980 gene locus_tag LOCUS_16740 1180 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 1224 2471 gene locus_tag LOCUS_16750 1224 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence85 461 1231 gene locus_tag LOCUS_16760 461 1231 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 protein_id gnl|my_center|LOCUS_16760 1730 2221 gene locus_tag LOCUS_16770 1730 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 2214 2498 gene locus_tag LOCUS_16780 2214 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 >Feature sequence86 707 276 gene locus_tag LOCUS_16790 707 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 949 2175 gene locus_tag LOCUS_16800 949 2175 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728453.1 protein_id gnl|my_center|LOCUS_16800